Compositions and methods for the treatment of hereditary cystatin C amyloid angiopathy (HCCAA) and other neurodegenerative disorders involving abnormal amyloid deposition
Administering antioxidants like N-acetylcysteine disrupts amyloid deposits in HCCAA and other neurodegenerative disorders, effectively reducing protein aggregates and alleviating symptoms through cellular models and skin biopsy reductions.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-07-04
- Publication Date
- 2026-03-06
AI Technical Summary
Current methods for treating hereditary cystatin C amyloid angiopathy (HCCAA) and other neurodegenerative disorders associated with abnormal amyloid deposition are inadequate, as they often require high concentrations of compounds that are not therapeutically viable and do not effectively prevent the formation of toxic oligomers and fibrils.
Administering antioxidants such as glutathione or N-acetylcysteine, or their derivatives, to disrupt amyloid deposits and reduce protein aggregates, combined with agents like ionophores and proteases to alleviate symptoms and monitor amyloid levels.
Reduces amyloid-cystatin protein aggregates, alleviating symptoms of HCCAA and other neurodegenerative disorders, as demonstrated by skin biopsy reductions and cellular models, indicating potential therapeutic efficacy.
Smart Images

Figure 0007825361000001 
Figure 0007825361000002 
Figure 0007825361000003
Abstract
Description
[Technical Field]
[0001] This application claims priority to U.S. Provisional Application No. 62 / 555,496, filed September 7, 2017, the entire contents of which are incorporated herein by reference as if fully set forth.
[0002] The present invention relates to the field of vascular disorders, most notably including cerebral amyloid angiopathy and neurodegenerative disorders associated with pathogenic fibrillogenesis. More specifically, the present invention provides compositions and methods useful for the treatment and management of diseases associated with abnormal fibrillogenesis, particularly hereditary cystatin C amyloid angiopathy (HCCAA) and Alzheimer's disease. [Background technology]
[0003] Several publications and patent documents are cited throughout this specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as if fully set forth.
[0004] Hereditary cystatin C amyloid angiopathy (HCCAA) is a dominantly inherited disease caused by a leucine 68 to glutamine mutation in human cystatin C (hCC; L68Q-hCC). 1 HCCAA is classified as a group of cerebral amyloid angiopathy (CAA), a group of diseases in which amyloid deposits form in the walls of blood vessels in the central nervous system (CNS). While HCCAA is correctly classified as a CAA disorder due to its predominantly cerebral manifestations, hCC deposits are systemic and can also be found in other internal organs. Most carriers of the mutation suffer from microinfarcts and cerebral hemorrhages in their 20s, leading to paralysis, dementia, and death in young adulthood, with an average life expectancy of 30 years. 2-6 Postmortem studies in humans have shown that hCCs are present in all brain regions, gray matter and white matter, as well as most prominently in arteries and arterioles.
[0005] Human cystatin C, a cysteine protease inhibitor belonging to the cystatin superfamily, is a secreted type 2 cystatin that is expressed in all nucleated human cells and is detected in all tissues and body fluids, particularly in high concentrations in cerebrospinal fluid. 2、7-9 hCC inhibits cysteine proteases such as papain and legumain through interactions via multiple binding motifs resulting from the characteristic hCC fold. 9-11 Its normal conformation consists of a polypeptide folded into a five-stranded β-sheet that partially encases a central α-helix. An N-terminal segment and two hairpin loops form the edges of the protein, which bind to the active site of cysteine proteases and block their proteolytic activity. 12-14 Mutation of leucine 68 to glutamic acid destabilizes the packing between the beta sheet and the alpha helix, allowing the molecule to open up. Two such open hCC molecules can interact with each other, with the helices of each molecule interacting with the beta sheet of the other, and the resulting dimer is said to be the product of domain swapping. 15-17 Furthermore, a process called propagation domain exchange builds long chains of molecules, with the free domains of each molecule interacting with new hCC monomers. 18 Protein aggregation leads to the formation of highly ordered, pathogenic fibrous aggregates called amyloid fibrils, 19、20 It is involved not only in HCCAA but also in a wide range of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease and other CAAs. 20
[0006] The degree of amyloid maturation observed in cystatin C deposits is shown to vary between tissues (i.e., maturation is less pronounced in skin than in brain). 21Although the skin deposits were not amyloid fibrils, the skin of mutation carriers showed significantly higher levels of hCC immunoreactivity in symptomatic carriers than asymptomatic carriers. The fact that the amount of hCC deposits in the skin was associated with CNS disease progression indicates that skin biopsies can be used to assess disease progression and, therefore, to evaluate therapeutic interventions. 22
[0007] Protein oligomers of different pathogenic amyloidogenic proteins precede the fibril formation stage in HCCAA and other diseases, but for HCCAA it is unclear whether such oligomers lead directly to pathogenic fibrils or whether fibril assembly occurs most rapidly from monomers. 23 Drugs that reduce the aggregation of amyloidogenic proteins may reduce the formation of toxic oligomers that are known to occur in some types of amyloidosis. 24、25 Previous studies have suggested that preventing domain swapping in hCC may be used to treat HCCAA. 24 WT hCC and L6Q-hCC have intrachain stabilizing disulfide bonds, preventing domain swapping that could form either dimers or amyloid fibrils. 26 These results suggest that knowledge of the molecular mechanisms that trigger the transition from physiologically normal, soluble proteins to toxic oligomers and insoluble fibrils is essential for the development of therapeutic strategies.
[0008] Ostner and colleagues have previously attempted to prevent the polymerization of hCC monomers and to disrupt or remove the multimeric species through various approaches. 24 Modified and stabilized hCC monomers have been used to demonstrate that preventing domain swapping prevents aggregation. Antibodies have been generated specifically against the domain-swapped dimeric hCC. These antibodies were able to specifically remove the hCC dimers, but not the monomers, from patient plasma using size-exclusion chromatography. 27A high-throughput screening of compounds has been undertaken in an effort to find molecules that prevent dimerization using the US Drug Collection (consisting of 1040 FDA-approved compounds, found on the world wide web at msdiscovery.com / usdrug.html). 24 This approach requires large amounts of purified hCC protein produced in bacteria, and most of the compounds identified as inhibiting dimer formation were used at concentrations too high to be considered therapeutic in living organisms.
[0009] Clearly, there is a need for improved methods and compositions for treating HCCAA. Summary of the Invention [Means for solving the problem]
[0010] According to the present invention, a method for treating amyloidosis comprises delivering an effective amount of at least one antioxidant to a patient, where the antioxidant disrupts the amyloid deposits, thereby alleviating disease symptoms. Amyloidosis includes, for example, hereditary cystatin C amyloid angiopathy (HCCAA), Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease, and cerebral amyloid angiopathy of the Dutch type. In certain embodiments, the amyloidosis is HCCAA caused by mutant cystatin C. In other embodiments, the mutant cystatin C comprises L68Q cystatin C. Preferred antioxidants for use in the above methods include, but are not limited to, glutathione, N-acetylcysteine, or derivatives thereof. In certain embodiments, the derivative is selected from NAC-amide, NAC-ethyl ester, and zinc mercaptide N-acetylcysteine carboxylate salt.
[0011] In another aspect, a method for treating hereditary cystatin C amyloid angiopathy (HCCAA) in a human subject in need thereof is provided. An exemplary method includes administering to the subject an effective amount of N-acetylcysteine or a functional derivative thereof in a pharmaceutically acceptable carrier, wherein the administration is effective in reducing amyloid-cystatin protein aggregates, thereby alleviating the symptoms of HCCAA. In certain embodiments, the NAC derivative is selected from NAC-amide, NAC-ethyl ester, and zinc mercaptide N-acetylcysteine carboxylate salt. The method may optionally involve performing a skin biopsy on the subject after treatment to evaluate the reduction of amyloid-cystatin protein aggregates in the skin, or to measure the amount of cystatin C monomer, dimer, or oligomer in serum or plasma, or the amount of monomer excreted in urine.
[0012] In another embodiment, this method may involve the administration of additional agents that alleviate amyloid deposition symptoms. These include, but are not limited to, one or more ionophores, one or more anti-inflammatory agents, and one or more proteases. In another embodiment, siRNA directed against the cystatin C coding sequence is administered to selectively block mutant alleles.
[0013] In another aspect of the present invention, a method for treating a neurodegenerative disorder associated with pathogenic fibrillary protein aggregates in a human subject in need thereof is disclosed. An exemplary method comprises administering to the subject an effective amount of N-acetylcysteine or a functional derivative thereof in a pharmaceutically acceptable carrier, wherein the administration is effective to reduce the protein fibril aggregates, thereby alleviating the symptoms of the neurodegenerative disorder. In certain embodiments, the disorder is selected from Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease, and other forms of cerebral amyloid angiopathy (CAA), such as the Dutch type.
[0014] In certain embodiments, the above methods include monitoring said patient for amyloid deposit levels.
[0015] In yet another aspect of the present invention, a method for identifying a therapeutic agent that alters amyloid-cystatin protein aggregate formation is provided. An exemplary method includes providing cells expressing a nucleic acid encoding a mutant hCC protein, where the mutant causes the formation of amyloid-cystatin protein aggregates, and providing cells expressing an hCC protein lacking the hCC mutation. Both cell populations are contacted with a test agent and evaluated to determine whether the agent alters the formation of amyloid-cystatin protein aggregates in cells expressing the mutant compared to cells expressing the wild-type protein, thereby identifying an agent that alters amyloid-cystatin protein aggregation. Such an agent should be effective in treating HCCAA or other disorders associated with abnormal fibrillogenesis.
