Method and materials for activating the internal ribosome entry site in exon 5 of the DMD gene
The use of a DMD exon 5 IRES-activated oligomer construct delivered via AAV, in conjunction with glucocorticoids, effectively treats muscular dystrophies by producing a functional dystrophin protein, overcoming the limitations of current therapies for exon duplications and improving muscle function.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-07-26
- Publication Date
- 2026-03-17
AI Technical Summary
Current treatments for muscular dystrophies, particularly Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), are limited, especially for mutations involving exon duplications in the DMD gene, which affect a significant portion of patients, and there is a need for more effective therapeutic options beyond exon skipping and glucocorticoids.
A method involving the use of a DMD exon 5 Internal Ribosome Entry Site (IRES)-activated oligomer construct, delivered via recombinant adeno-associated virus (AAV), to initiate cap-independent translation and produce a functional N-terminal cleavage isoform of dystrophin, combined with glucocorticoids to enhance therapeutic efficacy.
This approach inhibits dystrophy progression and improves muscle function, including strength and walking stability, by generating a functional dystrophin protein even in the presence of exon duplications, addressing the limitations of existing treatments.
Smart Images

Figure 0007832150000003 
Figure 0007832150000004 
Figure 0007832150000005
Abstract
Description
[Technical Field]
[0001] This application claims the benefit as of the filing date of U.S. Provisional Patent Application No. 62 / 035,395, filed on 9 August 2014, which is incorporated herein by reference in its entirety.
[0002] Statement of government interests This invention was made with government support granted by the National Institute of Neurological Infectious Diseases and Stroke under authorization number R01 NS043264. The government has certain rights in this invention.
[0003] Inclusion by referencing the sequence list This application includes, as a separate part of the present disclosure, a computer-readable sequence listing (filename: 48873 PCT_SeqListing.txt, 20,279 bytes - ASCII text file, created August 6, 2015), which is incorporated herein by reference in its entirety. (Technical field)
[0004] This invention relates to the delivery of oligomers for treating patients with 5' mutations in the DMD gene other than DMD exon 2 duplication. The invention provides a method and materials for activating an internal ribosome entry site in exon 5 of the DMD gene to yield a functional cleavage isoform of dystrophin. The method and materials may be used for the treatment of muscular dystrophy resulting from 5' mutations in the DMD gene, such as Duchenne muscular dystrophy or Becker muscular dystrophy. [Background technology]
[0005] Muscular dystrophy (MD) is a group of genetic disorders characterized by progressive weakening and degeneration of the skeletal muscles that control movement. Some forms of MD develop in infancy or childhood, but others may not appear until middle age or later. These disorders differ in the distribution and extent of muscle fragility (some forms of MD also affect the cardiac muscle), age of onset, rate of progression, and pattern of inheritance.
[0006] One form of muscular dystrophy (MD) is Duchenne muscular dystrophy (DMD). This is the most common severe form of muscular dystrophy in children, affecting 1 in 5,000 newborn boys. DMD is caused by mutations in the DMD gene, leading to the absence of the dystrophin protein (427 kDa) in skeletal and cardiac muscle, as well as in the gastrointestinal tract and retina. Dystrophin not only protects the sarcolemma from eccentric contraction but also anchors many signaling proteins in close proximity to the sarcolemma. Many clinical cases of DMD are associated with deletion mutations in the DMD gene. Despite multi-system studies following the identification of the DMD gene, treatment options are limited. Corticosteroids are clearly beneficial, but even with increased years of walking and physical activity, their benefits are offset by long-term side effects. The original controlled, randomized, double-blind study, reported over 20 years ago, demonstrated the benefit of using prednisone [Mendell et al., N.Engl.J.Med., 320:1592-1597 (1989)]. A subsequent report showed equivalent efficacy using deflazacort, a sodium-sparing steroid [Biggar et al., J.Pediatr., 138:45-50 (2001)]. More recent studies have also demonstrated the efficacy of exon skipping in increasing walking distance in 6MWT. To date, published clinical studies have reported benefits only for mutations where the reading frame is restored by skipping exon 51 [Cirak et al., Lancet, 378:595-605 (2011) and Goemans et al., New Engl.J.Med. 364:1513-1522 (2011)]. Only double-blind, randomized clinical trials have demonstrated promising results using the phosphorodiamidate morpholino oligomer (PMO) eteplirsene [Mendell et al., Annals Neurology, 74(5):637-647 (2013)]. In all of these exon skipping trials, a common outcome was a plateau in walking ability after initial moderate improvement.Another paper on exon skipping is Greer et al., Molecular Therapy-Nucleic Acids, 3:3155 (2014).
[0007] See also U.S. Patent Application Publication No. 2012 / 0077860, published March 29, 2012; No. 2013 / 0072541, published March 21, 2013; and No. 2013 / 0045538, published February 21, 2013.
[0008] In contrast to deletion mutations, DMD exon duplications account for approximately 5% of disease-causing mutations in unbiased samples of dystrophinopathy patients [Dent et al., Am.J.Med.Genet., 134(3):295-298 (2005)], but the number of duplications is higher in some mutation catalogs [including those published by the United Dystrophinopathy Project in Flanigan et al., Hum.Mutat., 30(12):1657-1666 (2009), where it accounted for 11%].
[0009] Mutations within the DMD gene result in either a more severe form of DMD or a milder form of Becker muscular dystrophy (BMD). The phenotype generally depends on whether the mutation results in the complete absence of the protein product dystrophin (in DMD) or preserves a read frame that allows for the translation of a partially functional dystrophin protein (in BMD) [Monaco, Trends in Biochemical Sciences, 14:412-415 (1989)]. We previously identified specific BMD founder alleles (c.9T>G, p.Trp3X) that do not follow this read frame rule [Flanigan et al., Neuromuscular Disorders:NMD, 19:743-748 (2009) and Flanigan et al., Human Mutation, 30:1657-1666 (2009)]. Although this nonsense mutation is predicted not to result in protein translation, muscle biopsy revealed a significant amount (approximately 21%) of minimally reduced dystrophin expression, and the clinical phenotype was one of the very mild dystrophin disorders [Flanigan et al., Neuromuscular Disorders:NMD, 19:743-748 (2009)]. Small cell and in vitro translation studies demonstrated that translation is initiated from AUG in exon 6 in p.Trp3X patients, suggesting alternative translation initiation as a mechanism of phenotypic recovery [Gurvich et al., Human Mutation, 30:633-640 (2009)]. Noting that the majority of cleavage mutations reported in the 5' exon were actually associated with MBD rather than DMD, we propose that altered translation initiation may be a general mechanism for phenotypic rescue of 5' mutations in this gene, and this prediction was later supported by the following reports: [Witting and Vissing, Neuromuscular Disorders:NMD, 23:25-28 (2013) and Flanigan et al., Neuromuscular Disorders:NMD, 23:192 (2013)].The canonical actin-binding domain 1 (ABD1) has previously been proposed to be essential for protein function [Gimona et al., FEBS Letters, 513:98-106 (2002)].
[0010] Translation initiation is generally understood to occur via cap-dependent initiation. Internal ribosome entry sites (IRESs) are RNA regulatory sequences that influence cap-independent translation initiation in eukaryotic cells and are activated when cap-dependent translation is impaired (e.g., during cellular stress). Ribosomes are directly recruited to these IRESs on mRNA and can then continue scanning in the 5'-3' direction for alternative start codons. They were first described in viruses, with encephalomyocarditis virus (EMCV) IRES being the earliest to be characterized. To date, approximately 85 cellular IRESs have been described, primarily located within the 5'UTR region. For example, the 5'UTR of utrophin A, an autosomal homolog of dystrophin, contains IRESs that are particularly active in muscle regeneration and are induceable by glucocorticoid exposure (a cornerstone of therapy for DMD) [Miura et al., J. Biol. Chem., 280:32997-33005 (2005) and Miura et al., PloS One, 3:e2309 (2008)]. However, other eukaryotic IRESs have been described within coding sequences, some involved in the regulation of pathology. These include IRESs within the APC gene associated with mild familial adenomatous polyposis, in which patients with certain 5' mutations still produce a partially functional protein through the use of downstream start codons.
[0011] Adeno-associated virus (AAV) is a replication-deficient parvovirus whose single-stranded DNA genome is approximately 4.7 kb long, including a 145-nucleotide inverse end sequence (ITR). Multiple serotypes of AAV exist. The nucleotide sequences of the AAV serotype genomes are known. For example, the complete genome of AAV-1 is provided under GenBank accession number NC_002077, and the complete genome of AAV-2 is provided under GenBank accession number NC_001401 and by Srivastava et al. The complete genome of AAV-3 is available in al., J. Virol., 45:555-564 (1983), the complete genome of AAV-4 is available in GenBank accession number NC_1829, the complete genome of AAV-5 is available in GenBank accession number AF085716, the complete genome of AAV-6 is available in GenBank accession number NC_001862, at least portions of the genomes of AAV-7 and AAV-8 are available in GenBank accession numbers AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 for AAV-8), and the genome of AAV-9 is available in Gao et al. The AAV-10 genome is provided in al., J. Virol., 78:6381-6388 (2004), the AAV-11 genome is provided in Mol. Ther., 13(1):67-76 (2006), and the AAV-11 genome is provided in Virology, 330(2):375-383 (2004). The sequence of the AAVrh.74 genome is provided herein. Cis action sequences that direct viral DNA replication (rep), capsid formation / packaging, and host cell chromosome integration are contained within the AAV ITR. Three AAV promoters (called p5, p19, and p40 relative to their relative map locations) drive the expression of two AAV internal open read frames encoding the rep and cap genes.Differential splicing of a single AAV intron (at nucleotides 2107 and 2227) ligates two rep promoters (p5 and p19), resulting in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. These rep proteins possess multienzymatic properties and are ultimately involved in viral genome replication. The cap gene is expressed from the p40 promoter and encodes three capsid proteins: VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are involved in the production of the three related capsid proteins. A single-consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992). AAV possesses unique characteristics that make it attractive, for example, as a vector for delivering foreign DNA to cells in gene therapy. AAV infection of cells in culture is non-cellular, and natural infection in humans and other animals is silent and asymptomatic. Furthermore, AAV infects many mammalian cells, enabling the potential to target many different tissues in vivo. Additionally, AAV can transduce slowly dividing and non-dividing cells and persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal factor). The AAV proviral genome is infectious as cloned DNA within a plasmid, enabling the construction of recombinant genomes. Furthermore, since the signals directing AAV replication, genomic capsid formation, and integration are contained within the ITR of the AAV genome, some or all of the approximately 4.3 kb of internal genome (rep-cap, encoding replication and structural capsid proteins) may be replaced with foreign DNA. The rep and cap proteins can be supplied trans. Another important characteristic of AAV is that it is an extremely stable and robust virus. AAV readily tolerates the conditions used to inactivate adenoviruses (560-65°C for several hours), reducing the importance of refrigerated storage of AAV. AAV may also be freeze-dried. Finally, AAV-infected cells are not resistant to co-infection. The need for treatments for muscular dystrophy, including DMD and BMD, still exists in this field. [Prior art documents] [Patent Documents]
[0012] [Patent Document 1] U.S. Patent Application Publication No. 2012 / 0077860 [Patent Document 2] U.S. Patent Application Publication No. 2013 / 0072541 [Patent Document 3] U.S. Patent Application Publication No. 2013 / 0045538 [Non-patent literature]
[0013]
Non-licensed literature 1
Non-licensed Document 4
Non-licensed Document 5
Non-licensed Document 6
Non-licensed Document 7
Non-licensed literature 9
Non-licensed literature 10
Non-licensed Document 11
Non-licensed Document 12
Non - Patent Document 13
Non - Patent Document 14
Non - Patent Document 15
Non - Patent Document 16
Non - Patent Document 17
Non - Patent Document 18
Non - Patent Document 19
[0015] This disclosure relates to a method for improving Duchenne muscular dystrophy or Becker muscular dystrophy in patients having a 5' mutation in the DMD gene, comprising the step of administering a DMD exon 5 IRES-activated oligomer construct to the patient, wherein the patient does not have a DMD exon 2 duplication.
[0016] In some embodiments of the method, the DMD exon 5 IRES-activated oligomer construct is the following portion of exon 2 of the DMD gene, 5'TCAAAAGAAAACATTCGCAAAATGGGTA 3'(Sequence ID 1), 5'GCACAATTTTCTAAGGTAAGAAT 3'(Sequence ID 2), 5'TAGATGAAAGAGAAGATGTTCAAAAGAAAAC 3' (Sequence ID 3), or The target is one of the 5'TAGATGAAAGAGAAGATGTTC 3'(SEQ ID NO: 4).
[0017] In some embodiments of the method, the DMD exon 5 IRES activated oligomer construct is a U7snRNA polynucleotide construct within the genome of recombinant adeno-associated virus. In some of these embodiments, the genome of recombinant adeno-associated virus lacks adeno-associated virus rep and cap DNA. In some of these embodiments, the viral genome is a self-complementary genome. In some of these embodiments, the recombinant adeno-associated virus (AAV) is recombinant AAV1 virus, recombinant AAV6 virus, recombinant AAV9 virus, or recombinant AAV rh74 virus. In some embodiments, the U7snRNA polynucleotide construct comprises U7-B antisense polynucleotide TACCCATTTTGCGAATGTTTTCTTTTGA (SEQ ID NO: 5), U7-C antisense polynucleotide ATTCTTACCTTAGAAAATTGTGC (SEQ ID NO: 6), U7-AL antisense polynucleotide GTTTTCTTTTGAAGATCTTCTCTTTCATCTA (SEQ ID NO: 7), or U7-AS antisense polynucleotide GAAGATCTTCTCTTTCATCTA (SEQ ID NO: 8).
[0018] In some embodiments of the method, the DMD exon 5 IRES activated oligomer construct is an antisense oligomer. In some embodiments, the antisense oligomer is an exon 2 targeted antisense oligomer, a B antisense oligomer UACCCAUUUUGCGAAUGUUUUCUUUUGA (SEQ ID NO: 9), a C antisense oligomer AUUCUUACCUUAGAAAAUUGUGC (SEQ ID NO: 10), an AL antisense oligomer GUUUUCUUUUGAACAUCUUCUCUUUCAUCUA (SEQ ID NO: 11), or an AS antisense oligomer GAACAUCUUCUCUU This is UCAUCUA (SEQ ID NO: 12). In some of these embodiments, the exon 2-targeted antisense oligomer is a phosphorodiamidate morpholino oligomer (PMO), a transcellular peptide-coupled PMO (PPMO), a PMO-intrinsed peptide (PIP), a tricyclo-DNA (tcDNA), or a 2'O-methyl-phosphorothioate modification.
[0019] In some embodiments of the method, the progression of dystrophy is inhibited in the patient.
[0020] In some embodiments of the method, muscle function is improved in the patient. This improvement in muscle function may be an improvement in muscle strength or an improvement in standing and walking stability.
[0021] In some embodiments, the proposed method further includes administering glucocorticoids to the patient.
[0022] This disclosure envisions recombinant adeno-associated virus (AAV) comprising a DMD exon 5 IRES activated oligomer construct, the DMD exon 5 IRES activated oligomer construct being a U7snRNA polynucleotide construct comprising the U7-B antisense sequence TACCCATTTTGCGAATGTTTTCTTTTGA (SEQ ID NO: 5), the U7-C antisense sequence ATTCTTACCTTAGAAAATTGTGC (SEQ ID NO: 6), the U7-AL antisense sequence GTTTTCTTTTGAAGATCTTCTCTTTCATCTA (SEQ ID NO: 7), or the U7-AS antisense sequence GAAGATCTTCTCTTTCATCTA (SEQ ID NO: 8). In some embodiments, the recombinant AAV genome lacks AAV rep and cap DNA. In some embodiments, the recombinant AAV genome is a self-complementary genome. In some embodiments, the recombinant adeno-associated virus is recombinant AAV1 virus, recombinant AAV6 virus, recombinant AAV9 virus, or recombinant AAV rh74 virus. In some embodiments, the self-complementary genome includes the DMD exon 5 IRES-activated U7snRNA polynucleotide construct U7_ACCA (Figure 15A shows the genome insert 3'~5', but Figure (Figure 15B shows the inverse complement of the sequence in Figure 15A).
