RNA-modulated oligonucleotides with improved characteristics for the treatment of Duchenne and Becker muscular dystrophy
Modified oligonucleotides with 2'-O-methylRNA and phosphorothioate chemistry, incorporating 5-methylpyrimidine and 2,6-diaminopurine bases, address delivery and stability issues in DMD treatment, enhancing exon skipping and dystrophin expression.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2021-08-05
- Publication Date
- 2026-03-18
AI Technical Summary
Current antisense oligonucleotides (AONs) for treating Duchenne muscular dystrophy (DMD) have limited delivery, stability, and uptake in muscle fibers, leading to modest dystrophin expression and challenging therapeutic outcomes.
Development of oligonucleotides comprising 2'-O-methylRNA monomers and phosphorothioate skeletons, with 5-methylpyrimidine and/or 2,6-diaminopurine bases, to enhance binding affinity, stability, and cellular uptake, thereby improving exon skipping activity and reducing immunogenicity.
The modified oligonucleotides demonstrate enhanced exon skipping activity, improved in vivo stability, and reduced immunogenicity, potentially leading to more effective dystrophin expression and therapeutic benefits for DMD.
Smart Images

Figure 0007832771000014 
Figure 0007832771000015 
Figure 0007832771000016
Abstract
Description
Field of the Invention
[0001] The present invention relates to human genetics, more specifically to the field of neuromuscular disorders. The present invention particularly relates to the use of oligonucleotides having improved characteristics that enhance clinical applicability as further defined herein. Background of the Invention
[0002] Neuromuscular diseases are characterized by muscular dysfunction due to either muscle or nerve lesions (myopathy and neuropathy). Myopathy includes hereditary muscular dystrophy, characterized by progressive weakness and degeneration of skeletal muscle, cardiac muscle, and / or smooth muscle. Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are the most common childhood forms of muscular dystrophy. DMD is a severe and fatal neuromuscular disorder that leads to wheelchair dependence by age 12, and patients often die by age 30 from respiratory or heart failure. It is caused by one or more exon reading frame shift deletions (approximately 67%) or duplications (approximately 7%), or point mutations in the 2.24 Mb DMD gene (approximately 25%), resulting in a lack of functional dystrophin. BMD is also caused by mutations in the DMD gene, but these maintain the open reading frame and produce a semi-functional dystrophin protein, typically resulting in a milder phenotype and longer survival. Over the past decade, specific modifications of splicing to repair disrupted reading frames in transcripts have emerged as promising treatments for DMD (van Ommen et al., 2008; Yokota et al., 2007; van Deutekom et al., 2007; Goemans et al., 2011; Cirak et al., 2011). Highly sequence-specific antisense oligonucleotides (AONs) that bind to exons adjacent to or containing mutations and interfere with splicing signaling can induce exon skipping during the processing of DMD mRNA precursors. Despite the resulting cleaved transcript, the open reading frame is repaired, and proteins similar to those found in BMD patients are introduced. AON-induced exon skipping provides a mutation-specific and therefore personalized therapeutic approach for DMD patients.As described in International Publication Nos. 02 / 024906, 2004 / 083446, 2006 / 112705, 2007 / 135105, 2009 / 139630, 2010 / 050801, or 2010 / 050802, several oligonucleotides are currently under development to skip many relevant exons of the dystrophin mRNA precursor (e.g., exons 2, 8, 9, 17, 29, 43, 44, 45, 46, 47, 48, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60-63, 71-78).
[0003] Since many mutations are clustered around exons 45-55, skipping a single specific exon may be effective in treating many patients with various mutations. Exon 51 skipping is applied to the largest subset of patients (approximately 13%), including patients with deletions in exons 45-50, 48-50, 50, or 52. The applied AON is chemically modified to be resistant to endonucleases, exonucleases, and RNaseH, and to enhance RNA binding and double-strand stability. Two different AON chemistrys are currently being developed for exon 51 skipping in DMD: 2'-O-methylphosphorothioate RNA AON (2OMePS, GSK2402968 / PRO051) and phosphorodiamidate morpholino oligomer (PMO, AVI-4658) (Goemans et al., 2011; Cirak et al., 2011). Two independent Phase I / II trials showed that both specifically induced exon 51 skipping after systemic administration and at least partially repaired dystrophin expression in the muscle fiber membrane. AON is not normally well taken up by healthy muscle fibers, but dystrophin deficiency in DMD (which results in damaged and consequently more permeable fiber membranes) actually promotes uptake. In a study using a dystrophin-deficient mdx mouse model, 2'-O-methylphosphorothioate RNA oligonucleotides demonstrated up to 10-fold higher uptake in various muscle groups compared to wild-type mice (Heemskerk et al., 2010). Recent Phase I / II results for both 2'-O-methylphosphorothioate RNA and phosphorodiamidate morpholino AON in DMD patients confirm this enhancement of uptake in dystrophy muscle, but different chemical modifications were thought to result in differential uptake and distribution through muscle. The levels of novel dystrophin in both studies three months after treatment were promising, but still modest and challenging, for investigating next-generation oligochemistry.
[0004] The specific chemical characteristics of the selected oligonucleotides affect, at least partially, the delivery of AONs to target transcripts: administration route, in vivo stability, in vivo distribution, tissue distribution, and cellular uptake and transport. Furthermore, further optimization of oligonucleotide chemistry is thought to enhance binding affinity and stability, increase activity, improve safety, and / or shorten length or reduce the cost of the product by improving synthesis and / or purification procedures. While several chemical modifications have become generally and / or commercially available to research groups (e.g., 2'-O-methylRNA and 5-substituted pyrimidines and 2,6-diaminopurines), most others still require significant synthetic efforts to obtain. As will be revealed herein, particularly preliminary and promising results have been obtained using 2'-O-methylphosphorothioate RNA containing modifications to pyrimidine and purine bases.
[0005] In conclusion, there is a need for AONs with further improved characteristics to enhance the therapeutic applicability of AONs for DMD. Description of the Invention
[0006] Oligonucleotides: In a first embodiment, the present invention provides oligonucleotides comprising a 2'-O-methylRNA monomer and a phosphorothioate skeleton, or comprising a 2'-O-methylRNA monomer linked by a phosphorothioate skeleton, comprising a 5-methylpyrimidine and / or a 2,6-diaminopurine base, preferably for use as a drug for the treatment of Duchenne muscular dystrophy or Becker muscular dystrophy.
[0007] Accordingly, the present invention provides oligonucleotides comprising a 2'-O-methylRNA monomer, a phosphorothioate skeleton, and a 5-methylpyrimidine and / or a 2,6-diaminopurine base, preferably oligonucleotides for use as drugs for the treatment of Duchenne muscular dystrophy or Becker muscular dystrophy.
[0008] Furthermore, the present invention provides oligonucleotides comprising a 2'-O-methylRNA monomer and a phosphorothioate skeleton, and containing 5-methylpyrimidine and / or a 2,6-diaminopurine base, preferably oligonucleotides for use as drugs for treating Duchenne muscular dystrophy or Becker muscular dystrophy.
[0009] It will be apparent to those skilled in the art that the “RNA monomer” as expressed in the oligonucleotide of the present invention can also be identified as an “RNA nucleotide residue.” Both terms can be used interchangeably throughout this specification.
[0010] In the present invention, "a" in each of the following expressions means "at least one": a 2'-O-methylRNA monomer, a 2'-O-methylRNA nucleotide residue, a 2'-O-methylphosphorothioate RNA monomer, a 5-methylpyrimidine base, or a 2,6-diaminopurine base.
[0011] It will be apparent to those skilled in the art that in the present invention, "an oligonucleotide comprising a 2'-O-methylRNA monomer and a phosphorothioate skeleton" is replaced by "an oligonucleotide comprising a 2'-O-methylRNA monomer linked by a phosphorothioate skeleton." The same applies to the replacement of "an oligonucleotide consisting of a 2'-O-methylRNA monomer and a phosphorothioate skeleton" by "an oligonucleotide consisting of a 2'-O-methylRNA monomer linked by a phosphorothioate skeleton."
[0012] In the present invention, the expression "for use as a drug for the treatment of Duchenne muscular dystrophy or Becker muscular dystrophy" is replaced with the expression "for use in the treatment of Duchenne muscular dystrophy or Becker muscular dystrophy."
[0013] The oligonucleotide is preferably one having fewer than 34 nucleotides. The oligonucleotide may have 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Such oligonucleotides can also be identified as oligonucleotides having 10 to 33 nucleotides.
[0014] In other words, the oligonucleotide of the present invention comprises a 2'-O-methylRNA monomer and a phosphorothioate skeleton, and contains fewer than 34 nucleotides (i.e., containing 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides).
[0015] Furthermore, the oligonucleotides of the present invention consist of 2'-O-methylRNA monomers linked by a phosphorothioate skeleton and contain fewer than 34 nucleotides (i.e., containing 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides).
[0016] Furthermore, the oligonucleotide of the present invention comprises a 2'-O-methylRNA monomer, a phosphorothioate skeleton, and less than 34 nucleotides (i.e., including 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides), and a 5-methylpyrimidine and / or a 2,6-diaminopurine base.
[0017] Furthermore, the oligonucleotide of the present invention consists of a 2'-O-methylRNA monomer linked by a phosphorothioate skeleton, and comprises less than 34 nucleotides (i.e., including 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) and a 5-methylpyrimidine and / or a 2,6-diaminopurine base.
[0018] Each of these oligonucleotides is intended for use in the treatment of Duchenne muscular dystrophy or Becker muscular dystrophy, or may be intended for use as a drug in the treatment of Duchenne muscular dystrophy or Becker muscular dystrophy.
[0019] The oligonucleotides of the present invention contain or consist of a 2'-O-methylphosphorothioate RNA monomer. Such oligonucleotides contain or consist of a 2'-O-methylRNA monomer linked or ligated through a phosphorothioate backbone. Such oligonucleotides preferably consist of 2'-O-methylphosphorothioate RNA. Such chemistry is known to those skilled in the art. Throughout this specification, oligonucleotides containing a 2'-O-methylRNA monomer and a phosphorothioate backbone may be replaced by oligonucleotides containing 2'-O-methylphosphorothioate RNA. Throughout this specification, oligonucleotides consisting of a 2'-O-methylRNA monomer linked or ligated through a phosphorothioate backbone may be replaced by oligonucleotides consisting of 2'-O-methylphosphorothioate RNA.
[0020] In the present invention, “skeleton” is used to identify a linkage (i.e., nucleoside linkage) between two modified versions of sugar units or sugar units or sugar moieties (as defined later herein). Throughout this specification, the terms “skeleton,” “nucleoside linkage,” and “linkage” may be used interchangeably. Thus, an oligonucleotide having 10 nucleotides contains together nine skeletons linking 10 modified versions of sugar units or sugar units or sugar moieties (as defined later herein). At least one of the skeletons of the oligonucleotides according to the present invention consists of a phosphorothioate moiety linking two modified versions of sugar units or sugar units or sugar moieties (as defined later herein). Thus, at least one phosphate diester skeleton present in RNA is replaced by a phosphorothioate moiety. The naturally occurring nucleoside linkage or skeleton is a 3'-to-5' phosphate diester linkage.
[0021] Furthermore, the oligonucleotides of the present invention may include base modifications that increase binding affinity to a target chain, and / or increase the melting temperature of the double helix formed with the target of the oligonucleotide, and / or reduce immunostimulatory effects, and / or increase in vivo stability, and / or improve in vivo distribution, and / or tissue distribution, and / or cellular uptake and transport.
[0022] In a more preferred embodiment, the oligonucleotide of the present invention comprises 5-methylpyrimidine and / or a 2,6-diaminopurine base. The 5-methylpyrimidine base is selected from 5-methylcytosine and / or 5-methyluracil and / or thymine (thymine is identical to 5-methyluracil).
[0023] Therefore, the expression "containing 5-methylcytosine and / or 5-methyluracil and / or 2,6-diaminopurine bases" can be replaced with "containing base modifications selected from the group consisting of 5-methylcytosine, 5-methyluracil, and 2,6-diaminopurine bases" with respect to the modified oligonucleotides of the present invention.
[0024] If the oligonucleotide of the present invention has two or more such base modifications, the base modifications may be identical, for example, all such modified bases in the oligonucleotide may be 5-methylcytosine. Alternatively, the base modifications may be a combination of various base modifications, for example, the oligonucleotide may have one or more 5-methylcytosine and one or more 5-methyluracil.
[0025] "Thymine" and "5-methyluracil" may be interchangeable throughout this specification. Also, 2,6-diaminopurine is identical to 2-aminoadenine, and these terms may be interchangeable throughout this specification. The use of 2,6-diaminopurine is disclosed elsewhere in U.S. Patent No. 7,745,420.
[0026] In this specification, the terms “base modification” or “modified base” refer to the modification of an existing base (i.e., a pyrimidine or purine base) or the novel synthesis of a base. This novelly synthesized base can be identified as “modified” by comparison with an existing base. The oligonucleotides of the present invention comprising 5-methylcytosine and / or 5-methyluracil and / or 2,6-diaminopurine bases are each modified in such a way that at least one of the cytosine nucleic acid bases of the oligonucleotide is modified by substitution of a methyl group on the proton at position 5 of the pyrimidine ring, i.e., by 5-substituted cytosine, and / or at least one of the uracil nucleic acid bases of the oligonucleotide is modified by substitution of a methyl group on the proton at position 5 of the pyrimidine ring (i.e., 5-methyluracil), and / or at least one of the adenine nucleic acid bases of the oligonucleotide is modified by substitution of an amino group on the proton at position 2 (i.e., 2,6-diaminopurine). In the present invention, the expression "substitution of a proton at position 5 of the pyrimidine ring with a methyl group" may be replaced by the expression "substitution of pyrimidine with 5-methylpyrimidine," and pyrimidine may refer to uracil alone, cytosine alone, or both. Also in the present invention, the expression "substitution of a proton at position 2 of adenine with an amino group" may be replaced by the expression "substitution of adenine with 2,6-diaminopurine." If the oligonucleotide contains 1, 2, 3, 4, 5, 6, 7, 8, or 9 or more cytosine, uracil, and / or adenine molecules, then at least one, 2, 3, 4, 5, 6, 7, 8, or 9 or more cytosine, uracil, and / or adenine molecules are each modified in this manner. Preferably, all cytosine, uracil, and / or adenine molecules are modified in this manner or substituted with 5-methylcytosine, 5-methyluracil, and / or 2,6-diaminopurine molecules, respectively. It goes without saying that this aspect of the present invention can only be applied to oligonucleotides that each contain at least one cytosine, uracil, or adenine in their sequence. Oligonucleotides containing at least one 5-methylcytosine, 5-methyluracil, and / or 2,6-diaminopurine can be referred to as modified oligonucleotides by reference to their unmodified counterparts that do not contain 5-methylcytosine, 5-methyluracil, and 2,6-diaminopurine.The unmodified counterpart may also be identified as an oligonucleotide containing unmodified cytosine, unmodified uracil, and unmodified adenine. A preferred unmodified sequence is represented by one of the following base or nucleotide sequences, including or consisting of SEQ ID NOs. 91, 93-170.
[0027] The inventors have discovered that the presence of 5-methylcytosine, 5-methyluracil, and / or 2,6-diaminopurine in the oligonucleotides of the present invention has a favorable effect on at least one of the parameters of the oligonucleotides, where the parameters may include binding affinity and / or kinetics, exon skipping activity, in vivo stability, (intratissue) distribution, cellular uptake and / or transport, and / or immunogenicity, as described below. The favorable effect may correlate with the number or percentage of base modifications incorporated. With respect to the parameter of exon skipping activity, the inventors have found that, for some oligonucleotides, the modification of nucleic acid bases itself is not necessary to obtain a relatively high level of exon skipping. This may be related to the specific role (and intensity) of sequences that are specifically targeted within the exon during the splicing process.
[0028] Binding affinity and dynamics depend on the thermodynamic properties of the AON. These are determined, at least partially, by the melting temperature (Tm; calculated for single-stranded RNA using the basic Tm and neighboring model, for example, by oligonucleotide characterization (http: / / www.unc.edu / ~cail / biotool / oligo / index.html or http: / / eu.idtdna.com / analyzer / Applications / OligoAnalyzer / )) of the oligonucleotide and / or by the free energy of the oligonucleotide target exon complex (using RNA Structure version 4.5 or RNA mfold version 3.5). Exon skipping activity typically increases with increasing Tm, but if Tm is too high, the AON is expected to become less sequence-specific. Acceptable Tm and free energy depend on the oligonucleotide sequence. Therefore, it is difficult to specify a preferred range for each of these parameters.
[0029] Exon skipping activity is preferably measured by analyzing total RNA isolated from AON-treated muscle cell cultures or muscle tissue by reverse transcription polymerase chain reaction (RT-PCR) using DMD gene-specific primers adjacent to the targeted exon, as described in Aartsma-Rus et al. (2003). RT-PCR products are analyzed on a 1-2% agarose gel or using an Agilent 2100 Bioanalyzer (Agilent Technologies, The Netherlands). The proportion of short transcription fragments (representing transcripts in which the targeted exon is skipped) to the total transcript is evaluated (calculated as the percentage of exon skipping induced by AON). Short fragments may also be sequenced to determine the accuracy and specificity of targeted exon skipping. An increase in exon skipping percentage can be detected for the modified oligonucleotide of the present invention (i.e., an oligonucleotide comprising a 2'-O-methylRNA monomer, a phosphorothioate skeleton, and 5-methylpyrimidine and / or a 2,6-diaminopurine base) compared to its unmodified counterpart (i.e., an oligonucleotide comprising a 2'-O-methylRNA monomer, a phosphorothioate skeleton, and no 5-methylpyrimidine or 2,6-diaminopurine base). The increase is preferably a detectable increase evaluated as described above using RT-PCR. The increase is preferably at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 times higher, or even 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times or more higher.
[0030] In vivo distribution and in vivo stability are preferably determined, at least partially, by a validated hybridization ligation assay, source Yu et al., 2002. In one embodiment, plasma or homogenized tissue samples are incubated with a specific capture oligonucleotide probe. After separation, the DIG-labeled oligonucleotides are ligated into a complex, followed by detection using anti-DIG antibody-conjugated peroxidase. Non-compartmental pharmacokinetic analysis is performed using the WINNONLIN software package (Model 200, version 5.2, Pharsight, Mountainview, CA). The level of AON (ug) per 1 mL of plasma or 1 mg of tissue is expressed as the area under the curve (AUC), peak concentration (C). max ), time to peak concentration (T max ), terminal phase half-life and absorption lag time (t lag ) is monitored over time to evaluate the following. Such preferred assays are disclosed in the experimental section.
[0031] AONs can stimulate the innate immune response by activating Toll-like receptors (TLRs), including TLR9 and TLR7 (Krieg et al., 1995). TLR9 activation typically occurs by mimicking bacterial DNA that activates the innate immune system through TLR9-mediated cytokine release, due to the presence of unmethylated CG sequences in oligodeoxynucleotides (ODNs). However, 2'-O-methyl modifications have been suggested to significantly reduce such possible effects. TLR7 has been described as recognizing uracil repeats in RNA (Diebold et al., 2006).
[0032] Activation of TLR9 and TLR7 triggers a series of harmonic immune responses, including innate immunity (macrophages, dendritic cells (DCs), and NK cells) (Krieg et al., 1995; Krieg, 2000). Several chemo-cytokines, such as IP-10, TNFα, IL-6, MCP-1, and IFNα (Wagner, 1999; Popovic et al., 2006), are involved in this process. Inflammatory cytokines attract additional protective cells, such as T and B cells, from the blood. The levels of these cytokines can be investigated by in vitro testing. Briefly, human whole blood is incubated with escalated concentrations of AON, and then cytokine levels are determined by standard commercially available ELISA kits. Such preferred assays are described in the experimental section. By comparing the concentrations of the corresponding cytokines in the assay in cells treated with an oligonucleotide containing at least one 5-methylcytosine with cells treated with the corresponding oligonucleotide that does not contain 5-methylcytosine, the decrease in immunogenicity preferably corresponds to a detectable decrease in the concentration of the at least one cytokine mentioned above.
[0033] Accordingly, the preferred oligonucleotides of the present invention have improved parameters such as acceptable or reduced immunogenicity and / or better biodistribution and / or acceptable or improved RNA binding dynamics and / or thermodynamic properties compared to the corresponding oligonucleotides consisting of 2'-O-methylphosphorothioate RNA that does not contain 5-methylcytosine, 5-methyluracil, and 2,6-diaminopurine (i.e., so-called unmodified oligonucleotides). The unmodified oligonucleotides may also be identified as oligonucleotides containing unmodified cytosine, unmodified uracil, and unmodified adenine. Each of these parameters can be evaluated using assays known to those skilled in the art or preferably disclosed herein.
[0034] Other chemicals and modifications of the oligonucleotides of the present invention will be described later. These additional chemicals and modifications may also exist in combination with oligonucleotides containing or consisting of the chemicals already described for the oligonucleotides, namely 5-methylcytosine, 5-methyluracil, and / or 2,6-diaminopurine.
[0035] The preferred oligonucleotides of the present invention include or consist of RNA molecules or modified RNA molecules. In preferred embodiments, the oligonucleotides are single-stranded. However, those skilled in the art will understand that single-stranded oligonucleotides can form an internal double-stranded structure. However, these oligonucleotides are still referred to as single-stranded oligonucleotides in the present invention.
[0036] In addition to the modifications described above, the oligonucleotides of the present invention may include further modifications such as various nucleic acid monomers or nucleotides described later. Various nucleic acid monomers may be used to produce the oligonucleotides of the present invention. The oligonucleotides may have at least one backbone and / or sugar modification and / or at least one base modification compared to RNA-based oligonucleotides.
[0037] Base modifications include hypoxanthine, orotic acid, agmatidine, lysidine, 2-thiopyrimidine (e.g., 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g., 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A and N4-ethylcytosine or derivatives thereof; N 2 -Cyclopentylguanine (cPent-G), N 2-Cyclopentyl-2-aminopurine (cPent-AP) and N 2 This includes modified versions of natural purines and pyrimidine bases (e.g., adenine, uracil, guanine, cytosine, and thymine), such as propyl-2-aminopurine (Pr-AP), pseudouracil, or derivatives thereof; and degenerate or universal bases, such as 2,6-difluorotoluene or debase-debasic sites (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen is substituted with nitrogen (azaribose)). Examples of derivatives of Super A, Super G, and Super T can be found in U.S. Patent No. 6,683,173 (Epoch Biosciences), which is incorporated herein by reference in its entirety. cPent-G, cPent-AP, and Pr-AP have been shown to reduce immunostimulatory effects when incorporated into siRNA (Peacock H. et al., J.Am.Chem.Soc.2011, 133, 9200).