[0016] Also provided are pharmaceutical compositions comprising an effective amount of an agent acting as an antioxidant or a reducing agent for the treatment of amyloid deposition diseases in a pharmaceutically acceptable carrier. Diseases treated with the compositions include, for example, HCCAA, Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease, and other CAAs. In one embodiment, the agent is glutathione, N-acetylcysteine, or a derivative thereof. In a preferred embodiment, the agent is a derivative selected from NAC-amide, NAC-ethyl ester, and zinc mercaptide N-acetylcysteine carboxylate salt. The compositions of the present invention may also include one or more of an ionophore, an anti-inflammatory agent, or a protease. [Brief explanation of the drawings]
[0017] [Figure 1A] Figure 1A shows that genetically engineered HEK-293T cells detect and secrete hCC (WT or L68Q) that can oligomerize under non-reducing conditions. Figure 1A shows a schematic diagram of the WT and L68Q mutant hCC proteins. The dashed line represents the N-terminal signal peptide, which undergoes proteolysis. The red rectangle represents the Myc tag added to the C-terminus. [Figure 1B] Figure 1B (left panel) Lysates of HEK-293T cells stably expressing hCC WT or L68Q mutant or supernatants (right panel) were mixed with 2% SDS with or without the reducing agents DTT or β-mercaptoethanol. Samples were subjected to electrophoresis, and CST3 levels were examined by Western blot using an anti-cystatin C antibody. Figure 1B: Incubation with glutathione impairs cystatin C di / oligomerization in cell extracts and supernatants (biological replica). [Figure 1C] Figure 1C is a biological replicate related to the experiment shown in Figure 2, in which supernatants and cell extracts were incubated in the presence of glutathione at the indicated concentrations for 1 h at 37°C. Samples were mixed with 2% SDS without reducing agents before electrophoresis, and protein levels were detected by anti-cystatin C antibody WB. [Figure 2A] Figure 2A: Incubation with glutathione inhibits the di- / oligomerization of cystatin C in cell extracts and supernatants. Supernatants and cell extracts were incubated for 1 hour at 37°C in the presence of the indicated concentrations of glutathione. Samples were mixed with 2% SDS without reducing agents before electrophoresis, and protein levels were detected by Western blot for cystatin C (N = 3; *Significant vs. untreated (HMW) at P < 0.05; Significant vs. untreated (monomer) at P < 0.05). [Figure 2B] Figure 2B: Glutathione and N-acetylcysteine impair the oligomerization of secreted cystatin C L68Q (biological replicates). Biological replicates related to the experiment shown in Figure 3 were incubated in the presence of glutathione or NAC at the indicated concentrations for 1 h at 37 °C. Samples were mixed with 2% SDS without reducing agents before electrophoresis, and protein levels were detected by WB with an anti-cystatin C antibody. [Figure 3A]Glutathione and N-acetylcysteine impair the oligomerization of secreted cystatin C L68Q. Supernatants were incubated for 1 hour at 37°C in the presence of the indicated concentrations of glutathione or NAC. Samples were mixed with 2% SDS without reducing agents before electrophoresis, and protein levels were detected with an anti-cystatin C antibody. Histograms represent densitometric quantification of Western blot bands of high molecular weight fraction (HMW) relative to monomer (Mono) for untreated or DTT-treated samples. No HMW fraction was detected in the supernatant of HEK-293T cells stably expressing hCC WT. (*Significant at P<0.05 relative to untreated (HMW); +Significant at P<0.05 relative to untreated (Mono)). [Figure 3B] Figure 3B: N-acetylcysteine impairs the oligomerization of secreted cystatin C L68Q. A small amount of supernatant was removed from the cells and analyzed by Western blot at the indicated times. On days 2 and 3, only the L68Q supernatant was analyzed. Samples were mixed with 2% SDS without reducing agents before electrophoresis, and protein levels were detected by anti-cystatin C antibody WB. [Figure 4] Figure 4 shows that NAC impairs the oligomerization of secreted hCC L68Q. 293T cells expressing WT or L68Q cystatin C were incubated with medium containing the indicated amounts of either GSH or NAC for 24, 48, or 72 hours. A small amount of supernatant was removed from the cells and analyzed by Western blot at the indicated times. On days 2 and 3, only the supernatant from cells expressing the hCC L68Q mutant was analyzed. Samples were mixed with 2% SDS without reducing agents before electrophoresis, and protein levels were detected with an anti-cystatin C antibody. Histograms represent densitometric quantification of the high molecular weight fraction (HMW) relative to the monomer (Mono) fraction for untreated or DTT-treated samples. (*Significant at P<0.05 relative to untreated (HMW); +Significant at P<0.05 relative to untreated (Mono)). [Figure 5]Figure 5 shows that reduced activity of GSH or NAC is important for degrading oligomers into monomers of secreted cystatin C L68Q. Supernatants were incubated for 1 h at 37 °C in the presence of oxidized (GSSG) or reduced glutathione (GSH), NAC, or its inactive analog (NAS) at the indicated concentrations. Samples were mixed with 2% SDS without reducing agents before electrophoresis, and protein levels were detected with an anti-cystatin C antibody. [Figure 6] Figure 6. NAC-amide and NAC-ethyl-ester impair the oligomerization of intracellular and secreted cystatin C L68. Supernatants and cell extracts were incubated for 1 h at 37 °C in the presence of NAC, NAC-amide, and NAC-methyl ester at the indicated concentrations. Samples were mixed with 2% SDS without reducing agents before electrophoresis, and protein levels were detected with an anti-cystatin C antibody. [Figure 7] Figure 7. High molecular weight complexes of Cyst-C L68Q can be detected in transgenic mice. Short incubation of NAC impairs the oligomerization of Cyst-C L68Q on blood and brain extracts. Plasma or brain extracts were incubated for 1 hour at 37°C in the presence of NAC at the indicated concentrations. Samples were mixed with 2% SDS without reducing agents before electrophoresis, and protein levels were detected with a biotinylated anti-cystatin C antibody followed by streptavidin-HRP. [Figure 8A]Figure 8A: Effect of NAC therapy in HCCAA patients. Cystatin C immunostaining (brown staining) was performed using rabbit anti-human cystatin C antibody on three separate skin biopsies obtained from the same location on the back from two members of an HCCAA family who were carriers of the hCC L68Q variant. The biopsy in each left panel (skin biopsy 1 in Figure 8A and Figure 8B) was obtained when the family joined the study more than two years before this work began. The biopsy in the center panel (skin biopsy 2 in Figure 8A and Figure 8B) was obtained approximately 18 months later. The biopsies in the right panel (skin biopsy 3 in Figure 8A and Figure 8B) from both subjects show deposition of cystatin C protein complexes after 6 months of treatment with NAC. A significant reduction was observed in the proband (Panel A) and parent (Panel B) after 6 months of NAC therapy. Panel A: Cystatin C immunostaining of skin biopsies from the proband. Panel B: Cystatin C immunostaining of a skin biopsy from a parent. [Figure 8B] Figure 8B: Effect of NAC therapy in HCCAA patients. Cystatin C immunostaining (brown staining) was performed using rabbit anti-human cystatin C antibody on three separate skin biopsies obtained from the same location on the back from two members of an HCCAA family who were carriers of the hCC L68Q variant. The biopsy in each left panel (skin biopsy 1 in Figure 8A and Figure 8B) was obtained when the family joined the study more than two years before this work began. The biopsy in the center panel (skin biopsy 2 in Figure 8A and Figure 8B) was obtained approximately 18 months later. The biopsies in the right panel (skin biopsy 3 in Figure 8A and Figure 8B) from both subjects show deposition of cystatin C protein complexes after 6 months of treatment with NAC. A significant reduction was observed in the proband (Panel A) and parent (Panel B) after 6 months of NAC therapy. Panel A: Cystatin C immunostaining of skin biopsies from the proband. Panel B: Cystatin C immunostaining of a skin biopsy from a parent. [Figure 8C] Figure 8C. Cyst-C monomers can be detected at reduced blood levels in subjects carrying the L68Q mutation. High molecular weight complexes appear to be present in one carrier who does not take NAC. DETAILED DESCRIPTION OF THE INVENTION
[0018] To create a system for testing compounds' ability to affect hCC multimerization while gaining some insight into their toxicity, we generated cell lines expressing large amounts of wild-type or mutant hCC. These cell lines, and the monomeric and multimeric hCC they produced, were characterized and used in experiments to nontoxically disrupt mutant protein aggregation. Furthermore, a biomarker study was conducted using NAC to treat human subjects with HCCAA.
[0019] This system facilitates the evaluation of a molecule's ability to prevent mutant hCC aggregation while also providing information on its toxicity to cells or organisms. Clones of 293T cells overexpressing wild-type or mutant hCC were generated. These cells produce and secrete detectable levels of hCC. Importantly, conditions were established that allowed for the detection of high-molecular-weight complexes formed in both the lysate and supernatant of cells expressing mutant hCC, which were absent in cells expressing equivalent amounts of wild-type protein. High-molecular-weight complexes of mutant hCC could be detected by Western blotting under non-reducing conditions. Interestingly, short-term incubation of either the lysate or supernatant with one of two reducing agents, reduced glutathione (GSH) or N-acetylcysteine (NAC), degraded the mutant oligomers to monomers. Furthermore, treatment of L68Q hCC-expressing cells with either NAC or GSH reduced the oligomerization of secreted hCC L68Q at 24, 48, and 72 hours. Patients with HCCAA were subsequently treated with NAC for 6 months. As a biomarker of response, skin biopsies were obtained to determine whether staining for amyloid cystatin C complexes was reduced in the skin after treatment. The proband, who was on the highest dose and had used NAC for 9 months to treat pulmonary mucus plugs and had previously experienced 3 major strokes in the 9 months prior to starting NAC, had approximately 75% reduction in amyloid staining penetrating the skin and was event-free for 18 months of NAC therapy.