[0023] This disclosure envisions DMD exon 5 IRES-activated oligomer constructs, which are exon 2-targeted antisense oligomers, B antisense oligomer UACCCAUUUUGCGAAUGUUUUCUUUUGA (SEQ ID NO: 9), C antisense oligomer AUUCUUACCUUAGAAAAUUGUGC (SEQ ID NO: 10), AL antisense oligomer GUUUUCUUUUGAACAUCUUCUCUUUCAUCUA (SEQ ID NO: 11), or AS antisense oligomer GAACAUCUUCUCUUUCAUCUA (SEQ ID NO: 12). In embodiments, the exon 2-targeted antisense oligomer is a phosphorodiamidate morpholino oligomer (PPO), a transcellular peptide-coupled PMO (PPMO), a PMO-internalized peptide (PIP), contains tricyclo-DNA (tcDNA), or contains a 2'O-methyl-phosphorothioate modification. Some embodiments of this disclosure provide, for example, the following: (Item 1) A method for improving Duchenne muscular dystrophy or Becker muscular dystrophy in a patient having a 5' mutation in the DMD gene, comprising the step of administering a DMD exon 5 IRES-activated oligomer construct to the patient, wherein the patient does not have a DMD exon 2 duplication. (Item 2) The method according to item 1, wherein the DMD exon 5 IRES activated oligomer construct is a U7snRNA polynucleotide construct within the genome of recombinant adeno-associated virus. (Item 3) The method according to item 1, wherein the DMD exon 5 IRES activated oligomer construct is an antisense oligomer. (Item 4) The method according to item 1, 2, or 3, wherein the progression of dystrophy is inhibited within the patient. (Item 5) The method according to item 1, 2, or 3, wherein muscle function is improved in the patient. (Item 6) The method described in item 5, wherein the improvement in muscle function is an improvement in muscle strength. (Item 7) The method according to item 5, wherein the improvement in muscle function is an improvement in standing and walking stability. (Item 8) The method according to item 2, wherein the genome of the recombinant adeno-associated virus is deleting adeno-associated virus rep and cap DNA. (Item 9) The method according to item 2, wherein the viral genome is a self-complementary genome. (Item 10) The method according to item 2, wherein the recombinant adeno-associated virus (AAV) is recombinant AAV1 virus, recombinant AAV6 virus, recombinant AAV9 virus, or recombinant AAV rh74 virus. (Item 11) The method according to item 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, further comprising administering a glucocorticoid to the patient. (Item 12) The DMD exon 5 IRES activated oligomer construct comprises the following portion of exon 2 of the DMD gene, 5'TCAAAAGAAAACATTCACAAAATGGGTA 3'(Sequence ID 1), 5'GCACAATTTTCTAAGGTAAGAAT 3'(Sequence ID 2), 5'TAGATGAAAGAGAAGATGTTCAAAAGAAAAC 3' (Sequence ID 3), or The method according to item 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11, targeting one of the 5'TAGATGAAAGAGAAGATGTTC 3' (SEQ ID NO: 4). (Item 13) The aforementioned U7snRNA polynucleotide construct U7-B antisense polynucleotide TACCCATTTTGCGAATGTTTTCTTTTGA (SEQ ID NO: 5) U7-C antisense polynucleotide ATTCTTACCTTAGAAAATTGTGC (SEQ ID NO: 6) U7-AL antisense polynucleotide GTTTTCTTTTGAAGATCTTCTCTTTCATCTA (SEQ ID NO: 7), or The method described in item 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11, comprising U7-AS antisense polynucleotide GAAGATCTTCTCTTTCATCTA (SEQ ID NO: 8). (Item 14) The aforementioned antisense oligomer Exon 2-targeted antisense oligomers, B Antisense oligomer UACCCAUUUUGCGAAUGUUUUCUUUUGA (Sequence ID 9), C antisense oligomer AUUCUUACCUUAGAAAAUUGUGC (Sequence ID 10), AL antisense oligomer GUUUUCUUUUGAACAUCUUCUCUUUCAUCUA (Sequence ID 11), or The method described in item 3, 4, 5, 6, 7, 8, 9, 10, or 11, wherein the AS antisense oligomer GAACAUCUUCUCUUUCAUCUA (Sequence ID 12). (Item 15) Recombinant adeno-associated virus (AAV) comprising a DMD exon 5 IRES activated oligomer construct, wherein the DMD exon 5 IRES activated oligomer construct is U7-B antisense polynucleotide TACCCATTTTGCGAATGTTTTCTTTTGA (SEQ ID NO: 5) U7-C antisense polynucleotide ATTCTTACCTTAGAAAATTGTGC (SEQ ID NO: 6) U7-AL antisense polynucleotide GTTTTCTTTTGAAGATCTTCTCTTTCATCTA (SEQ ID NO: 7), or Recombinant adeno-associated virus containing a U7snRNA polynucleotide construct including the U7-AS antisense polynucleotide GAAGATCTTCTCTTTCATCTA (SEQ ID NO: 8). (Item 16) The recombinant AAV described in item 15, wherein the genome of the recombinant AAV is deleting AAV rep and cap DNA. (Item 17) The recombinant AAV described in item 15 or 16, wherein the recombinant AAV genome is a self-complementary genome. (Item 18) The recombinant AAV described in item 15, 16, or 17, wherein the recombinant adeno-associated virus is recombinant AAV1 virus, recombinant AAV6 virus, recombinant AAV9 virus, or recombinant AAV rh74 virus. (Item 19) The aforementioned DMD exon 5 IRES activated oligomer construct is Exon 2-targeted antisense oligomers, B Antisense oligomer UACCCAUUUUGCGAAUGUUUUCUUUUGA (Sequence ID 9), C antisense oligomer AUUCUUACCUUAGAAAAUUGUGC (Sequence ID 10), AL antisense oligomer GUUUUCUUUUGAACAUCUUCUCUUUCAUCUA (Sequence ID 11), or The AS antisense oligomer GAACAUCUUCUCUUUCAUCUA (Sequence ID 12) is a DMD exon 5 IRES activated oligomer construct. (Item 20) Recombinant adeno-associated virus having a self-complementary genome containing the DMD exon 5 IRES-active U7 snRNA polynucleotide construct U7_ACCA, wherein the self-complementary genome is the genome shown in Figure 15. (Item 21) Recombinant adeno-associated virus (AAV) as described in item 20, wherein the recombinant adeno-associated virus is recombinant AAV1 virus, recombinant AAV6 virus, recombinant AAV9 virus, or recombinant AAVrh74 virus. (Item 22) The method according to item 14, wherein the exon 2-targeted antisense oligomer is a phosphorodiamidate morpholino oligomer (PPO), a transcellular peptide-coupled PMO (PPMO), a PMO-internalized peptide (PIP), contains tricyclo-DNA (tcDNA), or contains a 2'O-methyl-phosphorothioate modification. (Item 23) The DMD exon 5 IRES-activated oligomer construct according to item 19, wherein the exon 2-targeted antisense oligomer is a phosphorodiamidate morpholino oligomer (PPO), a transcellular peptide-coupled PMO (PPMO), a PMO-intrinsed peptide (PIP), contains tricyclo-DNA (tcDNA), or contains a 2'O-methyl-phosphorothioate modification. [Brief explanation of the drawing]
[0024] [Figure 1A] Human biopsy specimens confirm translation from exon 6. (a) Immunoblotting of muscle from asymptomatic individuals with exon 2 deletion (DEL2) resulting in frameshift and premature stop codon (p.Tyr11PhefsX7) demonstrates minimally reduced dystrophin expression. Antibodies: NCL-DYS1 (bar domain), NCL-DYS2 (C-terminus). [Figure 1B] Human biopsy specimens confirm translation from exon 6. (b) Mass spectrometry analysis of dystrophin peptides from muscle biopsies of individuals with deletion exon 2 did not identify the peptide encoded before M124 (within exon 6), but peptides encoded within exons 2, 3, and 4 were readily identified in control muscle (control). Dystrophin reference sequence UniProt acceptance number P11532. Sequence IDs 27-29, respectively. [Figure 1C] Human biopsy specimens confirm translation from exon 6. (c) Immunoblot analysis of muscle dystrophin expression from BMD patients with a cleavage frameshift (FS) mutation (c.40_41del) in exon 2, from normal controls (WT), and from DMD patients with exon 2 duplication (DUP2). Reduced size and amount of dystrophin protein in the presence of an early stop codon induced by the frameshift mutation can be detected using a C-terminal antibody (PA1-21011, Thermo, Inc.; red), but not using an antibody (Manex1A, green) detected against the epitope encoded in exon 1. In contrast, dystrophin is absent overall in Dup2 patients. [Figure 1D] Human biopsy specimens confirm translation from exon 6. (d) Using ribosome profiling data, the translation efficiency (TE) metric was calculated for each of the 1000 most abundant transcripts (by mRNA mass) from patient FS (c.40_41del) and normal control muscle. The TE value for each gene was calculated by dividing the normalized number of ribosome footprint sequence reads by the number of RNA-Seq reads mapped within the coding (CDS) sequence. Rank transcript amounts for the top 1000 genes were calculated from the total number of mapped reads per transcript. Subgroups of genes classified as "sarcomeric" by gene ontology annotation are colored red, and the location of DMD genes is circled. [Figure 1E] Human biopsy specimens confirm translation from exon 6. (e) RNA-Seq read depth from total muscle RNA mapped to the 5' region of the DMD gene (hg19, chrX:32,737,599~33,487,390). Read depth for Dp427m exons 1~7 was cleaved at 40 reads per nucleotide, and exon read depths ranged from 67~91 (FS, c.40_41del) and 58~89 (normal) reads per nucleotide. [Figure 1F] Human biopsy specimens confirm translation from exon 6. (f) Ribosome footprint mapped to the 5' region (nt.1~1500) of the Dp427m (NM_004006.2) transcription. The locations of the exon 1 Dp427m start codon and c.40_41del mutation are shown along with a short ORF (p.Glu14Argfs*17) as the first CDS segment (green) isolated from the rest of the CDS (green) beginning with the exon 6 alternative AUG (green) start codon. Asterisks indicate the locations of nine out-of-frame AUG codons within exons 1-5. [Figure 2A]Dystrophin exon 5 can induce cap-independent translation. (a) Translation of the downstream (FLuc) cistron in an in vitro transcription / translation system (rabbit reticulocyte lysate [RRL], left), and subsequent induction of translocation to C2C12 cells (right) in a disisstronic dual luciferase reporter. Results are expressed as the firefly:sea lichen luciferase (F / L) ratio and normalized to an empty vector (set as 1). [Figure 2B] Dystrophin exon 5 can induce cap-independent translation. (b) Formaldehyde electrophoresis of the T7 transcript used in the RRL assay confirms RNA integrity. [Figure 2C] Dystrophin exon 5 can induce cap-independent translation. (c) Mapping of exon 5 IRES: Dysistronic mapping constructs used to map cap-independent translation activity (left). In each example, numbering is based on the Dp427m cDNA sequence, with the full-length construct pRdEF+4+369 (exons 1-6) starting at position +4, excluding the native AUG start codon. Exon 6 is conserved, and AUG2 (M124) and AUG3 (M128) were cloned in frame using a downstream FLuc reporter. FLuc luminescence (cap-dependent) is expressed as the percentage of post-translational RLuc luminescence (cap-dependent) of the dysistronic construct in C2C12 cells (right). All results were normalized to exon 6-only vectors, and the FLuc:RLuc ratio was set to a value of 1. Statistical analysis using the Kruskal-Wallis test compared the results of each construct against exon 6 alone, resulting in expression levels generally equivalent to the empty vector (p>.99). Significantly increased translation of downstream reporters was demonstrated for exons 1–6 (p<.0001), exons 2–6 (p=0.0175), exons 3–6 (p=0.0009), exons 3*–6 (p=0.0078), exons 4–6 (p=0.0078), or exons 5–6 (p=0.0019). In contrast, deletion of exon 5 (whole or partial) did not result in a significant difference in any of the three compared to exon 6 alone. [Figure 2D]Dystrophin exon 5 may induce cap-independent translation. (d) RT-PCR products amplified from RNA derived from transfected C2C12 cells using primers positioned as arrows on the scheme in panel (c) show no evidence of altered splicing. [Figure 2E] Dystrophin exon 5 may induce cap-independent translation. (e) Northern blot analysis of C2C12 transfected cells using a P32 radiolabeled probe targeting FLuc cistrons shows no evidence of RNA helix disruption to explain the increased signal in the presence of dystrophin exons 1-5. (A nonspecific band of approximately 3kb was detected under all transfected conditions, including empty vectors, and is therefore not associated with the increase in FLuc or EMCV signaling compared to empty vectors.) [Figure 2F] Dystrophin exon 5 can induce cap-independent translation. (f) IRES activity is suppressed not by the deletion of exon 2, but by the presence of a duplicated exon 2. Error bars represent standard deviation. [Figure 3A] Out-of-frame exon skipping stimulates IRES activity in patient-derived cell lines. (a) Schematic representation of human DMD exons 1-10 readout frames (blue) and 5'UTR (red). The blue numbers above each exon indicate the cDNA position, and the red numbers below each exon indicate the amino acid position. Canonical actin-binding domain 1 is represented together with the predicted CH and ABS domains (via ScanProsite). [Figure 3B] Out-of-frame exon skipping stimulates IRES activity in patient-derived cell lines. (b) Schematic representation of exon 2 (SEQ ID NO: 30). Selected target sequences that affect either a splice acceptor (SA), splice donor (SD), or exon splice enhancer (ESE) sequence (predicted using Human Splicing Finder or ESE Finder 3.0) are shown below. [Figure 3C]Out-of-frame exon skipping stimulates IRES activity in patient-derived cell lines. (c) Two copies each of U7-C and U7-AL were cloned into the same AAV plasmid because they were the most efficient at skipping exon 2 (see Figure 10). The resulting construct is referred to as U7-ACCA. RT-PCR results after infection of either wt or duplicated exon 2 FibroMyoD (FM) cells with U7-ACCA vector (1E11 vg) or H2A antisense oligonucleotide (AON H2A). These are derived from patient fibroblast cell lines stably infected with hTERT and tet-inducible MyoD lentivirus, and treatment with doxycycline results in transdifferentiation to myogenic lineage, along with subsequent dystrophin mRNA expression. [Figure 3D] Out-of-frame exon skipping stimulates IRES activity in patient-derived cell lines. (d) Immunoblotting performed 14 days after infection of FM cells with U7-ACCA shows expression of a smaller N-terminal dystrophin protein (arrow). Antibody: C-terminal dystrophin (PA1-21011, Thermo, Inc.). A smaller band of approximately 390 kDa is detected in all lanes, but it is nonspecific (as seen in untreated specimens) and does not correspond to the IRES-driven isoform. (Image assembled for clarity; complete image included as Figure 11). [Figure 4A]Intramuscular delivery of U7-ACCA results in significant N-cleaved dystrophin expression in Dup2 mice, restoring the localization of dystrophin-related proteins. (a, b) RT-PCR results performed 4 weeks after TA intramuscular injection of 1e11vg U7-ACCA showed almost complete skipping of both copies of exon 2 in both (a) Dup2 and (b) control BI6 mice (PDN: methylprednisolone 1 mg / kg / day, intraperitoneal). In Dup2 animals (a), quantification revealed that Dup2 transcription accounted for 5.1% of the total, compared to 8.6% in wild-type and 86.3% in Del2 transcription. In wild-type BI6 animals (b), wild-type transcription accounted for 14.2% and Del2 transcription accounted for 85.8%. [Figure 4B] Intramuscular delivery of U7-ACCA results in significant N-cleaved dystrophin expression in Dup2 mice, restoring the localization of dystrophin-related proteins. (a, b) RT-PCR results performed 4 weeks after TA intramuscular injection of 1e11vg U7-ACCA showed almost complete skipping of both copies of exon 2 in both (a) Dup2 and (b) control BI6 mice (PDN: methylprednisolone 1 mg / kg / day, intraperitoneal). In Dup2 animals (a), quantification revealed that Dup2 transcription accounted for 5.1% of the total, compared to 8.6% in wild-type and 86.3% in Del2 transcription. In wild-type BI6 animals (b), wild-type transcription accounted for 14.2% and Del2 transcription accounted for 85.8%. [Figure 4C] Intramuscular delivery of U7-ACCA results in significant N-cleavage dystrophin expression in Dup2 mice, restoring the localization of dystrophin-related proteins. (c) RNA-Seq read depth (mm9, chrX.80, 150,000~81,050,000) using total RNA libraries of the tibialis anterior muscle from Dup2 U7-ACCA-treated (top) and Dup2-untreated (bottom) mice, mapped to the 5' region of the mouse Dmd gene. [Figure 4D]Intramuscular delivery of U7-ACCA results in significant N-cleaved dystrophin expression in Dup2 mice, restoring the localization of dystrophin-related