[0038] Pseudouracil is a naturally occurring isomerized version of uracil that contains a C-glycoside instead of the usual N-glycoside in uridine. Pseudouridine-containing synthetic mRNA may have an improved safety profile compared to uridine-containing mRNA (International Publication No. 2009127230, which is incorporated herein by reference in its entirety).
[0039] In one embodiment, the oligonucleotide of the present invention includes a debasing site or debasing monomer. In the present invention, such monomer may be referred to as a debasing site or debasing monomer. A debasing monomer or debasing site is a monomer or component that lacks a nucleic acid base compared to a corresponding monomer that contains a nucleic acid base. Therefore, in the present invention, a debasing monomer is a component portion of an oligonucleotide (lacking a nucleic acid base). Such a debasing monomer may be present at, linked to, attached to, or conjugated to the free end of the oligonucleotide.
[0040] In a more preferred embodiment, the oligonucleotide of the present invention contains 1 to 20 or more debasic monomers. Therefore, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more debasic monomers may be present in the oligonucleotide of the present invention.
[0041] The debase monomer may be of any kind known and conceivable to those skilled in the art. Non-limiting examples are given below.
[0042] [ka]
[0043] In the formula, R1 and R2 are independently H, oligonucleotides, or other debasing sites (except when both R1 and R2 are H, or when both R1 and R2 are oligonucleotides). The debasing monomer can be bound to either or both of the ends of the oligonucleotides defined above. It should be noted that an oligonucleotide bound to one or two debasing sites or debasing monomers may contain fewer than 10 nucleotides. In this regard, the oligonucleotide according to the present invention may contain at least 10 nucleotides (optionally containing one or more debasing sites or debasing monomers at one or both of its ends).
[0044] The oligonucleotides of the present invention may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 base modifications, depending on their length. Introducing more than one different base modification into the oligonucleotide is also included in the present invention.
[0045] Sugar modification includes 2'-O-alkyl or 2'-O-(substituted)alkyl, e.g., 2'-O-methyl, 2'-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl, 2'-O-butyryl, 2'-O-propargyl, 2'-O-allyl, 2'-O-(3-amino)propyl, 2'-O-(3-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy(DNA); 2'-O-(haloalkoxy)methyl (Arai) K. et al., Bioorg. Med. Chem. 2011, 21, 6285), for example, 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxy)methyl (DCEM), 2'-O-alkoxycarbonyl, for example, 2'-O-[2-(methoxycarbonyl)ethyl](MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl](MCE), 2'-O-[2-(N,N-dimethylcarbamoyl)ethyl] ](DCME); 2'-halo, e.g., 2'-F, modified versions of ribosyl sites such as 2'-O-modified RNA such as FANA (2'-F arabinosyl nucleic acid); carba sugars, sulfa and sulfo sugars, and aza sugar modifications; 3'-O-alkyl (e.g., 3'-O-methyl, 3'-O-butyryl, 3'-O-propargyl); 4'-carboxy (e.g., 4'-carboxythymidine) (Hari et al.); and derivatives thereof.
[0046] Other sugar modifications include "crosslinked" or "bicyclic" nucleic acids (BNAs), such as locked nucleic acids (LNAs), xylol-LNA, α-L-LNA, β-D-LNA, cEt(2'-O,4'-C constrained ethyl)LNA, cMOEt(2'-O,4'-C constrained methoxyethyl)LNA, ethylene crosslinked nucleic acids (ENA), tricycloDNA (tcDNA, tc-PS-DNA, e.g., U.S. Patent Application No. 20120149756); and 3'-S-phosphorothiolate DNA (e.g., Org.Bi). This includes oligonucleotides (e.g., PMO, PPMO, PMOPlus, PMO-X) and their derivatives. The oligonucleotides of the present invention may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 sugar modifications depending on their length. The invention also encompasses the introduction of more than one different sugar modification into the oligonucleotide. In one embodiment, the oligonucleotide described herein comprises or consists of LNA or a derivative thereof. BNA derivatives are described, for example, in International Publication 2011 / 097641, which is incorporated in whole by reference. In a more preferred embodiment, the oligonucleotide of the present invention is fully 2'-O-methyl modified. An example of PMO-X is described in International Publication 2011150408, which is incorporated in whole by reference.
[0047] Skeletal modifications include modified versions of phosphate diesters present in RNA, such as phosphorothioates (PS), chiralally pure phosphorothioates, phosphorodithioates (PS2), phosphonoacetates (PACE), phosphonoacetamides (PACA), thiophosphonoacetates, thiophosphonoacetamides, phosphorothioate prodrugs, H-phosphonates, methylphosphonates, methylphosphonothioates, methyl phosphates, methylphosphorothioates, ethyl phosphates, ethyl phosphorothioates, boranophosphates, boranophosphorothioates, methylboranophosphates, methylboranophosphorothioates, methylboranophosphonates, methylboranophosphonothioates, and their derivatives. Other modifications include phosphoramidites, phosphoramidates, N3'→P5' phosphoramidates, phosphorudiamidates, phosphorothiodiamidates, sulfamic acid, dimethylene sulfoxide, sulfonic acid, triazole, oxalyl, carbamate, methylene imino (MMI), 3'-S-phosphorothiolate (Org. Biol. Chem. 2013, 11, 966), and thioacetamide nucleic acid (TANA); and their derivatives. The oligonucleotides of the present invention may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, and 32 skeletal modifications depending on their length. Introducing more than one different skeletal modifications into the oligonucleotides is also included in the present invention.
[0048] In preferred embodiments, the oligonucleotide of the present invention includes at least one phosphorothioate modification. In more preferred embodiments, the oligonucleotide of the present invention is completely phosphorothioate modified.
[0049] Other chemical modifications of oligonucleotides of the present invention include peptide-based nucleic acids (PNA), boron cluster-modified PNA, pyrrolidine-based oxypeptide nucleic acids (POPNA), glycol or glycerol-based nucleic acids (GNA), threose-based nucleic acids (TNA), acyclic threoninol-based nucleic acids (aTNA), morpholino-based oligonucleotides (PMO, PPMO, PMO-X), cationic morpholino-based oligomers (PMOPlus), oligonucleotides having integrated bases and a skeleton (ONIB), pyrrolidineamide oligonucleotides (POM); and derivatives thereof.
[0050] In another embodiment, the oligonucleotide comprises peptide nucleic acids and / or morpholinophosphodiamides, or derivatives thereof.
[0051] In another embodiment, the oligonucleotide contains a monothiophosphate group at the 5' position of the 5' terminal residue and / or a monothiophosphate group at the 3' position of the 3' terminal residue. These monothiophosphate groups have been shown to improve oligonucleotide stability (e.g., U.S. Patent Application No. 20120148664 - miRagen).
[0052] The emergence of nucleic acid mimicry technology has made it possible to generate molecules that do not need to be identical to the nucleic acid itself, but rather have similar, preferably identical, hybridization characteristics. Such functional equivalents are, naturally, also suitable for use in the present invention.
[0053] Those skilled in the art will understand that each sugar, base, and / or skeleton may not be similarly modified. Several different modified sugars, bases, and / or skeletons may be combined in one oligonucleotide of the present invention.
[0054] Those skilled in the art will also recognize that there are numerous synthetic derivatives of oligonucleotides. Skeletal modifications include modified versions of phosphate diesters present in RNA, such as phosphorothioates (PS), chiralally pure phosphorothioates, phosphorodithioates (PS2), phosphonoacetates (PACE), phosphonoacetamides (PACA), thiophosphonoacetates, thiophosphonoacetamides, phosphorothioate prodrugs, H-phosphonates, methylphosphonates, methylphosphonothioates, methylphosphates, methylphosphorothioates, ethylphosphates, ethylphosphorothioates, boranophosphates, boranophosphorothioates, methylboranophosphates, methylboranophosphorothioates, methylboranophosphonates, methylboranophosphonothioates, and derivatives thereof. Other modifications include phosphoramidites, phosphoramidates, N3'→P5' phosphoramidates, phosphorudiamidates, phosphorothiodiamidates, sulfamic acid, dimethylene sulfoxide, sulfonic acid, and thioacetamide nucleic acid (TANA); and their derivatives.
[0055] Since RNA / RNA double helixes are very stable, the oligonucleotide is preferably RNA. It is preferable that the RNA oligonucleotide includes modifications that provide RNA with additional properties such as resistance to endonucleases, exonucleases, and RNaseH, additional hybridization strength, increased stability (e.g., in body fluids), increased or decreased mobility, increased activity, reduced toxicity, increased intracellular transport, and tissue specificity. Furthermore, mRNA complexed with the oligonucleotide of the present invention is preferably not sensitive to RNaseH cleavage. Preferred modifications are identified above.
[0056] Accordingly, the present invention provides oligonucleotides comprising or consisting of 2'-O-methylphosphorothioate RNA monomers and 5-methylpyrimidine and / or 2,6-diaminopurine bases. Most preferably, these oligonucleotides consist of 2'-O-methylRNA monomers linked through a phosphorothioate skeleton, where all cytosine and / or all uracil and / or all adenine are independently substituted with 5-methylcytosine, 5-methyluracil, and / or 2,6-diaminopurine, respectively. Preferred modified and unmodified oligonucleotides encompassed in the present invention and disclosed herein comprise or consist of one base or nucleotide sequence selected from one of the SEQ ID NOs: 14-90 shown in Table 1. The expression "oligonucleotides represented by nucleotides or nucleotide sequences selected from SEQ ID NOs: 14-90" can be replaced with the expression "oligonucleotides represented by nucleotides or nucleotide sequences selected from one of SEQ ID NOs: 14-90" or "oligonucleotides represented by nucleotides or nucleotide sequences selected from the list of SEQ ID NOs: 14-90". The same applies to the other groups of sequence numbers referenced herein.
[0057] A preferred unmodified oligonucleotide is derived from one of SEQ ID NOs: 14-90 and comprises or consists of one of the bases or nucleotide sequences selected from SEQ ID NOs: 91, 93-170 (as included in the present invention and disclosed herein).
[0058] The modified oligonucleotide is preferably derived from one of SEQ ID NOs: 14-90 and comprises or consists of one of the bases or nucleotide sequences selected from SEQ ID NOs: 92, 171-213, and 215 (as included in the present invention and disclosed herein).
[0059] Note that there are two identical sequences in the sequence listing; that is, sequence number 91 is identical to sequence number 132, and sequence number 92 is identical to sequence number 199.
[0060] The sequences representing each of these oligonucleotides are disclosed in Tables 1-3 and the sequence listing. The most preferred oligonucleotide is described in more detail below.
[0061] Therefore, the oligonucleotide of the present invention is At least one, preferably all, cytosines are substituted with 5-methylcytosine. At least one, preferably all, cytosines are substituted with 5-methylcytosine, and at least one, preferably all, uracils are substituted with 5-methyluracil. At least one, preferably all, cytosines are substituted with 5-methylcytosine, and at least one, preferably all, adenines are substituted with 2,6-diaminopurine. At least one, preferably all, cytosines are substituted with 5-methylcytosine, and at least one, preferably all, uracils are substituted with 5-methyluracil, and at least one, preferably all, adenines are substituted with 2,6-diaminopurine. At least one, preferably all, uracils are substituted with 5-methyluracil. At least one, preferably all, uracils are substituted with 5-methyluracil, and at least one, preferably all, adenines are substituted with 2,6-diaminopurine, or At least one, preferably all, adenines are substituted with 2,6-diaminopurine. It is possible.
[0062] However, oligonucleotides may also have at least one, at least two, at least half, or all cytosines substituted with 5-methylcytosine. Preferably, if the unmodified oligonucleotide of the present invention based on SEQ ID NOs: 14-90 has x cytosines, x is an integer in the range of 1 to 33, and the corresponding modified oligonucleotide of the present invention may have 1, 2, 3, ... (x-2), (x-1), x 5-methylcytosines.
[0063] If x is 3 in such an unmodified oligonucleotide, the number of 5-methylcytosine molecules in the corresponding modified oligonucleotide is 1, 2, or 3. If x is 4 in such an unmodified oligonucleotide, the number of 5-methylcytosine groups in the corresponding modified oligonucleotide is 1, 2, 3, or 4. If x is 5 in such an unmodified oligonucleotide, the number of 5-methylcytosine molecules in the corresponding modified oligonucleotide is 1, 2, 3, 4, or 5. If x is 6 in such an unmodified oligonucleotide, the number of 5-methylcytosine groups in the corresponding modified oligonucleotide is 1, 2, 3, 4, 5, or 6. If x is 7 in such an unmodified oligonucleotide, the number of 5-methylcytosine molecules in the corresponding modified oligonucleotide is 1, 2, 3, 4, 5, 6, or 7. If x is 8 in such an unmodified oligonucleotide, the number of 5-methylcytosine molecules in the corresponding modified oligonucleotide is 1, 2, 3, 4, 5, 6, 7, or 8.
[0064] The same applies to uracil substitution in 5-methyluracil and adenine substitution in 2,6-diaminopurine.
[0065] The oligonucleotides of the present invention are preferably for use as drugs for DMD, and more preferably for use in therapeutic RNA modulation. Therefore, the oligonucleotides are antisense oligonucleotides (AONs). An antisense oligonucleotide is an oligonucleotide that is reverse-complementary to a specific sequence of a dystrophin mRNA precursor derived from the coding sense strand of DNA of DMD or an individual. This oligonucleotide binds to and / or targets and / or hybridizes to and / or can bind to and / or can target and / or can hybridize to the sequence of the mRNA precursor. The target of RNA modulation for DMD is to skip one or more specific exons in the DMD or dystrophin mRNA precursor to repair the open reading frame of the transcript and induce the expression of a short but (furthermore) functional dystrophin protein, with the ultimate goal of being able to halt the course of the disease.
[0066] Therefore, in preferred embodiments, the oligonucleotides of the present invention are used to induce exon skipping in DMD or dystrophin mRNA precursors in cells, organs, tissues, and / or organisms. Exon skipping can result in mature DMD or dystrophin mRNA that does not contain skipped exons, thereby leading to the expression of even shorter protein products if the exons encode amino acids. Exon skipping is preferably induced by binding of the AON to specific exon internal sequences, including splicing regulatory elements, splice sites, and / or intron branching point sequences.
[0067] In this specification, DMD mRNA precursor preferably means the mRNA precursor of the DMD gene encoding the dystrophin protein. Mutant DMD mRNA precursors correspond to mRNA precursors with mutations in BMD or DMD patients compared to wild-type DMD mRNA precursors in healthy humans, resulting in abnormal protein (BMD) (reduced levels) or a lack of functional dystrophin (DMD). DMD mRNA precursors are also referred to as dystrophin mRNA precursors. The DMD gene is sometimes referred to as the dystrophin gene. Dystrophin and DMD may be used interchangeably throughout this specification.
[0068] Patients are preferably intended to mean patients with DMD or BMD as defined later herein, or patients who are predisposed to developing DMD or BMD due to their genetic background. In the case of DMD patients, the oligonucleotide used preferably corrects one mutation present in the patient's DMD gene and produces a BMD protein-like protein. The protein is preferably a functional or semi-functional dystrophin as defined later herein. In the case of BMD patients, the oligonucleotide used preferably corrects one mutation present in the patient's BMD gene and produces a dystrophin that is more functional than the dystrophin originally present in the BMD patient.
[0069] In this specification, functional dystrophin is preferably wild-type dystrophin corresponding to a protein having the amino acid sequence identified in SEQ ID NO: 1. In this specification, semi-functional dystrophin is preferably BMD-like dystrophin corresponding to a protein having an action-binding domain in its N-terminal portion (the first 240 amino acids of the N-terminus), a cysteine-rich domain (amino acids 3361-3685), and a C-terminal domain (the last 325 amino acids of the C-terminus) (as is known to those skilled in the art, each of these domains is present in wild-type dystrophin). The amino acids shown in this specification correspond to the amino acids of wild-type dystrophin shown by SEQ ID NO: 1. In other words, functional or semi-functional dystrophin is a dystrophin exhibiting at least the same level of activity as wild-type dystrophin. "At least the same level" preferably means at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the corresponding activity of wild-type functional dystrophin. In this regard, the activity of functional dystrophin is preferably due to its binding to actin and to dystrophin-associated glycoprotein complexes (DGC or DAPC) (Ehmsen J et al., 2002).
[0070] As is known to those skilled in the art, the binding of dystrophin to actin and to the DGC or DAPC complex can be visualized from pre- and / or post-treatment control (non-DMD) biopsies of muscle suspected of dystrophy by either co-immunoprecipitation using whole protein extracts or by cross-sectional immunofluorescence analysis using various antibodies that react with different members of the complex.
[0071] Individuals or patients with Duchenne muscular dystrophy typically have mutations in the gene encoding dystrophin (DMD or dystrophin gene) that interfere with complete protein synthesis, i.e., an intermediate stop codon that prevents C-terminus synthesis. In Becker muscular dystrophy, the dystrophin gene also has mutations compared to the wild type, but the mutations typically do not produce an intermediate stop codon, and the C-terminus is typically synthesized. As a result, a functional or semi-functional dystrophin protein is synthesized that has at least the same type of activity, though not necessarily the same activity as the wild-type protein. Typically, the genome of a BMD patient includes an N-terminal region (the first 240 amino acids of the N-terminus), a cysteine-rich domain (amino acids 3361-3685), and a C-terminal domain (the last 325 amino acids of the C-terminus), but in most cases its central rod domain encodes a shorter dystrophin protein than that of wild-type dystrophin (Monaco et al., 1988). Antisense oligonucleotide-induced exon skipping for the treatment of DMD typically aims to overcome premature termination in the mRNA precursor (preferably in the central rod domain) by skipping exons, correcting open reading frames, and enabling the synthesis of the remainder of the dystrophin protein, including the C-terminus (although the protein is somewhat smaller as a result of the smaller rod domain). In a preferred embodiment, an individual having DMD and being treated with the oligonucleotide described herein is provided with a dystrophin exhibiting at least the same activity as wild-type dystrophin. If the individual is or is suspected of being a Duchenne patient, the functional or semi-functional dystrophin is the dystrophin of the individual having BMD. Typically, the dystrophin can interact with both actin and DGC or DAPC, but it is more preferable that its central rod domain may be shorter than that of wild-type dystrophin (Monaco et al., 1988). The central rod domain of wild-type dystrophin contains 24 spectrin-like repeats.For example, the central rod domain of dystrophin provided herein may contain 5-23, 10-22, or 12-18 spectrin-like repeats, as long as they can bind to actin and DGC.
[0072] The alleviation of one or more symptoms of Duchenne muscular dystrophy or Becker muscular dystrophy in an individual using the oligonucleotides of the present invention can be evaluated by any of the following assays: extension of time to inability to walk, improvement in muscle strength, improvement in ability to lift heavy objects, improvement in time required to get up from the floor, improvement in time to walk 9 meters, improvement in time required to climb 4 steps, improvement in leg function grade, improvement in lung function, improvement in cardiac function, and improvement in quality of life. Each of these assays is known to those skilled in the art. As an example, the publication of Manzur et al. (2008) provides a detailed description of each of these assays. For each of these assays, if a detectable improvement or extension of the parameter measured in the assay is found, it preferably means that one or more symptoms of Duchenne muscular dystrophy or Becker muscular dystrophy are alleviated in the individual using the oligonucleotides of the present invention. The detectable improvement or extension is preferably a statistically significant improvement or extension as described by Hodgetts et al. (2006). Alternatively, the alleviation of one or more symptoms of Duchenne muscular dystrophy or Becker muscular dystrophy can be assessed by measuring improvements in muscle fiber function, integrity, and / or survival time. In preferred methods, one or more symptoms of a DMD or BMD patient are alleviated and / or one or more characteristics of one or more muscle cells derived from a DMD or BMD patient are improved. Such symptoms or characteristics can also be assessed at the cellular, tissue, or patient level.
[0073] The relaxation of one or more characteristics of patient-derived muscle cells can be assessed by any of the following assays in patient-derived myobiocytes or muscle cells: reduced calcium uptake by muscle cells, decreased collagen synthesis, morphological changes, altered lipid biosynthesis, reduced oxidative stress, and / or improvements in muscle fiber function, integrity, and / or survival time. These parameters are typically assessed using immunofluorescence and / or histochemical analysis of cross-sections of muscle biopsies. Improvements in muscle fiber function, integrity, and / or survival can be assessed using at least one of the following assays: a detectable decrease in blood creatine kinase, a detectable decrease in muscle fiber necrosis in a biopsy cross-section of suspected dystrophic muscle, and / or a detectable increase in the uniformity of muscle fiber diameter in a biopsy cross-section of suspected dystrophic muscle. Each of these assays is known to those skilled in the art.
[0074] Creatine kinase can be detected in the blood, as described by Hodgetts et al. (2006). A detectable decrease in creatine kinase may mean a decrease of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more compared to the creatine kinase concentration in the same DMD or BMD patient before treatment.
[0075] A detectable reduction in muscle fiber necrosis is preferably assessed in a muscle biopsy, more preferably using a biopsy cross section as described by Hodgetts et al. (2006). A detectable reduction in necrosis may be a reduction of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the area (necrosis was identified using a biopsy cross section). The reduction is measured by comparing it to necrosis assessed in the same DMD or BMD patient before treatment.
[0076] A detectable increase in the uniformity of muscle fiber diameter is preferably assessed in a muscle biopsy cross-section, more preferably as described by Hodgetts et al. (2006). The increase is measured by comparison with the uniformity of muscle fiber diameter in the same DMD or BMD patient before treatment.
[0077] Preferably, the oligonucleotides of the present invention provide the individual with a functional or semi-functional dystrophin protein (typically in the case of DMD) and can at least partially reduce the production of abnormal dystrophin protein in the individual (typically in the case of BMD).
[0078] Reducing the production of abnormal dystrophin mRNA or abnormal dystrophin protein preferably means reducing the initial amount of abnormal dystrophin mRNA or abnormal dystrophin protein to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5% or less, while still detectable by RT PCR (mRNA) or immunofluorescence or Western blot analysis (protein). Abnormal dystrophin mRNA or protein is also referred herein to as less functional (compared to the wild-type functional dystrophin protein described above) or non-functional dystrophin mRNA or protein. Non-functional dystrophin protein is preferably a dystrophin protein that cannot bind to members of the actin and / or DGC protein complex. Non-functional dystrophin protein or dystrophin mRNA typically does not have or encode a dystrophin protein with an untreated C-terminus of the protein. Detection of functional or semi-functional dystrophin mRNA or protein can be carried out in the same manner as for abnormal dystrophin mRNA or protein.