[0020] In summary, this study provides a new cellular model for testing novel therapeutic approaches for the treatment of HCCAA and clearly demonstrates that mutant hCC is a pharmacological target for reducing agents such as NAC. Most importantly, the data, based on skin biomarker results from three patients with HCCAA, implicate NAC as a potentially useful therapy for treating this devastating disease.
[0021] The following definitions are provided to aid in the understanding of the subject matter regarded as the invention.
[0022] As used herein, "a" or "an" means "at least one" or "one or more," etc., unless the context clearly indicates otherwise. The term "or" means "and / or" unless otherwise stated, except that in the case of multiple dependent claims, the use of the term "or" refers to the multiple preceding claims in the alternative only.
[0023] As used herein, "human cystatin C (hCC)" refers to a protein that belongs to the cystatin superfamily and functions as a cysteine protease inhibitor. hCC is a secreted type 2 cystatin and is expressed in all nucleated human cells. L68Q-hcc refers to a mutant hCC in which leucine at position 68 is replaced by a glutamine variant.
[0024] The terms "drug" and "test compound" are used interchangeably herein to refer to a chemical compound, a mixture of compounds, a biopolymer, or an extract made from biological materials such as bacteria, plants, fungi, or animals (especially mammals), cells, or tissues. Biopolymers include siRNA, shRNA, antisense oligonucleotides, peptides, peptide / DNA complexes, and nucleic acid-based molecules that exhibit the ability to modulate hCC activity. Exemplary drugs include reducing agents such as NAC and its derivatives, used alone and in combination. Other useful drugs include, but are not limited to, glutathione, monensin, papain, cathepsin B, and falcipain. The biological activity of such drugs can be evaluated using the screening assays described herein below.
[0025] As used herein, "treatment" encompasses the administration or application of a disease therapeutic agent to a mammal, including a human, and refers to inhibiting a disease or its progression, inhibiting or slowing a disease or its progression, arresting its development, partially or completely alleviating a disease, preventing the onset of a disease, or preventing the recurrence of symptoms of a disease. An exemplary treatment includes the administration of an effective dose of at least one NAC derivative.
[0026] The term "inhibition" or "inhibiting" refers to a characteristic that refers to a reduction or cessation of some event (such as fibrillogenesis), a reduction or cessation of a phenotypic characteristic, or a reduction or cessation of its incidence, degree, or likelihood. "Reducing" or "inhibiting" refers to a decrease, reduction, or prevention of an activity, function, and / or amount compared to a baseline. The suppression or reduction does not necessarily have to be complete. For example, in certain embodiments, "reducing" or "inhibiting" refers to the ability to cause an overall reduction of 20% or more. In other embodiments, "reducing" or "inhibiting" refers to the ability to cause an overall reduction of 50% or more. In yet other embodiments, "reducing" or "inhibiting" refers to the ability to cause an overall reduction of 75%, 85%, 90%, 95%, or more.
[0027] The term "inhibitor" refers to an agent that slows or prevents a particular chemical reaction, signaling pathway, or other process, or that reduces the activity of a particular reactant, catalyst, or enzyme.
[0028] The terms "patient" and "subject" are used interchangeably to refer to mammals, including humans.
[0029] "N-acetylcysteine (NAC)" is a derivative of cysteine that reduces disulfide bonds associated with fibrillogenesis present in neurodegenerative diseases such as HCCAA and Alzheimer's disease. While NAC and ester derivatives are exemplified herein, other NAC derivatives are known in the art and are described in the following patent documents: US3242052, US3591686, US3647834, US3749770, US4016287, US4132803, US4276284, US4331648, US4708965, US47117 80, US4721705, US4724239, US4827016, US4859653, US4868114, US4876283, DE150694C, EP0219605A2, EP0219455A2, EP0269017A2, EP0280606A1, EP0304017A2, and EP0339508A1.
[0030] As used herein, "nucleic acid" or "nucleic acid molecule" refers to a DNA or RNA molecule, either single-stranded or double-stranded, and, if single-stranded, the complementary sequence molecule, whether linear or circular. In discussing nucleic acid molecules, the sequence or structure of a particular nucleic acid molecule may be described herein according to the usual convention of providing the sequence in the 5' to 3' direction.
[0031] With respect to the nucleic acid of the present invention, the term "isolated nucleic acid" is sometimes used. When applied to DNA, this term refers to a DNA molecule that is separated from the sequence that is immediately contiguous with it in the naturally occurring genome of the organism from which it originates. For example, "isolated nucleic acid" can include a DNA molecule that is inserted into a vector, such as a plasmid or viral vector, or that is integrated into the genomic DNA of a prokaryotic or eukaryotic cell or host organism.
[0032] When applied to RNA, the term "isolated nucleic acid" refers primarily to an RNA molecule encoded by an isolated DNA molecule as defined above. Alternatively, the term may refer to an RNA molecule that has been sufficiently separated from other nucleic acids with which it is associated in its natural state (i.e., cells or tissues). Isolated nucleic acid (either DNA or RNA) may further refer to a molecule that is produced directly by biological or synthetic means and separated from other components present during its production.
[0033] A "replicon" is a genetic element, such as a plasmid, cosmid, bacmid, phage, or virus, that is capable of replication largely under its own control. A replicon may be RNA or DNA, single- or double-stranded.
[0034] A "vector" is a replicon, such as a plasmid, cosmid, bacmid, phage, or virus, to which another genetic sequence or element (DNA or RNA) can be attached and which can bring about the replication of the attached sequence or element. Exemplary vectors of the invention include, but are not limited to, adenovirus-based vectors, adeno-associated virus vectors, and retrovirus vectors.
[0035] An "expression operon" refers to a nucleic acid segment that contains and promotes transcriptional and translational control sequences, such as promoters, enhancers, translation initiation signals (e.g., ATG or AUG codons), polyadenylation signals, and terminators, that facilitate the expression of a polypeptide-coding sequence in a host cell or organism.
[0036] The terms "isolated protein" or "isolated and purified protein" are sometimes used herein. This term primarily refers to a protein produced by expression of an isolated nucleic acid molecule of the invention. Alternatively, this term may refer to a protein that has been sufficiently separated from other proteins with which it is naturally associated, such that it exists in "substantially pure" form. "Isolated" does not imply artificial or synthetic mixture with other compounds or materials, or the presence of impurities that do not interfere with essential activity and that may be present, for example, due to incomplete purification, addition of stabilizers, or incorporation into, for example, an immunogenic or pharmaceutically acceptable formulation.
[0037] The term "substantially pure" refers to a preparation that contains at least 50-60% by weight of a given material (e.g., nucleic acid, oligonucleotide, protein, etc.). More preferably, the preparation contains at least 75% by weight, and most preferably 90-95% by weight, of the given compound. Purity is measured by methods appropriate for the given compound (e.g., chromatographic methods, agarose or polyacrylamide gel electrophoresis, HPLC analysis, etc.).
[0038] The terms "tag," "tag sequence," or "protein tag" refer to a chemical moiety, either a nucleotide, oligonucleotide, polynucleotide, or amino acid, peptide, or protein, or other chemical, that, when added to another sequence, provides additional utility or a useful property to that sequence, particularly in detection or separation. Thus, for example, a homopolymeric nucleic acid sequence or a nucleic acid sequence complementary to a capture oligonucleotide may be added to a primer or probe sequence to facilitate subsequent isolation of the extension or hybridization product. In the case of a protein tag, histidine residues (e.g., 4-8 consecutive histidine residues) can be added to the amino or carboxy terminus of a protein to facilitate protein separation by chelating metal chromatographies. Alternatively, amino acid sequences, peptides, proteins, or fusion partners representing epitopes or binding determinants reactive with specific antibody molecules or other molecules (e.g., Flag epitope, c-myc epitope, transmembrane epitope of influenza A virus hemagglutinin protein, protein A, cellulose-binding domain, calmodulin-binding protein, maltose-binding protein, chitin-binding domain, glutathione S-transferase, etc.) can be added to proteins to facilitate protein isolation by procedures such as affinity chromatography or immunoaffinity chromatography. Chemical tag moieties include molecules such as biotin, which can be added to either nucleic acids or proteins to facilitate separation or detection by interaction with avidin reagents, etc. Numerous other tag moieties are known and can be imagined by the trained artisan and are considered within the scope of this definition.
[0039] As used herein, the terms "reporter," "reporter system," "reporter gene," or "reporter gene product" refer to an operable genetic system in which a nucleic acid comprises a gene encoding a product that, upon expression, produces a reporter signal, e.g., a signal readily measurable by biological assay, immunoassay, radioimmunoassay, or colorimetric, fluorescent, chemiluminescent, or other methods. The nucleic acid may be RNA or DNA, linear or circular, single-stranded or double-stranded, antisense or sense polarity, and is operably linked to regulatory elements required for expression of the reporter gene product. The required regulatory elements vary depending on the nature of the reporter system and whether the reporter gene is DNA or RNA, but may include, but are not limited to, promoters, enhancers, translational control sequences, polyaddition signals, transcription termination signals, and the like.