proteins. (d) Immunoblotting performed one month after infection shows significant expression of the N-cleaved isoform (asterisk) in both Dup2 mice and control BI6 mice. The protein induced in U7-ACCA injected BI6 males was the same size as that expressed in Dup2-treated animals, confirming the size difference between this protein and the full-length isoform. (C-terminal antibody: PA1-21011, Thermo, Inc.). Coomassie staining of the same specimens does not demonstrate a difference in migration behavior. [Figure 4E] Intramuscular delivery of U7-ACCA results in significant N-cleaved dystrophin expression in Dup2 mice, restoring the localization of dystrophin-related proteins. (e) Immunofluorescence staining of dystrophin (C-terminal antibody: PA1-21011, Thermo, Inc), β-dystroglycan (β-DG, MANDAG2), and neuronal nitric oxide synthase (nNOS, sc-648, Santa Cruz). [Figure 4F] Intramuscular delivery of U7-ACCA results in significant N-cleaved dystrophin expression in Dup2 mice, restoring the localization of dystrophin-related proteins. (f) Evans Blue (EBD) protective assay in Dup2 mice one month after intramuscular injection of 1e11vg shows fascial stabilization. Evans Blue uptake (red) is observed only in fibers without positive dystrophin expression (green, C-terminal antibody: PA1-21011, Thermo, Inc). (Dup2 mice used in these panels, n=5). [Figure 5A] Glucorticoid activation of dystrophin IRES. (a) Dual luciferase assay performed on lysates from C2C12 cells transfected with a pRDEF vector carrying the exon 5-6 IRES construct. Methylprednisolone (PDN) increases IRES activity in a dose-dependent manner. Error bars represent standard deviation. [Figure 5B]Glucorticoid activation of dystrophin IRES. (b) Dup2 FM cells treated with both U7-ACCA and PDN (6.4 μM) show increased dystrophin expression. Image intensity of the wild-type lane was reduced to allow band identification. MHC = myosin heavy chain (loading control). [Figure 5C] Glucorticoid activation of dystrophin IRES. (c) A representative immunoblot demonstrates increased dystrophin expression in Dup2 mice injected with 1e11vg U7-ACCA after treatment with PDN (1 mg / kg / day). %Dys: Dystrophin:α-actin intensity ratio normalized to control muscle. [Figure 5D] Glucorticoid activation of dystrophin IRES. (d) Quantification of dystrophin / α-actinin signaling in U7-ACCA-treated muscle in the presence or absence of PDN. Five animals treated with U7-ACCA in the tibialis anterior muscle were injected with either PBS or PDN (1 mg / kg / day). Immunoblotting was performed dually on each muscle, and the signals for both dystrophin and α-actin from the resulting 5 lanes were quantified using ImageJ. Significantly more dystrophin was present in the muscle from PDN-treated animals (P=0.0159, two-sided Mann-Whitney test, error bars represent standard deviation). [Figure 5E] Glucorticoid activation of dystrophin IRES. (e) Representative Western blots demonstrate increased utrophin levels in Dup2 compared to BI6 mice. Treatment with PDN (1 mg / kg / day) does not increase utrophin expression. [Figure 5F]Glucorticoid activation of dystrophin IRES. (f) Quantification of utrophin / α-actinin signaling in treated muscle in the presence or absence of U7-ACCA and PDN. Five animals treated with U7-ACCA in the tibialis anterior muscle were injected with either PBS or PDN (1 mg / kg / day). Signals for both utrophin and α-actin from the resulting five lanes were quantified using ImageJ. No significant differences were detected among the four (Kruskal-Wallis, error bars represent standard deviation). [Figure 6A] IRES-driven isoform expression improves fascial integrity and protects the Dup2 muscle from contraction-induced damage. The Dup2 tibialis anterior muscle was treated with intramuscular injection of 5e11vg U7-ACCA alone or with methylprednisolone (PDN: 1 mg / kg / day, intraperitoneal) and analyzed 4 weeks post-injection. (a) Central nucleation (73.0 ± 1.6% of muscle fibers) in untreated Dup2 animals was significantly reduced by treatment with U7-ACCA alone (65.2 ± 2.2%, ***p=0.0002). No significant difference was observed between Dup2 and Dup2 + PDN. (a, b, c) Animals tested for each condition n=4, bilateral Kruskal-Wallis, error bars as standard deviation, when 2000 fiber counts per mouse were applied. [Figure 6B]IRES-driven isoform expression improves fascial integrity and protects the Dup2 muscle from contraction-induced damage. The Dup2 tibialis anterior muscle was treated with intramuscular injection of 5e11vg U7-ACCA alone or with methylprednisolone (PDN: 1 mg / kg / day, intraperitoneal) and analyzed 4 weeks post-injection. (b) The percentage of Evans blue stain (EBD) positive fibers in untreated Dup2 muscle (14.7 ± 6.6%, one outlier is shown as a point) was reduced by treatment with U7-ACCA alone (2.8 ± 1.8%, *p=0.0310) or in combination with prednisone (0.65 ± 0.5%, ***p=0.0005). No significant difference was observed between Dup2 and Dup2 + PDN. EBD positive fibers were quantified as a percentage of the total 5,000 fibers counted per animal. (a, b, c) For each condition, n=4 animals were tested, and 2000 fiber counts were applied per mouse (bilateral Kruskal-Wallis, error bars as standard deviation). [Figure 6C]IRES-driven isoform expression improves fascial integrity and protects the Dup2 muscle from contraction-induced damage. The Dup2 tibialis anterior muscle was treated by intramuscular injection of 5e11vg U7-ACCA alone or with methylprednisolone (PDN: 1 mg / kg / day, intraperitoneal) and analyzed 4 weeks post-injection. (c) Normalized maximum hindlimb (Norm max HL) grip strength (force of 2.22 ± 0.26 kg per 1 kg of animal mass, or kgf / kg) in untreated Dup2 mice was significantly lower than in BI6 (3.36 ± 0.37 kgf / kg, ***p<0.0001). After treatment with either U7-ACCA alone (3.35±0.32 kgf / kg, ***p<0.0001) or in combination with prednisone (3.17±0.28 kgf / kg, ***p=0.0002), strength significantly improved, restoring strength to a level not significantly different from that seen in BI6. No significant difference was observed between Dup2 and Dup2+PDN. (a, b, c) Animals tested for each condition n=4, 2000 fiber counts applied per mouse, bilateral Kruskal-Wallis, error bars as standard deviation). [Figure 6D] IRES-driven isoform expression improves fascial integrity and protects the Dup2 muscle from contraction-induced damage. The Dup2 tibialis anterior muscle was treated with intramuscular injection of 5e11vg U7-ACCA alone or with methylprednisolone (PDN: 1 mg / kg / day, intraperitoneal) and analyzed 4 weeks post-injection. (d) Normalized specific force after tetany spasm (170.9 ± 14.3 mN / mm2) in untreated Dup2 animals was significantly lower than BI6 (274.0 ± 12.1 mN / mm2, **p=0.0061). Following treatment with U7-ACCA alone (236.04 ± 19.4 mN / mm2, *p=0.0350) or prednisone (251.2 ± 10.4 mN / mm2, **p=0.0025), force significantly increased, restoring specific force to levels not significantly different from those seen in BI6. No significant difference was observed between Dup2 and Dup2+PDN. (d, e) Muscle samples from at least 3 animals, n=5, error bars as standard error of mean). [Figure 6E] IRES-driven isoform expression improves fascial integrity and protects the Dup2 muscle from contraction-induced damage. The Dup2 tibialis anterior muscle was treated with intramuscular injection of 5e11vg U7-ACCA alone or with methylprednisolone (PDN: 1 mg / kg / day, intraperitoneal) and analyzed 4 weeks post-injection. (e) Treatment significantly protects the Dup2 muscle from force loss following repetitive eccentric contractions. Two-way ANOVA demonstrated a significant improvement in the decay curve compared to untreated Dup2 (*p<0.05 and ***p<0.001), and Bonferroni post-hoc analysis demonstrated that neither treatment combination showed a significant difference compared to the control BI6 in force retention following contractions #3-#10 (*p<0.05 and ***p<0.001). No significant difference was observed between Dup2 and Dup2+PDN (p<0.99). Two-way ANOVA demonstrates a significant difference between Dup2+U7 and Dup2+U7+PDN (*p<0.05). (d, e) Muscle from at least 3 animals n=5, error bars as standard error of mean). [Figure 7A] Mutagenesis analysis in asymptomatic boys with exon 2 deletion. (a) H&E-stained muscle portions from patients with exon 2 deletion (DEL2) reveal the absence of dystrophin features. [Figure 7B] Mutation analysis in asymptomatic boys with deleted exon 2. (b) Histochemical staining of muscle tissue (exons 10-12) from the same patient using NCL-DYS3 antibody. Manex1A staining (exon 1 specific) was not performed at that time, and the tissue is no longer available. [Figure 7C] Mutation analysis in an asymptomatic boy with a deleted exon 2. (c) CGH profiles of the genomic context (upper panel) and the entire X chromosome (lower panel) of the 12.983 bp deletion including exon 2 (shown in the overlay track at the bottom of the upper panel). [Figure 7D]Mutation analysis in asymptomatic boys with deletion exon 2. (d) Alignment of continuous junctions with the reference genome sequence (NCBI hg18) (SEQ ID NOs. 31-33, respectively). Proximal and distal reference sequences are colored differently, and junctions are black. Vertical bars between sequences represent sequence homology. 5 bp microhomology (CTGTG, shown in boxes) is found at the junction between the distal and proximal sequences, characteristic of non-homologous terminal junctions. [Figure 7E] Mutation analysis in asymptomatic boys with deletion exon 2. (e) Genome sequence of a delimiter with a microhomology sequence underlined in blue (SEQ ID NO: 34). [Figure 7F] Mutation analysis in asymptomatic boys with deleted exon 2. (f, g) RT-PCR and sequencing results confirm the deletion of exon 2 at the RNA level. [Figure 7G] Mutation analysis in asymptomatic boys with deleted exon 2. (f, g) RT-PCR and sequencing results confirm the deletion of exon 2 at the RNA level. [Figure 8A]Immunofluorescence analysis of muscle from frameshift (c.40_41del) patients. (a) Immunostaining using dystrophin antibody (Abcam 15277, C-terminus) shows dystrophin in the sarcolemma membrane in both control and patient muscle biopsies, but Manex1A staining is absent in patient specimens, confirming the deletion of expression of the epitope encoded by exon 1. (b) Ribosome profiling of DMD muscle-isoform transcription. Normalized mean reads for RNA-Seq reads (read depth per 1nt. vs. mean read depth on NM_004006) are plotted every 25 nucleotides using the normalized mean read depth averaged per nucleotide calculated from a 500 bp. sliding window. Reads from patient FS (c.40_41del) are shown in red, reads from control muscle are shown in gray, and regression lines are shown for each mean group. (c) Linear regression lines were calculated for the CDS region only, as shown in (b), except that RPF-Seq reads were used. (d) The exon structure of the NM_004006 transcription is plotted on the same scale as the x-axis from (b) and (c). The arrows indicate the location of the alternative translation start site in exon 6. Since this experiment used total RNA, the RNA-Seq reads mapping to NM_004006 are derived from both early and mature transcriptions. The 5'-3' gradient of the RNA-Seq reads shown in (b) is consistent with the original estimate of a relative excess of 5' exons in the early RNA from human skeletal muscle, attributable to the travel time (approximately 16 hours) for RNA polymerase to copy over approximately 2.2 Mb of chr. X region containing 79 DMD exons of muscle isoform. Regression analysis of the RPF-Seq reads shows no 5'-3' gradient, inferring that ribosomes are evenly distributed over the length of mature transcription. [Figure 8B]Immunofluorescence analysis of muscle from frameshift (c.40_41del) patients. (a) Immunostaining using dystrophin antibody (Abcam 15277, C-terminus) shows dystrophin in the sarcolemma membrane in both control and patient muscle biopsies, but Manex1A staining is absent in patient specimens, confirming the deletion of expression of the epitope encoded by exon 1. (b) Ribosome profiling of DMD muscle-isoform transcription. Normalized mean reads for RNA-Seq reads (read depth per 1nt. vs. mean read depth on NM_004006) are plotted every 25 nucleotides using the normalized mean read depth averaged per nucleotide calculated from a 500 bp. sliding window. Reads from patient FS (c.40_41del) are shown in red, reads from control muscle are shown in gray, and regression lines are shown for each mean group. (c) Linear regression lines were calculated for the CDS region only, as shown in (b), except that RPF-Seq reads were used. (d) The exon structure of the NM_004006 transcription is plotted on the same scale as the x-axis from (b) and (c). The arrows indicate the location of the alternative translation start site in exon 6. Since this experiment used total RNA, the RNA-Seq reads mapping to NM_004006 are derived from both early and mature transcriptions. The 5'-3' gradient of the RNA-Seq reads shown in (b) is consistent with the original estimate of a relative excess of 5' exons in the early RNA from human skeletal muscle, attributable to the travel time (approximately 16 hours) for RNA polymerase to copy over approximately 2.2 Mb of chr. X region containing 79 DMD exons of muscle isoform. Regression analysis of the RPF-Seq reads shows no 5'-3' gradient, inferring that ribosomes are evenly distributed over the length of mature transcription. [Figure 8C]Immunofluorescence analysis of muscle from frameshift (c.40_41del) patients. (a) Immunostaining using dystrophin antibody (Abcam 15277, C-terminus) shows dystrophin in the sarcolemma membrane in both control and patient muscle biopsies, but Manex1A staining is absent in patient specimens, confirming the deletion of expression of the epitope encoded by exon 1. (b) Ribosome profiling of DMD muscle-isoform transcription. Normalized mean reads for RNA-Seq reads (read depth per 1nt. vs. mean read depth on NM_004006) are plotted every 25 nucleotides using the normalized mean read depth averaged per nucleotide calculated from a 500 bp. sliding window. Reads from patient FS (c.40_41del) are shown in red, reads from control muscle are shown in gray, and regression lines are shown for each mean group. (c) Linear regression lines were calculated for the CDS region only, as shown in (b), except that RPF-Seq reads were used. (d) The exon structure of the NM_004006 transcription is plotted on the same scale as the x-axis from (b) and (c). The arrows indicate the location of the alternative translation start site in exon 6. Since this experiment used total RNA, the RNA-Seq reads mapping to NM_004006 are derived from both early and mature transcriptions. The 5'-3' gradient of the RNA-Seq reads shown in (b) is consistent with the original estimate of a relative excess of 5' exons in the early RNA from human skeletal muscle, attributable to the travel time (approximately 16 hours) for RNA polymerase to copy over approximately 2.2 Mb of chr. X region containing 79 DMD exons of muscle isoform. Regression analysis of the RPF-Seq reads shows no 5'-3' gradient, inferring that ribosomes are evenly distributed over the length of mature transcription. [Figure 8D]Immunofluorescence analysis of muscle from frameshift (c.40_41del) patients. (a) Immunostaining using dystrophin antibody (Abcam 15277, C-terminus) shows dystrophin in the sarcolemma membrane in both control and patient muscle biopsies, but Manex1A staining is absent in patient specimens, confirming the deletion of expression of the epitope encoded by exon 1. (b) Ribosome profiling of DMD muscle-isoform transcription. Normalized mean reads for RNA-Seq reads (read depth per 1nt. vs. mean read depth on NM_004006) are plotted every 25 nucleotides using the normalized mean read depth averaged per nucleotide calculated from a 500 bp. sliding window. Reads from patient FS (c.40_41del) are shown in red, reads from control muscle are shown in gray, and regression lines are shown for each mean group. (c) Linear regression lines were calculated for the CDS region only, as shown in (b), except that RPF-Seq reads were used. (d) The exon structure of the NM_004006 