[0079] When functional or semi-functional dystrophin protein is provided to DMD patients, at least some of the causes of DMD are eliminated. Therefore, it is expected that the symptoms of DMD will be alleviated, at least partially. Increased skipping frequency also increases the levels of functional or semi-functional dystrophin protein produced in muscle cells of individuals with DMD or BMD.
[0080] Exons contain one or more specific sequences including splicing regulatory elements that have been shown to be effective targets for antisense oligonucleotides (Aartsma-Rus et al., 2010). Thus, one embodiment provides an oligonucleotide for providing a functional or semi-functional dystrophin protein to an organism, wherein the oligonucleotide contains sequences that specifically bind to, target and / or hybridize and / or block these splicing regulatory elements in the dystrophin mRNA precursor exon. Such an oligonucleotide can bind to and / or target and / or hybridize and / or block these splicing regulatory elements in the dystrophin mRNA precursor. Furthermore, since the exon is contained in the mRNA from which the exon is derived only when both splice sites are recognized by the spliceosome complex, the splice sites are other targets of the oligonucleotide of the present invention. Accordingly, one embodiment provides an oligonucleotide for providing a functional or semi-functional dystrophin protein to the organism, comprising a sequence that specifically binds to and / or targets and / or hybridizes to and / or blocks one or both of the splice sites of the exons of the dystrophin mRNA precursor. Such an oligonucleotide can bind to and / or target, hybridize to and / or block one or both of these splice sites of the exons of the dystrophin mRNA precursor. Typically, the splice sites of an exon contain one, two, or three or more nucleotides present in the exon and one, two, or three or more nucleotides present in adjacent or neighboring introns. In one embodiment, an oligonucleotide is used that binds to and / or targets and / or hybridizes to the intron region of the dystrophin mRNA precursor alone. Such an oligonucleotide can bind to and / or target and / or hybridize to the intron region. However, this is not necessary.Oligonucleotides that target and / or bind to and / or hybridize to and / or can target and / or bind to and / or hybridize to intron-specific sequences and exon-specific sequences can also be used. Naturally, the oligonucleotide does not need to bind to and / or target and / or hybridize to the entire dystrophin exon or intron sequence. Such oligonucleotides also do not need to be able to bind to and / or target and / or hybridize to the entire dystrophin exon or intron sequence. Oligonucleotides that specifically bind to, target and / or hybridize to and / or specifically bind to and / or target and / or hybridize to a portion of such exons or introns are preferred. Oligonucleotides are used, wherein the oligonucleotides are preferably inversely complementary to and / or bind to and / or target and / or hybridize to and / or can bind to and / or target and / or hybridize to at least a portion of the dystrophin exons and / or introns (the portion having at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides).
[0081] Splicing of the dystrophin mRNA precursor occurs via two sequential esterification reactions involving intron branching points and splice sites of adjacent introns. Therefore, oligonucleotides are used for exon skipping, and the oligonucleotides contain sequences that bind to and / or target and / or hybridize to and / or can bind to and / or can target and / or hybridize to such branching points and / or splice sites. The splice sites and / or branching points are preferably present in the dystrophin mRNA precursor.
[0082] Because the splice sites contain common sequences, the use of an oligonucleotide portion or its functional equivalent containing a sequence that can bind to and / or can bind to and / or can target and / or hybridize to and / or binds to and / or targets and / or hybridizes to and / or binds to and / or targets and / or hybridizes to and / or binds to the splice sites carries the risk of accidental hybridization. Hybridization of the oligonucleotide to other splice sites other than the skipped exon sites can easily interfere with the accuracy of the splicing process. To overcome these and other potential problems associated with the use of oligonucleotides that can bind to and / or hybridize to and / or target and / or bind to and / or target and / or hybridize to the splice sites, the most preferred embodiment provides an oligonucleotide for providing a functional or semi-functional dystrophin protein to the organism, wherein the oligonucleotide or its functional equivalent can bind to and / or hybridize to and / or target and / or bind to and / or hybridize to and / or target a specific portion of the dystrophin mRNA precursor exon. The exon contains a coding sequence that is typically even more specific to the non-coding intron sequence. The oligonucleotides that bind to and / or hybridize to and / or target and / or can bind to and / or hybridize to and / or can target specific portions of the dystrophin mRNA precursor exon are preferably capable of specifically blocking, interfering with, and / or inhibiting the splicing control sequences and / or structures of the anticpated exon in the dystrophin mRNA precursor. Interfering with such splicing control sequences and / or structures has the advantage that such elements are located within the exon. The risk of sequence-related out-of-target effects is therefore limited. By providing oligonucleotides within the skipped exon, the exon can be shielded from the splicing apparatus. Therefore, failure of the splicing apparatus that recognizes the skipped exon results in the exclusion of the exon from the final mRNA.This embodiment does not directly interfere with the enzymatic process of the splicing mechanism (exon conjugation). This is considered to make the method more specific and / or reliable. Oligonucleotides that can bind to and / or can bind to and / or can target and / or can hybridize to and / or bind to and / or hybridize and / or target exons at any point have been found to induce exon skipping.
[0083] The oligonucleotides of the present invention may include functional equivalents or equivalents of oligonucleotides. Functional equivalents or equivalents of oligonucleotides preferably mean the oligonucleotides described herein, wherein one or more nucleotides are substituted, and the activity of the functional equivalent or equivalent is retained to at least some extent. The activity of the oligonucleotides containing functional equivalents or equivalents of oligonucleotides preferably provides a functional or semi-functional dystrophin protein. The activity of the oligonucleotides containing functional equivalents or equivalents of oligonucleotides is therefore preferably evaluated by quantifying the amount of functional or semi-functional dystrophin protein. In this specification, functional or semi-functional dystrophin is preferably defined as a dystrophin capable of binding to members of the actin and DGC (or DAPC) protein complex. The evaluation of the activity of the functional equivalents of oligonucleotides is preferably performed by RT-PCR and sequencing (at the RNA level; for detection of specific exon skipping) or by immunofluorescence and Western blot analysis (at the protein level; for detection of protein repair). The activity is preferably retained to at least a certain extent, such that it exhibits at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% or more of the corresponding activity of the functional equivalent or the oligonucleotide from which the equivalent is derived. Throughout this specification, where the term oligonucleotide is used, it may be replaced by its functional equivalent or equivalent as described herein. In one embodiment, the equivalent or functional equivalent of the oligonucleotide of the present invention includes modifications. Throughout this specification, where the term oligonucleotide is used, unless otherwise specified, it may be replaced by the antisense oligonucleotide as described herein.
[0084] Therefore, the use of oligonucleotides or their functional equivalents or equivalents represented by nucleotide sequences comprising a 2'-O-methylphosphorothioate RNA monomer or consisting of 2'-O-methylphosphorothioate RNA, containing 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or 2,6-diaminopurine bases, and containing / being inversely complementary to and / or binding to and / or targeting and / or hybridizing to and / or binding to and / or targeting and / or hybridizing to the dystrophin mRNA precursor exon, is considered to have a favorable effect on at least one of the parameters of the oligonucleotides (as previously defined herein) compared to their counterparts (i.e., so-called unmodified oligonucleotides) that do not contain any of 5-methylcytosine, 5-methyluracil, and 2,6-diaminopurine, and is therefore considered to exhibit improved therapeutic outcomes in patients' DMD or BMD cells and / or DMD or BMD patients. Such therapeutic outcomes are To alleviate one or more symptoms of DMD or BMD, and / or To mitigate one or more characteristics of patient-derived muscle cells, and / or To provide the aforementioned individual with a functional or semi-functional dystrophin protein, and / or To at least partially reduce the production of abnormal dystrophin protein in the aforementioned individual. It can be characterized by:
[0085] Each of these characteristics has already been described herein.
[0086] An oligonucleotide is represented by a nucleotide sequence that includes or comprises a sequence that binds to and / or targets and / or is inversely complementary to and / or hybridizes to and / or can bind to and / or can target and / or can hybridize to and / or is inversely complementary to at least a portion of dystrophin mRNA precursor exons 44-55, wherein the oligonucleotide is preferably at least 10 nucleotides long. However, the length of the oligonucleotide may be at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Throughout this specification, the sequence representing an oligonucleotide may also be referred to as a base or nucleotide sequence.
[0087] The oligonucleotides of the present invention are preferably represented by nucleotide sequences or base sequences that include or comprise sequences that bind to and / or target and / or are inversely complementary to and / or hybridize to and / or can bind to and / or can hybridize to and / or can target to a portion of the exons of the dystrophin mRNA precursor. The binding or targeting portion may comprise at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or up to 98% and 100% of the length of the oligonucleotide of the present invention. The oligonucleotides may be represented by nucleotides or base sequences that comprise at least a portion of exons selected from the group consisting of exons 44 to 55 of the dystrophin mRNA precursor described herein, and sequences that bind to and / or target and / or are inversely complementary to and / or hybridize to and / or can bind to and / or can hybridize to and / or can target to additional adjacent sequences. In a more preferred embodiment, the length of the binding or targeting portion of the oligonucleotide is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Several types of flanking sequences may be used. The flanking sequence is preferably used to modify the binding of the protein to the oligonucleotide or to modify the thermodynamic properties of the oligonucleotide, and more preferably to modify the target RNA binding affinity. In another preferred embodiment, the additional flanking sequence is inversely complementary to a dystrophin mRNA precursor sequence that is not present in the exon. Such a flanking sequence is preferably capable of binding to and / or targeting sequences that include or consist of branching points and / or splice site receptors or donor common sequences of the exon. In a preferred embodiment, such adjacent sequences are capable of binding to and / or targeting sequences that include or consist of intron sequences of the dystrophin mRNA precursor adjacent to the exon.
[0088] A preferred embodiment is an oligonucleotide for providing a functional or semi-functional dystrophin protein to the organism, wherein the oligonucleotide or its functional equivalent or equivalent is Sequences that bind to, can bind to, target, hybridize to, or are inversely complementary to regions of dystrophin mRNA precursor exons (closed structures) that hybridize to other parts of the dystrophin mRNA precursor exon, and A sequence that binds to and / or targets and / or hybridizes with and / or is inversely complementary to and / or can bind to and / or can target and / or can hybridize with a region of the dystrophin mRNA precursor exon that does not hybridize within the dystrophin mRNA precursor (open structure). This provides an oligonucleotide represented by a sequence or base sequence containing [a specific element].
[0089] Refer to International Publication No. 2004 / 083446 for this embodiment. RNA molecules exhibit robust secondary structures primarily for the base pairing of complementary or partially complementary stretches within the same RNA. It has long been believed that the structure within RNA plays a role in its function. Without being constrained by theory, it is thought that the RNA secondary structure of exons plays a role in constructing the splicing process. Through this structure, exons are recognized as the portion that must be included in mRNA. In one embodiment, oligonucleotides can interfere with the structure of an exon, and therefore can interfere with the splicing apparatus of the exon, masking the exon from the splicing apparatus and thereby inducing the skipping of the exon. A number of oligonucleotides have been found to actually possess this ability and to be somewhat more efficient than others. Without being constrained by theory, it is thought that duplications with open structures improve the infiltration efficiency of oligonucleotides (i.e., increase the efficiency with which oligonucleotides can penetrate the structure), while duplications with closed structures then increase the efficiency of interfering with the RNA secondary structure of the exon. It has been found that the length of partial reverse complementarity to both closed and open structures is not extremely limited. The inventors have observed high efficiency in compounds containing oligonucleotides of various lengths having reverse complementarity in any of the structures. The term (reverse) complementarity is used herein to refer to a stretch of nucleic acid that can hybridize to another stretch of nucleic acid under physiological conditions. Hybridization conditions are described below herein. Therefore, it is not absolutely required that all bases in the complementary region can pair with the bases of the opposite strand. For example, when designing antisense oligonucleotides, it may be desirable to incorporate residues that do not base pair with bases on the complementary strand. Under cellular environmental conditions, mismatches may be tolerated to some extent, and the nucleotide stretch can hybridize to the complementary region.
[0090] In preferred embodiments, the reverse-complementary portion of the antisense oligonucleotide (either the open or closed structure) comprises at least three, more preferably at least four, consecutive nucleotides. The reverse-complementary region is preferably designed so that, when combined, they are specific to exons in the mRNA precursor. Such specificity depends on the actual sequence in other mRNAs (precursors) in the system and can therefore be produced with reverse-complementary regions of varying lengths. The risk that one or more other mRNA precursors can also hybridize to the oligonucleotide decreases with increasing oligonucleotide size. It is clear that antisense oligonucleotides containing mismatches in the reverse-complementary region but retaining the ability to hybridize to the targeted region in the mRNA precursor are usable in the present invention. However, it is preferable that at least the reverse-complementary portion does not contain such mismatches, as this typically results in higher efficiency and specificity than oligonucleotides having such mismatches in one or more reverse-complementary regions. Higher hybridization strength (i.e., an increase in the number of interactions in the opposite strand) is considered advantageous in increasing the efficiency of the process that interferes with the splicing mechanism of the system. A reverse complementarity of 90-100% is preferred. Generally, this allows for one or two mismatches in a 20-nucleotide oligonucleotide and one to four mismatches in a 40-nucleotide oligonucleotide. Therefore, the inventors believe that oligonucleotides of 10-50 nucleotides may have one, two, three, four, or five mismatches. It is preferable that 0, one, or two mismatches are present in oligonucleotides of 10-50 nucleotides.
[0091] The structure (i.e., open and closed structures) is well analyzed in the contents of the mRNA precursor to which the exon belongs. Such structures can be analyzed in actual RNA. However, it is now possible to predict the secondary structure of RNA molecules (at the lowest energy cost) very well using structure modeling programs. Non-limiting examples of suitable programs are RNA Structure version 4.5 or RNA mfold version 3.5 (Zuker et al., 2003). Those skilled in the art can predict the expected structure of an exon for a given nucleotide sequence with good reproducibility. The best predictions are obtained when such modeling is provided with both the exon and the adjacent intron sequence. It is typically not necessary to model the structure of the full-length mRNA precursor.
[0092] The open and closed structures targeted by the oligonucleotide are preferably adjacent to each other. Thus, annealing of the oligonucleotide to the open structure is thought to induce the opening of the closed structure, and annealing immediately proceeds to this closed structure. Through this action, the previously closed structure becomes a different conformation. However, if a cryptic splice receptor and / or donor sequence is present within the targeted exon, a novel exon inclusion signal or splicing regulatory sequence, element, structure, or signal may be generated, revealing a different (neo)exon (i.e., having a different 5' end, a different 3' end, or both). This type of activity is within the scope of the present invention because the targeted exon is excluded from the mRNA. The presence of a novel exon (containing a portion of the targeted exon) in the mRNA does not alter the fact that the targeted exon (itself) is excluded. Neoexon inclusion may be observed as an occasional side effect. When exon skipping is used to repair (part of) the open reading frame of dystrophin that is disrupted as a result of mutation, there are two possibilities. One is that the neoexon is functional in repairing the reading frame, while in the other the reading frame is not repaired. If compounds containing oligonucleotides are selected by means of exon skipping to repair the dystrophin reading frame, it is obvious that under these conditions only these compounds containing these oligonucleotides will be selected, and that exon skipping that repairs the dystrophin open reading frame (with or without neoexons) will actually occur.
[0093] Further provided are oligonucleotides for providing a functional or semi-functional dystrophin protein to the organism, the oligonucleotide or its functional equivalent or equivalent thereof comprising a 2'-O-methylphosphorothioate RNA monomer or consisting of 2'-O-methylphosphorothioate RNA, comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, and represented by a nucleotide or base sequence comprising a sequence that is inversely complementary to and / or binds to and / or targets and / or hybridizes with and / or can bind to and / or can target and / or hybridizes with the binding site for the serine-arginine (SR) protein in the RNA of the exons of the dystrophin mRNA precursor. In International Patent Publication No. 2006 / 112705, the inventors disclosed the existence of a correlation between the effectiveness of an exon-internal antisense oligonucleotide in inducing exon skipping and the presence of an SR binding site predicted (e.g., by ESEfinder) at the target mRNA precursor site of the AON. Accordingly, in one embodiment, the oligonucleotide is produced by a method comprising determining the (presumed) binding site for the SR (Ser-Arg) protein in the RNA of a dystrophin exon, and producing a corresponding compound that is inversely complementary to and / or binds to and / or targets and / or hybridizes to and / or can bind to and / or can target and / or hybridizes with the RNA, and at least partially overlaps the (presumed) binding site. The term "at least partially overlapping" is defined herein as including overlapping of only a single nucleotide of the SR binding site and overlapping of multiple nucleotides of the binding site and complete overlapping of the binding site.This embodiment preferably further includes determining from the secondary structure of the RNA a region that hybridizes to another part of the RNA (closed structure) and a region that does not hybridize to the structure (open structure), and then generating an oligonucleotide that at least partially overlaps the (presumed) binding site, overlaps to at least a portion of the closed structure, and overlaps to at least a portion of the open structure. In this way, the inventors increase the opportunity to obtain an oligonucleotide that prevents exon inclusion from mRNA precursor to mRNA. If the initially selected SR-binding region does not have the required open-close structure, then another (second) SR protein binding site can be selected and then examined for the presence of an open-close structure. This step is continued until a sequence containing an SR protein binding site and an (partially overlapping) open-close structure is identified. This sequence is then used to design an oligonucleotide that is inversely complementary to the sequence.
[0094] Such a method for generating antisense oligonucleotides can also be carried out by reversing the order described, namely, first determining (from the secondary structure of RNA derived from dystrophin exons) which regions will become a structure that hybridizes to another part of the RNA (closed structure) and which regions will not hybridize into the structure (open structure); and then generating oligonucleotides in which at least a portion of the oligonucleotide is inversely complementary to the closed structure and at least another portion of the oligonucleotide is inversely complementary to the open structure. This is then followed by determining whether the SR protein binding site overlaps with the open / closed structure at least. Thus the method of International Publication No. 2004 / 083446 is improved. In yet another embodiment, the selection is carried out simultaneously.
[0095] Without being constrained by any theory, it is currently believed that the use of oligonucleotides targeting or targeting the SR protein binding site impairs (at least partially) the binding of the SR protein to its binding site, resulting in disrupted or impaired splicing.
[0096] The open / closed structure and the SR protein binding site preferably partially overlap, and more preferably the open / closed structure completely overlaps the SR protein binding site or the SR protein binding site completely overlaps the open / closed structure. This allows for improved disruption of exon inclusions.
[0097] In addition to common splice sites and branching point intron sequences, numerous (but not all) exons contain splicing regulatory sequences, such as exon splicing enhancer (ESE) sequences, which facilitate the recognition of the original splice site by the spliceosome (Cartegni et al., 2002; and Cartegni et al., 2003). A subgroup of splicing factors, called SR proteins, can bind to these ESEs and recruit other splicing factors, such as U1 and U2AF, to (unidentified) splice sites. The binding sites of the four most abundant SR proteins (SF2 / ASF, SC35, SRp40, and SRp55) have been analyzed in detail, and these results are performed in ESEfinder (a web-based resource predicting potential binding sites for these SR proteins) (Cartegni et al., 2002; and Cartegni et al., 2003). There is a correlation between the effectiveness of an oligonucleotide and the presence / absence of SF2 / ASF, SC35, and SRp40 binding sites at the site targeted by the oligonucleotide. Therefore, in a preferred embodiment, the present invention provides the oligonucleotide that is inversely complementary to and / or targets and / or binds to and / or hybridizes with and / or can target and / or bind to and / or can hybridize with the binding site to the SR protein. The SR protein is preferably SF2 / ASF, SC35, or SRp40.
[0098] In one embodiment, a functional or semi-functional dystrophin protein is provided to a DMD patient by using an oligonucleotide or functional equivalent thereof, or an equivalent thereof, that contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and contains 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, and is capable of specifically binding to, targeting, and / or binding to, and / or targeting, and / or hybridizing to a regulatory RNA sequence necessary for correcting dystrophin exon splicing in the transcript. Several cis-active RNA sequences are necessary for correcting exon splicing in the transcript. In particular, elements such as exon splicing enhancers (ESEs), exon recognition sequences (ERSs), and / or exon splicing silencers (ESSs) are identified to control the specific and efficient splicing of constitutive and alternative exons. Using sequence-specific antisense oligonucleotides or base-specific antisense oligonucleotides (AONs) that bind to and / or target and / or are inversely complementary to and / or hybridize to and / or can bind to and / or can hybridize to and / or can target the element, their regulatory functions are disrupted and exons are skipped as shown for DMDs. Therefore, in one preferred embodiment, an oligonucleotide or functional equivalent thereof, or equivalent thereof, that is inversely complementary to and / or binds to and / or targets and / or hybridizes to and / or can bind to and / or can target and / or can hybridize to an exon splicing enhancer (ESE), an exon recognition sequence (ERS), and / or an exon splicing silencer (ESS), is used.
[0099] In preferred embodiments, the oligonucleotides of the present invention include or comprise sequences or nucleotide sequences that are inversely complementary to and / or bind to and / or target and / or hybridize with and / or can bind to and / or can target and / or hybridize with at least a portion of dystrophin mRNA precursor exons 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55, wherein the portion comprises at least 10 nucleotides. However, the portion may also comprise at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. With respect to the dystrophin exon described above, the inventors provide a stretch of nucleotides of the exon to which an oligonucleotide can bind and / or is inversely complementary and / or targeted and / or hybridize and / or bind and / or be targeted and / or hybridize (SEQ ID NOs: 2-13 as defined below).