[0040] The terms "transformation," "transfect," and "transduction" are intended to refer to any method or means of introducing nucleic acid into a cell or host organism and can be used interchangeably to convey the same meaning. Such methods include, but are not limited to, transfection, electroporation, microinjection, PEG fusion, etc.
[0041] The introduced nucleic acid may be incorporated (not covalently linked) into the nucleic acid of the recipient cell or organism. For example, in bacteria, yeast, plants, and mammalian cells, the introduced nucleic acid may be maintained as an episomal element or an independent replicon, such as a plasmid. Alternatively, the introduced nucleic acid may be incorporated into the nucleic acid of the recipient cell or organism, stably maintained within that cell or organism, and further inherited or inherited by descendant cells or organisms of the recipient cell or organism. In other methods, the introduced nucleic acid may only be present transiently in the recipient cell or host organism.
[0042] A "clone" or "clonal cell population" is a population of cells derived from a single cell or common ancestor by mitosis.
[0043] A "cell line" is a clone of a primary cell or population of cells capable of stable growth in vitro for many generations.
[0044] Methods and Uses for Treating HCCAA and Other Neurodegenerative Disorders The present invention includes a method for treating HCCAA and other neurodegenerative disorders in a subject, comprising administering an effective amount of NAC or its functional derivatives. As used herein, the term "treatment" includes administering or administering a therapeutic agent for a disease or disorder in a subject, inhibiting a disease, arresting its development, alleviating symptoms of a disease, or preventing the occurrence or recurrence of a disease or symptom of a disease.
[0045] In some embodiments, the method of treatment includes identifying or diagnosing a subject with a genetic alteration in hCC that causes HCCAA, and administering NAC or a functional derivative thereof to the identified or diagnosed subject. In other embodiments, the subject has a different disease associated with pathological fibrillogenesis, including, but not limited to, Alzheimer's disease.
[0046] The total therapeutic dose(s) (if more than one target is being treated) can be administered to the subject as a single dose, or can be administered using a split treatment protocol in which multiple / separate doses are administered over a longer period, for example, over a daily period to allow for the administration of a daily dose, or over a longer period to administer doses over a desired period. Those skilled in the art will understand that the amount of therapeutic agent required to achieve an effective dose in a subject depends on many factors, including the subject's age, weight, and general health, as well as the route and number of administrations. Taking these factors into account, those skilled in the art will adjust the specific dose to achieve an effective dose for treating an individual with HCCAA.
[0047] The effective amount of a therapeutic agent depends on the method of administration and the body weight of the individual being treated. The dosages described herein are generally those for an average adult, but can be adjusted for the treatment of children. Doses will generally range from about 0.001 mg to about 1000 mg.
[0048] In individuals suffering from more severe forms of the disease, administration of therapeutic agents may be particularly useful, for example, when administered in combination with conventional agents for treating such diseases. One skilled in the art would administer therapeutic agents alone or in combination and monitor the effectiveness of such treatment using routine methods, such as determinations of neurological or pulmonary function, radiological or immunological assays, or histopathological methods, if indicated.
[0049] The pharmaceutical preparation is preferably administered in an "effective amount", which is sufficient to show benefit to the individual. This amount prevents, alleviates, reduces, or reduces the severity of HCCAA symptoms in patients. Treating patients with HCCAA with an effective amount of NAC or its functional derivatives can result in improved neurological function, respiratory function, reduced concomitant drug use, or increased survival.
[0050] Pharmaceutical preparations are formulated in dosage unit form for ease of administration and uniformity of dosage.As used herein, dosage unit form refers to the physically separate unit of pharmaceutical preparations that is suitable for the patient who will be treated.Each dosage should contain the amount of active ingredient that is calculated to obtain the desired effect in association with selected pharmaceutical carrier.The procedure of determining suitable dosage unit is well known to those skilled in the art.
[0051] Dosage units may be proportionally increased or decreased based on the patient's weight. Appropriate concentrations for alleviating a particular pathological condition can be determined by dose-concentration curve calculations, as known in the art.
[0052] Pharmaceutical compositions useful in the methods of the present invention can be administered parenterally, via oral solid and liquid formulations, subcutaneously, intradermally, intramuscularly, sublingually, topically, intraperitoneally, intranasally, transdermally, respiratory, ophthalmic, suppository, aerosol, topically, or other known routes of administration. In addition to the drug useful for treating HCCAA, pharmaceutical compositions can contain pharmaceutically acceptable carriers and other ingredients known to facilitate and enhance drug administration. Therefore, such compositions may optionally contain other ingredients, such as adjuvants, for example, aqueous suspensions of aluminum hydroxide and magnesium hydroxide, and / or other pharmaceutically acceptable carriers, such as saline. Other possible formulations, such as nanoparticles, liposomes, resealed red blood cells, and immunologically-based systems, can also be used to deliver / administer appropriate drugs to patients according to the methods of the present invention. The use of nanoparticles for drug delivery, as well as cell membrane-permeable peptide carriers that can be used, are described in Cromez et al., Biochemical Society Transactions v35:p44 (2007).
[0053] The pharmaceutical compositions may also include co-administered anti-inflammatory agents to further alleviate the symptoms of amyloid disease, including, but not limited to, corticosteroids, aspirin, celecoxib, diclofenac, diflunisal, etodolac, ibuprofen, indomethacin, ketoprofen, ketorolac, nabumetone, naproxen, oxaprozin, piroxicam, salsalate, sulindac, tolmetin, interleukins, IL-4, IL-6, IL-10, IL-11, IL-13, cytokine receptors for IL-1, tumor necrosis factor-α, IL-18 and derivatives and biosimilars thereof.
[0054] To facilitate the practice of the present invention, the following materials and methods are provided.
[0055] Cells and hCC WT and L68Q variant expression constructs Human embryonic kidney 293 (HEK-239T) cells were obtained from ATCC (Manassas, VA) and grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum at 37°C. A plasmid containing the CST3 cDNA was obtained from Dharmacon (Lafayette, CO). The full-length coding sequence was amplified with a c-terminal Myc tag by PCR using the forward primer GATCGAATTCGCCACCATGGCCGGGCCCCTGCGCG (SEQ ID NO: 1) and the reverse primer TCGCGGCCGCCTACAGATCCTCTTCTGAGATGAGTTTTTGTTCGGCGTCCTGACAGGTGGATTTCG (SEQ ID NO: 2) and ligation of the NotI site. The CMV-Puro.58 L68Q mutation was amplified with a c-terminal Myc tag using the primers GTGAACTACTTCTTGGACGTCGAGCAGGGCCGAACCACGTGTACC (SEQ ID NO: 3) and GGTACACGTGGTTCGGCCCTGCTCGACGTCCAAGAAGTAGTTCAC (SEQ ID NO: 4). All sequences were confirmed by Sanger sequencing. Wild-type and mutant constructs were transfected into HEK-293T cells using 3 μg of DNA and 9 μl of transfection reagent using Fugene HD (Promega, Madison, WI) according to the manufacturer's protocol. After transfection, cells were incubated in fresh medium containing puromycin (1 μg / ml) for 3 weeks. After selection, stable clones of each transfectant were generated by limiting dilution. Clones were screened by Western blot using anti-hCystatin C antibody MAB1196 (R&D, Minneapolis, MN).
[0056] Western blotting HEK-293T cells expressing hCC WT or the L68Q variant were washed twice with ice-cold phosphate-buffered saline (PBS) and lysed on ice using freshly prepared ice-cold cell lysis buffer containing 50 mM Tris-HCl, pH 7.4, 100 mM NaCl, 50 mM β-glycerophosphate, 10% glycerol (w / v), 1% NP-40 (w / v), 1 mM EDTA, 2 mM NaVO4, and 20 μl of complete EDTA-free protein inhibitor cocktail (Roche Applied Science, Mannheim, Germany) per mL of lysis buffer. After centrifugation (10 min, 21,000 × g, 4 °C), the cell lysate was removed and the supernatant was collected for Western blotting. Sample buffer containing SDS, glycerol, Tris-HCl pH 6.8, and bromophenol blue was added to each sample to a final concentration of 2% SDS, 10% glycerol, 50 mM Tris-HCl, and 0.02% bromophenol blue. For reduced samples, DTT (50 mM final concentration) or β-mercaptoethanol (5% final concentration) was added. Equal amounts of lysate or supernatant samples were loaded onto a NuPAGE 4-12% Bis-Tris gel (Thermo Fisher Scientific, Waltham, MA) without heating or boiling. Proteins were transferred to a PVDF membrane (Millipore, Billerica, MA), blotted with anti-hCystatin C, and developed by enhanced chemiluminescence (ECL; Thermo Fisher Scientific). The ECL film was scanned, and band densities were determined using the gel analysis function in Fiji.59.
[0057] Drug treatment HEK-239T cells were seeded in 6-well plates and cultured for 2 days, at which time reduced glutathione (GSH) (Sigma, St. Louis, MO) or N-acetylcysteine (NAC) (Sigma) were added at the indicated concentrations. Cells were incubated with compounds for 72 hours, and 100 μl samples of the supernatant were removed at 24, 48, and 72 hours. The supernatant was removed by centrifugation (10 min, 21,000 × g, 4°C). Sample buffer containing SDS, glycerol, Tris-HCl pH 6.8, and bromophenol blue was added to each sample to a final concentration of 2% SDS, 10% glycerol, 50 mM Tris-HCl, and 0.02% bromophenol blue. Where indicated, cells were washed with PBS, lysed, and cystatin C levels were determined by Western blot analysis.