transcription is plotted on the same scale as the x-axis from (b) and (c). The arrows indicate the location of the alternative translation start site in exon 6. Since this experiment used total RNA, the RNA-Seq reads mapping to NM_004006 are derived from both early and mature transcriptions. The 5'-3' gradient of the RNA-Seq reads shown in (b) is consistent with the original estimate of a relative excess of 5' exons in the early RNA from human skeletal muscle, attributable to the travel time (approximately 16 hours) for RNA polymerase to copy over approximately 2.2 Mb of chr. X region containing 79 DMD exons of muscle isoform. Regression analysis of the RPF-Seq reads shows no 5'-3' gradient, inferring that ribosomes are evenly distributed over the length of mature transcription. [Figure 9A] Dystrophin IRES is not ubiquitously active. (a) A dual luciferase assay demonstrated activation not in HEK209K cells but in two myogenic cell lines (C2C12 and the commercial human skeletal myoblast cell line [hSKMM]), suggesting preferential activation in myogenic cell lines. [Figure 9B]Dystrophin IRES is eccentrically inactive. (b) Northern blots from transfected C2C12 and 293k using probes against firefly luciferase demonstrate the presence of transcription and the aforementioned nonspecific band (Figure 2). In particular, this band is present under all conditions, including after transfection with the exon 6 single construct, and is therefore unrelated to the fold change observed in the exon 5-containing construct. [Figure 9C] Dystrophin IRES is not ubiquitously active. (c) RT-PCR products amplified from RNA derived from transfected 293k cells do not show evidence of altered splicing. Error bars represent standard deviation. [Figure 10A] Optimization of AAV-mediated U7 exon skipping. (a) Four different target sequences (AS, AL, B, or C) were cloned into AAV under the control of U7. Infection with either these AAVs alone (a) or in combination (b) was performed in both control and duplicated exon 2 patient-derived FibroMyoD cells. Three days after AAV infection, RT-PCR results demonstrated that U7-C could induce exon skipping in both control and duplicated exon 2 patient FibroMyoD cells, while U7-AL could only induce skipping in patient cell lines. Two copies constructed U7-C, and U7-AL was cloned into the same AAV plasmid (U7-ACCA). (c) Transfusion of cultured MyoD-transformed fibroblasts and primary myoblasts from Dup2 patients using an AON (AONH2A) targeting an internal exon 2 sequence yielded similar results, but with lower efficiency than U7-mediated skipping. [Figure 10B]Optimization of AAV-mediated U7 exon skipping. (a) Four different target sequences (AS, AL, B, or C) were cloned into AAV under the control of U7. Infection with either these AAVs alone (a) or in combination (b) was performed in both control and duplicated exon 2 patient-derived FibroMyoD cells. Three days after AAV infection, RT-PCR results demonstrated that U7-C could induce exon skipping in both control and duplicated exon 2 patient FibroMyoD cells, while U7-AL could only induce skipping in patient cell lines. Two copies constructed U7-C, and U7-AL was cloned into the same AAV plasmid (U7-ACCA). (c) Transfusion of cultured MyoD-transformed fibroblasts and primary myoblasts from Dup2 patients using an AON (AONH2A) targeting an internal exon 2 sequence yielded similar results, but with lower efficiency than U7-mediated skipping. [Figure 11A] Western blots from patient-derived cell lines. (a) Original Western blots from Figure 3d viewed at two different imaging intensities: low (upper panel) and high (lower panel). Figure 3d was constructed using lane 1 from the upper panel and lanes 2 and 4 from the lower panel. FM = control cell line from FibroMyoD, FM Dup2 = cell line from a FibroMyoD patient from an exon 2 duplication patient, FS = protein from muscle biopsy of c.40_41del. [Figure 11B] Western blots from patient-derived cell lines. (b) Coomassie staining of the same specimens as shown in Figure 4c does not demonstrate a significant difference in migration behavior. [Figure 12A] Glucocorticoids increase IRES activity, but they cannot force its activation. (a) The results of a dual luciferase assay after translocation of three constructs at 293k treated with glucocorticoids demonstrate that IRES activity cannot be induced by this compound. Error bars represent the standard deviation. [Figure 12B]Glucocorticoids increase IRES activity but cannot force its activation. (b) Genomic qPCR of AAV copy numbers confirms that the increase in dystrophin levels detected by Western blotting in PDN-treated mice is not attributable to the increased number of AAV vectors in PDN-treated animals. N=4 animals per group. Error bars represent standard deviation. [Figure 13-1] This is the rh74 genome sequence (SEQ ID NO: 14), where nucleotides 210-2147 are the Rep78 open read frame, 882-208 are the Rep52 open read frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are the splice donor sites, 2094-2097 are the splice acceptor sites, 2121-2124 are the splice acceptor sites, 174-181 are the predicted p5 promoter+1, 145-151 are the p5 TATA box, 758-761 are the predicted p19 promoter+1, 732-738 are the p19 TATA box, and 1711-1716 are the p40 This is a TATA box, where 2098-4314 is the VP1 Cap gene open read frame, 2509-2511 is the VP2 start, 2707-2709 is the VP3 start, and 4328-4333 is the poly(A) signal. [Figure 13-2]This is the rh74 genome sequence (SEQ ID NO: 14), where nucleotides 210-2147 are the Rep78 open read frame, 882-208 are the Rep52 open read frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are the splice donor sites, 2094-2097 are the splice acceptor sites, 2121-2124 are the splice acceptor sites, 174-181 are the predicted p5 promoter+1, 145-151 are the p5 TATA box, 758-761 are the predicted p19 promoter+1, 732-738 are the p19 TATA box, and 1711-1716 are the p40 This is a TATA box, where 2098-4314 is the VP1 Cap gene open read frame, 2509-2511 is the VP2 start, 2707-2709 is the VP3 start, and 4328-4333 is the poly(A) signal. [Figure 13-3] This is the rh74 genome sequence (SEQ ID NO: 14), where nucleotides 210-2147 are the Rep78 open read frame, 882-208 are the Rep52 open read frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are the splice donor sites, 2094-2097 are the splice acceptor sites, 2121-2124 are the splice acceptor sites, 174-181 are the predicted p5 promoter+1, 145-151 are the p5 TATA box, 758-761 are the predicted p19 promoter+1, 732-738 are the p19 TATA box, and 1711-1716 are the p40 This is a TATA box, where 2098-4314 is the VP1 Cap gene open read frame, 2509-2511 is the VP2 start, 2707-2709 is the VP3 start, and 4328-4333 is the poly(A) signal. [Figure 13-4]This is the rh74 genome sequence (SEQ ID NO: 14), where nucleotides 210-2147 are the Rep78 open read frame, 882-208 are the Rep52 open read frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are the splice donor sites, 2094-2097 are the splice acceptor sites, 2121-2124 are the splice acceptor sites, 174-181 are the predicted p5 promoter+1, 145-151 are the p5 TATA box, 758-761 are the predicted p19 promoter+1, 732-738 are the p19 TATA box, and 1711-1716 are the p40 This is a TATA box, where 2098-4314 is the VP1 Cap gene open read frame, 2509-2511 is the VP2 start, 2707-2709 is the VP3 start, and 4328-4333 is the poly(A) signal. [Figure 13-5] This is the rh74 genome sequence (SEQ ID NO: 14), where nucleotides 210-2147 are the Rep78 open read frame, 882-208 are the Rep52 open read frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are the splice donor sites, 2094-2097 are the splice acceptor sites, 2121-2124 are the splice acceptor sites, 174-181 are the predicted p5 promoter+1, 145-151 are the p5 TATA box, 758-761 are the predicted p19 promoter+1, 732-738 are the p19 TATA box, and 1711-1716 are the p40 This is a TATA box, where 2098-4314 is the VP1 Cap gene open read frame, 2509-2511 is the VP2 start, 2707-2709 is the VP3 start, and 4328-4333 is the poly(A) signal. [Figure 13-6]This is the rh74 genome sequence (SEQ ID NO: 14), where nucleotides 210-2147 are the Rep78 open read frame, 882-208 are the Rep52 open read frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are the splice donor sites, 2094-2097 are the splice acceptor sites, 2121-2124 are the splice acceptor sites, 174-181 are the predicted p5 promoter+1, 145-151 are the p5 TATA box, 758-761 are the predicted p19 promoter+1, 732-738 are the p19 TATA box, and 1711-1716 are the p40 This is a TATA box, where 2098-4314 is the VP1 Cap gene open read frame, 2509-2511 is the VP2 start, 2707-2709 is the VP3 start, and 4328-4333 is the poly(A) signal. [Figure 13-7] This is the rh74 genome sequence (SEQ ID NO: 14), where nucleotides 210-2147 are the Rep78 open read frame, 882-208 are the Rep52 open read frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are the splice donor sites, 2094-2097 are the splice acceptor sites, 2121-2124 are the splice acceptor sites, 174-181 are the predicted p5 promoter+1, 145-151 are the p5 TATA box, 758-761 are the predicted p19 promoter+1, 732-738 are the p19 TATA box, and 1711-1716 are the p40 This is a TATA box, where 2098-4314 is the VP1 Cap gene open read frame, 2509-2511 is the VP2 start, 2707-2709 is the VP3 start, and 4328-4333 is the poly(A) signal. [Figure 13-8]This is the rh74 genome sequence (SEQ ID NO: 14), where nucleotides 210-2147 are the Rep78 open read frame, 882-208 are the Rep52 open read frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are the splice donor sites, 2094-2097 are the splice acceptor sites, 2121-2124 are the splice acceptor sites, 174-181 are the predicted p5 promoter+1, 145-151 are the p5 TATA box, 758-761 are the predicted p19 promoter+1, 732-738 are the p19 TATA box, and 1711-1716 are the p40 This is a TATA box, where 2098-4314 is the VP1 Cap gene open read frame, 2509-2511 is the VP2 start, 2707-2709 is the VP3 start, and 4328-4333 is the poly(A) signal. [Figure 13-9] This is the rh74 genome sequence (SEQ ID NO: 14), where nucleotides 210-2147 are the Rep78 open read frame, 882-208 are the Rep52 open read frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are the splice donor sites, 2094-2097 are the splice acceptor sites, 2121-2124 are the splice acceptor sites, 174-181 are the predicted p5 promoter+1, 145-151 are the p5 TATA box, 758-761 are the predicted p19 promoter+1, 732-738 are the p19 TATA box, and 1711-1716 are the p40 This is a TATA box, where 2098-4314 is the VP1 Cap gene open read frame, 2509-2511 is the VP2 start, 2707-2709 is the VP3 start, and 4328-4333 is the poly(A) signal. [Figure 13-10]This is the rh74 genome sequence (SEQ ID NO: 14), where nucleotides 210-2147 are the Rep78 open read frame, 882-208 are the Rep52 open read frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are the splice donor sites, 2094-2097 are the splice acceptor sites, 2121-2124 are the splice acceptor sites, 174-181 are the predicted p5 promoter+1, 145-151 are the p5 TATA box, 758-761 are the predicted p19 promoter+1, 732-738 are the p19 TATA box, and 1711-1716 are the p40 This is a TATA box, where 2098-4314 is the VP1 Cap gene open read frame, 2509-2511 is the VP2 start, 2707-2709 is the VP3 start, and 4328-4333 is the poly(A) signal. [Figure 13-11] This is the rh74 genome sequence (SEQ ID NO: 14), where nucleotides 210-2147 are the Rep78 open read frame, 882-208 are the Rep52 open read frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are the splice donor sites, 2094-2097 are the splice acceptor sites, 2121-2124 are the splice acceptor sites, 174-181 are the predicted p5 promoter+1, 145-151 are the p5 TATA box, 758-761 are the predicted p19 promoter+1, 732-738 are the p19 TATA box, and 1711-1716 are the p40 This is a TATA box, where 2098-4314 is the VP1 Cap gene open read frame, 2509-2511 is the VP2 start, 2707-2709 is the VP3 start, and 4328-4333 is the poly(A) signal. [Figure 14] A map of plasmids containing an AAV genome insert of an exon 2-targeted U7snRNA is shown. [Figure 15-1](a) shows the AAV genome insert (3'~5') of the plasmid in Figure 14 (sequence number 15 is the same sequence in the 5'~3' direction). Figure 15(b) shows the reverse complement of the sequence in Figure 15(a) (sequence number 26). U7 encodes U7snRNP, which shares some features with spliceosome snRNP. It is not involved in premRNA splicing but processes the 3' end of histone mRNA (Muller and Schumperli 1997, Dominski and Marzluff 1999). Nucleotides 1~113 of sequence number 15 correspond to the 3'ITR, and nucleotides 114~220 of sequence number 15 correspond to the 3' untranslated region (UTR) (reverse-oriented sequence). Nucleotides 221~251 of sequence number 15 correspond to the SmOPT (reverse-oriented sequence). SmOPT is a modification of the original Sm-binding site of U7 snRNA by a consensus sequence derived from spliceosome snRNA (Grimm et al. 1993, Stefanovic et al. 1995a). Nucleotides 252-262 of SEQ ID NO: 15 correspond to a loop (reverse orientation sequence). Nucleotides 263-295 correspond to U7-Along (reverse orientation sequence), an antisense sequence targeting the acceptor site of exon 2. Nucleotides 296-551 of SEQ ID NO: 15 correspond to U7 (reverse orientation sequence), nucleotides 558-664 of SEQ ID NO: 15 correspond to 3'UTR (reverse orientation sequence), nucleotides 665-695 of SEQ ID NO: 15 correspond to SmOPT (reverse orientation sequence), and nucleotides 696-706 of SEQ ID NO: 15 correspond to a loop (reverse orientation sequence). Nucleotides 707-731 of sequence number 15 correspond to U7-C (reverse orientation sequence), an antisense sequence that targets the donor site in exon 2.Nucleotides 732-987 of SEQ ID NO: 15 correspond to U7 (reverse orientation sequence), nucleotides 994-1100 of SEQ ID NO: 15 correspond to 3'UTR (reverse orientation sequence), nucleotides 1111-1131 of SEQ ID NO: 15 correspond to SmOPT (reverse orientation sequence), nucleotides 1132-1142 of SEQ ID NO: 15 correspond to loop (reverse orientation sequence), nucleotides 1143-1167 of SEQ ID NO: 15 correspond to U7-C (reverse orientation sequence), nucleotides 1168-1423 of SEQ ID NO: 15 correspond to U7 (reverse orientation sequence), Nucleotides 1430-1536 in sequence number 15 correspond to the 3'UTR (reverse orientation sequence), nucleotides 1537-1567 in sequence number 15 correspond to the SmOPT (reverse orientation sequence), nucleotides 1568-1578 in sequence number 15 correspond to the loop (reverse orientation sequence), nucleotides 1579-1611 in sequence number 15 correspond to the U7-Along (reverse orientation sequence), nucleotides 1612-1867 in sequence number 15 correspond to the U7 (reverse orientation sequence), and nucleotides 1920-2052 in sequence number 15 correspond to the ITR. [Figure 15-2](a) shows the AAV genome insert (3'~5') of the plasmid in Figure 14 (sequence number 15 is the same sequence in the 5'~3' direction). Figure 15(b) shows the reverse complement of the sequence in Figure 15(a) (sequence number 26). U7 encodes U7snRNP, which shares some features with spliceosome snRNP. It is not involved in premRNA splicing but processes the 3' end of histone mRNA (Muller and Schumperli 1997, Dominski and Marzluff 1999). Nucleotides 1~113 of sequence number 15 correspond to the 3'ITR, and nucleotides 114~220 of sequence number 15 correspond to the 3' untranslated region (UTR) (reverse-oriented sequence). Nucleotides 221~251 of sequence number 15 correspond to the SmOPT (reverse-oriented sequence). SmOPT is a modification of the original Sm-binding site of U7 snRNA by a consensus sequence derived from spliceosome snRNA (Grimm et al. 1993, Stefanovic et al. 1995a). Nucleotides 252-262 of SEQ ID NO: 15 correspond to a loop (reverse orientation sequence). Nucleotides 263-295 correspond to U7-Along (reverse orientation sequence), an antisense sequence targeting the acceptor site of exon 2. Nucleotides 296-551 of SEQ ID NO: 15 correspond to U7 (reverse orientation sequence), nucleotides 558-664 of SEQ ID NO: 15 correspond to 3'UTR (reverse orientation sequence), nucleotides 665-695 of SEQ ID NO: 15 correspond to SmOPT (reverse orientation sequence), and nucleotides 696-706 of SEQ ID