[0100] Regarding Exxon 44 skipping, 5'-GCGAUUUGACAGAUCUGUUGAGAAAUGGCGGCGUUUUCAUUAUGAUAUAAAGAUAUUUAAUCAGUGGCUAACAGAAGCUGAACAGUUUCUCAGAAAGACACAAAUUCCUGAGAAUUGGGAACAUGCUAAAUACAAAUGGUAUCUUAAG-3' (SEQ ID NO: 2) Regarding skipping with Exxon 45, 5'-GAACUCCAGGAUGGCAUUGGGCAGCGGCAAACUGUUGUCAGAACAUUGAAUGCAACUGGGGAAGAAAUAAUUCAGCAAUCCUCAAAAACAGAUGCCAGUAUUCUACAGGAAAAAUUGGGAAGCCUGAAUCUGCGGUGGCAGGAGGUCUGCAAACAGCUGUCAGACAGAAAAAAGAG-3' (SEQ ID NO: 3) Regarding skipping Exxon 46, 5'-GCUAGAAGAACAAAAGAAUAUCUUGUCAGAAUUUCAAAGAGAUUAAAUGAAUUUGUUUUAUGGUUGGAGGAAGCAGAUAACAUUGCUAGUAUCCCACUUGAACCUGGAAAAGAGCAGCAACUAAAAGAAAAGCUUGAGCAAGUCAAG-3' (SEQ ID NO: 4) Regarding skipping Exxon 47, 5'-UUACUGGUGGAAGAGUUGCCCCUGCGCCAGGGAAUUCUCAAACAAUUAAAUGAAACUGGAGGACCCGUGCUUGUAAGUGCUCCCAUAAGCCCAGAAGAGCAAGAUAAACUUGAAAAUAAGCUCAAGCAGACAAAUCUCCAGUGGAUAAAG-3' (SEQ ID NO: 5) Regarding skipping with Exxon 48, 5'-GUUUCCAGAGCUUUACCUGAGAAACAAGGAGAAAUUGAAGCUCAAAUAAAAGACCUUGGGCAGCUUGAAAAAAAGCUUGAAGACCUUGAAGAGCAGUUAAAUCAUCUGCUGCUGUGGUUAUCUCCUAUUAGGAAUCAGUUGGAAAUUUAACCAACCAAACCAAGAAGGACCAUUUGACGUUCAG-3' (SEQ ID NO: 6) Regarding skipping Exxon 49, 5'-GAAACUGAAAUAGCAGUUCAAGCUAAACAACCGGAUGUGGAAGAGAUUUUGUCUAAAGGGCAGCAUUUGUACAAGGAAAAACCAGCCACUCAGCCAGUGAAG-3' (SEQ ID NO: 7) Regarding skipping with Exxon 50, 5'-AGGAAGUUAGAAGAUCUGAGCUCUGAGUGGAAGGCGGUAAACCGUUUACUUCAAGAGCUGAGGGCAAAGCAGCCUGACCUAGCUCCUGGACUGACCACUAUUGGAGCCU-3' (SEQ ID NO: 8) Regarding skipping Exxon 51, 5'-CUCCUACUCAGACUGUUACUCUGGUGACACAACCUGUGGUUACUAAGGAAACUGCCAUCUCCAAACUAGAAAUGCCAUCUUCCUUGAUGUUGGAGGUACCUGCUCUGGCAGAUUUCAACC GGGCUUGGACAGAACUUACCGACUGGCUUUCUCUGCUUGAUCAAGUUAUAAAAUCACAGAGGGUGAUGGUGGUGACCUUGAGGAUAUCAACGAGAUGAUCAUCAAGCAGAAG-3' (SEQ ID NO: 9) Regarding skipping Exxon 52, 5'-GCAACAAUGCAGGAUUUGGAACAGAGGCGUCCCCAGUUGGAAGAACUCAUUACCGCUGCCCAAAAUUUGAAAAACAAGACCAGCAAUCAAGAGGCUAGAACAAUCAUUACGGAUCGAA-3' (SEQ ID NO: 10) Regarding skipping Exxon 53, 5'-UUGAAAGAAUUCAGAAUCAGUGGGAUGAAGUACAAGAACACCUUCAGAACCGGAGGCAACAGUUGAAUGAAAUUAAAGGAUUCAACACAAUGGCUGGAAGCUAAGGAAGAAGCUGAGCAGGUCUUAGGACAGGCCAGAGCCAAGCUUGAGUCAUGGAAGGAGGGUCCCUAUACAGUAGAUGCAAUCCAAAAGAAAAUCACAGAAACCAAG-3' (SEQ ID NO: 11) Regarding Exxon 54 skipping, 5'-CAGUUGGCCAAAGACCUCCGCCAGUGGCAGACAAAUGUAGAUGUGGCAAAUGACUUGGCCCUGAAACUUCUCCGGGAUUAUUCUGCAGAUGAUACCAGAAAAGUCCACAUGAUAACAGAGAAUAUCAAUGCCUCUUGGAGAAGCAUUCAUAAAAG-3' (SEQ ID NO: 12) Regarding skipping with Exxon 55, 5'-GGUGAGUGAGCGAGAGGCUGCUUUGGAAGAAACUCAUAGAUUACUGCAACAGUUCCCCCUGGACCUGGAAAAGUUUCUUGCCUGGCUUACAGAAGCUGAAACAACUGCCAAUGUCCUACAGGAUGCUACCCGUAAGGAAAGGCUCCUAGAAGACUCCAAGGGAGUAAAAGAGCUGAUGAAACAAUGGCAA-3' (SEQ ID NO: 13)
[0101] Therefore, preferred oligonucleotides contain or consist of a 2'-O-methylphosphorothioate RNA monomer, more preferably containing 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, and bind to and / or are inversely complementary to and / or target and / or hybridize to and / or can bind to and / or target and / or can hybridize to a continuous stretch of 10 to 33 nucleotides within one of the exon nucleotide sequences selected from SEQ ID NOs. 2 to 13.
[0102] Preferred oligonucleotides are also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, It binds to and / or is inversely complementary to and / or targets and / or hybridizes to and / or can bind to and / or can target and / or can hybridize to a continuous stretch of 10 to 33 nucleotides within one of the exon nucleotide sequences selected from the above sequence numbers 2 to 13.
[0103] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base.
[0104] More preferred oligonucleotides contain 2'-O-methyl phosphorothioate RNA monomers or consist of 2'-O-methyl phosphorothioate RNA, more preferably contain 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or 2,6-diaminopurine bases, and are represented by nucleotide or base sequences that include or consist of SEQ ID NOs: 14 to 90, or by nucleotide or base sequences that include or consist of fragments of SEQ ID NOs: 14 to 90. SEQ ID NOs: 14 to 90 are shown in Table 1. In this regard, "5-methylpyrimidine" means at least one 5-methylpyrimidine. Therefore, "at least one 5-methylpyrimidine" means at least one 5-methylcytosine and / or at least one 5-methyluracil.
[0105] Therefore, preferred unmodified oligonucleotides preferably are derived from one of the nucleotide or base sequences of SEQ ID NOs: 14 to 90 where X = C, Y = U, Z = A, and / or are represented by SEQ ID NOs: 91, 93, 94 to 170. Each of these unmodified oligonucleotides does not contain 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and 2,6-diaminopurine. Note that SEQ ID NO: 91 is identical to SEQ ID NO: 132.
[0106] Also, preferred modified oligonucleotides are derived from one of the nucleotide or base sequences of SEQ ID NOs: 14 to 90, and contain at least one 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or at least one 2,6-diaminopurine (i.e., at least one X is m 5 C = X1 and / or at least one Y is m 5 U = Y1 and / or at least one Z is a 2A=Z1. )Includes. Note that SEQ ID NO: 92 is identical to SEQ ID NO: 199. Further preferred modified oligonucleotides are represented by nucleotides or base sequences containing or consisting of SEQ ID NOs: 92, 171-213, 215, 217, 218, 219. Further preferred modified oligonucleotides (all X=m 5 C=X1 and / or all Y=m 5 U=Y1 and / or all Z=a 2 A=Z1) is derived from the most preferred nucleotide or base sequence (SEQ ID NOs: 15, 21, 31, 40, 52, and 57) and is represented by SEQ ID NOs: 92, 171-174, 185-188, 199, 200, 202-215, 217, 218, and 219. The most preferred modified oligonucleotides are disclosed in Table 3.
[0107] In the present invention, the fragments of SEQ ID NOs. 14 to 90 or SEQ ID NOs. 91 to 219 preferably mean nucleotides or base sequences comprising or consisting of at least 10 consecutive nucleotides from SEQ ID NOs. 14 to 90 or from SEQ ID NOs. 91 to 219.
[0108] Such more preferred oligonucleotides also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, It is represented by nucleotides or base sequences containing or consisting of sequence numbers 14-90, 91, 93-170, or by nucleotides or base sequences containing or consisting of fragments of sequence numbers 14-90, 91, 93-170.
[0109] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base.
[0110] A more preferred oligonucleotide is represented by a nucleotide or base sequence comprising a 2'-O-methylphosphorothioate RNA monomer or consisting of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, and including or consisting of SEQ ID NOs. 14-90, 92, 171-215, 217, 218, 219, or comprising or consisting of fragments of SEQ ID NOs. 14-90, 92, 171-215, 217, 218, 219, and having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Preferred sequences (i.e., preferred nucleotide or base sequences) among sequence numbers 14-90, 92 and 171-215, 217, 218, 219 include sequence numbers 15, 21, 31, 40, 43, 52, 57, 59, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219, and more preferably include sequence numbers 40, 43, 52, 57, 59, 208, 207, 200, 210, 206, 171, 173, 199, 213, 185, 187.
[0111] Such even more preferred oligonucleotides also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, The oligonucleotides are represented by nucleotides or base sequences containing or consisting of SEQ ID NOs. 14-90, 91, 93-170, and 216, or by nucleotides or base sequences containing or consisting of fragments of SEQ ID NOs. 14-90, 91, 93-170, and having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Such oligonucleotides are more preferably composed of the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or 2,6-diaminopurine bases.
[0112] Such modified oligonucleotides are more preferably represented by nucleotides or base sequences containing or consisting of SEQ ID NOs. 92, 171-213, 215, 217, 218, 219, or by nucleotides or base sequences containing or consisting of fragments of SEQ ID NOs. 92, 171-213, 215, 217, 218, 219 and having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. A further preferred modified oligonucleotide is derived from the most preferred nucleotide or base sequence (SEQ ID NOs: 15, 21, 31, 40, 52, and 57) and represented by a nucleotide or base sequence containing or consisting of SEQ ID NOs: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219, or represented by a nucleotide or base sequence containing or consisting of fragments of SEQ ID NOs: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219 and having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0113] The following oligonucleotides are preferred for inducing exon 44 skipping from the dystrophin mRNA precursor.
[0114] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 14, and is represented by a nucleotide or base sequence having a length of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 14 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 14.
[0115] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 14 is represented by SEQ ID NO: 94, and a preferred fragment of SEQ ID NO: 94 is represented by SEQ ID NO: 143.
[0116] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 94, and is represented by a nucleotide or base sequence having a length of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 94 comprising or consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 94.
[0117] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. A preferred fragment of SEQ ID NO: 14 includes SEQ ID NO: 63, and a preferred fragment of SEQ ID NO: 94 includes SEQ ID NO: 143, and each of the aforementioned preferred fragments has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0118] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0119] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 15, and is represented by a nucleotide or base sequence having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 15 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 15.
[0120] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 15 is represented by SEQ ID NO: 95.
[0121] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 95, and is represented by a nucleotide or base sequence having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 95 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 95.
[0122] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. A preferred fragment of SEQ ID NO: 15 includes SEQ ID NO: 64, and a preferred fragment of SEQ ID NO: 95 includes SEQ ID NO: 144, each of which has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0123] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0124] Such preferred oligonucleotides also Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, The sequence is represented by a nucleotide or base sequence having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a nucleotide or base sequence having a fragment of SEQ ID NO: 15, 95, 64, or 144, wherein the fragment contains at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 consecutive nucleotides or bases of SEQ ID NO: 15, 95, 64, or 144.
[0125] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base.
[0126] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are replaced by 5-methylcytosine, It is more preferable that the sequence of nucleotides or bases having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 15, or that it be represented by a fragment of sequence number 15 consisting of at least 10 consecutive nucleotides or bases of sequence number 15. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0127] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All uracil is replaced by 5-methyluracil. It is more preferable that the sequence of nucleotides or bases comprising sequence number 204 and having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of sequence number 204 comprising at least 10 consecutive nucleotides or bases of sequence number 204. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0128] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are replaced by 5-methylcytosine, It is more preferable that the sequence of nucleotides or bases comprising sequence number 208 and having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of sequence number 208 comprising at least 10 consecutive nucleotides or bases of sequence number 208. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0129] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All uracils are replaced by 5-methyluracil, and all cytosines are replaced by 5-methylcytosine. It is more preferable that the sequence of nucleotides or bases comprising Sequence ID No. 205 and having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of Sequence ID No. 205 comprising or containing at least 10 consecutive nucleotides or bases of Sequence ID No. 205. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0130] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are replaced by 2,6-diaminopurine, It is more preferable that the sequence of nucleotides or bases comprising sequence number 207 and having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of sequence number 207 consisting of at least 10 consecutive nucleotides or bases of sequence number 207. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0131] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 16, and is represented by a nucleotide or base sequence having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 16 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 16.
[0132] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 16 is represented by SEQ ID NO: 96.
[0133] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 96, and is represented by a nucleotide or base sequence having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 96 comprising or consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 96.
[0134] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0135] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0136] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 17, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 17 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 17.
[0137] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 17 is represented by SEQ ID NO: 97, and a preferred fragment of SEQ ID NO: 97 is represented by SEQ ID NO: 145.
[0138] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 97, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 97 comprising or consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 97.
[0139] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. A preferred fragment of SEQ ID NO: 17 includes SEQ ID NO: 65, and a preferred fragment of SEQ ID NO: 97 includes SEQ ID NO: 145, each of which has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0140] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0141] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 18, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 18 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 18.
[0142] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 18 is represented by SEQ ID NO: 98, and the preferred fragment of SEQ ID NO: 98 is represented by SEQ ID NO: 146.
[0143] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. A preferred fragment of SEQ ID NO: 18 includes SEQ ID NO: 66, and a preferred fragment of SEQ ID NO: 98 includes SEQ ID NO: 146, each of the said fragments having a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0144] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 98, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 98 comprising or consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 98.
[0145] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0146] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 19, and is represented by a nucleotide or base sequence having a length of 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 19 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 19.
[0147] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 19 is represented by SEQ ID NO: 99.
[0148] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 99, and is represented by a nucleotide or base sequence having a length of 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 99 comprising or consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 99.
[0149] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0150] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0151] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 20, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 20 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 20.
[0152] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 20 is represented by SEQ ID NO: 100, and preferred fragments of SEQ ID NO: 100 are represented by SEQ ID NOs: 147, 148, or 149.
[0153] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including SEQ ID NO: 100, or by a fragment of SEQ ID NO: 100 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 100.
[0154] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. A preferred fragment of SEQ ID NO: 20 includes SEQ ID NO: 67, and a preferred fragment of SEQ ID NO: 100 includes SEQ ID NO: 147, each of the said fragments having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 20 includes SEQ ID NO: 68, and another preferred fragment of SEQ ID NO: 100 includes SEQ ID NO: 148, each of the said fragments having a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 20 includes SEQ ID NO: 69, and another preferred fragment of SEQ ID NO: 100 includes SEQ ID NO: 149, each of the said fragments having a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0155] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0156] The following oligonucleotides are preferred for inducing exon 45 skipping from the dystrophin mRNA precursor.
[0157] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 21, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 21 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 21.
[0158] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 21 is represented by SEQ ID NO: 101, and preferred fragments of SEQ ID NO: 101 are represented by SEQ ID NOs: 150, 151, or 152.
[0159] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 101, represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 101 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 101.
[0160] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. A preferred fragment of SEQ ID NO: 21 includes SEQ ID NO: 70, and a preferred fragment of SEQ ID NO: 101 includes SEQ ID NO: 150, with each of the aforementioned fragments having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 21 includes SEQ ID NO: 71, and another preferred fragment of SEQ ID NO: 101 includes SEQ ID NO: 151, with each of the aforementioned fragments having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 21 includes SEQ ID NO: 72, and another preferred fragment of SEQ ID NO: 101 includes SEQ ID NO: 152, each of the said fragments having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0161] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0162] Such preferred oligonucleotides also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, The nucleotide or base sequence is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides and containing or consisting of a fragment of SEQ ID NO: 21, wherein the fragment contains or consists of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 consecutive nucleotides or bases of SEQ ID NO: 21.
[0163] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base.
[0164] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are replaced by 5-methylcytosine, It is more preferable that the sequence be represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 21, or by a fragment of sequence number 21 consisting of at least 10 consecutive nucleotides or bases of sequence number 21.
[0165] Therefore, the oligonucleotide is particularly represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, which includes SEQ ID NO: 200, or by a fragment of SEQ ID NO: 200 which includes or consists of at least 10 consecutive nucleotides or bases of SEQ ID NO: 200.
[0166] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0167] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All uracils are replaced by 5-methyluracil, and all cytosines are replaced by 5-methylcytosine. It is more preferable that the sequence be represented by a nucleotide or base sequence having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, particularly including SEQ ID NO: 21 or SEQ ID NO: 209, or by a fragment of SEQ ID NO: 21 or 209 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 21 or 209. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0168] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are replaced with 2,6-diaminopurines. It is more preferable that the sequence be represented by a nucleotide or base sequence having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, particularly including SEQ ID NO: 21 or SEQ ID NO: 210, or by a fragment of SEQ ID NO: 21 or 210 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 21 or 210. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0169] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 22, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 22 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 22.
[0170] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 22 is represented by SEQ ID NO: 102.
[0171] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 102, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 102 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 102.
[0172] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0173] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0174] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 23, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 23 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 23.
[0175] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 23 is represented by SEQ ID NO: 103.
[0176] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 103, represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 103 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 103.
[0177] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0178] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0179] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 24, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 24 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 24.
[0180] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 24 is represented by SEQ ID NO: 104.
[0181] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 104, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 104 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 104.
[0182] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0183] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0184] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 25, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 25 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 25.
[0185] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 25 is represented by SEQ ID NO: 105.
[0186] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 105, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 105 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 105.
[0187] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0188] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0189] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 26, and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 26 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 26.
[0190] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 26 is represented by SEQ ID NO: 106.
[0191] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 106, and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 106 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 106.
[0192] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0193] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0194] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 27, and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 27 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 27.
[0195] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 27 is represented by SEQ ID NO: 107.
[0196] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 107, and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 107 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 107.
[0197] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0198] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0199] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 28, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 28 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 28.
[0200] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 28 is represented by SEQ ID NO: 108. SEQ ID NO: 28 and SEQ ID NO: 108, listed in Table 1, each contain a hypoxanthine base at position 7.
[0201] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 108, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 108 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 108.
[0202] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0203] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0204] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 29, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 29 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 29.
[0205] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 29 is represented by SEQ ID NO: 109.
[0206] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 109, represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 109 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 109.
[0207] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0208] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0209] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 30, and is represented by a nucleotide or base sequence having a length of 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 30 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 30.
[0210] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 30 is represented by SEQ ID NO: 110.
[0211] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 110, and is represented by a nucleotide or base sequence having a length of 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 110 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 110.
[0212] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0213] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0214] The preferred oligonucleotides for inducing exon 51 skipping from dystrophin mRNA precursor are as follows:
[0215] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 31, and is represented by a nucleotide or base sequence having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 31 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 31.
[0216] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 31 is represented by SEQ ID NO: 111, and preferred fragments of SEQ ID NO: 111 are represented by SEQ ID NO: 153 or 154.
[0217] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 111, and is represented by a nucleotide or base sequence having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 111 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 111.
[0218] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. A preferred fragment of SEQ ID NO: 31 includes SEQ ID NO: 73, and a preferred fragment of SEQ ID NO: 111 includes SEQ ID NO: 153, each of the said fragments having a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 31 includes SEQ ID NO: 74, and another preferred fragment of SEQ ID NO: 111 includes SEQ ID NO: 154, each of the said fragments having a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0219] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0220] Such preferred oligonucleotides also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, The sequence is represented by a nucleotide or base sequence having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a nucleotide or base sequence having a fragment of SEQ ID NO: 31, wherein the fragment contains or consists of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 consecutive nucleotides or bases of SEQ ID NO: 31.
[0221] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base.
[0222] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine. It is more preferable that the sequence be represented by a nucleotide or base sequence having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including SEQ ID NO: 31 or SEQ ID NO: 215, or by a fragment of SEQ ID NO: 31 or SEQ ID NO: 215 that includes or consists of at least 10 consecutive nucleotides of SEQ ID NO: 31 or SEQ ID NO: 215. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0223] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All uracils are substituted with 5-methyluracil. It is more preferable that the sequence of nucleotides or bases comprising sequence number 202 and having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of sequence number 202 comprising at least 10 consecutive nucleotides or bases of sequence number 202. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0224] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine, and all uracils are substituted with 5-methyluracil. It is more preferable that the sequence of nucleotides or bases having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 203, or that it be represented by a fragment of sequence number 203 consisting of at least 10 consecutive nucleotides or bases of sequence number 203. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0225] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, It is more preferable that the sequence of nucleotides or bases comprising sequence number 206 and having a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of sequence number 206 comprising at least 10 consecutive nucleotides or bases of sequence number 206. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0226] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 32, and is represented by a nucleotide or base sequence having a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 32 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 32.
[0227] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 32 is represented by SEQ ID NO: 112.
[0228] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 112, and is represented by a nucleotide or base sequence having a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 112 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 112.
[0229] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0230] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0231] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or 2'-O-methylphosphorothioate RNA, more preferably 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprises SEQ ID NO: 33, and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 33 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 33.
[0232] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 33 is represented by SEQ ID NO: 113.
[0233] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 113, and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 113 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 113.
[0234] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
[0235] Thus, it is more preferable that the oligonucleotide contains 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or 2,6-diaminopurine bases. Further, it is even more preferable that all cytosine and / or all uracil and / or all adenine of the oligonucleotide are substituted or modified as described herein.
[0236] In another embodiment, the oligonucleotide contains 2'-O-methyl phosphorothioate RNA monomers or consists of 2'-O-methyl phosphorothioate RNA, contains SEQ ID NO: 34, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO: 34 containing or consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 34.
[0237] Thus, the unmodified oligonucleotide derived from SEQ ID NO: 34 is represented by SEQ ID NO: 114.
[0238] Thus, in a preferred embodiment, the oligonucleotide contains 2'-O-methyl phosphorothioate RNA monomers or consists of 2'-O-methyl phosphorothioate RNA, contains SEQ ID NO: 114, and is represented by a nucleotide sequence having a length of 25, 26,, 27, 28, 29, 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO: 114 containing or consisting of at least 10 consecutive nucleotides of SEQ ID NO: 1-.
[0239] Therefore, it is more preferable that the oligonucleotide contains 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or 2,6-diaminopurine base. Further, it is more preferable that all cytosine and / or all uracil and / or all adenine of the oligonucleotide are substituted or modified as described herein.
[0240] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Preferred fragments of SEQ ID NO: 34 include or consist of SEQ ID NO: 93 (PS1116: 5’-CAACAUCAAGGAAGAUGGCAUUUCU-3’).
[0241] Such preferred oligonucleotides also contain 2’-O-methyl phosphorothioate RNA monomers or consist of 2’-O-methyl phosphorothioate RNA, include or consist of SEQ ID NO: 34 or 93 or 114, and are represented by a nucleotide or base sequence having a length of from 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides, or a nucleotide sequence including or consisting of a fragment of SEQ ID NO: 34 or 93 or 114, wherein the fragment includes or consists of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 consecutive nucleotides or bases of SEQ ID NO: 34 or 93 or 114.