[0058] statistical analysis The mean and standard deviation of the data were calculated. A one-tailed T-test was used to determine the level of significance with respect to untreated samples, and p<0.05 was considered statistically significant.
[0059] Treatment of HCCAA patients with NAC Three 4 mm skin biopsies from the back were taken from each of the three individuals studied. The skin biopsies were formalin-fixed and paraffin-embedded. They were cut into 3 μm sections for immunohistochemistry and immunostained with rabbit polyclonal cystatin C antibody (Sigma, HPA013143) using the EnVision Detection System as previously described. 22 hCC immunoreactivity in carrier skin biopsies was quantified by semi-automated image analysis using ImageJ software as previously described. 22 Bright-field images of each section from the carrier were captured using a ×20 / 0.3NA objective. RGB color images of the sections were imported into ImageJ. In each image, a rectangular 2000 × 2000 pixel region of interest (ROI) was defined. Subsequent processing to generate the % area coverage of hCC immunoreactivity within each ROI was performed as previously described. 22The first biopsy was a historical one taken approximately 2 years before the start of the study, after the proband had been on NAC therapy (400 mg four times per day) for more than 9 months to treat mucus-blockage in the lungs after a third stroke. The second biopsy was taken just before the entire family started NAC treatment (600 mg NAC three times per day for 6 months). The third biopsy was taken three times after 6 months of NAC therapy at 600 mg per day.
[0060] The proband received 400 mg of NAC four times daily for 9 months, followed by 600 mg three times daily for 6 months. The parents received only 600 mg three times daily for the 6-month course. The proband never missed a dose, and the parents missed the intermediate dose two to three times weekly.
[0061] Exam Approval All necessary permissions for the use of skin biopsies from L68Q-CST3 carriers, as well as records relating to samples and medical information, were obtained from the National Bioethics Committee of Iceland, reference numbers 04-046-S2 and 15-060-S1. Both family members signed informed consent forms. NAC therapy was prescribed clinically and incidentally as mucolytic therapy to treat pulmonary atelectasis in the proband. The other family members took NAC as a dietary supplement (i.e., NAC was purchased online from Amazon).
[0062] The following examples are provided to illustrate certain embodiments of the present invention and are not intended to limit the invention in any way. [Example]
[0063] As previously mentioned, HCCAA is a dominantly inherited disease caused by the leucine 68 to glutamine variant of human cystatin C (hCC; L68Q-hCC) (ref). Most carriers of the mutation suffer microinfarcts and cerebral hemorrhage in their twenties, leading to paralysis, dementia, and death in young adults, with an average lifespan of 30 years (1-5). Postmortem studies in humans show that hCC is deposited in all brain regions, most prominently in gray matter, as well as in arteries and arterioles. These deposits are composed of amyloid fibrils composed of hCC. This can be demonstrated by staining postmortem tissue with Congo red stain, which shows birefringence in amyloid structures under polarized light (6).
[0064] To create a system for testing compounds' ability to affect hCC multimerization while examining their toxicity, we generated cell lines expressing large amounts of wild-type or mutant hCC. This example describes characterization of the cell lines and the monomeric and multimeric hCC they produce, an attempt to nontoxically disrupt mutant protein aggregation, and a pilot biomarker study using NCC to treat subjects with HCCAA.
[0065] Genetically engineered HEK-293T cells produce and secrete hCC (wt or L68Q) that can oligomerize under non-reducing conditions. To identify therapeutic agents capable of halting the production of L68Q hCC oligomers and fibrils, we generated genetically engineered HEK-293T cells expressing either wild-type (WT) or L68Q mutant hCC. The proteins were tagged with a myc tag at the C-terminus. C-terminal tagging was selected to avoid interference with secretion of the produced protein, which could result from signal peptide cleavage or N-terminal tagging. After stably incorporating these constructs into HEK-293T cells, we monitored both the secreted and intracellular steady-state levels of hCC WT and the L68Q variant. Analysis of hCC was developed using an SDS-PAGE gel electrophoresis system, which allows for the formation and detection of low- and high-molecular-weight oligomers (LMW and HMW). As shown in Figure 1A, cells produce and secrete detectable levels of both hCC WT or variant L68Q, which can oligomerize under non-reducing conditions (lanes 1 and 3). WT and L68Q-expressing cells contain comparable amounts of hCC protein in their lysates, indicating similar expression levels. However, conditioned supernatants from L68Q-expressing cells contain much less hCC protein than supernatants from WT-expressing cells. This indicates that the L68Q variant protein is not secreted from cells as efficiently as WT, consistent with previous reports (17, 18). While intracellular hCC WT exists primarily as a monomer, with a low proportion of dimers (99% and 1%, respectively), the intracellular hCC L68Q variant was found to form monomers, dimers, and, as expected, LMW and HMW species due to its increased tendency to form oligomers (19). Interestingly, secreted hCC WT behaves similarly to the intracellular fraction, being found primarily as a monomer. In contrast, secreted hCC L68Q is only detected as an HMW protein. Notably, oligomerization of both WT and L68Q variant proteins is completely abolished in the presence of the reducing agents DTT or b-mercaptoethanol. Both are strong reducing agents that typically cause reduction of disulfide bonds.
[0066] Immunofluorescence assays were performed to detect the levels of hCC protein in untransfected or WT and L68Q-expressing 293T cells. hCC protein was expressed primarily in the cytoplasm, a subcellular distribution consistent with previously reported localization in late endosomes / prelysosomes and Golgi / ER / early endosome compartments, the latter largely consistent with the typical properties of secreted proteins (20).
[0067] Incubation with glutathione impairs hCC di / oligomerization in cell extracts and supernatants Depletion of LMW and HMW oligomers in the presence of DTT or β-mercaptoethanol emphasizes the importance of disulfide bonds in the dimerization / oligomerization process. Therefore, we hypothesize that treatment with other reducing agents would impair dimerization. We extensively characterized the effects of reducing agents on dimerization / oligomerization levels at both secreted and intracellular levels of hCC WT and the L68Q variant. Supernatants and cell extracts were treated with different concentrations of GSH at 37 °C for 15 min. Notably, as shown in Figure 2A, treatment with 3 or 10 mM GSH significantly reduced the amount of dimers and / or HMW oligomers observed in both the secreted and intracellular fractions of hCC WT or the L68Q variant. Quantification of these results by densitometry showed that 3 mM GSH demonstrated approximately 90% inhibition of HMW oligomers in the secreted fraction and approximately 50% inhibition in the intracellular fraction of the L68Q hCC mutant (Figure 2A and Figure 1B).
[0068] Incubation with NAC or glutathione impairs dimerization of secreted hCC L68Q The oxidized / reduced glutathione pair is important for combating oxidative stress and can effectively destroy hCC dimers and HMW oligomers, as shown in Figure 2. Therefore, we analyzed whether the commonly used dietary supplement NAC (which has a similar antioxidant effect as GSH) affects the oligomerization / dimerization of secreted hCC. The supernatant was treated with different concentrations of GSH and NAC for 60 min at 37 °C. As shown in Figure 3A, treatment with 3 or 10 mM glutathione or NAC significantly reduced the oligomerization / dimerization level of the secreted hCC L68Q variant in vitro. Quantification showed almost complete removal of HMW dimers at a 3 mM concentration of either GSH or NAC (Figure 3A and Figure 2B). This result clearly indicates that GSH or NAC can reduce the oligomerization level of the pathogenic version of hCC L68Q and may be used to treat HCCAA patients.
[0069] The presence of GSH or NAC reduces oligomerization of secreted cystatin C L68Q at 24, 48, and 72 h. To examine whether NAC or GSH reduces the oligomerization of secreted hCC L68Q in a cell system more representative of in vivo biology, cells expressing hCC WT or L68Q were treated with both agents. Cells were plated and allowed to secrete hCC for 48 hours, at which point increasing concentrations of GSH or NAC were added to the culture medium. Cells were cultured in the presence of the reducing agents for 72 hours, and supernatant samples were removed at 24, 48, and 72 hours. The oligomerization state of hCC was determined by Western blot at each time point. Cells remained viable throughout the experimental period in the presence of both reducing agents at all concentrations (up to 10 mM). Cell proliferation was only slightly affected at the highest 10 mM concentration (data not shown). As shown in Figure 4 (and Figure 3B), treatment of cells with 10 mM GSH or NAC completely eliminated the presence of HMW and LMW at 24 and 48 hours, with a significant, but incomplete, reduction of HMW and LMW persisting at 72 hours. Treatment with low doses of NAC or GSH was only partially effective at 24 and 48 hours, and no significant effect was detected after 72 hours.
[0070] Treatment of either the supernatant or cell extracts of a cell line engineered to overexpress a mutant version of human cystatin C (Cyst-C) with reducing agents such as NAC or reduced glutathione clearly reduces the formation of macromolecular complexes of L68Q mutant Cyst-C. To determine whether the effects of NAC and GSH are due to their ability as reducing agents or other properties of the compounds, the supernatant and cell extracts were treated with compounds structurally similar to NAC and GSH that lack reducing activity. As shown in Figure 5, treatment with N-acetylserine (NAS), in which the reducing sulfhydryl group of NAC is replaced with a hydroxyl group, or with the oxidized form of glutathione (GSSH), significantly reduced L68Q Cyst-C. A significant reduction was observed with both reducing agents. The reducing activity of either NAC or GSH is required for their effect on Cyst-C oligomerization.
[0071] Several derivatives of NAC were generated that exhibited improved reducing activity and bioavailability, as well as the ability to cross the blood-brain barrier. Two NAC derivatives were tested in our cell culture system. As shown in Figure 6, both the amide and methyl ester derivatives of NAC retain the ability to disrupt high molecular weight complexes of L68Q Cyst-C upon in vitro treatment of supernatants or cell extracts. Our data also indicate that both derivatives may be slightly more potent in their ability to disrupt oligomerization, as a loss of high molecular weight signal was observed with the 1 mM derivative, comparable to that seen with 10 mM NAC.
[0072] Additional results were generated from transgenic mice obtained from collaborator Eufrat Levy at New York University. These mice are transformed with human genomic DNA containing the coding sequence for Cyst-C, but without non-coding portions of the gene that could affect expression levels. The mice do not display a phenotype comparable to that of HCCAA. However, as shown in Figure 7, we were able to demonstrate the presence of high-molecular-weight Cyst-C complexes in both the brain and blood of transgenic animals. Western blots from mouse tissue extracts are not as clean as blots from cell lines because the antibody used for detection was developed in mice. Despite this complication, comparison of transgenic mice (nos. 6028 and 6019) with non-transgenic C57Bl6 animals demonstrates a significant signal caused by transgenic human Cyst-C. While several nonspecific high-molecular-weight bands are observed in non-transgenic samples, a clear high-molecular-weight "smear" is seen in transgenic animals, consistent with that observed in supernatants from cell culture systems. Treatment with NAC reduces this smear and induces the appearance of monomers. This indicates that NAC can reduce oligomerization in biological samples.
[0073] Effect of NAC therapy on HCCAA patients In Iceland, there are hundreds of patients suffering from HCCAA (i.e., suffering major strokes in their early twenties), all of which are attributable to founder mutations dating back to the early 1500s. We performed RNA sequencing on 30 subjects from three multiplex families and showed that genes involved in coronary artery disease, stroke, and atherosclerosis are upregulated in cystatin C mutation carriers. Reversing the disease process would likely be readily approved by the Icelandic Pharmacy. Dimerization of amyloid fibrils is a critical step in the amyloid deposition process in small and medium-sized cerebral arteries. Cell-based assays show that both wild-type and mutant proteins are expressed, and that expression of the mutant protein leads to dimerization, a process that can be inhibited. Therefore, drugs that block amyloid fibril dimerization are expected to be effective in preventing amyloid deposition and halting the progression of the disease process, thereby presenting an effective treatment.
[0074] Figure 8A shows the staining changes after 6 months of NAC therapy from biopsy 1 obtained 2 years earlier in all three patients, biopsy 2 obtained 6 months earlier, and biopsy 3 obtained 2 weeks earlier. Overall, the drug reduced the intensity of the skin biomarker (amyloid-cystatin protein aggregates), suggesting that it also reduces amyloid deposition in other organs, as previously demonstrated ( 21 ).
[0075] Based on the results of staining to measure amyloid-cystatin protein complex aggregates in the skin, the proband, who had very high levels of amyloid-cystatin staining in her first skin biopsy, was found not to have progressed in a significant way (age spots). Between skin biopsies #1 and #2, her father and her brother (both carriers of the L68Q variant) showed significant progression in the intensity of their age spots, reflecting increased deposition of amyloid complexes in the skin, over time in the absence of NAC therapy. It is noteworthy that the proband had been taking NAC medication for approximately 9 months to treat her lungs. She discontinued treatment several months before the second biopsy. The second biopsy was initially performed as a baseline to serve as a biomarker response to subsequent NAC therapy.
[0076] All three biopsies for each individual were stained simultaneously for legal comparison. The lead proband (three strokes in nine months) was 100% compliant with 600 mg NAC therapy per day, and she showed a highly visible reduction in amyloid staining compared to her original skin biopsy. It reached a 75% reduction at the end of 6 months of prospective treatment (Figure 8A). The reduction in staining in her father was 50%, and the reduction in staining in her sister's biopsy was less evident due to the lower dose of NAC, as shown in the Materials and Methods section.
[0077] Finally, blood samples were obtained from seven members of an Icelandic family known to be carriers of the L68Q mutation. Five of the family members had known mutation status (three L68Q carriers, two wild-type). DNA from all individuals was Sanger sequenced to confirm the known status and determine the status of previously untested individuals, one of whom was found to carry the mutation. The relationship between mutation status and the proband in this family is shown in Figure 8B. Western blotting of plasma samples under reducing conditions demonstrated a decrease in total Cyst-C levels in adult carriers of the L68Q mutation (proband, siblings, and father). The probands did not show a decrease in protein levels, indicating a potential age-related effect (and no effect on any treatment). Blotting of non-reduced samples demonstrated the detection of high-molecular-weight complexes in the probands. In other subjects, interpretation of these results is complicated by the fact that all adult carriers of the mutation regularly consumed NAC. It is possible that oligomers could be detected in adult L68Q carriers who do not take NAC.
[0078] Both NAC derivatives replace the hydroxyl group with less polar substituents, which is proposed to enhance membrane permeability. Increased membrane permeability often correlates with better passage through the blood-brain barrier. To assess the membrane permeability of derivative compounds, live cells were treated with NAC or the derivatives. If the compounds cross the cell membrane, we would expect the derivatives' effect on the accumulation of intracellular oligomers of L68Q Cyst-C. As shown in Figure 6, the compounds reduced the amount of high-molecular-weight Cyst-C in the supernatant. The limited effect on intracellular material may be due to timing issues. Cells continuously produce L68Q Cyst-C at overexpression levels, and compounds entering the cells may be quickly consumed, resulting in an initial effect that is lost with continued culture.
[0079] discussion Identifying drugs capable of reducing hCC dimerization and amyloid fibril formation is key to developing therapeutics for the treatment and / or prevention of HCC-associated amyloid formation and fatal cerebral hemorrhage. hCC variants are the cause of HCCAA, and no treatments are available to prevent premature death from cerebral hemorrhage. Here, we first generated cells that produce and secrete detectable levels of hCC (wt or L68Q) that can oligomerize under non-reducing conditions, and show that short incubation with either GSH or NAC resolves the oligomers into monomers of intracellular and secreted hCC L68Q. Treatment with either NAC or GSH reduced the oligomerization of secreted hCC L68Q at 24, 48, and 72 hours, demonstrating that treatment of human patients with NAC not only prevents ongoing amyloid deposition in the skin but also significantly reduces previously deposited amyloid. A reduction of more than 75% was observed after 6 months of oral therapy, which was well tolerated and without adverse events.
[0080] The developed cell system was constructed to identify drugs that reduce hCC dimerization and amyloid fibril formation in vivo for both wt and L68Q cystatin C. Previous systems for studying hCC dimerization have been developed, but most of them were performed primarily with wild-type cystatin C because it is extremely difficult to produce sufficient amounts of monomeric L68Q-cystatin C (14). Genetically engineered HEK-293T cells expressing both C-terminally tagged wt and L68Q hCC provide an excellent model to study and characterize the effects of small molecules on both the secreted and intracellular levels of wt and L68Q hCC. It is important to emphasize that, due to the different behavior of the L68Q-hCC variant, drug studies and characterization that reduce oligomerization must be performed in both fractions. This variant was found primarily as LMW oligomers in the intracellular fraction, but primarily forms HMW oligomers in the extracellular compartment. These may be because the secretion process induces oligomerization of the L68Q variant, or because the environmental conditions in the extracellular compartment favor oligomerization of this variant, or because oligomerization extends the half-life of the protein.
[0081] L68Q cystatin C is highly amyloidogenic, and subjects with the corresponding mutation suffer from cerebral amyloidosis, leading to cerebral hemorrhage and death in early adulthood (16). Other amyloid diseases, such as Alzheimer's disease, Parkinson's disease, and HD, have similar amyloid origins and are also caused by the accumulation of misfolded proteins. This broad-spectrum effect of proteotoxic stress has led to the term "proteinopathy" for neurodegenerative diseases. Interestingly, the risk of acquiring any of these neurodegenerative diseases increases dramatically with age, likely as a result of increased protein misfolding stress, decreased proteasome activity, and diminished antioxidant defenses that promote the extracellular accumulation of misfolded proteins (22). The proteasome and autophagy-lysosomal pathways are the primary routes for intracellular aggregate clearance. However, little is known about the corresponding mechanisms operating extracellularly or effective strategies to slow or prevent neurodegeneration resulting from these diseases in humans (23).
[0082] Glutathione (GSH) is synthesized in the cytosol from the precursor amino acids glutamate, cysteine, and glycine and is considered the major endogenous antioxidant within cells. It exists in different concentrations in the cytosol, ranging up to 10 mM, depending on the subcellular compartment, with high concentrations in the cytosol and very low concentrations in the ER (24). Due to the high concentration of GSH, protein disulfide bonds rarely form in the cytosol. In contrast, the lumen of the endoplasmic reticulum (ER) and extracellular compartments contains relatively high concentrations of oxidized glutathione (GSSG) (25). This differential distribution of GSH allows for the formation of native disulfide bonds in the ER through a complex process involving not only disulfide bond formation but also the isomerization of non-native disulfide bonds. Our immunofluorescence studies and previous reports indicate that hCC localizes to late endosomes / prelysosomes and Golgi / ER / early endosomal compartments (20). This localization is consistent with the typical properties of a secreted protein and is consistent with the hypothesis that L68Q hCC polymerizes in these compartments where reduced exposure to GSH increases aggregation, thereby explaining the released aggregates in the extracellular compartment.
