SCN2A regulatory compounds and methods

Oligomeric modified oligonucleotides targeting SCN2A RNA and protein reduce their expression, addressing the lack of effective treatments for developmental and epileptic encephalopathy, intellectual disability, and autism spectrum disorder, thereby improving associated symptoms.

JP7834712B2Active Publication Date: 2026-03-24IONIS PHARMACEUTICALS INC
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-08-06
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

There is a lack of effective treatments for developmental and epileptic encephalopathy, intellectual disability, and autism spectrum disorder, particularly for conditions associated with SCN2A mutations, which present symptoms such as seizures, cognitive impairments, and motor disorders.

Method used

Development of compounds, particularly oligomeric modified oligonucleotides, that reduce the amount or activity of SCN2A RNA and protein, targeting specific sequences to alleviate symptoms by reducing their expression.

Benefits of technology

The compounds effectively decrease SCN2A RNA and protein levels, improving symptoms like seizures, cognitive impairments, and motor disorders in conditions associated with SCN2A mutations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007834712000001
    Figure 0007834712000001
  • Figure 0007834712000002
    Figure 0007834712000002
  • Figure 0007834712000003
    Figure 0007834712000003
Patent Text Reader

Abstract

Compounds, methods, and pharmaceutical compositions are provided that reduce the amount or activity of SCN2A RNA in a cell or a subject, and in particular examples, reduce the amount of SCN2A protein in a cell or a subject. These compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of a disease or disorder associated with voltage-gated sodium channel proteins, such as developmental and epileptic encephalopathy, intellectual disability, or autism spectrum disorder. These symptoms and characteristics include, but are not limited to, seizures, hypotonia, impaired sensory integration, delayed motor skill development and impairment, intellectual and cognitive impairment, motor and balance impairment, visual impairment, language and speech delay, gastrointestinal disorders, neurodevelopmental delay, insomnia, and sudden and unexpected death in epilepsy.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence List This application is submitted together with an electronic sequence listing. The sequence listing is provided as a file titled BIOL0373WOSEQ_ST25.txt, created on August 2, 2021, with a size of 850KB. The information in the electronic sequence listing is incorporated herein by reference in its entirety.

[0002] The present invention provides compounds, methods, and pharmaceutical compositions that reduce the amount or activity of SCN2A RNA in cells or subjects, and in certain cases reduce the amount of SCN2A protein in cells or subjects. Such compounds, methods, and pharmaceutical compositions are useful for improving at least one symptom or feature of a disorder or illness associated with voltage-gated sodium channel proteins, such as developmental and epileptic encephalopathy, intellectual disability, or autism spectrum disorder. Such symptoms and features include, but are not limited to, seizures, hypotonia, sensory integration disorders, delayed and impaired motor skills development, intellectual and cognitive impairment, motor and balance disorders, visual impairment, delayed language and speech, gastrointestinal disorders, delayed neurodevelopment, insomnia, and sudden, unexpected death in epilepsy. [Background technology]

[0003] The human gene SCN2A encodes the human SCN2A protein, the alpha-1 subunit NaV1.2 of the voltage-gated sodium channel. Mutations in SCN2A are associated with various neurodevelopmental and intellectual disorders, including early-onset seizure-induced epileptic encephalopathy (EE), late-onset seizure-induced epileptic encephalopathy, and developmental and epileptic encephalopathy (DEE), including benign familial neonatal-infant seizures (BFNIS). Mutations in SCN2A are also associated with intellectual disability (ID) and / or autism spectrum disorder (ASD), with or without seizures (Wolff, M., et al., 2019, Epilepsia 60, S59-S67; Sanders, S., et al., 2018, Trends in Neurosciences 41, 442-456; Wolff, M., et al., 2017, Brain 140, 1316-1336).DEE encompasses a wide range of conditions, including neonatal DEE and early infant DEE, such as Ohtahara syndrome and infantile epilepsy with migraine-induced focal seizures (EIMFS), and early childhood and childhood DEE, such as West syndrome and Lennon-Gastaut syndrome, Dravet syndrome, idiopathic / generic generalized epilepsy (IGE / GGE), lateral temporal lobe epilepsy, myoclonic atopic epilepsy (MAE), infantile migraine-induced partial seizures (MMPSI), and familial epileptic migraine with or without epilepsy (Wolff, M., et al., 2019, Harkin, LA, et al., 2007, Brain 130, 843-852, Escayg, A., et al., 2010, Epilepsia 51, 1650-1658, Miller IO, et al.). November 29, 2007 [Updated April 18, 2019]. In: Adam MP, Ardinger HH, Pagon RA, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2020, available at: www.ncbi.nlm.nih.gov / books / NBK1318 / ).