[0242] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or 2,6-diaminopurine base.
[0243] The oligonucleotide is It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine. It is more preferable that the sequence of nucleotides or bases comprising sequence number 34 and having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of sequence number 34 comprising at least 10 consecutive nucleotides or bases of sequence number 34. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0244] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, It is more preferable that the sequence number 34 is represented by a nucleotide or base having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of the sequence number 34 comprising at least 10 consecutive nucleotides or bases of the sequence number 34. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0245] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 35, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 35 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 35.
[0246] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 35 is represented by SEQ ID NO: 115.
[0247] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 115, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 115 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 115.
[0248] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0249] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0250] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 36, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 36 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 36.
[0251] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 36 is represented by SEQ ID NO: 116, and preferred fragments of SEQ ID NO: 116 are represented by SEQ ID NO: 155, 156, or 157.
[0252] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioeautoRNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 116, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 116 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 116.
[0253] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. A preferred fragment of SEQ ID NO: 36 includes SEQ ID NO: 75, and a preferred fragment of SEQ ID NO: 116 includes SEQ ID NO: 155, each of the said fragments having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 36 includes SEQ ID NO: 76, and another preferred fragment of SEQ ID NO: 116 includes SEQ ID NO: 156, each of the said fragments having a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 36 includes SEQ ID NO: 77, and another preferred fragment of SEQ ID NO: 116 includes SEQ ID NO: 157, each of the said fragments having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0254] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0255] In a preferred embodiment, the oligonucleotide comprises 2'-O-methyl phosphorothioate RNA monomers or consists of 2'-O-methyl phosphorothioate RNA, more preferably contains 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or 2,6-diaminopurine bases, contains SEQ ID NO: 37, and is represented by a nucleotide or base sequence having a length of 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO: 37 comprising or consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 37.
[0256] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 37 is represented by SEQ ID NO: 117.
[0257] Therefore, in a preferred embodiment, the oligonucleotide comprises 2'-O-methyl phosphorothioate RNA monomers or consists of 2'-O-methyl phosphorothioate RNA, contains SEQ ID NO: 117, and is represented by a nucleotide or base sequence having a length of 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO: 117 comprising or consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 117.
[0258] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
[0259] Therefore, it is more preferred that the oligonucleotide contains 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or 2,6-diaminopurine bases. Further, it is even more preferred that all cytosine and / or all uracil and / or all adenosine are substituted or modified as described herein.
[0260] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 38, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 38 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 38.
[0261] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 38 is represented by SEQ ID NO: 118.
[0262] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 118, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 118 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 118.
[0263] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0264] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0265] The preferred oligonucleotides for inducing exon 52 skipping from dystrophin mRNA precursor are as follows:
[0266] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 39, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 39 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 39.
[0267] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 39 is represented by SEQ ID NO: 119.
[0268] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 119, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 119 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 119.
[0269] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0270] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0271] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine. It is more preferable that the sequence of nucleotides or bases comprising sequence number 201 and having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of sequence number 201 comprising at least 10 consecutive nucleotides or bases of sequence number 201. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0272] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 40, and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 40 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 40. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0273] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 40 is represented by SEQ ID NO: 120, and preferred fragments of SEQ ID NO: 120 are represented by SEQ ID NO: 158, 159, or 160.
[0274] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 120, and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 120 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 120.
[0275] A preferred fragment of SEQ ID NO: 40 includes SEQ ID NO: 78, and a preferred fragment of SEQ ID NO: 120 includes SEQ ID NO: 158, each fragment having a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 40 includes SEQ ID NO: 79, and another preferred fragment of SEQ ID NO: 120 includes SEQ ID NO: 159, each fragment having a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 40 includes SEQ ID NO: 80, and another preferred fragment of SEQ ID NO: 120 includes SEQ ID NO: 160, each fragment having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0276] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0277] Such preferred oligonucleotides also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, The sequence is represented by a nucleotide sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including or consisting of sequence number 40 or 120, or by a nucleotide sequence including or consisting of a fragment of sequence number 40 or 120, wherein the fragment contains or consists of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 consecutive nucleotides or bases of sequence number 40 or 120.
[0278] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base.
[0279] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine. It is more preferable that the oligonucleotide is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 40 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 40. Accordingly, the oligonucleotide is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 171 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 171. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, this is not limited to cases where all four cytosines in SEQ ID NO: 40 are modified as shown in SEQ ID NO: 171. It also includes cases where one, two, or three of these cytosines are modified.
[0280] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All uracils are substituted with 5-methyluracil. It is more preferable that the sequence of nucleotides or bases having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 172, or that it be represented by a fragment of sequence number 172 consisting of at least 10 consecutive nucleotides or bases of sequence number 172. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all seven uracils of sequence number 40 are modified as represented in sequence number 172. It includes cases where one, two, three, four, five, or six of these uracils are modified.
[0281] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, It is more preferable that the sequence of nucleotides or bases having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 173, or that it be represented by a fragment of sequence number 173 consisting of at least 10 consecutive nucleotides or bases of sequence number 173. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all five adenines of sequence number 40 are modified as represented in sequence number 173. It includes cases where one, two, three, or four of these adenines are modified.
[0282] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine, and all uracils are substituted with 5-methyluracil. It is more preferable that the oligonucleotide is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 174 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 174. Therefore, the oligonucleotide is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 174 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 174. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, this is not limited to cases where all four cytosines and all seven uracils in SEQ ID NO: 40 are modified as shown in SEQ ID NO: 174. It includes cases where one, two, or three of these cytosines and / or one, two, three, four, five, or six of these uracils are modified.
[0283] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine, and all adenines are substituted with 2,6-diaminopurine. It is more preferable that the oligonucleotide be represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 175 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 175. Therefore, the oligonucleotide is represented by a nucleotide sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 175 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 175. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, this is not limited to cases where all four cytosines and all five adenines in SEQ ID NO: 40 are modified as shown in SEQ ID NO: 175. It includes cases where one, two, or three of these cytosines and / or one, two, three, or four of these adenines are modified.
[0284] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, and all uracils are substituted with 5-methyluracil. It is more preferable that the sequence of nucleotides or bases having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 176, or that it be represented by a fragment of sequence number 176 comprising at least 10 consecutive nucleotides or bases of sequence number 176. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all five adenines and all seven uracils of sequence number 40 are modified as represented in sequence number 176. This includes cases where one, two, three, or four of these adenines and / or one, two, three, four, five, or six of these uracils are modified.
[0285] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, all cytosines are substituted with 5-methyluracil, and all uracils are substituted with 5-methyluracil. It is more preferable that the sequence of sequences includes sequence number 177 and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of sequence number 177 consisting of at least 10 consecutive nucleotides or bases of sequence number 177. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all four cytosines, all seven uracils, and all five adenines of sequence number 40 are modified to be represented in sequence number 177. This includes cases in which one, two, or three cytosines and / or one, two, three, four, five, or six uracils and / or one, two, three, or four adenines are modified.
[0286] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 41, and is represented by a nucleotide sequence or base having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 41 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 41.
[0287] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 41 is represented by SEQ ID NO: 121.
[0288] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 121, represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 121 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 121.
[0289] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0290] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0291] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 42, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 42 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 42.
[0292] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 42 is represented by SEQ ID NO: 122.
[0293] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 122, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 122 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 122.
[0294] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0295] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0296] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 43, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 43 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 43.
[0297] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0298] Such preferred oligonucleotides also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, A nucleotide sequence is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a nucleotide sequence comprising a fragment of SEQ ID NO: 43 or 123, wherein the fragment comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 consecutive nucleotides or bases of SEQ ID NO: 43 or 123. Therefore, an unmodified oligonucleotide derived from SEQ ID NO: 43 is represented by SEQ ID NO: 123, and a preferred fragment of SEQ ID NO: 123 is represented by SEQ ID NO: 161.
[0299] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 123, represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 123 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 123.
[0300] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotides are substituted or modified as described herein.
[0301] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine. It is more preferable that the oligonucleotide is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 43 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 43. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Accordingly, the oligonucleotide is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 178 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 178. Furthermore, this is not limited to cases where all six cytosines in SEQ ID NO: 43 are modified as shown in SEQ ID NO: 178. It also includes cases where one, two, three, four, or five of these cytosines are modified.
[0302] A preferred fragment of SEQ ID NO: 43 includes SEQ ID NO: 81, and a preferred fragment of SEQ ID NO: 123 includes SEQ ID NO: 161, each of the said fragments having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0303] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All uracils are substituted with 5-methyluracil. It is more preferable that the sequence number includes SEQ ID NO: 179 and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 179 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 179. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all 11 uracils of SEQ ID NO: 43 are modified as represented in SEQ ID NO: 179. It includes cases where 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of these uracils are modified.
[0304] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, It is more preferable that the sequence number includes SEQ ID NO: 180 and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 180 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 180. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where both adenines of SEQ ID NO: 43 are modified as represented in SEQ ID NO: 180. It includes cases where one of these adenines is modified.
[0305] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine, and all uracils are substituted with 5-methyluracil. It is more preferable that the oligonucleotide be represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 181 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 181. Therefore, the oligonucleotide is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 181 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 181. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, this is not limited to cases where all six cytosines and all eleven uracils in SEQ ID NO: 43 are modified as shown in SEQ ID NO: 181. It also includes cases where one, two, three, four, or five of these cytosines and / or one, two, three, four, five, six, seven, eight, nine, or ten of these uracils are modified.
[0306] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine, and all adenines are substituted with 2,6-diaminopurine. It is more preferable that the oligonucleotide be represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 182 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 182. Therefore, the oligonucleotide is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 182 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 182. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, this is not limited to cases where all six cytosines and all two adenines in SEQ ID NO: 43 are modified as shown in SEQ ID NO: 182. It includes cases where one, two, three, four, or five of these cytosines and / or one of these adenines are modified.
[0307] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, and all uracils are substituted with 5-methyluracil. It is more preferable that the sequence of sequences includes sequence number 183 and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of sequence number 183 consisting of at least 10 consecutive nucleotides or bases of sequence number 183. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all two adenines and all 11 uracils of sequence number 43 are modified as represented in sequence number 183. This includes cases where one of these adenines and / or one, two, three, four, five, six, seven, eight, nine, or ten of these uracils are modified.
[0308] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, all cytosines are substituted with 5-methylcytosine, and all uracils are substituted with 5-methyluracil. It is more preferable that the sequence of sequences includes sequence number 184 and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of sequence number 184 consisting of at least 10 consecutive nucleotides or bases of sequence number 184. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all six cytosines, all eleven uracils, and all two adenines of sequence number 43 are modified to be represented in sequence number 184. This includes cases in which one, two, three, four, or five of these cytosines and / or one, two, three, four, five, six, seven, eight, nine, or ten of these uracils and / or one of these adenines is modified.
[0309] The following oligonucleotides are preferred for inducing exon 53 skipping from dystrophin mRNA precursor.
[0310] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 44, and is represented by a nucleotide or base sequence having a length of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 44 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 44.
[0311] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 44 is represented by SEQ ID NO: 124.
[0312] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 124, and is represented by a nucleotide or base sequence having a length of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 124 comprising or consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 124.
[0313] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0314] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0315] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 45, and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 45 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 45.
[0316] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 45 is represented by SEQ ID NO: 125.
[0317] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 125, represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 125 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 125.
[0318] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0319] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0320] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 46, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 46 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 46.
[0321] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 46 is represented by SEQ ID NO: 126.
[0322] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 126, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 126 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 126.
[0323] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0324] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0325] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 47, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 47 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 47.
[0326] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 47 is represented by SEQ ID NO: 127.
[0327] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 127, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 127 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 127.
[0328] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0329] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0330] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 48, and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 48 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 48.
[0331] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 48 is represented by SEQ ID NO: 128.
[0332] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 128, represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 128 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 128.
[0333] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0334] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0335] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprises SEQ ID NO: 49, and is represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 49 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 49.
[0336] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 49 is represented by SEQ ID NO: 129.
[0337] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 129, represented by a nucleotide or base sequence having a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 129 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 129.
[0338] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0339] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0340] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 50, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 50 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 50.
[0341] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 50 is represented by SEQ ID NO: 130.
[0342] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 130, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 130 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 130.
[0343] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0344] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0345] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 51, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 51 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 51.
[0346] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 51 is represented by SEQ ID NO: 131.
[0347] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 131, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 131 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 131.
[0348] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0349] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0350] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 52, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 52 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 52.
[0351] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 52 is represented by SEQ ID NO: 91, and preferred fragments of SEQ ID NO: 91 are represented by SEQ ID NO: 162, 163, or 164. SEQ ID NO: 91 is identical to SEQ ID NO: 132.
[0352] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 91, represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 191 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 91.
[0353] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0354] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0355] Such preferred oligonucleotides also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, The nucleotide sequence is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, which includes or comprises sequence number 52 or 91, or a nucleotide sequence comprising a fragment of sequence number 52 or 91, wherein the fragment comprises or comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 consecutive nucleotides or bases of sequence number 51 or 91.
[0356] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base.
[0357] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine. It is more preferable that the sequence of nucleotides or bases comprising sequence number 52 and having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of sequence number 52 comprising at least 10 consecutive nucleotides or bases of sequence number 52. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0358] A preferred fragment of SEQ ID NO: 52 includes SEQ ID NO: 82, and a preferred fragment of SEQ ID NO: 91 includes SEQ ID NO: 162, each of which has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 52 includes SEQ ID NO: 83, and another preferred fragment of SEQ ID NO: 91 includes SEQ ID NO: 163, each of which has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 52 includes SEQ ID NO: 84, and another preferred fragment of SEQ ID NO: 91 includes SEQ ID NO: 164, each of which has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. The most preferred fragment of SEQ ID NO: 52 contains or consists of SEQ ID NO: 91 (PS229L: 5'-GUUGCCUCCGGUUCUGAAGGUGUUC-3'). Another most preferred fragment of SEQ ID NO: 52 contains or consists of SEQ ID NO: 92 (PS524: 5'-GUUGXXUXXGGUUXUGAAGGUGUUX-3' (where X is 5-methylcytosine)).
[0359] Such preferred oligonucleotides also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, Nucleotides containing or consisting of sequence numbers 82, 83, 84, 91 or 92 or 162 or 163 or 164, by nucleotides or base sequences having a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides, or containing or consisting of fragments of sequence numbers 82, 83, 84, 91 or 92 or 162 or 163 or 164 A creotide or base sequence, the fragment being represented by a nucleotide or base sequence containing or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 consecutive nucleotides or bases, as in sequence numbers 82, 83, 84, 91, 92, 162, 163, or 164.
[0360] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base.
[0361] Oligonucleotides are,
[0362] It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine. It is more preferable that the sequence is represented by a nucleotide or base sequence having a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of sequence number 82, 83, 84, or 92, comprising at least 10 consecutive nucleotides or bases of sequence number 82, 83, 84, or 92. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Sequence number 92 is identical to sequence number 199. Furthermore, it is not limited to cases where all six cytosines of sequence number 52 are modified to be represented in sequence number 92. This includes cases where 1, 2, 3, 4, or 5 of these cytosines are modified.
[0363] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, Two of those cytosines are substituted by 5-methylcytosine. It is more preferable that the sequence of nucleotides or bases having a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of the sequence of nucleotides or bases of the sequence of 218, comprising at least 10 consecutive nucleotides or bases of the sequence of 218. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0364] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, Three of those cytosines are substituted by 5-methylcytosine. It is more preferable that the sequence of nucleotides or bases having a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of sequence of nucleotides or bases having at least 10 consecutive nucleotides or bases of sequence of 219. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0365] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, Four of those cytosines are substituted by 5-methylcytosine. It is more preferable that the sequence of nucleotides or bases having a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of the sequence of nucleotides or bases of the sequence of 217, comprising at least 10 consecutive nucleotides or bases of the sequence of 217. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0366] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All uracils are substituted with 5-methyluracil. It is more preferable that the oligonucleotide be represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 211 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 211. Therefore, the oligonucleotide is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 211 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 211. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, this is not limited to cases where all nine uracils in SEQ ID NO: 52 are modified as shown in SEQ ID NO: 211. It includes cases where one, two, three, four, five, six, seven, or eight of these uracils are modified.
[0367] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine, and all uracils are substituted with 5-methyluracil. It is more preferable that the oligonucleotide be represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 212 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 212. Therefore, the oligonucleotide is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 212 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 212. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, this is not limited to cases where all six cytosines and all nine uracils in SEQ ID NO: 52 are modified as shown in SEQ ID NO: 212. It includes cases where one, two, three, four, or five of these cytosines and / or one, two, three, four, five, six, seven, or eight of these uracils are modified.
[0368] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, It is more preferable that the sequence of nucleotides or bases having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 213, or that it be represented by a fragment of sequence number 213 consisting of at least 10 consecutive nucleotides or bases of sequence number 213. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where both adenines of sequence number 52 are modified as represented in sequence number 213. It includes cases where one of these adenines is modified.
[0369] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 53, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 53 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 53.
[0370] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 53 is represented by SEQ ID NO: 133.
[0371] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 133, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 133 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 133.
[0372] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0373] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0374] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 54, and is represented by a nucleotide or base sequence having a length of 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 54 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 54.
[0375] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 54 is represented by SEQ ID NO: 134.
[0376] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 134, and is represented by a nucleotide or base sequence having a length of 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 134 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 134.
[0377] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0378] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0379] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 55, and is represented by a nucleotide or base sequence having a length of 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 55 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 55.
[0380] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 55 is represented by SEQ ID NO: 135.
[0381] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 135, and is represented by a nucleotide or base sequence having a length of 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 135 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 135.
[0382] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0383] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0384] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 56, and is represented by a nucleotide or base sequence having a length of 33, 34, or 35 nucleotides, or by a fragment of SEQ ID NO: 56 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 56.
[0385] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 56 is represented by SEQ ID NO: 136.
[0386] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 136, represented by a nucleotide or base sequence having a length of 33, 34, or 35 nucleotides, or by a fragment of SEQ ID NO: 136 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 136.
[0387] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0388] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0389] The preferred oligonucleotides for inducing exon 55 skipping from dystrophin mRNA precursor are as follows:
[0390] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 57, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 57 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 57. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0391] Such preferred oligonucleotides also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, The sequence is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, which includes or consists of SEQ ID NO: 57, or a nucleotide sequence which includes or consists of a fragment of SEQ ID NO: 57, wherein the fragment contains or consists of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 consecutive nucleotides or bases of SEQ ID NO: 57.
[0392] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 57 is represented by SEQ ID NO: 137, and preferred fragments of SEQ ID NO: 137 are represented by SEQ ID NO: 165 or 166.
[0393] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 137, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 137 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 137.
[0394] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotides are substituted or modified as described herein.
[0395] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine. It is more preferable that the sequence of sequences includes sequence number 57 and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of sequence number 57 that includes or consists of at least 10 consecutive nucleotides or bases of sequence number 57.
[0396] Therefore, the oligonucleotide is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 185 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 185. Furthermore, it is not limited to cases where all eight cytosines of SEQ ID NO: 57 are modified as represented in SEQ ID NO: 185. This includes cases where 1, 2, 3, 4, 5, 6, or 7 of these cytosines are modified.
[0397] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0398] A preferred fragment of SEQ ID NO: 57 includes SEQ ID NO: 85, and a preferred fragment of SEQ ID NO: 137 includes SEQ ID NO: 165, each of which has a length of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 57 includes SEQ ID NO: 86, and another preferred fragment of SEQ ID NO: 137 includes SEQ ID NO: 166, each of which has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0399] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All uracils are substituted with 5-methyluracil. It is more preferable that the sequence of nucleotides or bases having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 186, or that it be represented by a fragment of sequence number 186 consisting of at least 10 consecutive nucleotides or bases of sequence number 186. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all seven uracils of sequence number 57 are modified as represented in sequence number 186. It includes cases where one, two, three, four, five, or six of these uracils are modified.
[0400] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, It is more preferable that the sequence of sequences includes sequence number 187 and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of sequence number 187 consisting of at least 10 consecutive nucleotides or bases of sequence number 187. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all five adenines of sequence number 57 are modified as represented in sequence number 187. It includes cases where one, two, three, or four of these adenines are modified.
[0401] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine, and all uracils are substituted with 5-methyluracil. It is more preferable that the oligonucleotide be represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 188 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 188. Accordingly, the oligonucleotide is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 188 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 188. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, this is not limited to cases where all eight cytosines and all seven uracils in SEQ ID NO: 57 are modified as shown in SEQ ID NO: 188. It includes cases where one, two, three, four, five, six, or seven of these cytosines and / or one, two, three, four, five, or six of these uracils are modified.
[0402] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine, and all adenines are substituted with 2,6-diaminopurine. It is more preferable that the oligonucleotide is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 189 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 189. Therefore, the oligonucleotide is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 189 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 189. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, this is not limited to cases where all eight cytosines and all five adenines in SEQ ID NO: 57 are modified as shown in SEQ ID NO: 189. It includes cases where one, two, three, four, five, six, or seven of these cytosines and / or one, two, three, or four of these adenines are modified.
[0403] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, and all uracils are substituted with 5-methyluracil. It is more preferable that the sequence of nucleotides or bases having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 190, or that it be represented by a fragment of sequence number 190 comprising at least 10 consecutive nucleotides or bases of sequence number 190. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all five adenines and all seven uracils of sequence number 57 are modified as represented in sequence number 190. This includes cases where one, two, three, or four of these adenines and / or one, two, three, four, five, or six of these uracils are modified.
[0404] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, all cytosines are substituted with 5-methylcytosine, and all uracils are substituted with 5-methyluracil. It is more preferable that the sequence of sequences includes sequence number 191 and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of sequence number 191 consisting of at least 10 consecutive nucleotides or bases of sequence number 191. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all eight cytosines, all seven uracils, and all five adenines of sequence number 57 are modified to be represented in sequence number 191. This includes cases in which one, two, three, four, five, six, or seven cytosines and / or one, two, three, four, five, or six uracils and / or one, two, three, or four adenines are modified.
[0405] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 58, and is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 58 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 58.
[0406] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 58 is represented by SEQ ID NO: 138.
[0407] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 138, represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 138 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 138.
[0408] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0409] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0410] Such preferred oligonucleotides also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, The nucleotide or base sequence is represented by a nucleotide or base sequence having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including or consisting of sequence number 58 or 138, or by a nucleotide or base sequence including or consisting of a fragment of sequence number 58 or 138, wherein the fragment contains or consists of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 consecutive nucleotides or bases of sequence number 58 or 138.