[0083] Under normal conditions, GSH levels are regulated by two major mechanisms: by controlling its synthesis rate and its export rate from cells. However, GSH levels are also affected by agents or conditions that alter the thiol redox state, leading to the formation of glutathione S-conjugates or complexes, and / or by conditions that disrupt the distribution of GSH among various intracellular organelles. Furthermore, GSH levels are affected by nutritional status and hormone / stress levels, exhibit developmental and circadian variations, and are influenced by certain physiological states, such as pregnancy and exercise (26-33). While physiological levels of GSH in blood are necessary to provide an adequate antioxidant environment to avoid extracellular accumulation of proteins, the presence of mutations such as hCC L68Q or deficiencies in GSH levels as a result of nutritional status or age can lead to the undesired accumulation of misfolded proteins (3). Furthermore, GSH deficiency, or a reduced GSH / glutathione disulfide (GSSG) ratio, is known to be primarily manifested by increased susceptibility to oxidative stress, and the resulting damage is thought to be involved in diseases such as Parkinson's disease and Alzheimer's disease, which are strongly associated with other age-related pathologies (34, 35). The results presented in this study indicate that NAC could represent an interesting therapeutic approach for amyloid diseases such as HCCAA by reducing amyloid protein accumulation.
[0084] Acetylcysteine is a synthetic N-acetyl derivative of the endogenous amino acid L-cysteine, a precursor to the antioxidant enzyme glutathione. Both GSH and NAC have already been approved for human use and can be administered at high doses for extended periods without adverse side effects. They act as direct reactive oxygen species (ROS) scavengers and as sources of SH groups, stimulating GSH synthesis and increasing the abundance of 1) non-protein and 2) protein SH groups. In addition, acetylcysteine also regenerates hepatic stores of GSH. These effects endow NAC with the ability to reduce disulfide bonds, which is why NAC is widely used to reduce mucus viscosity and elasticity, among other uses. Our data show that treatment with antioxidants such as GSH and NAC (and DTT or beta-MetOH) abolishes hCC oligomerization. This effect indicates that disulfide bond formation is essential for the oligomerization process. Although disulfide bonds do not appear to be directly involved in the dimerization process (16), two disulfide bonds are present in human cystatin C (as in all type 2 cystatins), and their conservation in the dimeric structure indicates their important role in the dimerization process (16). We hypothesize that intramolecular disulfide bonds are essential for the correct folding of the hCC monomer and for disabling the exchange and oligomerization of three-dimensional “subdomains” between the two subunits of the dimer.
[0085] Our data show that treatment with NAC increases GSH production, and both antioxidants reduce the oligomerization of secreted hCC, thereby reducing amyloid formation in the brains of HCCAA patients. Although GSH treatment may be effective, its low bioavailability limits its potential as a therapeutic agent for the treatment of HCCAA patients. NAC appears to be a perfect candidate due to its role in restoring GSH levels, its antioxidant properties, and its ability to disrupt disulfide bonds, as reviewed in (36). Furthermore, NAC supplementation significantly improved coronary and peripheral vasodilation (37). Brain-specific NAC has been administered with some efficacy to patients with Alzheimer's disease (38), and our data suggest it could be an excellent alternative to HCCAA.
[0086] Because cell membranes, along with the blood-brain barrier, exhibit reduced permeability to NAC, extracellular NAC treatment does not appear to affect the dimerization state of intracellular levels of L68Q hCC (see data not shown). Therefore, the effects of NAC derivatives, including but not limited to N-acetylcysteine ethyl ester (NACET) or N-acetylcysteine methyl ester, may be investigated. These novel lipophilic, cell-permeable membrane cysteine derivatives should provide suitable candidates for oral use as H2S producers in the treatment of amyloid diseases such as HCCAA (39).
[0087] The observed reduction in amyloid staining in skin biopsies with NAC treatment is very promising and indicates that this therapy is effective in treating patients with HCCAA. Because amyloid is deposited in all organs, if a reduction is observed in the skin, there is no reason to believe that amyloid deposition and accumulation is continuing in the brain. More likely, there is a similar reduction in other body organs, including the cerebrovascular system and brain. No new events have occurred in any of the three individuals, and all are continuing treatment, with the index patient now approximately 2 years after his third and final stroke.
[0088] It is noteworthy that a significant number of HCCAA patients in Iceland never experience clinical stroke and only present with dementia at an early age. Because the amyloid deposition process in HCCAA patients parallels that of Alzheimer's disease, blocking the dimerization and polymerization of amyloid fibrils (enhanced by the L68Q-cystatin C founder mutation) may help Alzheimer's disease patients with amyloid-related dementia. Therefore, NAC therapy or NAC-like compounds may be beneficial for Alzheimer's disease.
[0089] The analogy here is familial combined hypercholesterolemia (FCH). Statins were developed to treat this familial condition (patients with FCH develop stroke and myocardial infarction in their 20s). It has since become clear that elevated cholesterol is harmful and a major risk factor for MI and stroke, and that patients with CV risk factors benefit from statin treatment. HCCAA promotes amyloid deposition, which occurs early in life and leads to devastating events in the 20s and early dementia. This process is somewhat comparable but slower in Alzheimer's disease, so dementia typically lasts until the mid-to-late 60s or 70s, but treatment is the same.
[0090] literature 1.Palsdottir, A. et al.Mutation in cystatin C gene causes hereditary brain haemorrhage.Lancet 2,603-604(1988). 2. Abrahamson, M., Barrett, AJ, Salvesen, G. & Grubb, A. Isolation of six cysteine proteinase inhibitors from human urine. Their physicochemical and enzyme kinetic properties and concentrations in biological fluids. J Biol Chem 261, 11282-11289 (1986). 3.SnorradottirA.O. et al.Deposition of collagen IV and aggrecan in leptomeningeal arteries of hereditary brain haemorrhage with amyloidosis. Brain Res 1535, 106-114(2013). 4.Palsdottir,A.et al.A drastic reduction in the life span of cystatin C L68Q carriers due to life-style changes during the last two centuries.PLoS Genet 4,e1000099 (2008). 5.Gudmundsson,G.,Hallgrimsson,J.,Jonasson,T.A.&Bjarnason, O. Hereditary cerebral haemorrhage with amyloidosis.Brain 95,387-404(1972). 6.Osk Snorradottir,A.et al.Parenchymal cystatin C focal deposits and glial scar formation around brain arteries in Hereditary Cystatin C Amyloid Angiopathy. Brain Res 1622,149-162(2015). 7.Abrahamson,M.,Grubb,A.,Olafsson,I.&Lundwall,A.Molecular cloning and sequence analysis of cDNA coding for the precursor of the human cysteine proteinase inhibitor cystatin C.FEBS Lett 216,229-233(1987). 8.Grubb,A.&Lofberg,H.Human gamma-trace,a basic microprotein: amino acid sequence and presence in the adenohypophysis.Proc Natl Acad Sci U S A 79,3024-3027(1982). 9.Grubb,A.O.Cystatin C--properties and use as diagnostic marker. Adv Clin Chem 35,63-99(2000). 10.Henskens,Y.M.et al.Effect of periodontal treatment on the protein composition of whole and parotid saliva.J Periodontol 67,205-212(1996). 11.Turk,V.&Bode,W.The cystatins:protein inhibitors of cysteine proteinases.FEBS Lett 285, 213-219(1991). 12.Bode,W.et al.The 2.0 A X-ray crystal structure of chicken egg white cystatin and its possible mode of interaction with cysteine proteinases.EMBO J 7,2593-2599 (1988). 13.Orlikowska,M.,Jankowska,E.,Kolodziejczyk,R.,Jaskolski,M.&Szymanska,A.Hinge-loop mutation can be used to control 3D domain swapping and amyloidogene of human cystatin C.J Struct Biol 173,406-413(2011). 14.Kolodziejczyk,R.et al.Crystal structure of human cystatin C stabilized against amyloid formation.FEBS J 277,1726-1737 (2010). 15.Janowski,R.et al.Human cystatin C, an amyloidogenic protein,dimerizes through three-dimensional domain swapping.Nat Struct Biol 8,316-320(2001). 16.Janowski,R.,Abrahamson,M.,Grubb,A.&Jaskolski,M.Domain swapping in N-truncated human cystatin C.J Mol Biol 341,151-160(2004). 17.Janowski,R.,Kozak,M.,Abrahamson,M.,Grubb,A.