[0004] Symptoms and characteristics associated with DEE include seizures, hypotonia, sensory integration disorders, delayed and impaired motor skills development, intellectual and cognitive impairment, motor and balance disorders, visual impairment, delayed language and speech, gastrointestinal disorders, delayed neurodevelopment, insomnia, and sudden, unexpected death due to epilepsy. Seizures include focal seizures, clonic seizures, tonic seizures, and generalized tonic-clonic seizures, prolonged seizures (often lasting more than 10 minutes), and frequent seizures (e.g., convulsive, myoclonic, absence, focal, blunt, and tonic seizures) (Guzzetta, F., 2011, Epilepsia 52:S2, 35-38, Anwar et al., 2019, Cureus 11, e5006, Wolff et al., 2019). Symptoms and characteristics associated with ID and ASD include delayed motor development, delayed social and verbal development indicators, repetitive movements, oral incoordination, gastrointestinal disorders, insomnia, and seizures (Wolff et al., 2019). Currently, there is a lack of acceptable options for the treatment of DEE, such as EE, delayed-onset EE, and BFNIS, as well as for the treatment of ID and ASD. Therefore, the purpose of this specification is to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases and disorders. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Wolff, M., et al., 2019, Epilepsia 60, S59-S67 [Non-Patent Document 2] Sanders, S., et al., 2018, Trends in Neurosciences 41, 442-456 [Non-Patent Document 3] Wolff, M., et al., 2017, Brain 140, 1316-1336 [Non-Patent Document 4] Harkin, LA, et al., 2007, Brain 130, 843-852 [Non-Patent Document 5] Escayg, A., et al., 2010, Epilepsia 51, 1650-1658 [Non-Patent Document 6] Miller IO, et al., 2007 Nov 29 [Updated April 18, 2019]. In: Adam MP, Ardinger HH, Pagon RA, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2020, available at: www.ncbi.nlm.nih.gov / books / NBK1318 / [Non-Patent Document 7] Guzzetta, F., 2011, Epilepsia 52:S2, 35-38 [Non-Patent Document 8] Anwar et al., 2019, Cureus 11, e5006, Wolff et al., 2019 [Overview of the project]

[0006] This specification provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SCN2A RNA, and in certain embodiments for reducing the expression of SCN2A protein in cells or subjects. In certain embodiments, the subject is a disease or disorder related to a voltage-gated sodium channel protein. In certain embodiments, the voltage-gated sodium channel protein is SCN2A. In certain embodiments, the subject is a disease or disorder related to a voltage-gated sodium channel protein other than SCN2A. In certain embodiments, the subject is a disease or disorder related to SCN1A.

[0007] In certain embodiments, the subject is developmental or epileptic encephalopathy; in certain embodiments, the subject is early-onset seizure-onset epileptic encephalopathy; in certain embodiments, the subject is late-onset seizure-onset epileptic encephalopathy; in certain embodiments, the subject is benign familial neonatal-infant seizures; in certain embodiments, the subject is intellectual disability (ID); in certain embodiments, the subject is autism spectrum disorder (ASD); and in certain embodiments, the subject is Dravet syndrome. In certain embodiments, the compound useful for reducing the amount or activity of SCN2A RNA is an oligomeric compound. In certain embodiments, the compound useful for reducing the amount or activity of SCN2A RNA is a modified oligonucleotide. In certain embodiments, the compound useful for reducing the expression of SCN2A protein is an oligomeric compound. In certain embodiments, the compound useful for reducing the expression of SCN2A protein is a modified oligonucleotide.