[0411] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base.
[0412] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine. It is more preferable that the sequence of nucleotides or bases comprising sequence number 58 and having a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or that it be represented by a fragment of sequence number 58 comprising at least 10 consecutive nucleotides or bases of sequence number 58. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0413] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 59, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 59 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 59. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0414] Such preferred oligonucleotides also, Contains a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, The sequence is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, which includes or consists of SEQ ID NO: 59, or a nucleotide sequence which includes or consists of a fragment of SEQ ID NO: 59, wherein the fragment contains or consists of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 consecutive nucleotides or bases of SEQ ID NO: 59.
[0415] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 59 is represented by SEQ ID NO: 139, and preferred fragments of SEQ ID NO: 139 are represented by SEQ ID NO: 167, 168, 169, or 170.
[0416] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 139, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 139 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 139.
[0417] Such oligonucleotides more preferably contain the aforementioned 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotides are substituted or modified as described herein.
[0418] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine. It is more preferable that the sequence number 59 is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of the sequence number 59 that includes or consists of at least 10 consecutive nucleotides or bases of the sequence number 59.
[0419] Therefore, the oligonucleotide is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 192 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 192. Furthermore, it is not limited to cases where all five cytosines of SEQ ID NO: 59 are modified as represented in SEQ ID NO: 192. It also includes cases where one, two, three, or four of these cytosines are modified.
[0420] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0421] A preferred fragment of SEQ ID NO: 59 includes SEQ ID NO: 87, and a preferred fragment of SEQ ID NO: 139 includes SEQ ID NO: 167, each of which has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 59 includes SEQ ID NO: 88, and another preferred fragment of SEQ ID NO: 139 includes SEQ ID NO: 168, each of which has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 59 includes SEQ ID NO: 89, and another preferred fragment of SEQ ID NO: 139 includes SEQ ID NO: 169, each of which fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Another preferred fragment of SEQ ID NO: 59 includes SEQ ID NO: 90, and another preferred fragment of SEQ ID NO: 139 includes SEQ ID NO: 170, each of which fragments has a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0422] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All uracils are substituted with 5-methyluracil. It is more preferable that the sequence of nucleotides or bases having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 193, or that it be represented by a fragment of sequence number 193 consisting of at least 10 consecutive nucleotides or bases of sequence number 193. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all six uracils of sequence number 59 are modified as represented in sequence number 193. It includes cases where one, two, three, four, or five of these uracils are modified.
[0423] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, It is more preferable that the sequence of nucleotides or bases having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 194, or that it be represented by a fragment of sequence number 194 consisting of at least 10 consecutive nucleotides or bases of sequence number 194. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all six adenines of sequence number 59 are modified as represented in sequence number 194. It includes cases where one, two, three, four, or five of these adenines are modified.
[0424] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine, and all uracils are substituted with 5-methyluracil. It is more preferable that the oligonucleotide be represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 195 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 195. Therefore, the oligonucleotide is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 195 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 195. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, this is not limited to cases where all five cytosines and all six uracils in SEQ ID NO: 59 are modified as shown in SEQ ID NO: 195. It includes cases where one, two, three, or four of these cytosines and / or one, two, three, four, or five of these uracils are modified.
[0425] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All cytosines are substituted with 5-methylcytosine, and all adenines are substituted with 2,6-diaminopurine. It is more preferable that the oligonucleotide is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 196 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 196. Therefore, the oligonucleotide is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 196 consisting of at least 10 consecutive nucleotides or bases of SEQ ID NO: 196. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, this is not limited to cases where all five cytosines and all six adenines in SEQ ID NO: 59 are modified as shown in SEQ ID NO: 196. It includes cases where one, two, three, or four of these cytosines and / or one, two, three, four, or five of these adenines are modified.
[0426] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, and all uracils are substituted with 5-methyluracil. It is more preferable that the sequence of nucleotides or bases having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, including sequence number 197, or that it be represented by a fragment of sequence number 197 comprising at least 10 consecutive nucleotides or bases of sequence number 197. Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all six adenines and all six uracils of sequence number 59 are modified as represented in sequence number 197. This includes cases where one, two, three, four, or five of these adenines and / or one, two, three, four, or five of these uracils are modified.
[0427] Oligonucleotides are, It consists of 2'-O-methylphosphorothioate RNA, All adenines are substituted with 2,6-diaminopurine, all cytosines are substituted with 5-methylcytosine, and all uracils are substituted with 5-methyluracil. It is more preferable that the sequence of sequences includes sequence number 198 and is represented by a nucleotide or base sequence having a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of sequence number 198 consisting of at least 10 consecutive nucleotides or bases of sequence number 198. Such a fragment preferably has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Furthermore, it is not limited to cases where all five cytosines, all six uracils, and all six adenines of sequence number 59 are modified to be represented in sequence number 198. This includes cases in which one, two, three, or four cytosines and / or one, two, three, four, or five uracils and / or one, two, three, four, or five adenines are modified.
[0428] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 60, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 60 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 60.
[0429] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 60 is represented by SEQ ID NO: 140.
[0430] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 140, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 140 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 140.
[0431] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0432] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0433] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 61, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 61 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 61.
[0434] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 61 is represented by SEQ ID NO: 141.
[0435] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 141, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 141 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 141.
[0436] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0437] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0438] In preferred embodiments, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA, more preferably comprising 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base, comprising SEQ ID NO: 62, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 62 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 62.
[0439] Therefore, the unmodified oligonucleotide derived from SEQ ID NO: 62 is represented by SEQ ID NO: 142.
[0440] Therefore, in a preferred embodiment, the oligonucleotide comprises a 2'-O-methylphosphorothioate RNA monomer or consists of 2'-O-methylphosphorothioate RNA and comprises SEQ ID NO: 142, and is represented by a nucleotide or base sequence having a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 142 comprising at least 10 consecutive nucleotides or bases of SEQ ID NO: 142.
[0441] Such fragments preferably have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
[0442] Therefore, it is more preferable that the oligonucleotide comprises 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) and / or a 2,6-diaminopurine base. Furthermore, it is even more preferable that all cytosine and / or all uracil and / or all adenine in the oligonucleotide are substituted or modified as described herein.
[0443] Composition: In a second embodiment, a composition is provided comprising an oligonucleotide described in a section titled "Oligonils." This composition preferably comprises or consists of the above oligonucleotide.
[0444] In a preferred embodiment, the composition is for use as a pharmaceutical. Therefore, the composition is a pharmaceutical composition. Pharmaceutical compositions typically include pharmaceutically acceptable carriers, diluents, and / or excipients. In a preferred embodiment, the composition of the present invention includes the compounds described herein and optionally further includes pharmaceutically acceptable formulations, fillers, preservatives, solubilizers, carriers, diluents, excipients, salts, adjuvants, and / or solvents. Such pharmaceutically acceptable carriers, fillers, preservatives, solubilizers, diluents, salts, adjuvants, solvents, and / or excipients can be found, for example, in Remington: The Science and Practice of Pharmacy, 20th edition, Baltimore, MD: Lippincott Williams & Wilkins, 2000. The compounds described in the present invention may have at least one ionizing group. The ionizing group may be a base or an acid and may be charged or neutral. The ionizing group may exist as an ion pair with a suitable counterion having the opposite charge. Examples of cationic counterions include sodium, potassium, cesium, tris, lithium, calcium, magnesium, trialkylammonium, triethylammonium, and tetraalkylammonium. Examples of anionic counterions include chlorides, bromides, iodides, lactates, mesylates, acetates, trifluoroacetates, dichloroacetates, and citrates. Examples of counterions are described (e.g., Kumar, 2008, which is incorporated herein by reference in its entirety).
[0445] In preferred embodiments, the composition comprises the oligonucleotide of the present invention and sodium as a counterion. The oligonucleotide present in the composition may also be named the sodium form of the oligonucleotide.
[0446] In another preferred embodiment, the composition comprises the oligonucleotide of the present invention and calcium and / or magnesium as counterions. The oligonucleotide present in the composition may also be named the oligonucleotide in calcium or magnesium or mixed calcium / magnesium form.
[0447] Such compositions comprising oligonucleotides and counterions of the present invention may be obtained either by formulating a counterionic salt of the oligonucleotide or by adding an appropriate amount of the salt to the oligonucleotide. The positive effect of calcium salts present in the oligonucleotide-containing composition on the immunostimulatory effect of the oligonucleotide has been described (for example, International Publication No. 2012021985 (Replicor), which is incorporated herein by reference in its entirety).
[0448] The pharmaceutical composition may include excipients that enhance the stability, solubility, absorption, bioavailability, activity, pharmacokinetics, pharmacodynamics, and cellular uptake of the compound, particularly complexes, nanoparticles, microparticles, nanotubes, nanogels, hydrogels, poloxamers or pluronics, polymerosomes, colloids, microbubbles, vesicles, micelles, lipoplexes, and / or liposomes. Examples of nanoparticles include polymer nanoparticles, gold nanoparticles, magnetic nanoparticles, silica nanoparticles, lipid nanoparticles, sugar particles, protein nanoparticles, and peptide nanoparticles.
[0449] A preferred composition comprises at least one excipient that can further assist in enhancing the targeting and / or delivery of the composition and / or the oligonucleotide to and / or into tissues and / or cells. Preferred tissues or cells are muscle tissue or cells.
[0450] Many of these excipients are known in the art (see, e.g., Bruno, 2011) and can be classified as first-type excipients. Examples of first-type excipients include polymers (e.g., polyethyleneimine (PEI), poly-2-hydroxypropyleneimine (pHP), polypropyleneimine (PPI), dextran derivatives, butyl cyanoacrylate (PBCA), hexyl cyanoacrylate (PHCA), poly(lactic acid-co-glycolic acid) (PLGA), polyamines (e.g., spermine, spermidine, putrescine, cadaverine), chitosan, poly(amideamine) (PAMAM), poly(esteramine), polyvinyl ethers, polyvinylpyrrolidone (PVP), polyethylene glycol (PEG) cyclodextrin, hyaluronic acid, colomic acid and their derivatives), dendrimers (e.g., poly(amideamine)), lipids {e.g., 1,2-dioleoyl- 3-Dimethylammonium propane (DODAP), dioleoyldimethylammonium chloride (DODAC), phosphatidylcholine derivatives [e.g., 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC)], lysophosphatidylcholine derivatives [e.g., 1-stearoyl-2-lyso-sn-glycero-3-phosphocholine (S-LysoPC)], sphingomyelin, 2-{3-[bis-(3-amino-propyl)-amino]-propylamino}-N-ditetracedylcarbamoylmethylacetamide (RPR209120), phosphoglycerol derivatives [e.g., 1,2-dipalmitoyl-sn-glycero-3-phosphoglycerol, sodium salt (DPPG-Na)], phosphatidic acid (phosphaticid acid) derivatives [1,2-distearoyl-sn-glycero-3-phosphatidic acid, sodium salt (DSPA), phosphatidylethanolamine derivatives [e.g., dioleoyl-LR-phosphatidylethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 2-difytanol-sn-glycero-3-phosphoethanolamine (DPhyPE)], N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTMA), 1,3-di-oleoyloxy-2-(6-carboxy-spermyl-propylamide (DOSPER), (1,2-dimyristhioloxypropyl-3-dimethylhydroxyethylammonium (DMRIE), (N1-cholesteryloxycarbonyl-3,7-diazanonane-1,9-diamine (CDAN), dimethyldioctadecylammonium bromide (DDAB), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (POPC), (bL-arginyl-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl-amide trihydrochloride (AtuFECT01), 1,,N,N-dimethyl-3-aminopropionate This includes derivatives [e.g., 1,2-distearoyloxy-N,N-dimethyl-3-aminopropane] (DSDMA), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DoDMA), 1,2-dilinoleyloxy-N,N-3-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl[1,3]-dioxolane (DLin-K-DMA), phosphatidylserine derivatives [1,2-dioleyl-sn-glycero-3-phospho-L-serine, sodium salt (DOPS)], cholesterol, proteins (e.g., albumin, gelatin, atelocollagen) and peptides (e.g., protamine, PepFects, NickFects, polyarginine, polylysine, CADY, MPG).
[0451] Another preferred composition may comprise at least one excipient classified as a second type of excipient. The second type of excipient may comprise a conjugate group described herein to enhance the targeting and / or delivery of the composition and / or oligonucleotide of the present invention to and / or into tissues and / or cells (e.g., muscle tissue or cells). Both types of excipients may be mixed together in a single composition described herein.
[0452] Those skilled in the art can select, mix, and / or adapt one or more of the above or other alternative excipients and delivery systems to formulate and deliver compounds for use in the present invention.
[0453] Such pharmaceutical compositions of the present invention can be administered to animals, preferably mammals, at an effective concentration over a set period of time. A more preferred mammal is the human. Oligonucleotides or compositions described herein for use in accordance with the present invention may be suitable for direct in vivo administration to cells, tissues and / or organs of individuals suffering from or at risk of developing the diseases or conditions described herein, and may be administered directly in vivo, ex vivo, or in vitro. Administration may be via local, systemic, and / or parenteral routes, such as intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, intraocular, nasal, urogenital, intradermal, dermal, intestinal, intravitreous, intracavernosal, intracerebral, intrathecal, epidural, or oral routes.
[0454] Such pharmaceutical compositions of the present invention may preferably be encapsulated in the form of an emulsion, suspension, pill, tablet, capsule or soft gel for oral delivery, or in the form of an aerosol or dry powder for delivery to the airways and lungs.
[0455] In one embodiment, the oligonucleotides of the present invention may be used in conjunction with other compounds already known to be used in the treatment of the aforementioned diseases. Such other compounds may be used as adjuncts to reduce inflammation, preferably to reduce muscle tissue inflammation, and / or to improve muscle fiber function, integrity and / or survival, and / or to improve, increase or repair cardiac function. Examples, though not limited to these, include steroids, preferably (gluco)corticosteroids, ACE inhibitors (preferably perindopril), angiotensin II1 receptor blockers (preferably losartan), tumor necrosis factor-alpha (TNFα) inhibitors, TGFβ inhibitors (preferably decorin), human recombinant biglycan, mIGF-1 sources, myostatin inhibitors, mannose-6-phosphate, antioxidants, ion channel inhibitors, protease inhibitors, phosphodiesterase inhibitors (preferably PDE5 inhibitors such as sildenafil or tadalafil), histone deacetylase inhibitors (HDAC inhibitors), androgen receptor modulators, creatine, creatine phosphate, and / or L-arginine. Such combined use may be sequential, with each component administered in a separate composition, or each component may be used together in a single composition.
[0456] use: In further embodiments, the use of the compositions or oligonucleotides described in the preceding sections, or the application of such oligonucleotides to impart their activity to cells, is provided for use as part of a pharmaceutical or therapeutic treatment.
[0457] The oligonucleotides or compositions of the present invention are preferably intended for use as part of a pharmaceutical or therapeutic for the prevention, delay, cure, improvement and / or treatment of DMD or BMD.
[0458] method: In further embodiments, methods are provided for preventing, treating, curing, improving and / or delaying conditions or diseases described in the preceding sections in an individual, the cells, tissues, or organs of the individual. The method comprises the step of administering an oligonucleotide or composition of the present invention to the individual or subject in need thereof.
[0459] In the methods according to the present invention, the oligonucleotides or compositions described herein may be suitable for in vivo administration to cells, tissues and / or organs of individuals suffering from any of the diseases described herein, and may be administered in vivo, ex vivo, or in vitro. The required individuals or subjects are preferably mammals, more preferably humans.
[0460] In a further embodiment, a method for diagnosis is provided in which the oligonucleotide of the present invention is provided together with a radiolabel or fluorescent label.
[0461] In one embodiment, the concentration of the oligonucleotide or composition in the method of the present invention is in the range of 0.01 nM to 1 μM. More preferably, the concentration used is 0.05 to 500 nM, 0.1 to 500 nM, 0.02 to 500 nM, or 0.05 to 500 nM, and even more preferably 1 to 200 nM.
[0462] The dose range of the oligonucleotides or compositions according to the present invention is preferably designed based on increasing dose studies in clinical trials (in vivo use) where strict protocol requirements exist. The oligonucleotides described herein may be used in doses ranging from 0.01 to 200 mg / kg, 0.05 to 100 mg / kg, 0.1 to 50 mg / kg, or 0.1 to 20 mg / kg, preferably 0.5 to 10 mg / kg.
[0463] The concentrations or doses of the oligonucleotides or compositions described above are preferred concentrations or doses for in vitro or ex vivo use. Those skilled in the art will understand that the concentrations or doses of the oligonucleotides used may be further modified and may need to be further optimized depending on the oligonucleotides used, the target cells to be treated, the gene target and its expression level, the culture medium used, and the transfection and incubation conditions.
[0464] In this specification, the verb “contains” and its conjugations are used in their non-restrictive sense to mean that the items following the term are included, but do not exclude items not specifically mentioned. Furthermore, the verb “consist of” may be replaced by “essentially consisting of,” meaning that oligonucleotides or compositions described herein may contain additional components other than those specifically specified, and such additional components do not alter the inherent characteristics of the invention. Moreover, the reference of elements with the indefinite article “a” or “an” does not exclude the possibility of more than one element being present unless it is clear from the context that one or only one element is present. Thus, the indefinite article “a” or “an” usually means “at least one.”
[0465] The embodiments described herein may be combined unless otherwise specified. All patents and references cited herein are incorporated herein by reference in their entirety. Embodiments of the present invention include, for example, the following embodiments 1 to 14. Embodiment 1: Oligonucleotides for use in the treatment of Duchenne muscular dystrophy or Becker muscular dystrophy, comprising a 2'-O-methylRNA monomer and a phosphorothioate skeleton, and comprising 5-methyluracil and / or 5-methylcytosine and / or a 2,6-diaminopurine base. Embodiment 2: The oligonucleotide according to Embodiment 1, comprising 5-methylcytosine and / or a 5-methyluracil base. Embodiment 3: An oligonucleotide according to Embodiment 1 or 2, comprising a 2,6-diaminopurine base. Embodiment 4: An oligonucleotide according to any one of Embodiments 1 to 3, comprising a 2'-O-methylRNA monomer and a phosphorothioate backbone, but lacking 5-methylcytosine, 5-methyluracil, and 2,6-diaminopurine, having improved parameters compared to a corresponding oligonucleotide, wherein the improved parameters are binding affinity, kinetics, exon skipping activity, in vivo stability, (intratissue) distribution, cellular uptake, transport, and / or immunogenicity. Embodiment 5: An oligonucleotide according to any one of Embodiments 1 to 4, having a length of less than 34 nucleotides. Embodiment 6: An oligonucleotide according to any one of Embodiments 1 to 5, which is inversely complementary to and / or binds to and / or targets and / or hybridizes to at least a portion of the dystrophin exon and / or non-exon region. Embodiment 7: The oligonucleotide according to any one of Embodiments 1 to 6, comprising or consisting of a sequence that is inversely complementary to and / or binds to and / or targets and / or hybridizes to at least a portion of dystrophin mRNA precursor exons 44 to 55, and the oligonucleotide portion having 10 to 33 nucleotides. Embodiment 8: It contains a 2'-O-methylRNA monomer and a phosphorothioate skeleton, It is represented by a nucleotide or base sequence containing or consisting of one sequence of sequence numbers 52, 14-51, 53-90, or by a nucleotide sequence containing or consisting of a fragment of one sequence of sequence numbers 52, 14-51, 53-90. Containing 5-methyluracil and / or 5-methylcytosine and / or a 2,6-diaminopurine base, The oligonucleotide described in Embodiment 7. Embodiment 9: The oligonucleotide according to Embodiment 8, represented by a nucleotide or base sequence containing or consisting of one of the sequences of SEQ ID NOs. 52, 15, 21, 31, 40, 57, or by a nucleotide or base sequence containing or consisting of a fragment of one of the sequences of SEQ ID NOs. 52, 15, 21, 31, 40, 57. Embodiment 10: The oligonucleotide according to Embodiment 8 or 9, represented by a nucleotide or base sequence containing or consisting of one of the sequences of SEQ ID NOs: 92, 171-215, 217, 218, 219, or by a nucleotide or base sequence containing or consisting of a fragment of one of the sequences of SEQ ID NOs: 92, 171-215, 217, 218, 219. Embodiment 11: A nucleotide or base sequence comprising one of the sequences of SEQ ID NOs: 92, 171, 173, 185, 187, 200, 206, 207, 208, 210, 213, 217, 218, or 219, or a nucleotide or base sequence comprising one of the sequences of SEQ ID NOs: 92, 171, 173, 185, 187, 200, 206, 207, 208, 210, 213, 217, 218, or 219, wherein the fragment is SEQ ID NOs: 92, 171, 173, 18 The oligonucleotide according to Embodiment 10, comprising or consisting of at least 10 consecutive nucleotides or bases of 5, 187, 200, 206, 207, 208, 210, 213, 217, 218, or 219, wherein such fragment is represented by a nucleotide or base sequence having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Embodiment 12: A composition comprising an oligonucleotide as described in any of Embodiments 1 to 11. Embodiment 13: The composition according to Embodiment 12, comprising at least one excipient that can further assist in enhancing the targeting and / or delivery of the composition and / or the oligonucleotide to and / or into tissues and / or cells. Embodiment 14: A method for the prevention, treatment and / or delay of Duchenne muscular dystrophy or Becker muscular dystrophy, wherein the prevention, treatment and / or delay is carried out by administering an oligonucleotide according to any of Embodiments 1 to 11 or a composition according to Embodiment 12 or 13 to a subject in need thereof.
[0466] Definition: Throughout this specification, the terms “binding,” “targeting,” and “hybridizing” may be used interchangeably when used in relation to antisense oligonucleotides that are inversely complementary to some of the mRNA precursors identified herein.
[0467] Furthermore, throughout this specification, the expressions “binding,” “targeting,” and “hybridizing” may be used interchangeably when used in relation to antisense oligonucleotides that are inversely complementary to a portion of an mRNA precursor for which conditions can be found, and such oligonucleotides may bind to, target, or hybridize to the portion of the mRNA precursor.
[0468] In this specification, “hybridization” refers to the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a specific mechanism, the most common mechanism of pairing involves hydrogen bonding (which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding) between complementary nucleosides or nucleotide bases (nucleic acid bases). For example, the natural base adenine is complementary to the natural nucleic acid bases thymine and uracil, which pair through hydrogen bonding. The natural base guanine is complementary to the natural nucleic acid bases cytosine and 5-methylcytosine. Hybridization can occur under a variety of conditions.