NO: 15 correspond to a loop (reverse orientation sequence). Nucleotides 707-731 of sequence number 15 correspond to U7-C (reverse orientation sequence), an antisense sequence that targets the donor site in exon 2.Nucleotides 732-987 of SEQ ID NO: 15 correspond to U7 (reverse orientation sequence), nucleotides 994-1100 of SEQ ID NO: 15 correspond to 3'UTR (reverse orientation sequence), nucleotides 1111-1131 of SEQ ID NO: 15 correspond to SmOPT (reverse orientation sequence), nucleotides 1132-1142 of SEQ ID NO: 15 correspond to loop (reverse orientation sequence), nucleotides 1143-1167 of SEQ ID NO: 15 correspond to U7-C (reverse orientation sequence), nucleotides 1168-1423 of SEQ ID NO: 15 correspond to U7 (reverse orientation sequence), Nucleotides 1430-1536 in sequence number 15 correspond to the 3'UTR (reverse orientation sequence), nucleotides 1537-1567 in sequence number 15 correspond to the SmOPT (reverse orientation sequence), nucleotides 1568-1578 in sequence number 15 correspond to the loop (reverse orientation sequence), nucleotides 1579-1611 in sequence number 15 correspond to the U7-Along (reverse orientation sequence), nucleotides 1612-1867 in sequence number 15 correspond to the U7 (reverse orientation sequence), and nucleotides 1920-2052 in sequence number 15 correspond to the ITR. [Figure 15-3](a) shows the AAV genome insert (3'~5') of the plasmid in Figure 14 (sequence number 15 is the same sequence in the 5'~3' direction). Figure 15(b) shows the reverse complement of the sequence in Figure 15(a) (sequence number 26). U7 encodes U7snRNP, which shares some features with spliceosome snRNP. It is not involved in premRNA splicing but processes the 3' end of histone mRNA (Muller and Schumperli 1997, Dominski and Marzluff 1999). Nucleotides 1~113 of sequence number 15 correspond to the 3'ITR, and nucleotides 114~220 of sequence number 15 correspond to the 3' untranslated region (UTR) (reverse-oriented sequence). Nucleotides 221~251 of sequence number 15 correspond to the SmOPT (reverse-oriented sequence). SmOPT is a modification of the original Sm-binding site of U7 snRNA by a consensus sequence derived from spliceosome snRNA (Grimm et al. 1993, Stefanovic et al. 1995a). Nucleotides 252-262 of SEQ ID NO: 15 correspond to a loop (reverse orientation sequence). Nucleotides 263-295 correspond to U7-Along (reverse orientation sequence), an antisense sequence targeting the acceptor site of exon 2. Nucleotides 296-551 of SEQ ID NO: 15 correspond to U7 (reverse orientation sequence), nucleotides 558-664 of SEQ ID NO: 15 correspond to 3'UTR (reverse orientation sequence), nucleotides 665-695 of SEQ ID NO: 15 correspond to SmOPT (reverse orientation sequence), and nucleotides 696-706 of SEQ ID NO: 15 correspond to a loop (reverse orientation sequence). Nucleotides 707-731 of sequence number 15 correspond to U7-C (reverse orientation sequence), an antisense sequence that targets the donor site in exon 2.Nucleotides 732-987 of SEQ ID NO: 15 correspond to U7 (reverse orientation sequence), nucleotides 994-1100 of SEQ ID NO: 15 correspond to 3'UTR (reverse orientation sequence), nucleotides 1111-1131 of SEQ ID NO: 15 correspond to SmOPT (reverse orientation sequence), nucleotides 1132-1142 of SEQ ID NO: 15 correspond to loop (reverse orientation sequence), nucleotides 1143-1167 of SEQ ID NO: 15 correspond to U7-C (reverse orientation sequence), nucleotides 1168-1423 of SEQ ID NO: 15 correspond to U7 (reverse orientation sequence), Nucleotides 1430-1536 in sequence number 15 correspond to the 3'UTR (reverse orientation sequence), nucleotides 1537-1567 in sequence number 15 correspond to the SmOPT (reverse orientation sequence), nucleotides 1568-1578 in sequence number 15 correspond to the loop (reverse orientation sequence), nucleotides 1579-1611 in sequence number 15 correspond to the U7-Along (reverse orientation sequence), nucleotides 1612-1867 in sequence number 15 correspond to the U7 (reverse orientation sequence), and nucleotides 1920-2052 in sequence number 15 correspond to the ITR. [Figure 16] This shows an overview of the vectors used in the formation of the mdxdup2 (Dup2) mouse. [Figure 17A] (a) RT-PCR performed on five different Dup2 mouse muscles one month after tail vein infusion of AAV9.U7-ACCA (3.3E12vg / kg) is shown. As demonstrated by the presence of multiple transcriptions (labeled here as Dup2, wt, and Del2), U7-ACCA treatment can force skipping of one or both copies of exon 2 in all muscles tested. (TA: anterior tibia, Gas: gastrocnemius) [ka] : cardiac muscle, Tri: triceps muscle, dia: diaphragm). [Figure 17B] (b) Western blots performed on five different muscles one month after injection demonstrate the presence of dystrophin in all tested muscles. [Figure 17C](c) Immunostaining of the same specimen for dystrophin confirms the expression of dystrophin and its proper localization in the sarcolemma. [Figure 17D] (d) Assessment of grip strength in both the forelimbs and hindlimbs demonstrates complete correction of grip strength in Dup2 animals treated with AAV9.U7-ACCA. [Figure 17E] (e) Normalized specific force and total force following tetany contraction show improved muscle strength compared to untreated Dup2 animals. (f) Papillary muscle demonstrates improved length-dependent force generation in treated animals. [Figure 17F] (f) The papillary muscle demonstrates improved length-dependent force generation in therapeutic animals. [Figure 18A] (a) IM study design. An escalating dose of AAV9.U7snRNA-ACCA vector was delivered to the tibialis anterior muscle at 2 months, and the muscle was analyzed at 3 months by mRNA, protein, and electrophysiological studies. [Figure 18B] (b) Quantification of mRNA by RT-PCR following increased dose-level IM injection. Transcriptions included two copies (Dup2), one copy (WT), or none (Δ2) of exon 2. Expression of N-cleaved dystrophin following increased dose-level IM injection. [Figure 18C] (c) Protein expression by immunofluorescence or (d) immunoblotting demonstrates the dose-response. [Figure 18D] (c) Protein expression by immunofluorescence or (d) immunoblotting demonstrates the dose-response. [Figure 18E] (e) Quantitative immunoblotting suggests maximum protein expression in 3.1E11vg. [Figure 18F] 3.1 Improvement of absolute force (f) and specific force (g) deficiencies in response to eccentric contraction following IM injection into the tibialis anterior muscle. [Figure 18G] 3.1 Improvement of absolute force (f) and specific force (g) deficiencies in response to eccentric contraction following IM injection into the tibialis anterior muscle. [Figure 19A](a) Study IV design. A escalating dose of AAV9.U7snRNA-ACCA vector was delivered whole-body at 2 months, and muscle was analyzed at 3 months by mRNA, protein, and electrophysiological studies. [Figure 19B] (b) Quantification of mRNA by RT-PCR in IV injection at elevated dose levels. Transcriptions include two copies of exon 2 (Dup2), one copy (WT), or none (Δ2). [Figure 19C] (c) Quantification of dystrophin by immunoblotting following IV infusion. Expression follows a dose-response pattern, with expression in the triceps muscle delayed compared to expression in the myocardium and diaphragm. [Figure 19D] (d) Immunostaining of dystrophin from BI6 and Dup2. [Figure 19E] (e) Expression following IV infusion. A dose-response is observed, with significant dystrophin expression in the myocardium and diaphragm at higher doses. [Figure 20] Early infusion of AAV9.U7-ACCA prevents myopathology in Dup2 mice. Immunostaining for dystrophin demonstrates the generation and localization of N-terminally truncated dystrophin in the plasma membrane. No centronucleation was observed following hematoxylin and eosin staining. By 6 months of age, untreated Dup2 mice typically demonstrate that 60% of their fibers have centronucleation (data not shown). [Figure 21]Generation of alternative N-terminally cleaved dystrophin in human cell lines derived from patients carrying mutations within the first nine exons. RT-PCR results after exon 2 skipping using either the AAV1.U7-ACCA vector (1×10E11 vector genome) or H2A antisense oligonucleotide (AON H2A) in various patient cell lines carrying mutations within exons 1-4. This results in approximately 90% of transcriptionally deleted exon 2 (quantification not shown). FM = FibroMyoD cells derived from healthy human subjects. Immunoblotting performed 14 days after infusion of FibroMyoD cells with AAV1.U7-ACCA shows expression of N-terminally cleaved dystrophin protein. A smaller band of approximately 390 kDa is detected in all lanes but is nonspecific (as seen in untreated specimens) and does not correspond to the IRES-driven isoform. (Image assembled for clarity, wild-type counter modified to clearly show the band). [Figure 22A] Expression of N-cleaved dystrophin following treatment with PPMO antisense oligonucleotides. (a) Transfusion into C2C12 mouse myoblasts, and (b) Intramuscular injection of AL-PPMO into Dup2 mouse tibialis anterior muscle. RT-PCR results from treated cells or muscle demonstrate efficient exon 2 skipping. [Figure 22B] Expression of N-cleaved dystrophin following treatment with PPMO antisense oligonucleotides. (a) Transfusion into C2C12 mouse myoblasts, and (b) Intramuscular injection of AL-PPMO into Dup2 mouse tibialis anterior muscle. RT-PCR results from treated cells or muscle demonstrate efficient exon 2 skipping. [Figure 22C] Expression of N-cleaved dystrophin following treatment with PPMO antisense oligonucleotides. (c) Immunofluorescence of dystrophin shows plasma membrane expression following intramuscular injection of AL-PPMO antisense oligonucleotides. [Modes for carrying out the invention]
[0025] As described above, this disclosure envisions a method and product for preventing, slowing progression, and / or treating patients with one or more 5' mutations in the DMD gene, based on the activation of glucocorticoid-inducible IRES in exon 5 of the DMD gene. Activation of inducible IRES in exon 5 of the DMD gene generates a functional N-terminal cleavage dystrophin isoform.
[0026] As used herein, “5' mutation of the DMD gene” refers to a mutation within or affecting exons 1, 2, 3, or 4 of the DMD gene. In the method of the present invention, the treated patient does not have a DMD exon 2 duplication; however, “mutations affecting exons 1, 2, 3, or 4” as intended herein may be duplications other than the DMD exon 2 duplication.
[0027] In one embodiment, the method requires the use of a "DMD exon 5 IRES activated oligomer construct." The DMD exon 5 IRES activated oligomer construct used herein targets exon 2, inducing altered splicing, resulting in the exclusion of exon 2 from mature RNA, causing a frameshift in the DMD gene reading frame, and inducing the utilization of IRES within exon 5 for translation initiation.
[0028] In some embodiments, the DMD exon 5 IRES-activated oligomer construct targets one of the following segments of exon 2 of the DMD gene (shown from 5' to 3'). B:TCAAAAGAAAACATTCGCAAAATGGGTA(+17+44)(Sequence ID 1) C:GCACAATTTTCTAAGGTAAGAAT(+48-8)(Sequence ID 2) AL:TAGATGAAAGAGAAGATGTTCAAAAGAAAAC(-3+28)(Sequence ID 3) AS:TAGATGAAAGAGAAGATGTTC(-3+18)(Sequence ID 4)
[0029] In some embodiments, rAAV is used to deliver a U7 micronucleus RNA polynucleotide construct that is targeted to DMD exon 2 by an antisense polynucleotide. In some embodiments, the U7 micronucleus RNA is human U7 micronucleus RNA. In some embodiments, the polynucleotide construct is inserted into the genome of rAAV9, rAAV6, or rAAVrh74. In some embodiments, the U7 micronucleotide RNA construct includes, but is not limited to, exemplary targeted antisense polynucleotides, such as the “U7-AL antisense polynucleotide,” which is complementary to and targets the “AL” exon 2 sequence of the preceding paragraph. U7-B antisense polynucleotide: TACCCATTTTGCGAATGTTTTCTTTTGA (Sequence ID 5) U7-C antisense polynucleotide: ATTCTTACCTTAGAAAATTGTGC (SEQ ID NO: 6) U7-AL antisense polynucleotide:GTTTTCTTTTGAAGATCTTCTCTTTCATCTA (SEQ ID NO: 7) U7-AS antisense polynucleotide: GAAGATCTTCTCTTTCATCTA (SEQ ID NO: 8)
[0030] In some embodiments, the DMD exon 5 IRES-activated oligomer construct is an exon 2-targeted antisense oligomer. In some embodiments, the antisense oligomer is intended to be modified to limit their nuclease sensitivity compared to natural phosphodiester oligodeoxynucleotide polymers. Examples of intended modifications include, but are not limited to, phosphorodiamidate morpholino oligomers (PPO), transcellular peptide-coupled PMOs (PPMOs), PMO internalization peptides (RIPs) [(Betts et al., Sci. Rep., 5:8986 (2015)], tricyclo-DNA (tcDNA) [Goyenvalle et al., Nat. Med., 21:270-275 (2015)], and 2'O-methyl-phosphorothioate modifications. Examples of exon 2-targeted antisense oligomers, such as the DMD exon 5 IRES-activated oligomer constructs, include, but are not limited to, the following antisense oligomers (shown in 5'-3'). For example, the "B antisense oligomer" targets the "B" exon 2 target in paragraph
[0032] . B Antisense Oligomer: UACCCAUUUUGCGAAUGUUUUCUUUUGA (Sequence ID 9) C antisense oligomer: AUUCUUACCUUAGAAAAUUGUGC (SEQ ID NO: 10) AL antisense oligomer: GUUUUCUUUUGAACAUCUUCUCUUUCAUCUA (Sequence ID 11) AS antisense oligomer: GAACAUCUUCUCUUUCAUCUA (SEQ ID NO: 12) H2A(+12+41):CCAUUUUGUGAAUGUUUUCUUUUGAACAUC(Sequence ID 13)
[0031] In another embodiment, a method is provided for improving muscular dystrophy (such as DMD or BMD) in patients with a 5' mutation in the DMD gene. In some embodiments, the method comprises the step of administering rAAV to the patient, wherein the rAAV genome comprises a DMD exon 5 IRES activated oligomer construct. In some embodiments, the method comprises the step of administering a DMD exon 5 IRES activated oligomer construct that is an exon 2 targeted antisense oligomer. In some embodiments, the patient is also treated with a glucorticoid.
[0032] In yet another embodiment, the present invention provides a method for inhibiting the progression of dystrophic pathology associated with muscular dystrophy (such as DMD or BMD). In some embodiments, the method comprises the step of administering rAAV to a patient having a 5' mutation in the DMD gene, wherein the rAAV genome comprises a DMD exon 5 IRES activated oligomer construct. In some embodiments, the method comprises the step of administering a DMD exon 5 IRES activated oligomer construct that is an exon 2 targeted antisense oligomer. In some embodiments, the patient is also treated with a glucorticoid.
[0033] In yet another embodiment, a method is provided for improving muscle function in patients having a 5' mutation in the DMD gene. In some embodiments, the method comprises the step of administering rAAV to the patient, wherein the rAAV genome comprises a DMD exon 5 IRES activated oligomer construct. In some embodiments, the method comprises the step of administering a DMD exon 5 IRES activated oligomer construct that is an exon 2 targeted antisense oligomer. In some embodiments, the improvement in muscle function is an improvement in muscle strength. The improvement in muscle strength is determined by techniques known in the art, such as the maximal spontaneous isometric contraction test (MVICT). In some cases, the improvement in muscle function is an improvement in standing and walking stability. The improvement in stability strength is determined by techniques known in the art, such as the 6-minute walk test (6MWT) or timed stair climbing. In some embodiments, the patient is also treated with glucorticoids.
[0034] In another embodiment, the present invention provides a method for delivering a DMD exon 5 IRES activated oligomer construct to an animal (including, but not limited to, a human) having a 5' mutation in the DMD gene. In some embodiments, the method comprises the step of making the animal rAAV patient, the rAAV genome comprising the DMD exon 5 IRES activated oligomer construct. In some embodiments, the method comprises the step of administering the DMD exon 5 IRES activated oligomer construct, which is an exon 2 targeted antisense oligomer. In some embodiments, the animal is also treated with a glucorticoid.