& Jaskolski,M.3D domain-swapped human cystatin C with amyloidlike intermolecular beta-sheets.Proteins 61,570-578(2005). 18.Wahlbom,M.et al.Fibrillogenic oligomers of human cystatin C are formed by propagated domain swapping.J Biol Chem 282,18318-18326(2007). 19.Tsiolaki,P.L.,Louros,N.N.,Hamodrakas,S.J.& Iconomidou,V.A.Exploring the'aggregation-prone' core of human Cystatin C:A structural study. J Struct Biol 191, 272-280(2015). 20.Sipe,J.D.et al.Amyloid fibril protein nomenclature: 2012 recommendations from the Nomenclature Committee of the International Society of Amyloidosis.Amyloid 19,167-170(2012). 21.Palsdottir,A.,Snorradottir,A.O.&Thorsteinsson,L. Hereditary cystatin C amyloid angiopathy:genetic,clinical,and pathological aspects.Brain Pathol 16,55-59(2006). 22.Snorradottir,A.O.et al.Pathological changes in basement membranes and dermal connective tissue of skin from patients with hereditary cystatin C amyloid angiopathy.Lab Invest 97,383-394(2017). 23.Perlenfein, T.J.,Mehlhoff,J.D.&Murphy,R.M.Insights into the mechanism of cystatin C oligomer and amyloid formation and its interaction with beta-amyloid.J Biol Chem 292,11485-11498(2017). 24.Ostner,G.et al.High throughput testing of drug library substances and monoclonal antibodies for capacity to reduce formation of cystatin C dimers to identify candidates for treatment of hereditary cystatin C amyloid angiopathy.Scandinavian Journal of Clinical and Laboratory Investigation 71,676-682(2011). 25.Chen,J.,Armstrong,A.H.,Koehler,A.N.&Hecht,M.H.Small molecule microarrays enable the discovery of compounds that bind the Alzheimer's Abeta peptide and reduce its cytotoxicity.J Am Chem Soc 132,17015-17022 2010). 26.Nilsson,M. et al.Prevention of domain swapping inhibits dimerization and amyloid fibril formation of cystatin C:use of engineered disulfide bridges,antibodies,and carboxymethylpapain to stabilize the monomeric form of cystatin C.J Biol Chem 279(2004). 27.Ostner,G.et al.Stabilization,Characterization,and Selective Removal of Cystatin C Amyloid Oligomers.Journal of Biological Chemistry 288,16438-16450(2013). 28.Pollak,J.,Szymanska,A.,Lindstrom, V.& Grubb,A.Production of Cystatin C Wild Type and Stabilized Mutants.EJIFCC 20,166-170(2010). 29.Bjarnadottir,M.et al.Intracellular accumulation of the amyloidogenic L68Q variant of human cystatin C in NIH / 3T3 cells.Mol Pathol 51,317-326(1998). 30.Benedikz,E.et al.Cellular processing of the amyloidogenic cystatin C variant of hereditary cerebral hemorrhage with amyloidosis,Icelandic type.Amyloid 6,172-182 (1999). 31.Thorsteinsson,L.et al.On the role of monocytes / macrophages in the pathogenesis of central nervous system lesions in hereditary cystatin C amyloid angiopathy.J Neurol Sci 108,121-128 (1992). 32.Wei,L.et al.Instability of the amyloidogenic cystatin C variant of hereditary cerebral hemorrhage with amyloidosis,Icelandic type.J Biol Chem 273,11806-11814 (1998). 33.Merz,G.S.et al.Human cystatin C forms an inactive dimer during intracellular trafficking in transfected CHO cells.J Cell Physiol 173,423-432(1997). 34.Xu,Y.,Lindemann,P.,Vega-Ramos,J.,Zhang,J.G.&Villadangos,J.A.Developmental regulation of synthesis and dimerization of the amyloidogenic protease inhibitor cystatin C in the hematopoietic system.J Biol Chem 289,9730-9740(2014). 35.Benedikz,E.,Blondal,H.&Gudmundsson,G. Skin deposits in hereditary cystatin C amyloidosis.Virchows Arch A Pathol Anat Histopathol 417,325-331(1990). 36.Unnithan, A.S., Choi,H.J.,Titler,A.M.,Posimo,J.M.&Leak,R.K.Rescue from a two hit,high-throughput model of neurodegeneration with N-acetyl cysteine.Neurochem Int 61,356-368 (2012). 37.Yerbury,J.J.,Stewart,E.M.,Wyatt,A.R.&Wilson,M.R.Quality control of protein folding in extracellular space.EMBO Rep 6,1131-1136(2005). 38.Lai,A.Y.&McLaurin,J.Clearance of amyloid-beta peptides by microglia and macrophages: the issue of what,when and where.Future Neurol 7,165-176 (2012). 39.Go, Y.M. & Jones, D.P. Redox compartmentalization in eukaryotic cells. Biochim Biophys Acta 1780, 1273-1290 (2008). 40.Hwang,C., Sinskey,A.J.&Lodish,H.F.Oxidized redox state of glutathione in the endoplasmic reticulum.Science 257,1496-1502(1992). 41.Lautwein,A.et al.Inflammatory stimuli recruit cathepsin activity to late endosomal compartments in human dendritic cells.Eur J Immunol 32,3348-3357(2002). 42.DeLeve,L.D.&Kaplowitz, N. Importance and regulation of hepatic glutathione. Semin Liver Dis 10,251-266 (1990). 43.Hahn, R.,Wendel,A.&Flohe,L.The fate of extracellular glutathione in the rat.Biochim Biophys Acta 539,324-337(1978). 44.Isaacs,J.T.& Binkley,F.Cyclic AMP-dependent control of the rat hepatic glutathione disulfide-sulfhydryl ratio.Biochim Biophys Acta 498,29-38(1977). 45.Kemp,M.,Go,Y.M.&Jones,D.P.Nonequilibrium thermodynamics of thiol / disulfide redox systems:a perspective on redox systems biology. Free radical biology&medicine 44,921-937(2008). 46.Lauterburg,B.H.,Smith,C.V.,Hughes, H. &Mitchell,J.R. Biliary excretion of glutathione and glutathione disulfide in the rat. Regulation and response to oxidative stress.J Clin Invest 73,124-133(1984). 47.Meister,A.&Tate,S.S.Glutathione and related gamma-glutamyl compounds: biosynthesis and utilization.Annu Rev Biochem 45,559-604(1976). 48.Meister,A.& Anderson,M.E.Glutathione.Annu Rev Biochem 52,711-760(1983). 49.Uhlig,S.&Wendel, A. The physiological consequences of glutathione variations.Life Sci 51,1083-1094(1992). 50.Ballatori,N.et al.Glutathione dysregulation and the etiology and progression of human diseases.Biol Chem 390,191-214(2009). 51.Samiec,P.S.et al.Glutathione in human plasma:decline in association with aging,age-related macular degeneration, and diabetes.Free radical biology&medicine 24,699-704(1998). 52.Atkuri,K.R., Mantovani,J.J.,Herzenberg,L.A.& Herzenberg,L.A.N-Acetylcysteine--a safe antidote for cysteine / glutathione deficiency.Curr Opin Pharmacol 7,355-359(2007). 53.Aitio,M.L.N-acetylcysteine -- passe-partout or much ado about nothing? Br J Clin Pharmacol 61,5-15(2006). 54.Bavarsad Shahripour,R.,Harrigan,M.R.&Alexandrov,A.V.N-acetylcysteine(NAC)in neurological disorders:mechanisms of action and therapeutic opportunities.Brain Behav 4,108-122(2014). 55.Andrews, N.P., Prasad, A. & Quyyumi, A.A. N-acetylcysteine improves coronary and peripheral vascular function. J Am Coll Cardiol 37, 117-123 (2001). 56. Adair, JC, Knoefel, JE & Morgan, N. Controlled trial of N-acetylcysteine for patients with probable Alzheimer's disease. Neurology 57, 1515-1517 (2001). 57. Giustarini, D., Milzani, A., Dalle-Donne, I., Tsikas, D. & Rossi, RN-Acetylcysteine ethyl ester (NACET): A novel lipophilic cell-permeable cysteine derivative with an unusual pharmacokinetic feature and remarkable antioxidant potential. Biochemical pharmacology 84, 1522-1533 (2012). 58.Cohen, GBet al.The selective downregulation of class I major histocompatibility complex proteins by HIV-1 protects HIV-infected cells from NK cells.Immunity 10,661-671(1999). 59. Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat Methods 9,676-682(2012).
[0091] While certain preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. It will be apparent to those skilled in the art that various changes and modifications can be made without departing from the scope of the invention, as set forth in the appended claims.
Claims
1. 1. A composition for the treatment of Alzheimer's disease in a human subject in need thereof, said composition comprising an effective amount of a functional derivative of N-acetylcysteine as an active ingredient in a pharmaceutically acceptable carrier, said composition being administered to a patient, said administration being effective in reducing said amyloid protein aggregates, thereby alleviating the symptoms of Alzheimer's disease, and said NAC derivative being selected from NAC-amide and NAC-ethyl ester.
2. 10. The method of claim 1, further comprising monitoring the patient's amyloid deposition level.
3. The composition according to any one of claims 1 to 2, further comprising the administration of an anti-inflammatory agent.
4. 4. The composition of claim 3, wherein the anti-inflammatory agent is selected from the group consisting of one or more of corticosteroids, aspirin, celecoxib, diclofenac, diflunisal, etodolac, ibuprofen, indomethacin, ketoprofen, ketorolac, nabumetone, naproxen, oxaprozin, piroxicam, salsalate, sulindac, tolmetin, interleukin (IL)-1 receptor antagonists, IL-4, IL-6, IL-10, IL-11, IL-13, cytokine receptors for IL-1, tumor necrosis factor-α, IL-18, and derivatives and biosimilars thereof.
5. The composition of any one of claims 1 to 4, further comprising the administration of an ionophore.
6. The composition of any one of claims 1 to 5, further comprising administration of one or more of glutathione, siRNA, monensin, papain, cathepsin B, and falcipain.