[0469] In this specification, “specifically hybridizes” refers to the ability of an oligomeric compound to hybridize to one nucleic acid site with a higher affinity than hybridizing to another nucleic acid site. In certain embodiments, the antisense oligonucleotide specifically hybridizes to more than one target site.
[0470] In this invention, unless otherwise specified, "hybridize" is used under physiological conditions in cells, preferably muscle cells.
[0471] In this specification, "nucleoside" refers to a compound comprising a heterocyclic base moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (found in DNA and RNA), debasic nucleosides, modified nucleosides, and sugar-modified nucleosides. Nucleosides can be modified with any of a variety of substituents.
[0472] In this specification, "sugar portion" means a natural (furanosyl) or modified sugar portion or a sugar substitute.
[0473] In this specification, "modified sugar moiety" means a chemically modified furanosyl sugar or non-furanosyl sugar moiety. This term also includes furanosyl sugar analogs and derivatives, including tricyclic sugars, bicyclic sugars, tetrahydropyran, morpholine, 2'-modified sugars, 4'-modified sugars, 5'-modified sugars, and 4'-substituted sugars.
[0474] In this specification, "sugar-modified nucleoside" means a nucleoside containing a modified sugar moiety.
[0475] In this specification, “sugar substitute” refers to a structure that can replace the furanose ring of a naturally occurring nucleoside. In certain embodiments, the sugar substitute is a non-furanose (or 4'-substituted furanose) ring, cyclic system, or open system. Such structures may involve simple modifications to the natural furanose ring, such as a six-membered ring, or they may be more complex, as are the acyclic systems used in peptide nucleic acids. Sugar substitutes include, but are not limited to, morpholine, cyclohexenyl, and cyclohexitol. In most nucleosides having a sugar substitute group, the heterocyclic base moiety is generally maintained to allow hybridization.
[0476] In this specification, "nucleotide" means a nucleoside further comprising modified or unmodified phosphate linking groups or non-phosphate nucleoside linkages.
[0477] In this specification, "linked nucleoside" may or may not be linked by phosphate linkage, and therefore includes "linked nucleotide."
[0478] In this specification, “nucleic acid base” refers to the heterocyclic base portion of a nucleoside. Nucleic acid bases may be naturally occurring or modified, and therefore not limited to these, but include analogs thereof such as adenine, cytosine, guanine, uracil, thymine, and 5-methylcytosine. In certain embodiments, a nucleic acid base may include any atom or group of atoms that can hydrogen bond to a base of another nucleic acid.
[0479] In this specification, “modified nucleoside” means a nucleoside that contains at least one modification compared to a naturally occurring RNA or DNA nucleoside. Such modifications may be sugar moieties and / or nucleic acid bases.
[0480] In this specification, "T m " refers to the melting temperature, which is the temperature at which the two strands of a double-stranded nucleic acid separate. m This is often used as a measure of the binding affinity of antisense compounds to stable or complementary double-stranded RNA molecules.
[0481] In this specification, "2' modification" or "2' substitution" refers to a nucleoside containing a sugar with a substituent at the 2' position other than H or OH. 2'-modified nucleosides include, but are not limited to, bicyclic nucleosides in which a bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon atom of the sugar ring, as well as allyl, amino, azide, thio, O-allyl, and O-C1-C2 nucleosides. 10 Alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CH2)2-ON(R m )(R n ) or O-CH2-C(=O)-N(R m )(R n )(wherein, R m and R n Each of these is independently H or substituted or unsubstituted C1-C 10 This includes nucleosides having non-crosslinked 2' substitutions (such as alkyl groups). 2'-modified nucleosides may further include other modifications, for example, at other positions in the sugar and / or at the nucleic acid base.
[0482] In this specification, "2'-OMe," "2'-OCH3," or "2'-O-methyl" each refers to a nucleoside containing a sugar with an -OCH3 group at the 2' position of the sugar ring.
[0483] In this specification, "MOE," "2'-MOE," "2'-OCH2CH2OCH3," or "2'-O-methoxyethyl" each refer to a nucleoside containing a sugar with an -OCH2CH2OCH3 group at the 2' position of the sugar ring.
[0484] In this specification, the term "adenine analog" means a chemically modified purine nucleic acid base that, when incorporated into an oligomer, can form a Watson-Crick base pair with either thymine or uracil of the complementary strand of RNA or DNA.
[0485] In this specification, the term "uracil analog" means a chemically modified pyrimidine nucleic acid base that, when incorporated into an oligomer, can form a Watson-Crick base pair with either an adenine of the complementary strand of RNA or DNA.
[0486] In this specification, the term "thymine analog" means a chemically modified pyrimidine nucleic acid base that, when incorporated into an oligomer, can form a Watson-Crick base pair with adenine of the complementary strand of RNA or DNA.
[0487] In this specification, the term "cytosine analog" means a chemically modified pyrimidine nucleic acid base that, when incorporated into an oligomer, can form a Watson-Crick base pair with guanine in the complementary strand of RNA or DNA. For example, a cytosine analog may be 5-methylcytosine.
[0488] In this specification, the term "guanine analog" means a chemically modified purine nucleic acid base that, when incorporated into an oligomer, can form a Watson-Crick base pair with cytosine of the complementary strand of RNA or DNA.
[0489] In this specification, the term "guanosine" refers to a nucleoside or sugar-modified nucleoside containing guanine or a guanine analog nucleic acid base.
[0490] In this specification, the term "uridine" refers to a nucleoside or sugar-modified nucleoside containing uracil or a uracil analog nucleic acid base.
[0491] In this specification, the term "thymidine" refers to a nucleoside or sugar-modified nucleoside containing thymine or a thymine analog nucleic acid base.
[0492] In this specification, the term "cytidine" refers to a nucleoside or sugar-modified nucleoside containing cytosine or a cytosine analog nucleic acid base.
[0493] In this specification, the term "adenosine" refers to a nucleoside or sugar-modified nucleoside containing adenine or an adenine analog nucleic acid base.
[0494] In this specification, “oligonucleotide” refers to a compound comprising multiple linked nucleosides. In certain embodiments, one or more of the multiple nucleosides are modified. In certain embodiments, the oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).
[0495] In this specification, "oligonucleoside" refers to an oligonucleotide in which none of the nucleoside links contain a phosphorus atom. In this specification, oligonucleotides include oligonucleosides.
[0496] In this specification, "modified oligonucleotide" or "chemically modified oligonucleotide" means an oligonucleotide comprising at least one modified sugar, modified nucleic acid base and / or modified nucleoside linkage or skeleton.
[0497] In this specification, "internucleoside linkage" or "skeleton" refers to a covalent bond between adjacent nucleosides.
[0498] In this specification, "naturally occurring nucleoside linkages" refers to 3'-5' phosphodiester linkages.
[0499] In this specification, "modified nucleoside linkage" refers to any nucleoside linkage other than those naturally occurring.
[0500] In this specification, “oligomer compound” refers to a polymer structure comprising two or more basic structures. In certain embodiments, the oligomer compound is an oligonucleotide. In certain embodiments, the oligomer compound is a single-stranded oligonucleotide. In certain embodiments, the oligomer compound is a double-stranded oligonucleotide comprising two oligonucleotides. In certain embodiments, the oligomer compound is a single-stranded or double-stranded oligonucleotide comprising one or more conjugate groups and / or terminal groups.
[0501] In this specification, “conjugate” refers to an atom or group of atoms bonded to an oligonucleotide or oligomeric compound. Generally, conjugate groups modify one or more properties of the compound to which they are bonded, including but not limited to pharmacodynamics, pharmacokinetics, binding, absorption, cell distribution, cell uptake, charge, and clearance. Conjugate groups are conventionally used in the chemical field and are bonded directly or via an optional linking moiety or linking group to a parent compound such as an oligomeric compound. In certain embodiments, conjugate groups include, but are not limited to, insertants, reporter molecules, polyamines, polyamides, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, and dyes. In certain embodiments, the conjugate is a terminal group. In certain embodiments, the conjugate is bound to a 3' or 5' terminal nucleoside or an internal nucleoside of an oligonucleotide.
[0502] In this specification, “conjugate linking group” refers to any atom or group of atoms used to link a conjugate to an oligonucleotide or oligomeric compound. Linking groups or bifunctional linking portions, such as those known in the art, conform to the present invention.
[0503] In this specification, “antisense compound” means an oligomeric compound, at least a portion thereof, which is at least partially complementary to the target nucleic acid with which the oligomeric compound hybridizes, and which modulates the activity, processing, or expression of the target nucleic acid.
[0504] In this specification, “expression” refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, splicing, post-transcriptional modification, and translation.
[0505] In this specification, "antisense oligonucleotide" refers to an antisense compound that is an oligonucleotide.
[0506] In this specification, “antisense activity” refers to any detectable and / or measurable activity resulting from the hybridization of an antisense compound with respect to its target nucleic acid. In certain embodiments, such activity may be an increase or decrease in the amount of nucleic acid or protein. In certain embodiments, such activity may be a change in the ratio of splice variants of nucleic acid or protein. Detection and / or measurement of antisense activity may be direct or indirect. In certain embodiments, antisense activity is evaluated by observing phenotypic changes in cells or animals.
[0507] In this specification, “target nucleic acid” refers to any nucleic acid molecule whose expression, quantity, or activity can be regulated by an antisense compound. In certain embodiments, the target nucleic acid is DNA or RNA. In certain embodiments, the target RNA is mRNA, mRNA precursor, non-coding DNA, premicroRNA, premicroRNA, mature microRNA, promoter-directed RNA, or natural antisense transcript. For example, the target nucleic acid may be a cellular gene (or mRNA transcribed from a gene) whose expression is associated with a nucleic acid molecule derived from a specific disorder or disease state or infectious agent. In certain embodiments, the target nucleic acid is a viral or bacterial nucleic acid.
[0508] In this specification, "target mRNA" refers to a pre-selected RNA molecule that encodes a protein.
[0509] In this specification, “targeting” or “targeting” means the association of an antisense compound with a specific target nucleic acid molecule or a specific region of nucleotides within a target nucleic acid molecule. An antisense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to enable hybridization under physiological conditions.
[0510] In this specification, “target site” refers to the region of the target nucleic acid to which the antisense compound binds. In certain embodiments, the target site is at least partially within the 3' untranslated region of the RNA molecule. In certain embodiments, the target site is at least partially within the 5' untranslated region of the RNA molecule. In certain embodiments, the target site is at least partially within the coding region of the RNA molecule. In certain embodiments, the target site is at least partially within the exon of the RNA molecule. In certain embodiments, the target site is at least partially within the intron of the RNA molecule. In certain embodiments, the target site is at least partially within the microRNA target region of the RNA molecule. In certain embodiments, the target site is at least partially within the repeat region of the RNA molecule.
[0511] In this specification, “target protein” refers to a protein whose expression is regulated by an antisense compound. In certain embodiments, the target protein is encoded by a target nucleic acid. In certain embodiments, the expression of the target protein is otherwise affected by the target nucleic acid.
[0512] In this specification, "complementarity" with respect to nucleic acid bases refers to nucleic acid bases that can base-pair with other nucleic acid bases. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleic acid bases refer to nucleic acid bases of an antisense compound that can base-pair with the nucleic acid bases of the target nucleic acid. For example, if a nucleic acid base at a specific position in an antisense compound can hydrogen-bond with a nucleic acid base at a specific position in the target nucleic acid, the positions of the hydrogen bonds between the oligonucleotide and the target nucleic acid are considered complementary in that nucleic acid base pair. Nucleic acid bases with specific modifications can still be nucleic acid base complementary because they can maintain their ability to pair with the corresponding nucleic acid bases.
[0513] In this specification, "non-complementary" with respect to nucleic acid bases refers to a pair of nucleic acid bases that do not form hydrogen bonds with each other or otherwise do not support hybridization.
[0514] In this specification, “complementary” with respect to linked nucleotides, oligonucleotides, or nucleic acids means the ability of an oligomeric compound to hybridize to another oligomeric compound or nucleic acid by nucleic acid base complementarity. In certain embodiments, an antisense compound and its target are complementary if a sufficient number of corresponding positions within each molecule are occupied by nucleic acid bases that can bind to each other to enable stable association between the antisense compound and the target. Those skilled in the art will recognize that the inclusion of mismatches is possible without excluding the ability of the oligomeric compound to maintain the association. Accordingly, antisense compounds that may contain up to about 20% of nucleotides that are mismatched (i.e., nucleic acid bases that are not complementary to the corresponding nucleotides of the target) are described herein. The antisense compound preferably contains or does not contain mismatches of about 15% or less, more preferably about 10% or less, and most preferably 5% or less. The remaining nucleic acid bases are complementary nucleic acid bases or nucleic acid bases that would otherwise disrupt hybridization (e.g., universal bases). Those skilled in the art will recognize that the compounds provided herein are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to the target nucleic acid.
[0515] In this specification, “regulation” means a disturbance of the quantity or quality of function or activity compared to the function or activity before regulation. For example, regulation includes any change, increase (stimulation or induction) or decrease (inhibition or reduction) in gene expression. Further examples include disturbing splice site selection in mRNA precursor processing, resulting in a change in the amount of a particular splice variant present compared to undisturbed conditions. Further examples include disturbing protein translation.
[0516] In this specification, “motif” refers to an oligomeric compound or a pattern of modification within its region. A motif may be defined by modifications at specific nucleosides and / or specific linking groups of the oligomeric compound.
[0517] In this specification, “nucleoside motif” refers to an oligomeric compound or a pattern of nucleoside modification in its region. The linkage of such oligomeric compounds may or may not be modified. Unless otherwise specified, motifs in this specification that describe only nucleosides are intended to be nucleoside motifs. Therefore, in such cases, the linkage is not limited.
[0518] In this specification, “linking motif” refers to an oligomeric compound or a pattern of linking modification within its region. The nucleoside of such an oligomeric compound may or may not be modified. Unless otherwise specified, a motif described solely as linking is intended to be a linking motif. Therefore, in such cases, the nucleoside is not limited.
[0519] In this specification, “same modification” refers to modifications to naturally occurring molecules that are identical to each other, including the absence of modification. Therefore, for example, two unmodified DNA nucleosides have “same modification” even if the DNA nucleosides are not modified.
[0520] In this specification, "type of modification" with respect to a nucleoside or "type" of nucleoside refers to the modification of a nucleoside and includes modified and unmodified nucleosides. Therefore, unless otherwise specified, "nucleoside having the first type of modification" may be an unmodified nucleoside.
[0521] In this specification, “separation region” means a portion of an oligomeric compound in which all nucleosides and internucleoside links within the region contain the same modification, and any adjacent portion of the nucleosides and / or internucleoside links contains at least one different modification.
[0522] In this specification, "pharmaceutically acceptable salt" means a salt of an active compound that retains the desired biological activity of the active compound and does not impart undesirable toxic effects to the salt.
[0523] In this specification, "cap structure" or "terminal cap portion" refers to a chemical modification incorporated into any of the ends of an antisense compound.
[0524] In this specification, the term “independently” means that each presence of repeating variants in the claimed oligonucleotide is selected independently of each other. For example, each repeating variant may be selected such that (i) each repeating variant is the same, (ii) two or more are the same, or (iii) each repeating variant is different.
[0525] Definition of general chemistry: In this specification, “alkyl” refers to saturated linear or branched hydrocarbon substituents or radicals that typically contain 24 or fewer carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, and dodecyl. Alkyl groups typically contain 1 to 24 carbon atoms, more typically 1 to 12 carbon atoms (C1-C2). 12 The alkyl group contains 1 to 6 carbon atoms (C1 to C6 alkyl), more preferably. In this specification, the term "lower alkyl" contains 1 to 6 carbon atoms (C1 to C6 alkyl). In this specification, the alkyl group may optionally contain one or more further substituents.
[0526] In this specification, “alkenyl” refers to a linear or branched hydrocarbon radical or substituent that typically contains 24 or fewer carbon atoms and has at least one carbon-carbon double bond. Examples of alkenyl groups include, but are not limited to, dienes such as ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, and 1,3-butadienyl. Alkenyl groups typically contain 2 to 24 carbon atoms, more typically 2 to 12 carbon atoms, and more preferably 2 to 6 carbon atoms. In this specification, alkenyl groups may optionally contain one or more further substituents.
[0527] In this specification, "alkynyl" refers to a linear or branched hydrocarbon radical or substituent typically containing 24 or fewer carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, and 1-butynyl. Alkynyl groups typically contain 2 to 24 carbon atoms, more typically 2 to 12 carbon atoms, and more preferably 2 to 6 carbon atoms. In this specification, alkynyl groups may optionally contain one or more further substituents.
[0528] In this specification, "aminoalkyl" refers to an amino-substituted alkyl radical or substituent. This term refers to a C1-C molecule having an amino substituent at any position, to which the aminoalkyl group is bonded to the parent molecule via its alkyl moiety. 12 This means that it contains an alkyl group. The alkyl and / or amino portions of an aminoalkyl group may be further substituted by substituents.
[0529] In this specification, “aliphatic compound” means a linear or branched hydrocarbon radical or substituent that typically contains 24 or fewer carbon atoms and where the saturation between any two carbon atoms is a single, double, or triple bond. The aliphatic group preferably contains 1 to 24 carbon atoms, more typically 1 to 12 carbon atoms, and more preferably 1 to 6 carbon atoms. The linear or branched chain of the aliphatic group may be interposed by one or more heteroatoms, including nitrogen, oxygen, sulfur, and phosphorus. Such aliphatic groups interposed by heteroatoms include, but are not limited to, polyalkoxys such as polyalkylene glycols, polyamines, and polyimines. In this specification, the aliphatic group may optionally contain further substituents.
[0530] In this specification, “alicyclic” or “alicyclic” refers to a cyclic radical or substituent in which the cyclic system is aliphatic. The cyclic system may include one or more rings in which at least one ring is aliphatic. Preferred alicyclic moieties include a ring having 5 to 9 carbon atoms within the ring. In this specification, the alicyclic group may optionally include further substituents.
[0531] In this specification, "alkoxy" refers to a radical or substituent containing an alkyl group and an oxygen atom, in which an alkoxy group is bonded to the parent molecule via its oxygen atom. Examples of alkoxy groups, but not limited to these, include methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, and n-hexoxy. In this specification, alkoxy groups may optionally contain further substituents.
[0532] In this specification, "halo," "halide," and "halogen" refer to an atom, radical, or substituent selected from fluorine, chlorine, bromine, and iodine.
[0533] In this specification, "aryl" and "aromatic" refer to radicals or substituents comprising monocyclic or polycyclic carbocyclic systems having one or more aromatic rings. Examples of aryl groups, but not limited to, include phenyl, naphthyl, tetrahydronaphthyl, indanyl, and idenyl. Preferred aryl ring systems have 5 to 20 carbon atoms in one or more rings. In this specification, aryl groups may optionally include further substituents.
[0534] In this specification, "aralkyl" and "arylalkyl" refer to radicals or substituents comprising alkyl and aryl groups to which an aralkyl or arylalkyl group is bonded to the parent molecule via its alkyl moiety. Examples include, but are not limited to, benzyl and phenethyl. In this specification, an aralkyl group may optionally include further substituents bonded to the alkyl, aryl, or both groups forming the radical or substituent.
[0535] In this specification, “heterocyclyl” means a radical or substituent comprising a monocyclic or polycyclic ring system that is unsaturated, partially saturated or fully saturated, and thereby comprises a heteroaryl group, and includes at least one heteroatom. A heterocyclyl also means a fusion ring system in which one or more fusion rings contain at least one heteroatom and other rings may contain one or more heteroatoms or optionally contain no heteroatoms. Heterocyclic groups typically contain at least one atom selected from sulfur, nitrogen or oxygen. Examples of heterocyclic groups include [1,3]dioxolane, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridadinyl, tetrahydrofuryl, and others. In this specification, the heterocyclic group may optionally include further substituents.
[0536] In this specification, “heteroaryl” and “heteroaromatic ring” refer to radicals or substituents comprising monocyclic or polycyclic aromatic rings, ring systems, or fusion ring systems in which at least one ring is aromatic and contains one or more heteroatoms. Heteroaryl also means fusion ring systems in which one or more of the fusion rings do not contain heteroatoms. Heteroaryl groups typically contain one ring atom selected from sulfur, nitrogen, or oxygen. Examples of heteroaryl groups, but not limited to these, include pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isoxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzoxazolyl, quinoxalinyl, and others. Heteroaryl radicals or substituents may be bonded directly to the parent molecule or via linking parts such as aliphatic groups or heteroatoms. In this specification, heteroaryl groups may optionally contain further substituents.
[0537] In this specification, “heteroarylalkyl” refers to a radical or substituent comprising the heteroaryl group and alkyl moiety, wherein the heteroarylalkyl group is bonded to the parent molecule via its alkyl moiety. Examples, but not limited to, include pyridinylmethyl, pyrimidinylethyl, and naphthilidinylpropyl. In this specification, the heteroarylalkyl group may optionally include further substituents on one or both of the heteroaryl or alkyl moiety.
[0538] In this specification, “monocyclic or polycyclic” means any ring system, such as a monocyclic or polycyclic system having fused or linked rings, and includes monocyclic and mixed ring systems individually selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic, and heteroarylalkyl. Such monocyclic and polycyclic structures may contain rings that are fully saturated, partially saturated, or completely unsaturated, and rings that are homogeneous or have varying degrees of saturation. Each ring may contain ring atoms selected from C, N, O, and S to produce heterocyclic rings and rings containing only carbon ring atoms. Heterocyclic rings and all carbon rings may exist in mixed motifs, such as benzimidazole, where one ring in the fused ring system has only carbon ring atoms and the other ring has two nitrogen atoms. Monocyclic or polycyclic structures may be further substituted with substituents, such as phthalimide having two oxo groups (=O) bonded to one of the rings. In another embodiment, monocyclic or polycyclic structures may be bonded to the parent molecule directly via ring atoms, or via substituents or difunctional linkages.
[0539] In this specification, "acyl" refers to a radical or substituent comprising a carbonyl moiety (C=O or -C(O)-) and a further substituent X, to which an acyl group is bonded to the parent molecule via its carbonyl moiety. Thus, an acyl group is formally obtained by removing a hydroxyl group from an organic acid and has the general formula -C(O)-X (wherein X is typically aliphatic, alicyclic, or aromatic). The term "acyl" is also used for the general formula -Y(O) n -X(wherein X is equivalent to the above, Y(O) n This typically refers to a sulfonyl, sulfinyl, or phosphate group. It means that the group contains a heteroacyl radical or substituent having ( ). Examples of acyl groups include aliphatic carbonyl, aromatic carbonyl, aliphatic sulfonyl, aromatic sulfinyl, aliphatic sulfinyl, aromatic phosphate, aliphatic phosphate, etc. In this specification, the acyl group may optionally contain further substituents.