[0035] The cell transduction efficiency of the methods of the present invention described herein may be at least about 60, about 65, about 70, about 75, about 80, about 85, about 90, or about 95%.
[0036] In some embodiments of the aforementioned methods of the present invention, the viral genome is a self-complementary genome. In some embodiments of the methods, the rAAV genome lacks AAV rep and cap DNA. In some embodiments of the methods, the rAAV is SC rAAV U7_ACCA, including the exemplary genome shown in Figure 15. In some embodiments, the rAAV is rAAV6. In some embodiments, the rAAV is rAAV9. In some embodiments, the rAAV is rAAV rh74 (Figure 13).
[0037] In yet another embodiment, the present invention provides a genome comprising an rAAV containing an AAV rAAV9 capsid and an exemplary DMD exon 5 IRES-activated U7 snRNA polynucleotide construct U7_ACCA. In some embodiments, the rAAV genome is deficient in AAV rep and cap DNA. In some embodiments, the rAAV comprises a self-complementary genome. In some embodiments of the method, the rAAV is SC rAAV U7_ACCA, comprising the exemplary genome shown in Figure 15. In some embodiments, the rAAV is rAAV6. In some embodiments, the rAAV is rAAV9. In some embodiments, the rAAV is rAAV rh74 (Figure 13).
[0038] The recombinant AAV genome of the present invention comprises one or more AAV ITRs adjacent to at least one DMD exon 5 IRES-activated U7 snRNA polynucleotide construct. Particularly intended are genomes having DMD exon 5 IRES-activated U7 snRNA polynucleotide constructs containing each of the target antisense sequences described in paragraph
[0033] , and genomes having DMD exon 5 IRES-activated U7 snRNA polynucleotide constructs containing each of two or more possible combinations of the target antisense sequences described in paragraph
[0033] . In some embodiments, including the exemplary embodiments, the U7 snRNA polynucleotide includes its own promoter. The AAV DNA within the rAAV genome may be from any AAV serotype from which the recombinant virus may originate, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, and AAV rh.74. As described in the background section above, the nucleotide sequences of various AAV serotype genomes are known in the field of this technology.In some embodiments of the present invention, promoter DNA is a muscle-specific regulatory element derived from the actin and myosin gene families, such as the myoD gene family [see Weintraub et al., Science, 251:761-766 (1991)], a muscle cell-specific enhancer binding factor MEF-2 [Cserjesi and Olson, Mol. Cell. Biol., 11:4854-4862 (1991)], a regulatory element derived from the human skeletal actin gene [Muscat et al., Mol. Cell. Biol., 7:4089-4099 (1987)], a cardiac actin gene, a muscle creatine kinase sequence element [Johnson et al.] Examples include, but are not limited to, the mouse creatine kinase enhancer (MCK) element, the desmin promoter, the regulatory element derived from the bone rapid spasm troponin C gene, the slow spasm cardiac troponin C gene, and the slow spasm troponin I gene: hypoxia-inducible nuclear factor [Semenza et al., Proc. Natl. Acad. Sci. USA, 88:5680-5684 (1991)], the steroid-inducible element, and the promoter including the glucocorticoid response element (GRE) [Mader and White, Proc. Natl. Acad. Sci. USA, 90:5603-5607 (1993)], as well as other regulatory elements.
[0039] The DNA plasmid of the present invention comprises the rAAV genome of the present invention. The DNA plasmid is transferred to a cell tolerant of infection by an AAV helper virus (e.g., adenovirus, E1 deletion adenovirus, or herpesvirus) for the integration of the rAAV genome into infectious viral particles. Techniques for producing rAAV particles in which the AAV genome is packaged, rep and cap genes, and helper virus functions provided to the cell are standard in the art. The production of rAAV requires that the following components, the rAAV genome, the rep and cap genes isolated from (i.e., not present in) the AAV rAAV genome, and helper virus functions, be present in a single cell (indicated herein as a packaging cell). The AAV rep gene can be any AAV serotype from which the recombinant virus may originate, and may be from an AAV serotype different from the rAAV genome ITR, including but not limited to AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, and AAV rh74. The use of homogeneous components is particularly intended. The generation of pseudotyped rAAV is disclosed, for example, in International Publication No. 01 / 83692, which is incorporated herein by reference in its entirety.
[0040] The method for generating packaging cells involves forming a cell line that stably expresses all the essential components for AAV particle generation. For example, a plasmid (or multiple plasmids) containing selectable markers such as AAV rep and cap genes lacking the rAAV genome, AAV rep and cap genes isolated from the rAAV genome, and neomycin resistance genes is incorporated into the cell genome. The AAV genome was introduced into bacterial plasmids by procedures such as GC tracking [Samulski et al., Proc. Natl. Acad. S6. USA, 79:2077-2081 (1982)], addition of a synthetic linker containing restriction endonuclease cleavage sites [Laughlin et al., Gene, 23:65-73 (1983)], or direct blunt-end ligation [Senapathy & Carter, J. Biol. Chem., 259:4661-4666 (1984)]. Next, the packaging cell line is infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and it is suitable for large-scale rAAV production. Another example of a preferred method is to introduce the rAAV genome and / or rep and cap genes into packaging cells using adenoviruses or baculoviruses rather than plasmids.
[0041] The general principles of rAAV generation are reviewed, for example, in Carter, Current Opinions in Biotechnology, 1533-1539 (1992), and Muzyczka, Curr. Topics in Microbial. and Immunol., 158:97-129 (1992). Various approaches include Ratschin et al., Mol. Cell. Biol., 4:2072 (1984), Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984), Tratschin et al., Mol. Cell. Biol. al., J. Virol., 62:1963 (1988), and Lebkowski et al., Mol. Cell. Biol., 7:349 (1988), Samulski et al. al., J. Virol., 63:3822-3828 (1989), U.S. Publication No. 5,173,414, International Publication No. 95 / 13365 and corresponding U.S. Publication No. 5,658,776, International Publication No. 95 / 13392, International Publication No. 96 / 17947, PCT / US98 / 18600, International Publication No. 97 / 09441 (PCT / US96 / 14423), International Publication No. 97 / 08298 (PCT / US96 / 13872), International Publication No. 97 / 21825 (PCT / US96 / 20777), International Publication No. WO97 / 06243 (PCT / FR96 / 01064), International Publication No. 99 / 11764, Perrin et al. See, al., Vaccine, 13:1244-1250 (1995), Paul et al., Human Gene Therapy, 4:609-615 (1993), Clark et al., Gene Therapy, 3:1124-1132 (1996), U.S. Patents No. 5,786,211, No. 5,871,982, and No. 6,258,595. The aforementioned documents are incorporated herein in their entirety by reference, with particular emphasis on those parts of the documents relating to rAAV generation.
[0042] Therefore, the present invention provides packaging cells that generate infectious rAAV. In one embodiment, the packaging cells may be stably transformed cancer cells such as HeLa cells, 293 cells, and PerC.6 cells (allogeneic 293 strain). In another embodiment, the packaging cells may be non-transformed cancer cells, such as low-passage 293 cells (human fetal kidney cells transformed with adenovirus E1), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells), and FRhL-2 cells (rhesus monkey fetal lung cells).
[0043] rAAV may be purified by methods standard in the art, for example, by column chromatography or a cesium chloride gradient. Methods for purifying rAAV vectors from helper viruses are known in the art and include, for example, those disclosed in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69:427-443 (2002), U.S. Patent No. 6,566,118, and International Publication No. 98 / 09657.
[0044] In another embodiment, the present invention envisions a composition comprising the DMD exon 5 IRES activated oligomer construct of the present invention in a viral delivery vector or other delivery vehicle. The composition of the present invention comprises a pharmaceutically acceptable carrier. The composition may also comprise other components such as diluents. Acceptable carriers and diluents are non-harmful to the recipient and preferably inactive at the dosage and concentration used, and include buffers such as phosphates, citrates, or other organic acids; antioxidants such as ascorbic acid; proteins such as low molecular weight polypeptides, serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween, Pluronics, or polyethylene glycol (PEG).
[0045] Sterile injectable preparations are prepared by incorporating the required amount of the active ingredient, along with various other components listed above, into a suitable solvent, and then, if necessary, by filter sterilization. Generally, dispersants are prepared by incorporating the sterile active ingredient into a sterile vehicle containing a basic dispersion medium and other necessary components from those listed above. For sterile powders for the preparation of sterile injectable preparations, preferred preparation methods are vacuum drying and freeze-drying techniques, which produce powders of the active ingredient plus any additional desired components from its previously sterile filtered solution.
[0046] The titer of rAAV administered by the method of the present invention varies depending, for example, on the specific rAAV, mode of administration, therapeutic target, target organism and cell type, and can be determined by standard methods in the art. The titer of rAAV is approximately 1 × 10⁶ per mL. 6 , about 1×10 7 , about 1×10 8 , about 1×10 9 , about 1×1010 , about 1×10 11 , about 1×10 12 , about 1×10 13 ~about 1×10 14 or more, and can be within the range of DNase-resistant particles (DRP). The dosage may be expressed in units of viral genome (vg) (i.e., 1×10 7 vg, 1×10 8 vg, 1×10 9 vg, 1×10 10 vg, 1×10 11 vg, 1×10 12 vg, 1×10 13 vg, 1×10 14 vg).
[0047] Methods of transducing target cells (e.g., skeletal muscle) of patients with a 5' mutation of the DMD gene having the rAAV of the present invention, either in vivo or in vitro, are contemplated herein. The method includes administering a composition comprising an effective dose, or effective multiple doses, of the rAAV of the present invention to an animal (including humans) having a 5' mutation of the DMD gene. When the dose is administered before the onset of DMD, the administration is preventive. When the dose is administered after the onset of DMD, the administration is therapeutic. In embodiments of the present invention, an "effective dose" reduces (eliminates or reduces) at least one symptom associated with the DMD being treated, slows or prevents progression to DMD, slows or prevents progression of the disorder / disease state, reduces the degree of the disease, results in remission (partial or complete) of the disease, and / or extends survival.
[0048] Administration of an effective dose of the composition may be via intramuscular, parenteral, intravenous, oral, buccal, nasal, pulmonary, intracranial, intraosseous, intraocular, rectal, or vaginal, and may be any standard route in the art, but is not limited to these. The route of administration and serotype of the AAV components of the present invention (in particular AAV ITR and capsid protein) may be selected and / or adapted by those skilled in the art, taking into account the infection and / or pathological condition being treated, as well as the target cells / tissues. In some embodiments, the route of administration is intramuscular. In some embodiments, the route of administration is intravenous.
[0049] Combination therapies are also intended by the present invention. Combination therapies as used herein include concurrent or sequential treatments. Combinations of the methods of the present invention with standard medical treatments (e.g., corticosteroids and / or immunosuppressants) are particularly intended, as are combinations with other therapies, such as those described in the background section above. In some embodiments, the corticosteroid is a glucocorticoid such as prednisone, deflazacort, or medrol (6-methylprednisolone, PDN). [Examples]
[0050] Aspects and embodiments of the present invention are illustrated by the following examples.
[0051] Most mutations that cleave the reading frame of the DMD gene result in loss of dystrophin expression, leading to DMD. However, improvement in disease severity can arise from alternative translation initiation starting within DMD exon 6, leading to the expression of a highly functional N-cleaved dystrophin. This novel isoform arises from the use of IRES within glucocorticoid-inducible exon 5. IRES activity was confirmed in patient muscle by both peptide sequencing and ribosome profiling. Generation of a cleavage reading frame upstream of IRES by exon skipping leads to the synthesis of a functional N-cleavage isoform in both patient-derived cell lines and DMD mouse models, and its expression protects muscle from contraction-inducible injury and corrects muscle strength to the same level as control mice. These results support a novel therapeutic approach for patients with mutations in the 5' exon of the DMD gene. See also Wein et al., Abstracts / Neuromuscular Disorders, 23:738-852 (2013).
[0052] Example 1 Evidence of IRES-induced translation from human muscle specimens We previously published that nonsense and frameshift mutations leading to stop codons within at least the first two DMD exons should result in a mild BMD phenotype via exon 6 translation initiation [Gurvich et al., Human Mutation, 30:633-640 (2009)]. However, exon 2 duplication, the most common single-exon duplication and resulting in an early stop codon within the duplication exon 2 sequence, appears to be an exception to this prediction, as it is usually associated with DMD [White et al., Human Mutation, 27:938-945 (2006)]. However, exon 2 deletions that also result in an early stop codon were not described in our large population [Flanigan et al., Human Mutation, 30:1657-1666 (2009)] or any other publicly available large catalog (www.dmd.nl). The absence of reported cases was interpreted to mean that the clinical features in patients with exon 2 deletion are either asymptomatic or very mild due to the expression of N-cleavage isoforms.
[0053] This interpretation was confirmed by the detection of an exon 2 deletion (DEL2) in an Italian boy first shown at age 6, for evaluation of incidentally detected serum creatine kinase sequence (550 iu / L, normal <200 iu / L). Normal early motor milestones were reported, and no muscular dystrophy had been reported in the family. His neurological examination was generally normal at age 15. Muscle biopsy showed slight variability in fiber size (Figure 7a) and, in some parts, an increased number of central nuclei, along with several heavily stained hypercontractile fibers. Immunofluorescence analysis using a C-terminal antibody showed the presence of dystrophin in the membrane (Figure 7b). Interestingly, Western blotting revealed that the detected dystrophin had a smaller molecular weight (approximately 410 kDa) (Figure 1a), and mutagenesis analysis revealed an exon 2 deletion (7c-g). Tandem mass spectrometry (LC-MS / MS) 20Subsequent peptide sequencing using this method confirmed the absence of any residues encoded by exons 1-5 among the 99 unique peptides detected and fitted for dystrophin, consistent with translation initiation in exon 6 (Figure 1b and Table 1). [Table 1] Table 1. Peptide spectral fit in human muscle. Dystrophin peptide encoded within exons 1-10. (N) indicates the number of times the peptide sequence was detected in the muscle of a normal control or a patient with exon 2 deletion.
[0054] In a complementary approach, muscle RNA isolated from mild BMD patients with an exon 2 frameshift mutation (c.40_41del[p.Glu14ArgfsX17], referred to as FS) was used to investigate DMD translation efficiency, promoter use, and alternative splicing. Western blots also revealed the expression of the same small molecular weight dystrophin (approximately 410 kDa) lacking the N-terminal epitope (Figure 1c, Figure 8a). To confirm the Western blot results, RNA-Seq libraries were constructed using muscle homogenates from the same FS patients for ribosome-protected fragments (i.e., ribosome footprints isolated after RNase digestion) and total RNA. mRNA translation efficiency in normal muscle and patient muscle was compared using the ratio of reads from ribosome-protected fragments (RPF) to reads from RNA-Seq. Among the top 1000 most abundant muscle mRNAs, DMD showed the largest change in translation efficiency (Figure 1d), indicating an approximately 5-fold reduction in the amount of ribosomes translating DMD muscle transcription in frameshifted patient FS. This reduced translation volume is expected given the patient's mild BMD phenotype and the resulting reduction in dystrophin levels, as well as in p.Trp3X patients. 4 This is consistent with the amount of dystrophin found in both and other 5' mutant alleles (Figure 1c).
[0055] The serrated RNA-Seq pattern observed in DMD introns 1–8 (Figure 1e) confirmed that the primary transcription start was located at the dystrophin muscle-specific promoter (Dp427m), and that DMD exons 1–7 underwent efficient cotranscriptional splicing in both control and FS patient specimens [Ameur et al., Nature Structural & Molecular Biology, 18:1435-1440 (2011)]. Two alternative 427kD isoforms of dystrophin (Dp427p and Dp427c) are primarily expressed in the central nervous system and differ from Dp427m only in the use of the alternative exon 1 sequence. The deletion of a strong initial RNA signal from either the Dp427p or Dp427c promoter confirmed that upregulation of the alternative promoter does not contribute to the use of alternative AUG within exon 6 (Figure 1e). In both samples, RNA-Seq readouts extending to exon-exon junctions exclusively mapped to known junctions between Dp427m exons 1 and 11, indicating novel 5'UTR splicing from the surrogate promoter, did not contribute to exon 6 AUG utilization. The distribution of ribosome footprints mapped onto Dp427m exons 1–11 revealed normal levels of exon 1 AUG initiation, followed by early termination in exon 2, and resumption of translation after the AUG codon within the exon 6 frame (Figure 1f), leading to the main body of DMD transcription (Figures 8b, c, and d), consistent with efficient surrogate translation initiation.
[0056] Example 2 In vitro transcription / translation research We sought to demonstrate new evidence of efficient alternative translation initiation and characterize factors contributing to high translation efficiency by directly using both ribosome profiling and protein analysis in patient muscle. To determine whether exons 1-5 of DMD contain IRES, we cloned the 5' portion of cDNA, which excludes the native AUG start codon (c.4_c.369, referred to as exons 1-6) by including a portion of exon 6 starting at exon 1-+4, into a disisstronic double luciferase reporter vector pRDEF. This vector contained an upstream cap-dependent sea urchin luciferase (RLuc) open read frame (ORF) under the control of the SV40 promoter and a downstream cap-independent firefly luciferase (FLuc) ORF under the control of the sequence of interest, with the two ORFs separated by a secondary structure element (dEMCV) that prevents ribosome scanning (Figure 2c). The EMCV IRES sequence was used as a positive control, and all values were normalized against an empty vector. In each example, the exon 6 AUG was included, consisting of 49 nucleotides from exon 6 placed in a frame with a downstream FLuc reporter. This sequence corresponds to the first 39 nt, including two in-frame AUGs (M124 and M128) and 10 additional nucleotides used for cloning purposes. T7-mediated RNAs were generated from different constructs and used for rabbit reticulocyte lysate (RRL) translation assays (Figure 2a, left panel). The size and integrity of the corresponding RNAs were checked using a formaldehyde agarose gel (Figure 2b). The cap-independent translational activity of exons 1–5 of the DMD (expressed as the ratio of downstream FLuc to RLuc luminescence) resulted in a 1.5–1.7-fold increase in FLuc signaling, which was less than the 3.4–3.8-fold increase seen in the control EMCV IRES, but consistent with IRES activity (Figure 2a, left panel).
[0057] Example 3 IRES activity in cell cultures RRL-based translation may underestimate the IRES activity of either viral or eukaryotic IRESs, possibly due to limited amounts of RNA-binding protein in this specialized extract, or due to the absence of tissue-specific IRES transacting factor (ITAF). Therefore, assays were performed in dystrophin-expressing C2C12 myoblasts, and it was observed that the presence of the exon 1-6 construct led to approximately 8-fold higher Fluc expression compared to the exon 6-only vector (Figure 2a, right panel). This represents approximately 50% of the activity of the control EMCV IRES and suggests the presence of relatively strong IRESs within exons 1-5. To map the location of the IRESs, deletion constructs consisting of the 5' portion of the DMD gene (exons 1-5) or appropriate controls were cloned into pRDEF (Figure 2c). Deletion of the first 300 nucleotides (nt) of this sequence did not significantly alter FLuc expression, but removal or inversion of the last 71 nt (representing almost all of exon 5) completely suppressed FLuc reporter expression, and deletion within exon 5 resulted in significantly reduced FLuc expression. To test the hypothesis that putative IRESs require muscle-specific factors, experiments were repeated in HEK293K cells that do not endogenously express dystrophin, and in commercial human myoblast cell lines (hSKMM). Unlike ECMV IRESs, putative DMD IRESs did not stimulate FLuc expression in 293K cells, but the level of stimulation in hSKMM cells replicated the C2C12 result (Figure 9a), suggesting that IRESs are preferentially active in muscle.
[0058] Control experiments were performed to rule out the possibility of abnormal splicing events, inexplicable promoter activity, or other potential artificial consequences leading to misinterpretation of disisstronic assays. The upstream SV40 promoter was removed to generate a promoterless version of the pRDEF vector containing the exon 1-6 (c.4_c.369) DMD sequence. Transfusion of this construct into C2C12 myoblasts showed only slight background luminescence from both RLuc and FLuc, strongly refuting any inexplicable promoter activity in the DMD coding sequence (data not shown). No abnormal splicing was detected by RT-PCR (Figures 2d and 9c), and RNA integrity was confirmed by Northern blotting (Figures 2e and 9b).
[0059] In particular, while either exon 2 duplication or deletion results in a disrupted read frame, the different associated clinical phenotypes led to the hypothesis that IRES activity may be lost in the presence of exon 2 duplication. This hypothesis was tested in C2C12 cells, and IRES activity was equal between full-length (exons 1-6) and deleted 2 cDNA, but significantly reduced in the presence of exon 2 duplication (Figure 2f), confirming that exon 2 duplication, rather than deletion, eliminates IRES activity.
[0060] Example 4 Out-of-frame exon skipping allows for the in vitro activation of IRES-mediated dystrophin. Considering the skipping of the exon before exon 5 IRES, only the removal of exon 2 would cause the read frame to collapse and result in an early stop codon (Figure 3a). We intended to use the deletion of this exon therapeutically to increase IRES activation, either through the use of antisense oligonucleotides (AONs) [Wood et al., Brain: A Journal of Neurology, 133:957-972 (2010), van Deutekom et al., New England Journal of Medicine, 357:2677-2686 (2007), and Kinali et al., Lancet Neurology, 8:918-928 (2009)] or through the use of AAV-U7-mediated antisense delivery [Goyenvalle et al., Science, 306:1796-1799 (2004), and Vulin et al., Molecular Therapy: Journal of the American Society of Gene Therapy, 20:2120-2133 (2012)]. Four different sequences (labeled "B," "AL," "AS," and "C" respectively in Figure 3b) were selected for U7 snRNA targeting, and each was cloned into AAV1 to evaluate exon skipping efficiency in myoblasts generated from either wild-type or exon 2 duplicated fibroblast cell lines (referred to as FibroMyoD) expressing doxycycline-inducible MyoD [Chaouch et al., Human Gene Therapy, 20:784-790 (2009)]. All constructs were able to skip either one or two copies of exon 2 (Figure 10). Subsequently, to increase skipping efficiency, two copies each of the U7-C and U7-AL target antisense sequences were cloned into a single self-complementary (sc)AAV1 vector (and designated AAV1.U7-ACCA), whose genome is shown 3'-5' oriented in Figure 15. U7-C and U7-AL were used to avoid any possible overlaps in the antisense sequences between AL and B.A known antisense sequence (AON H2A) was used as a positive control for skipping [Tennyson and Worton, Nucleic Acids Res., 24:3059-3064 (1996)]. Infection of FibroMyoD cells resulted in 88.6% of DMD transcriptions exhibiting complete exon 2 skipping, leading to the generation of N-terminal cleaved dystrophin (Figures 3c, 3d, and 12a).
[0061] Example 5 IRES-driven N-cleaved dystrophin is expressed after out-of-frame exon skipping in a novel mouse model containing exon 2 duplication. The ability of the U7-ACCA vector to skip exon 2 in vivo in a mouse model carrying exon 2 duplication in a C57BL / 6 background (Dup2 mice, described in Example 8 below) was tested. The resulting DMD mRNA contained two copies of exon 2, disrupting the reading frame and resulting in the near-complete absence of dystrophin expression. AAV1.U7-ACCA(1e11vg) was directly injected into the anterior tibial region of 6-8 week old Dup2 mice (n=5) or BI6 control mice. After 4 weeks, RT-PCR analysis from the injected muscle demonstrated near-complete exon skipping of exon 2 in Dup2 or BI6 (Figures 4a, 4b). Consistent with RT-PCR results, the serrated RNA-Seq patterns observed in Dmd introns 1 and 2 confirmed the suppression of cotranscriptional splicing of duplicated exon 2, as well as the high efficiency of cotranscriptional splicing of exons 1-3 in treated mice (Figure 4c). Western blotting and immunostaining demonstrated the expression of N-cleaved proteins. Sarcolemma staining was reconstituted for β-dystroglycan and nNOS (Figures 4d, 4e), suggesting the presence of a functional dystroglycan complex.
[0062] To evaluate the extent of dose-response in exon skipping and protein expression, dose-escalation studies were also performed using intramuscular injection (IM) into the anterior tibialis (TA) of Dup2 mice. The IM dose escalation is shown in Figure 18a. As seen in Figure 18b, the extent of skipped transcription shows the expected dose response. Figure 18b shows a similar expected dose response in protein expression, maximizing at 3.1E11vg per injection, with significant correction for physiological force deficits (Figure 18c).
[0063] Example 6 Glucocorticoids increase the activation of dystrophin IRES. Since muscle-specific IRESs found in the 5'UTR of utrophin, an analog of dystrophin, were found to be glucocorticoid-activated, the effect of glucocorticoid exposure on IRES activity was investigated [Miura et al., PloS One, 3:e2309 (2008)]. Furthermore, treatment with glucocorticoids, prednisone, and deflazacort is standard treatment for DMD. When exon 5 IRES activity was evaluated using exon 5-6 constructs in C2C12 cells in the presence of increased concentrations of 6-methylprednisolone (PDN), downstream FLuc activity increased in a dose-dependent manner, from approximately 7-fold in the presence of PDN to more than 20-fold at 6.4 μM PDN (Figure 5a). This glucocorticoid activation was not observed after transduction of exon 6 alone or an inverted exon 5 control construct, or at 293K (Figures 5a and S5a). Increased dystrophin expression was observed in Dup2 FibroMyoD cells treated with 6.4 μM PDN (Figure 5b), and co-treatment with both U7-ACCA and PDN in Dup2 mice (n=5) resulted in increased dystrophin expression beyond that of U7-ACCA alone (Figures 5c-d), consistent with glucocorticoid induction. An increase of less than 3% compared to untreated Dup2 was observed with PDN alone in rare specimens (shown in Figure 5c), suggesting some leakage of IRES in the Dup2 model. In all cases, this increase in dystrophin expression was not attributable to differences in AAV vector genome copy number (data not shown). Utrophin levels in the same injection muscle were evaluated because utrophin translation may be regulated by corticosteroids and overexpression may compensate for the absence of dystrophin (Figure 5e). In untreated Dup2 animals, utrophin levels were increased compared to BI6, similar to what has been reported in the mdx, standard dystrophinopathy mouse model. Comparison of the four groups did not reveal a statistically significant difference in utrophin levels between PDN-treated and untreated animals (Figure 5f), thus excluding utrophin upregulation as a cause of functional relief after PDN treatment.
[0064] Example 7 Locally IRES-driven N-transection dystrophin expression stabilizes the fascia and corrects force deficiencies in Dup2 mouse muscles. We investigated whether the expression of IRES-driven isoforms improved muscle integrity and physiology in Dup2 mice. Similar to mdx mice, dystrophin alterations in Dup2 mice were quantifiable at 4 weeks of age as extensive muscle regeneration characterized by centralized nuclei (Vulin et al., manuscript in press). One month after intramuscular injection of AAV1.U7-ACCA into the tibialis anterior muscle of 4-week-old Dup2 mice, the expression of IRES-driven isoforms resulted in a significant reduction in centralized nuclei (Figure 6a). To demonstrate that this isoform restores membrane integrity, treated and untreated Dup2 mice were subjected to a downhill running protocol and injected with Evans blue dye (EBD), which entered permeabilized skeletal muscle fibers due to membrane damage. Following intraperitoneal injection of EBD, uptake was found only in fibers that were not stained with dystrophin, suggesting that the N-cleaved protein stabilizes the sarcolemma and provides further evidence for the in vivo functionality of this protein (Figure 4f). Quantitative analysis of the number of EBD-positive fibers confirmed that the expression of IRES-driven isoforms resulted in muscle fiber protection in these mice (Figure 6b). Importantly, this membrane protection was associated with the recovery of hindlimb grip strength (Figure 6c) and muscle-specific strength (Figure 6d) to levels seen in BI6 control mice. With or without prednisone, Dup2 muscles injected with U7-ACCA showed significantly higher resistance to contraction-induced injury than untreated Dup2 muscles, and the combination of both treatments did not show a significant difference compared to BI6 controls (Figure 6e). Despite minimal (<3%) dystrophin expression observed in some Dup2 muscles with PDN (Figure 5c), treatment of Dup2 muscles with PDN alone did not result in a significant improvement in muscle physiology (Figure 6).
[0065] Example 8 DMD Model Examples of the DMD exon 2 duplication model include in vivo and in vitro models, as follows.
[0066] mdxdup2 mouse model Mice were developed carrying a duplication of exon 2 within the DMD gene locus. Exon 2 duplication mutations are the most common human duplication mutations and result in relatively severe DMD.
[0067] A map of the insertion vector is shown in Figure D. In this map, the numbers indicate the relative positions of the cloning site, exon, and restriction site. The neocassette is oriented in the same direction as the gene, and the insertion site is precisely 32207 / 32208 bp within intron 2. At least 150 bp of intron sequence is retained on each side of the inserted exon 2, and the E2 region is 1775–2195 bp. The sizes of exon 2 and intron 2 are 62 bp and 209572 bp, respectively.
[0068] Male C57BL / 6 ES cells were transfused with a vector carrying the exon 2 constructor (Figure D), and insertion was then checked by PCR. In many albino BL / 6 blastocysts, one good clone was found, amplified, and injected. The injected blastocysts were transplanted into recipient mice. The dystrophin gene from chimeric males was checked by PCR, and then by RT-PCR. The colonies were expanded and included several homozygous female mice. Intramuscular dystrophin expression from 4-week-old hemizygous mdxdup2 mice was essentially absent.
[0069] Immortalized, condition-induced fibroMyoD cell line The expression of the MyoD gene in mammalian fibroblasts leads to the cell's transition to a myogenic lineage. Such cells can further differentiate into myotubes, which express muscle genes, including the DMD gene.
[0070] We generated immortalized cell lines that conditionally express MyoD under the control of a tetracycline-inducible promoter. This is tet-inducible MyoD, achieved by stable translocation of a lentiviral primary fibroblast cell line containing the human telomerase gene (TER). The resulting stable strain allows MyoD expression to be initiated by treatment with doxycycline. Such cell lines were generated from DMD patients carrying exon 2 duplication.
[0071] Using this strain and a 2'-O-methyl antisense oligomer (AON) provided by Dr. Steve Wilton (Perth, Australia), duplicate skipping was demonstrated. Multiple cell lines were tested.
[0072] Temporarily MyoD-transfected primary cell lines A proof-of-principle experiment was performed using primary fibroblast cell lines transiently transfected with adenovirus-MyoD. The adenovirus construct was not integrated into the cell genome, but MyoD was transiently expressed. The resulting DMD expression was sufficient for exon skipping experiments (however, reproducibility favors stably transfected cell lines).
[0073] Example 9 Intravenous injection of AAV9-U7_ACCA in the Dup2 mouse model results in correction of significant expression and reduced intensity of the N-cleavage isoform. The ability of the AAV9-U7-ACCA genome to skip exon 2 in vivo in Dup2 mice upon intravenous injection was tested. For administration to mice, the U7-ACCA genome was cloned into an rAAV9 vector (designated AAV9-U7_ACCA herein). AAV9-U7_ACCA was injected into the tail vein (3.3E12vg / kg) of five Dup2 mice. The treated animals were examined one month after injection.
[0074] The results of the experiment are shown in Figure 17.
[0075] A dose-escalation study with intravenous administration was also performed (Figure 19a). As seen in Figure 19b, the degree of skipped transcription shows the expected dose response, as seen in the IM study. At the highest levels, the majority of transcription consists of either wild-type transcription translated to full-length dystrophin or exon 2-deleted transcription translated to N-cleavage isoforms, either of which provides a functional benefit to mice (similar to humans). Figure 19c shows a similar expected dose response in protein expression. Crucially, with respect to clinical utility, there is undoubtedly abundant expression of dystrophin in the diaphragm and myocardium at higher doses. Quantitative analysis of protein expression on immunoblot (Figure 19d) confirms the dose-escalation response.
[0076] Neonatal screening (NBS) for DMD in human neonates is now feasible, and therefore, at postnatal day 1 (P1) in Dup2 mice, AAV9.U7-ACCA vector (8×10) is used. 11 vg) We investigated the benefits of early N-transection isoform development through delivery of the result. This single injection resulted in widespread N-transection isoform development in all muscles and sustained muscle fiber protection for 1–6 months post-treatment (Figure 20).