[0540] In this specification, “substituent” includes groups that are typically added to other substituents or parent compounds to enhance a desired property or to impart a desired effect. Substituents may or may not be protected and may be bonded to one or more available sites in the parent compound. Substituents may also be further substituted by other substituents and may be bonded to the parent compound directly or via linking groups such as alkyl or heterocarbyl groups. In this specification, “hydrocarbyl” refers to any group containing C, O, and H. This includes linear, branched, and cyclic groups having any degree of saturation. Such hydrocarbyl groups may contain one or more heteroatoms selected from N, O, and S and may be further substituted by one or more substituents.
[0541] Unless otherwise specified, the terms substituted or "optionally substituted" refer to the presence of any optional substituent from the following: halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (-C(O)R aa ), carboxyl(-C(O)OR aa ), aliphatic group, alicyclic group, alkoxy, substituted oxo (-OR aa ), aryl, aralkyl, heterocyclic, heteroaryl, heteroarylalkyl, amino(-NR bb R cc ), Imino (=NR bb ), amide (-C(O)NR bb R cc or -N(R bb )C(O)R aa ), azide (-N3), nitro (-NO2), cyano (-CN), carbamide (-OC(O)NR bb R cc or -N(R bb )C(O)OR aa ), Ureid (-N(R bb )C(O)NR bb R cc ), Thiouraid (-N(R bb )C(S)NR bb R cc ), Guanidinyl (-N(R bb )C(=NR bb)NR bb R cc ), amidinyl (-C(=NR bb )NR bb R cc or -N(R bb )C(NR bb )R aa ), thiol (-SR bb ), sulfinyl (-S(O)R bb ), sulfonyl (-S(O)2R bb ), sulfonamidyl (-S(O)2NR bb R cc or -N(R bb )S(O)2R bb ) and conjugate group. In this specification, R aa , R bb and R cc Each of these is independently H and optionally linked chemical functional groups or further substituents, preferably, but not limited to, selected from the group consisting of H, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic, and heteroarylalkyl. The selected substituents in the compounds described herein are present to a certain degree of recurrence.
[0542] Here, "recursive substituent" means that the substituent can give rise to another instance of itself. Due to the recursive nature of such substituents, theoretically, there can be a large number of them in any given claim. Those skilled in the art of medicinal chemistry and organic chemistry understand that the total number of such substituents is reasonably limited by the desired properties of the compound of interest. Such properties include, for example, physical properties (e.g., molecular weight, solubility, log P), applicability (e.g., activity for a target), and practical properties (e.g., ease of synthesis).
[0543] Recurrent substituents are an intended aspect of the present invention. Those skilled in the art in the fields of pharmaceuticals and organic chemistry will understand the diversity of such substituents. The total number of recurrent substituents is determined as described above, to the extent that they are present in the claims of the present invention.
[0544] In this specification, the terms “stable compound” and “stable structure” refer to a compound that is potent enough to survive isolation from a reaction mixture to a useful degree of purity and formulation into an effective therapeutic agent. Only stable compounds are intended in this specification.
[0545] In this specification, zero (0) in a range indicating the number of units means that no units may exist. For example, an oligomeric compound containing 0 to 2 regions of a particular motif means that the oligomeric compound may contain one or two such regions having the particular motif, or it may not contain any regions having the particular motif. If an internal part of a molecule is absent, the parts adjacent to the absent part bond directly to each other. Similarly, in this specification, the term “none” indicates the absence of a particular feature.
[0546] In this specification, "analog" or "derivative" means any compound or part that is structurally similar but differs from the parent compound in elemental composition, regardless of the method by which the compound is prepared. For example, analog or derivative compounds are not required to be prepared from a parent compound, such as a chemical starting material.
[0547] The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention. [Brief explanation of the drawing]
[0548] [Figure 1-1]Fig. 1: (a) PS229L / PS524 (SEQ ID NO: 52) (corresponding to SEQ ID NO: 91 (unmodified sequence) and SEQ ID NO: 92 (all cytosines are modified)) or (b) PS220 / PS339 (SEQ ID NO: 21) (corresponding to SEQ ID NO: 101 (unmodified sequence) and SEQ ID NO: 200 (all cytosines are modified)) or (c) PS524 / PS1317 / PS1318 / PS1319 (SEQ ID NO: 52) (SEQ ID NO: 92 (PS524) (all 6 cytosines are modified) In vitro comparison of AONs with and without cytosine-to-5-methylcytosine substitution in differentiated healthy muscle cells after transfection with SEQ ID NOs (corresponding to SEQ ID NOs: 217 (PS1317) (4 of 6 cytosines are modified), SEQ ID NOs: 218 (PS1318) (2 of 6 cytosines are modified), and SEQ ID NOs: 219 (PS1319) (3 of 6 cytosines are modified). The mean skipping rate was calculated from three transfections (n=3) (a,b) or two transfections (n=2) (c) per concentration. The solid line represents AONs with 5-methylcytosine, and the dotted line represents AONs with unsubstituted cytosines (a,b). [Figure 1-2]Fig. 1: (a) PS229L / PS524 (SEQ ID NO: 52) (corresponding to SEQ ID NO: 91 (unmodified sequence) and SEQ ID NO: 92 (all cytosines are modified)) or (b) PS220 / PS339 (SEQ ID NO: 21) (corresponding to SEQ ID NO: 101 (unmodified sequence) and SEQ ID NO: 200 (all cytosines are modified)) or (c) PS524 / PS1317 / PS1318 / PS1319 (SEQ ID NO: 52) (SEQ ID NO: 92 (PS524) (all 6 cytosines are modified) In vitro comparison of AONs with and without cytosine-to-5-methylcytosine substitution in differentiated healthy muscle cells after transfection with SEQ ID NOs (corresponding to SEQ ID NOs: 217 (PS1317) (4 of 6 cytosines are modified), SEQ ID NOs: 218 (PS1318) (2 of 6 cytosines are modified), and SEQ ID NOs: 219 (PS1319) (3 of 6 cytosines are modified). The mean skipping rate was calculated from three transfections (n=3) (a,b) or two transfections (n=2) (c) per concentration. The solid line represents AONs with 5-methylcytosine, and the dotted line represents AONs with unsubstituted cytosines (a,b). [Figure 2]Fig. 2: Summary of pharmacokinetic studies in wild-type (control) and mdx mice comparing plasma and muscle tissue profiles of AONs with 5-methylcytosine [PS524 (SEQ ID NO: 52) (corresponding to SEQ ID NO: 92 (all cytosines are modified)) and PS652 (SEQ ID NO: 57) (corresponding to SEQ ID NO: 185 (all cytosines are modified))] and AONs with unmodified (unmethylated) cytosine [PS229L (SEQ ID NO: 52) (corresponding to SEQ ID NO: 91 (unmodified sequence)) and PS531 (SEQ ID NO: 57) (corresponding to SEQ ID NO: 137 (unmodified sequence))]. (a) 1) Ratio of mean intramuscular AON levels in mdx mice versus control mice after a single sc injection, 2) Levels of AON (μg / g) in the muscle of several mdx mice at day 14, 3) Relative muscle / kidney and muscle / liver levels at day 14, and 4) Pharmacokinetic histological analysis of the estimated half-lives of different AONs in the triceps muscle. (b) Pharmacokinetic plasma analysis of 1) Tmax (time at which Cmax is reached, including only two analysis time points (15 or 60 minutes), 2) Cmax (highest plasma concentration reached), 3) AUC (area under the curve, an indicator of bioavailability), and 4) Cl (plasma clearance over 24 hours). [Figure 3-1] Fig. 3: Analysis of cytokine levels in human whole blood after incubation with 0, 10, 25, or 50 μg / ml of AONs containing unmodified cytosine [PS232 (SEQ ID NO: 39) (corresponding to SEQ ID NO: 119 (unmodified sequence)) and PS534 (SEQ ID NO: 59) (corresponding to SEQ ID NO: 139 (unmodified sequence)] (black bars) or AONs containing 5-methylcytosine [PS648 (SEQ ID NO: 39) (corresponding to SEQ ID NO: 201 (all cytosines are modified)) and PS653 (SEQ ID NO: 59) (corresponding to SEQ ID NO: 192 (all cytosines are modified))] (gray bars). Levels of TNFα (a,b), MCP-1 (d,e), IP-10 (e,f), and IL6 (g,h) were determined using commercially available ELISA kits. Each experiment was repeated four times (n=4). Data show the most significant response for each cytokine. [Figure 3-2]Fig. 3: Analysis of cytokine levels in human whole blood after incubation with 0, 10, 25, or 50 μg / ml of AONs containing unmodified cytosine [PS232 (SEQ ID NO: 39) (corresponding to SEQ ID NO: 119 (unmodified sequence)) and PS534 (SEQ ID NO: 59) (corresponding to SEQ ID NO: 139 (unmodified sequence)] (black bars) or AONs containing 5-methylcytosine [PS648 (SEQ ID NO: 39) (corresponding to SEQ ID NO: 201 (all cytosines are modified)) and PS653 (SEQ ID NO: 59) (corresponding to SEQ ID NO: 192 (all cytosines are modified))] (gray bars). Levels of TNFα (a,b), MCP-1 (d,e), IP-10 (e,f), and IL6 (g,h) were determined using commercially available ELISA kits. Each experiment was repeated four times (n=4). Data show the most significant response for each cytokine. [Figure 3-3] Fig. 3: Analysis of cytokine levels in human whole blood after incubation with 0, 10, 25, or 50 μg / ml of AONs containing unmodified cytosine [PS232 (SEQ ID NO: 39) (corresponding to SEQ ID NO: 119 (unmodified sequence)) and PS534 (SEQ ID NO: 59) (corresponding to SEQ ID NO: 139 (unmodified sequence)] (black bars) or AONs containing 5-methylcytosine [PS648 (SEQ ID NO: 39) (corresponding to SEQ ID NO: 201 (all cytosines are modified)) and PS653 (SEQ ID NO: 59) (corresponding to SEQ ID NO: 192 (all cytosines are modified))] (gray bars). Levels of TNFα (a,b), MCP-1 (d,e), IP-10 (e,f), and IL6 (g,h) were determined using commercially available ELISA kits. Each experiment was repeated four times (n=4). Data show the most significant response for each cytokine. [Figure 3-4]Fig. 3: Analysis of cytokine levels in human whole blood after incubation with 0, 10, 25, or 50 μg / ml of AONs containing unmodified cytosine [PS232 (SEQ ID NO: 39) (corresponding to SEQ ID NO: 119 (unmodified sequence)) and PS534 (SEQ ID NO: 59) (corresponding to SEQ ID NO: 139 (unmodified sequence)] (black bars) or AONs containing 5-methylcytosine [PS648 (SEQ ID NO: 39) (corresponding to SEQ ID NO: 201 (all cytosines are modified)) and PS653 (SEQ ID NO: 59) (corresponding to SEQ ID NO: 192 (all cytosines are modified))] (gray bars). Levels of TNFα (a,b), MCP-1 (d,e), IP-10 (e,f), and IL6 (g,h) were determined using commercially available ELISA kits. Each experiment was repeated four times (n=4). Data show the most significant response for each cytokine. [Figure 4-1]Fig. 4: Activity comparison of AONs having 5-methylcytosine and / or 5-methyluracil and corresponding AONs without these base modifications. (a) In vitro transfection of two 200 nM transfections into differentiated healthy muscle cells. Activity was expressed as the average skipping rate (n=2) of exon 51 (PS43: corresponds to SEQ ID NO: 111 (unmodified sequence); PS559: corresponds to SEQ ID NO: 202 (all uracils are modified); PS1106: corresponds to SEQ ID NO: 203 (all cytosines and all uracils are modified); all sequences originate from SEQ ID NO: 31), exon 44 (PS188: corresponds to SEQ ID NO: 95 (unmodified sequence); PS785: corresponds to SEQ ID NO: 204 (all uracils are modified); PS1107: corresponds to SEQ ID NO: 205 (all cytosines and all uracils are modified); all sequences originate from SEQ ID NO: 15), or exon 52 (PS235: corresponds to SEQ ID NO: 120 (unmodified sequence); PS786: corresponds to SEQ ID NO: 172 (all uracils are modified); all sequences originate from SEQ ID NO: 40). The AON sequence (5' to 3') and base modifications (bold, underlined nucleotides) are shown at the bottom of the table. (b) Intramuscular injection of 20 μg of PS49 (unmodified sequence, SEQ ID NO: 216) or PS959 (modified sequence with all uracil modified, SEQ ID NO: 214) into the gastrocnemius muscle of mdx mice. Activity was expressed as the mean mouse exon 23 skipping rate (n=4). The AON sequence (5' to 3') and base modifications (bold, underlined nucleotides) are shown at the bottom of the table. [Figure 4-2]Fig. 4: Activity comparison of AONs having 5-methylcytosine and / or 5-methyluracil and corresponding AONs without these base modifications. (a) In vitro transfection of two 200 nM transfections into differentiated healthy muscle cells. Activity was expressed as the average skipping rate (n=2) of exon 51 (PS43: corresponds to SEQ ID NO: 111 (unmodified sequence); PS559: corresponds to SEQ ID NO: 202 (all uracils are modified); PS1106: corresponds to SEQ ID NO: 203 (all cytosines and all uracils are modified); all sequences originate from SEQ ID NO: 31), exon 44 (PS188: corresponds to SEQ ID NO: 95 (unmodified sequence); PS785: corresponds to SEQ ID NO: 204 (all uracils are modified); PS1107: corresponds to SEQ ID NO: 205 (all cytosines and all uracils are modified); all sequences originate from SEQ ID NO: 15), or exon 52 (PS235: corresponds to SEQ ID NO: 120 (unmodified sequence); PS786: corresponds to SEQ ID NO: 172 (all uracils are modified); all sequences originate from SEQ ID NO: 40). The AON sequence (5' to 3') and base modifications (bold, underlined nucleotides) are shown at the bottom of the table. (b) Intramuscular injection of 20 μg of PS49 (unmodified sequence, SEQ ID NO: 216) or PS959 (modified sequence with all uracil modified, SEQ ID NO: 214) into the gastrocnemius muscle of mdx mice. Activity was expressed as the mean mouse exon 23 skipping rate (n=4). The AON sequence (5' to 3') and base modifications (bold, underlined nucleotides) are shown at the bottom of the table. [Figure 5-1]Fig. 5: Activity comparison of AONs containing 2,6-diaminopurine and corresponding AONs without this base modification. (a) In vitro transfection of two 200 nM transfections into differentiated healthy muscle cells. Activity was expressed as the average exon 51 (PS43: corresponds to SEQ ID NO: 111 (unmodified sequence); PS403: corresponds to SEQ ID NO: 206 (all adenines are modified); all sequences originate from SEQ ID NO: 31), exon 52 (PS235: corresponds to SEQ ID NO: 120 (unmodified sequence); PS897: corresponds to SEQ ID NO: 173 (all adenines are modified); all sequences originate from SEQ ID NO: 40), or exon 44 (PS188: corresponds to SEQ ID NO: 95 (unmodified sequence); PS733: corresponds to SEQ ID NO: 207 (all adenines are modified); all sequences originate from SEQ ID NO: 15) skipping rate (n=2). The AON sequence (5' to 3') and base modifications (nucleotides in bold and underlined) are shown at the bottom of the table. (b) and (c) show the effect on in vitro safety of substituting all unmodified adenine (PS188, SEQ ID NO: 95) with 2,6-diaminopurine (PS733, SEQ ID NO: 207). Mitotic factors C3a (b) and Bb (c) were measured in monkey plasma as markers for the activation of the second complement pathway. [Figure 5-2]Fig. 5: Activity comparison of AONs containing 2,6-diaminopurine and corresponding AONs without this base modification. (a) In vitro transfection of two 200 nM transfections into differentiated healthy muscle cells. Activity was expressed as the average exon 51 (PS43: corresponds to SEQ ID NO: 111 (unmodified sequence); PS403: corresponds to SEQ ID NO: 206 (all adenines are modified); all sequences originate from SEQ ID NO: 31), exon 52 (PS235: corresponds to SEQ ID NO: 120 (unmodified sequence); PS897: corresponds to SEQ ID NO: 173 (all adenines are modified); all sequences originate from SEQ ID NO: 40), or exon 44 (PS188: corresponds to SEQ ID NO: 95 (unmodified sequence); PS733: corresponds to SEQ ID NO: 207 (all adenines are modified); all sequences originate from SEQ ID NO: 15) skipping rate (n=2). The AON sequence (5' to 3') and base modifications (nucleotides in bold and underlined) are shown at the bottom of the table. (b) and (c) show the effect on in vitro safety of substituting all unmodified adenine (PS188, SEQ ID NO: 95) with 2,6-diaminopurine (PS733, SEQ ID NO: 207). Mitotic factors C3a (b) and Bb (c) were measured in monkey plasma as markers for the activation of the second complement pathway. [Examples]
[0549] Table 1: General structure of AON [X=C or m 5 C, Y = U or m 5 U, Z = A or a 2 A, I = inosine (hypoxanthine base), X1 = m 5 C, Y1 = m 5 U, Z1=a 2 A] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7]
[0550] Table 2: General structure of AON [X=C or m 5 C, Y = U or m 5 U, Z = A or a 2 A, I = inosine (hypoxanthine base), X1 = m 5 C, Y1 = m 5 U, Z1=a 2 A] [Table 2-1] [Table 2-2] [Table 2-3]
[0551] Table 3 (Most Preferred AON): General structure of AON [X=C or m 5 C, Y = U or m 5 U, Z = A or a 2 A, I = inosine (hypoxanthine base), X1 = m 5 C, Y1 = m 5 U, Z1=a 2 A] [Table 3-1] [Table 3-2]
[0552] Preferred unmodified oligonucleotides (X = C, Y = U, Z = A) are more preferably each derived from each of the oligonucleotide base sequences (SEQ ID NOs: 14 to 90) and are represented by SEQ ID NOs: 91, 93 to 170 of the nucleotide or base sequence.
[0553] Preferred modified oligonucleotides are derived from one of the nucleotides or base sequences of SEQ ID NOs: 14 to 90, and at least one X that is m 5 C and / or at least one Y that is m 5 U and / or at least one Z that is a 2 A, and are represented by a nucleotide or base sequence that includes or consists of SEQ ID NOs: 92, 171 to 213, 215, 217, 218, 219. More preferred modified oligonucleotides (all X = m 5 C = X1 and / or all Y = m 5 U = Y1 and / or all Z = a 2 A = Z1) are derived from the most preferred nucleotide or base sequences (SEQ ID NOs: 15, 21, 31, 40, 52 and 57) and are represented by SEQ ID NOs: 92, 171 to 174, 185 to 188, 199, 200, 202 to 213, 215, 217, 218, 219. The most preferred modified oligonucleotides are disclosed in Table 3.
[0554] [Example 1] Materials and methods: AON: All oligonucleotides [PS220 / PS399 (based on SEQ ID NO: 21) (corresponding to SEQ ID NO: 101 (PS220) with an unmodified sequence and SEQ ID NO: 200 (PS399) with all cytosines modified); PS229L / PS524 / PS1317 / PS1318 / PS1319 (based on SEQ ID NO: 52) (corresponding to SEQ ID NO: 91 (PS229L) with an unmodified sequence, SEQ ID NO: 92 (PS524) with all 6 cytosines modified, SEQ ID NO: 217 (PS1317) with 4 of the 6 cytosines modified, SEQ ID NO: 218 (PS1318) with 2 of the 6 cytosines modified, and SEQ ID NO: 219 (PS1319) with 3 of the 6 cytosines modified); PS232 / PS6 48 (based on SEQ ID NO: 39) (corresponding to SEQ ID NO: 119 (PS232) in its unmodified form and SEQ ID NO: 201 (PS648) with all cytosines modified; PS531 / PS652 (based on SEQ ID NO: 57) (corresponding to SEQ ID NO: 137 (PS531) in its unmodified form and SEQ ID NO: 185 (PS652) with all cytosines modified); PS534 / PS653 (based on SEQ ID NO: 59) (corresponding to SEQ ID NO: 139 (PS534) in its unmodified form and SEQ ID NO: 192 (PS653) with all cytosines modified)) is a 2'-O-methylphosphorothioate RNA that can be synthesized on a 40 nmol to 4.5 mmol scale using a standard phosphoramidite protocol in an OP-10 synthesizer (GE / AKTA). The oligonucleotides were synthesized using Oligopilot or obtained from suppliers. The oligonucleotides synthesized by Prosensa were cleaved, deprotected in a two-step sequence (DIEA followed by treatment with concentrated NH4OH), purified by HPLC, dissolved in water, and excess NaCl was added as exchange ions. After evaporation, the compounds were redi...
Claims
1. It consists of a 2'-O-methylRNA monomer and a phosphorothioate skeleton. Containing a 2,6-diaminopurine base, A sequence comprising, or consisting of, a sequence that is inversely complementary to and / or binds to and / or hybridizes with at least a portion of dystrophin mRNA precursor exon 51. Having a length of 20 to 25 nucleotides, It is possible to induce skipping of Exxon 51, Represented by a nucleotide or base sequence that includes or consists of the sequence of SEQ ID NO: 206, Oligonucleotides.
2. The oligonucleotide according to claim 1, comprising a 2'-O-methylRNA monomer and a phosphorothioate skeleton, but lacking 5-methylcytosine, 5-methyluracil, and 2,6-diaminopurine, having improved parameters compared to a corresponding oligonucleotide, wherein the improved parameters are binding affinity, kinetics, exon skipping activity, in vivo stability, in vivo distribution, tissue distribution, cellular uptake, transport, and / or immunogenicity.
3. A composition comprising the oligonucleotide described in claim 1 or 2.
4. The composition according to claim 3, comprising at least one excipient that can help enhance the targeting and / or delivery of the composition and / or the oligonucleotide to and / or into tissues and / or cells.
5. The composition according to claim 3 or 4 for use in the prevention, treatment, and / or delay of Duchenne muscular dystrophy or Becker muscular dystrophy.
6. The composition according to claim 5, which is a pharmaceutical composition.
Citation Information
Patent Citations
Methods and compositions for treating bone resorption disorders, including osteoporosis
JP2002508737A
Splice switch oligomers for TNF superfamily receptors and their use in the treatment of diseases
JP2010524476A
ENA NUCLEIC ACID DRUGS MODIFYING SPLICING IN mRNA PRECURSOR
WO2004048570A1
Multiple EXON skipping compositions for dmd
WO2010048586A1
Molecule for treating an inflammatory disorder
WO2011078672A1