[0077] Example 10 PPMO having the following sequence (shown at 5'~3') is administered to Dup2 mice. C antisense oligomer: AUUCUUACCUUAGAAAAUUGUGC (SEQ ID NO: 10) AL antisense oligomer: GUUUUCUUUUGAACAUCUUCUCUUUCAUCUA (Sequence ID 11)
[0078] AL-PPMO was transfused into wild-type C2C12 mouse myoblasts (Figure 22). Three days after transfusion, RT-PCR was performed to demonstrate efficient exon 2 skipping (Figure 22a). Similar experiments were performed in the Dup2 mouse model. To evaluate the degree of exon 2 skipping and protein expression, AL-PPMO was intramuscularly injected into the anterior tibial bone (TA) of Dup2 mice. As shown in Figure 22b, exon 2 skipping was efficiently achieved. Figure 22c was obtained using the same treated TA muscle. Immunostaining for dystrophin was performed, and the dystrophin results demonstrated efficient production and localization of the plasma membrane protein.
[0079] In a separate experiment, a systemic infusion of 12 mg / kg into the tail vein was administered to a different population of mice three times a week. Skipping and dystrophin recovery were evaluated four weeks after the first infusion.
[0080] Example 11 Patients carrying nonsense mutations in exon 1 or 2 still express highly functional N-terminal cleavage dystrophin isoforms. This is due to the presence of IRES in exon 5, which enables ribosome reentry and translation from exon 6. Therefore, we hypothesize that the formation of nonsense mutations should compel IRES activation in human patient cell lines carrying either missense mutations or intraframe deletion duplications in exons 1-4. Only exon 2 removal generates a stop codon in exon 3. Thus, complete skipping of exon 2 in patients carrying the aforementioned mutations induces a stop codon in exon 3, thereby inducing the generation of IRES-mediated N-terminal cleavage isoforms.
[0081] Cells were collected from human patients carrying mutations within these exons. These cells were then infected with a lentivirus expressing inducible MyoD, which forces the conversion of fibroblasts into myotubes (hereinafter referred to as "myofibroblasts"), a cell type expressing dystrophin. Although the aim was to collect cells from patients containing missense mutations or intraframe deletions or duplications within exons 1-4, only cells from patients carrying nonsense mutations were available. These cells originated from BMD patients, who, due to carrying nonsense mutations, already naturally expressed the N-terminal truncated dystrophin isoform. However, treatment with AAV1.U7-ACCA during differentiation resulted in higher expression of the isoform, with IRES initiation occurring by day 14 (Figure 21).
[0082] Discussion of the results in the examples We demonstrated the presence of a glucocorticoid-responsive IRES within DMD exon 5 that can drive the expression of functional dystrophin despite being N-cleaved. Ribosome profiling from BMD patients with exon 2 frameshift mutations demonstrated a mild reduction in dystrophin translation efficiency, as well as a ribosome footprint pattern consistent with ribosome loading originating in exons 5 and 6. The association of this IRES-induced isoform, which we first described in patients with exon 1 nonsense mutations [Flanigan et al., Neuromuscular Disorders:NMD, 19:743-748 (2009)], with improved disease severity was also confirmed by mass spectrometry data from the first reported case of exon 2 deletion and found in an overall asymptomatic population. Finally, in a novel therapeutic approach, we induced out-of-frame exon skipping to generate early arrest codons, thereby forcing IRES activation, restoring components of the dystrophin complex, and correcting the pathological and physiological features of myopathy in both patient-derived cell lines and novel DMD mouse models.
[0083] Most eukaryotic mRNAs are monocistronic and possess a specialized cap structure at their 5' end, which is required for translation initiation as it is the site where scanning by the 40S ribosomal subunit begins. Despite clear evidence for a cap-dependent 5'→3' scanning model of initiation, bioinformatics analysis suggested that approximately 50% of human transcriptions contain short upstream open read frames (uORFs) in the 5' UTR that may mediate and regulate transcription-specific translation efficiency. While uORFs may function by regulating either leaky scanning or end-dependent restart, they can also dynamically control access to IRES elements, as demonstrated for the mammalian cationic amino acid transporter 1 gene, CAT1 / SLC7A1. Recognizing the caveats regarding IRES identification via reporter assays, all control experiments performed in this study, including assessment of RNA integrity by RT-PCR and Northern blotting, use of promoter-less plasmids, and use of appropriate positive IRES controls, were consistent with cap-independent initiation attributable to IRES activity. The smallest region carrying DMD IRES activity was mapped to 71 nt, which is shorter in length compared to EMCV (588 nt) but similar in size to that identified in c-myc 5'UTR (50 nt). This is an important feature because such small IRESs can be used in disisstronic vectors, where space is limited when packaged in viral vectors such as AAV.
[0084] The precise molecular mechanisms by which cellular IRESs regulate translation are not defined in the literature, but the requirement of ITAFs has been strongly suggested. These cellular proteins act in trans to assist IRES activity. Almost all ITAFs have been shown to carry an RNA-binding domain, and it was hypothesized that they act as RNA chaperones, helping the IRES primary sequence acquire the appropriate conformational state intrinsic to its activity. This may be related to the loss of dystrophin IRES activity in the presence of exon 2 duplication, which may exclude IRES function by forming complex secondary structures or cause the formation of inhibitory uORFs that interfere with ITAF access to exon 5 IRESs.
[0085] Our results provide a molecular explanation for the rescue of 5' truncated mutations via a previously unexplained mechanism of post-transcriptional regulation of dystrophin expression. The identification of this novel cellular IRES and the resulting dystrophin isoforms have important implications for understanding the fundamental biology of muscle and dystrophin. We have noticed that exon 5 of DMD is highly conserved, with 87% identity with human in the canine, mouse, horse, and chicken DMD genes, and 67% identity in 39 species, including D. relio and X. tropicalis. The presence of an IRES within such a highly conserved region strongly suggests selective pressure supporting a programmed role in alternative translational initiation. The role of the IRES under normal conditions is unclear, but continued efforts to understand the relevant cell lineage-specific and / or conditionally activated signals will elucidate the underlying mechanisms of IRES regulation and clarify potentially novel functions of dystrophin.
[0086] An intriguing question is how the N-cleaved isoform remains functional. The primary cellular role of dystrophin is presumed to be the transmission of contractile force across the sarcolemma to extracellular structures by functioning as a crucial structural bridge between the F-actin cytoskeleton and the sarcoplasmic membrane. Two regions within dystrophin, ABD1 (actin-binding domain, spanning residues 15–237) and ABD2 (spanning residues 1468–2208), are involved in F-actin binding. Numerous studies have shown a lack of dystrophin stability in settings of deletion within the ABD1 domain. However, it is worth noting that most of these studies were conducted using microdystrophin constructs lacking the ABD2 domain, which were shown to enhance the interaction between ABD1 and actin. Such miniproteins bind to actin and modify actin dynamics in different ways compared to the full-length version. Results from such constructs indicate that the absence of ABD2 does not completely eliminate dystrophin binding to actin, but the absence of ABD1 is less likely to completely disrupt the interaction between dystrophin and actin. Expression of a trans gene deleted for ABD1 reduced the mdx phenotype and restored the costameric pattern of the M band and Z line, suggesting that the link between dystrophin and the subsarcolemma cytoskeleton requires more interaction with ABD1 than with ABD1. Consistent with this, other members of the cytoskeleton were shown to interact with the dystrophin spectrin repeat.
[0087] While several series suggest that BMD caused by mutations affecting ABD1 is more severe [Beggs et al., American Journal of Human Genetics, 49:54-67 (1991)], our clinical and experimental observations, as reported by other BMD patients with partial or complete absence of the ABD1 domain [Winnard et al., Human Molecular Genetics, 2:737-744 (1993); Winnard et al., American Journal of Human Genetics, 56:158-166 (1995) and Heald et al., Neurology, 44:2388-2390 (1994)], reveal significant functionality of the IRES-driven N-cleavage isoform despite the absence of the first half of canonical ABD1 (Figure 3a). This is of particular interest because forcing the expression of this isoform by generating out-of-frame transcription to induce IRES activity retains substantial therapeutic potential. This novel out-of-frame strategy can be combined with glucocorticoid therapy, a drug already used in DMD / BMD patients, and should increase IRES activation. Importantly, out-of-frame skipping of exon 2 to induce the expression of such proteins, rather than a personalized exon skipping approach for patients with exon 2 duplication (representing nearly 2% of DMD patients in one large series), is intended for the treatment of all patients (up to 6% in the same population) carrying mutations at the 5' end of the DMD gene [Flanigan et al., Neuromuscular Disorders:NMD, 19:743-748 (2009)].
[0088] Although the present invention has been described in relation to specific embodiments, it will be understood that those skilled in the art will be able to conceive of variations and modifications. Therefore, only the limitations that appear in the claims should be imposed on the present invention.
[0089] All documents referenced in this application are incorporated herein by reference in their entirety, with particular attention paid to the content in which they are referenced.
Claims
1. A composition for improving Duchenne muscular dystrophy or Becker muscular dystrophy in patients with a 5' mutation in the DMD gene, wherein the composition comprises a DMD exon 5 IRES activated oligomer construct, and the patient does not have a DMD exon 2 duplication. The aforementioned DMD exon 5 IRES activated oligomer construct is a) U7 snRNA polynucleotide constructs comprising the nucleotide sequence shown in SEQ ID NOs: 5, 6, 7, or 8; or b) A nucleotide sequence that expresses RNA containing the nucleotide sequence shown in SEQ ID NOs: 9, 10, 11, or 12. A composition containing the following:
2. The composition according to claim 1, wherein the progression of the disease of dystrophy is inhibited in the patient.
3. The composition according to claim 1, wherein muscle function is improved in the patient.
4. The composition according to claim 3, wherein the improvement in muscle function is an improvement in muscle strength.
5. The composition according to claim 3, wherein the improvement in muscle function is an improvement in standing and walking stability.
6. The composition according to any one of claims 1 to 5, wherein the patient is further administered a glucocorticoid.
7. The U7snRNA polynucleotide construct is U7-B antisense polynucleotide TACCCATTTTTGCGAATGTTTTTCTTTGA (SEQ ID NO: 5), U7-C antisense polynucleotide ATTCTTACCTTAGAAAATTGTGC (SEQ ID NO: 6), U7-AL antisense polynucleotide GTTTTCTTTTTGAAGATCTTCCTTTCATCTA (SEQ ID NO: 7), or U7-AS antisense polynucleotide GAAGATCTTCCTTTTCCATCTA (SEQ ID NO: 8) A composition according to any one of claims 1 to 6, comprising:
8. The aforementioned oligomer construct, UACCCAUUUUGCGGAAUGUUUUUCUUUGA (Sequence code 9), AUUCUUACCUUAGAAAAUUGUC (Sequence ID 10), GUUUUCUUUUGAACAUCUCUCUCUUCAUCUA (Sequence ID 11), or GAACAUCUUCUCUUCAUCAUCUA (Sequence No. 12) A composition according to any one of claims 1 to 6, comprising a nucleotide sequence that expresses an RNA transcript containing the above.
9. The aforementioned DMD exon 5 IRES activated oligomer construct is an exon 2 targeted antisense oligomer, The aforementioned exon 2-targeted antisense oligomer (a) a phosphorodiamidate morpholino oligomer (PPO), a transcellular peptide-coupled PMO (PPMO), or a PMO internalization peptide (RIP), or (b) Tricyclo-DNA (tcDNA), or comprising a 2'O-methyl-phosphorothioate modification, The composition according to any one of claims 1 to 8.
10. A DMD exon 5 internal ribosome entry site (IRES) activating oligomer construct containing a U7snRNA polynucleotide construct, TACCCATTTTTGCGAATGTTTTTCTTTGA (Sequence No. 5) ATTCTTACCTTAGAAAATTGTGC (Sequence ID 6), or GAAGATCTTCTCTTTCCATCTA (Sequence No. 8) A DMD exon 5 IRES activated oligomer construct containing a nucleotide sequence including [specific nucleotide sequence].
11. A DMD exon 5 IRES activated oligomer construct, UACCCAUUUUGCGGAAUGUUUUUCUUUGA (Sequence code 9), AUUCUUACCUUAGAAAAUUGUC (Sequence ID 10), GUUUUCUUUUGAACAUCUCUCUCUUCAUCUA (Sequence ID 11), or GAACAUCUUCUCUUCAUCAUCUA (Sequence No. 12) A DMD exon 5 IRES-activated oligomer construct containing a nucleotide sequence that expresses an RNA transcript containing [specific nucleotide sequence].
12. The aforementioned DMD exon 5 IRES activated oligomer construct is an exon 2 targeted antisense oligomer, The aforementioned exon 2-targeted antisense oligomer (a) a phosphorodiamidate morpholino oligomer (PPO), a transcellular peptide-coupled PMO (PPMO), or a PMO internalization peptide (RIP), or (b) Tricyclo-DNA (tcDNA), or comprising a 2'O-methyl-phosphorothioate modification, The DMD exon 5 IRES activated oligomer construct according to claim 10 or 11.
13. The use of a DMD exon 5 internal ribosome entry site (IRES) activated oligomer construct in the preparation of a therapeutic drug for Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy in patients with a 5' mutation in the DMD gene, The aforementioned patient does not have DMD exon 2 duplication. The aforementioned DMD exon 5 IRES activated oligomer construct is (a)(i)TACCCATTTTTGCGAATGTTTTTCTTTGA (Sequence No. 5), (ii) ATTCTTACCTTAGAAAATTGTGC (Sequence No. 6), (iii)GTTTTTTTTTGAAGATCTTCCTTTCATTA (Sequence No. 7), or (iv)GAAGATCTTCCTTTCATCTA (Sequence No. 8) Includes a nucleotide sequence containing; or (b) (i) UACCCAUUUUGCGGAAUGUUUUUCUUUGA (Sequence No. 9), (ii) AUUCUUACCUUAGAAAAUUGUC (Sequence No. 10), (iii)GUUUUCUUUUGAACAUCUCUCUCUUCAUCUA (Sequence ID 11), or (iv)GAACAUCUUCUCUCUCAUCUA (Sequence No. 12) A nucleotide sequence that expresses an RNA transcript containing the following use.
14. The composition according to claim 7, or the construct according to claim 10, wherein the DMD exon 5 IRES activated oligomer construct comprises the nucleotide sequence of SEQ ID NO:
5.
15. The composition according to claim 7, or the construct according to claim 10, wherein the DMD exon 5 IRES activated oligomer construct comprises the nucleotide sequence of SEQ ID NO:
6.
16. The composition according to claim 7, wherein the DMD exon 5 IRES activated oligomer construct comprises the nucleotide sequence of SEQ ID NO:
7.
17. The composition according to claim 7, or the construct according to claim 10, wherein the DMD exon 5 IRES activated oligomer construct comprises the nucleotide sequence of SEQ ID NO:
8.
18. The composition according to claim 8, or the construct according to claim 11, wherein the DMD exon 5 IRES activated oligomer construct comprises a nucleotide sequence that expresses an RNA transcript containing the sequence of SEQ ID NO:
9.
19. The composition according to claim 8, or the construct according to claim 11, wherein the DMD exon 5 IRES activated oligomer construct comprises a nucleotide sequence that expresses an RNA transcript containing the sequence of SEQ ID NO:
10.
20. The composition according to claim 8, or the construct according to claim 11, wherein the DMD exon 5 IRES activated oligomer construct comprises a nucleotide sequence that expresses an RNA transcript containing the sequence of SEQ ID NO:
11.
21. The composition according to claim 8, or the construct according to claim 11, wherein the DMD exon 5 IRES activated oligomer construct comprises a nucleotide sequence that expresses an RNA transcript containing the sequence of SEQ ID NO: 12.
Citation Information
Patent Citations
Adeno-Associated Viral Vector for Exon Skipping in a Gene Encoding a Dispensable Domain Protein
US20120077860A1
Modified u7 snrnas for treatment of neuromuscular diseases
US20130045538A1
Adeno-associated viral vector for exon skipping in a gene encoding a dispensible-domain protein
US20130072541A1
Antisense molecules and methods for treating pathologies
WO2011057350A1
Antisense oligonucleotides and uses threreof
WO2011078797A2