[0008] The invention also provides methods useful for improving at least one symptom or feature of developmental or epileptic encephalopathy, intellectual disability, or autism spectrum disorder, such as EE, delayed seizure onset EE, and BFNIS. In certain embodiments, such symptoms or features include seizures, hypotonia, sensory integration disorders, motor skills impairments, intellectual and cognitive impairments, motor and balance impairments, visual impairments, language and speech delays, neurodevelopmental delays, sudden unexpected death in epilepsy, motor skills development delays, social and language developmental indicators delays, repetitive movements, oral incoordination, gastrointestinal disorders (e.g., gastroesophageal reflux disease, diarrhea, constipation, motor disorders, etc.), and insomnia. In certain embodiments, seizures include focal seizures, clonic seizures, tonic seizures, and generalized tonic-clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (e.g., convulsive, myoclonic, absence, focal, blunt, and tonic seizures). In certain embodiments, for example, the following are provided: (Item 1) An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 90% complementary to an equal-length portion of the SCN2A nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. (Item 2) An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleic acid base sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 adjacent nucleic acid bases from any of the nucleic acid base sequences of SEQ ID NOs. 16 to 2531, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. (Item 3) An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleic acid base sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 adjacent nucleic acid bases from any of the nucleic acid base sequences of SEQ ID NOs. 2532 to 2539, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. (Item 4) The modified oligonucleotide is at least 90% complementary to the equal-length portion of SEQ ID NO: 2 and 50% or less complementary to the equal-length portion of SEQ ID NO: 1, as described in any of items 1 to 3. (Item 5) An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, a) The nucleic acid base sequence of the modified oligonucleotide is the nucleic acid bases of SEQ ID NO. 2: 199863~199905, 227493~22755, 243124~243204, 247823~247921, 254142~254177, 168911~168945, 170026~170061, 183519~183562, 188630~188668, 199912~199962, 227419~227450, or 23817 It comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 adjacent nucleic acid bases that are complementary to the equal-length portion from 3 to 238192, wherein the modified oligonucleotide does not contain six or more LNA nucleosides, or b) The nucleic acid base sequence of the modified oligonucleotide contains at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 adjacent nucleic acid bases that are complementary to the equal-length portion of nucleic acid bases 243917-244073, 170174-170200, 176724-176751, 180772-180801, 183968-184016, 202877-202906, 224198-224217, 224199-224218, or 243918-243937 of SEQ ID NO: The modified oligonucleotide is an oligomeric compound comprising at least one modification selected from a modified sugar moiety and a modified nucleoside bond. (Item 6) An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, a) The nucleic acid base sequences of the modified oligonucleotides are: SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, 2526; 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, 2521; 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2 406, 2527; 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, 2522; 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, 2539; 18, 96, 485, 561, 638 ,715,791,868,2247,2323,2400;174,1328,1405,1482,1559,1636,1713,1790,1865,1942,2019;20,98,253,332,410,1406,1483,1560,1637,1714,1791,1866,1943;21,411,1407,1484,1561,1638,1715;24,414,871,948,1025,1100;25,337,415,490, The modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 adjacent nucleic acids of a sequence selected from 566, 2099, 2176, 2252, 2328, 2405, and 182, wherein the modified oligonucleotide does not contain six or more LNA nucleosides, or b) The nucleic acid base sequences of the modified oligonucleotides are: SEQ ID NOs: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, 2537; 302, 1513, 1667, 1744, 1819, 1896, 1973; 148, 226, 1364, 1441, 1518, 1595, 1672, 1749; 227, 1292, 1369, 1446, 1523, 1600, 1677, 1754, 1829; 228, 1679, 1756, A sequence selected from 1831, 1908, 1985, 2061, 2138, 2214, 2290; 1226, 1303, 1380, 1457, 1534, 1611; 2079; 2523, and 2477, containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 adjacent nucleic acid bases, The modified oligonucleotide is an oligomeric compound comprising at least one modification selected from a modified sugar moiety and a modified nucleoside bond. (Item 7) An oligomer compound according to any of items 1 to 6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleic acid base sequence containing at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 adjacent nucleic acid bases, as of SEQ ID NOs. 2487, 2493, 2510, or 2514. (Item 8) An oligomer compound according to any one of items 1 to 6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleic acid base sequence of SEQ ID NO: 2534, comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 adjacent nucleic acid bases. (Item 9) The oligomer compound according to any one of items 1 to 8, wherein the modified oligonucleotide has a nucleic acid base sequence that, when measured over the entire nucleic acid base sequence of the modified oligonucleotide, is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleic acid base sequence of SEQ ID NO: 1 or SEQ ID NO: 2. (Item 10) The oligomer compound according to item 9, wherein the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the intron region of the nucleic acid sequence of SEQ ID NO: 2, the untranslated region of the nucleic acid sequence of SEQ ID NO: 2, or the intron / exon junction region of the nucleic acid sequence of SEQ ID NO: 2. (Item 11) The oligomer compound according to any of items 1 to 10, wherein the nucleic acid base sequence of the modified oligonucleotide has a complementarity of 50% or less, 60% or less, 70% or less, 80% or less, 90% or less, or 95% or less with respect to the exon region of the nucleic acid base sequence of Sequence ID No. 2. (Item 12) The modified oligonucleotides are 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, 1 An oligomeric compound according to any of items 1 to 11, consisting of 7-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides. (Item 13) The modified oligonucleotide is an oligomer compound according to any of items 1 to 11, comprising 17 to 19 or 21 to 30 linked nucleosides. (Item 14) The modified oligonucleotide is an oligomer compound according to any of items 1 to 13, comprising 16, 17, 18, 19, or 20 linked nucleosides. (Item 15) The modified oligonucleotide is the oligomeric compound described in item 14, consisting of 20 linked nucleosides. (Item 16) The modified oligonucleotide is the oligomer compound described in item 14, consisting of 18 linked nucleosides. (Item 17) The oligomer compound according to any one of items 1 to 16, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a modified sugar moiety. (Item 18) The oligomer compound according to item 17, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a bicyclic sugar moiety. (Item 19) The aforementioned bicyclic sugar portion includes a 4'-2' crosslink, and the 4'-2' crosslink is -CH 2 -O-, and -CH(CH 3 An oligomeric compound selected from )-O-, as described in item 18. (Item 20) The modified oligonucleotide is an oligomer compound according to any of items 17 to 19, which does not contain six or more bicyclic sugar moieties. (Item 21) The modified oligonucleotide is the oligomer compound described in item 17, which does not contain a bicyclic sugar moiety. (Item 22) The modified oligonucleotide is an oligomer compound according to any of items 17 to 20, which does not contain six or more LNA sugar moieties. (Item 23) The modified oligonucleotide is an oligomer compound according to any of items 17 to 21, which does not contain the LNA sugar moiety. (Item 24) The oligomer compound according to any one of items 17 to 23, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a non-bicyclic modified sugar moiety. (Item 25) The oligomer compound according to item 24, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety. (Item 26) The oligomeric compound according to any one of items 17 to 25, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a sugar substitute. (Item 27) The oligomeric compound according to item 26, wherein the sugar substitute is one of morpholino, modified morpholino, PNA, THP, and F-HNA. (Item 28) The modified oligonucleotide is a gapmer, as described in any of items 1 to 27. (Item 29) The modified oligonucleotide is, A 5'-region consisting of 1 to 6 linked 5'-region nucleosides, The central region consists of 6 to 10 linked central nucleosides, It includes a 3'-region consisting of 1 to 6 linked 3'-region nucleosides, Each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety, as described in any of items 1 to 28. (Item 30) The modified oligonucleotide is, A 5'-region consisting of 1 to 6 linked 5'-region nucleosides, The central region consists of 6 to 10 linked central nucleosides, It includes a 3'-region consisting of 1 to 6 linked 3'-region nucleosides, The oligomer compound according to any of items 1 to 28, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. (Item 31) The modified oligonucleotide is, A 5'-region consisting of five linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of five linked 3'-region nucleosides, The oligomer compound according to item 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. (Item 32) The modified oligonucleotide is, A 5'-region consisting of five linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of five linked 3'-region nucleosides, The oligomer compound described in item 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. (Item 33) The modified oligonucleotide is, A 5'-region consisting of 6 linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of four linked 3'-region nucleosides, The oligomer compound according to item 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. (Item 34) The modified oligonucleotide is, A 5'-region consisting of 6 linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of four linked 3'-region nucleosides, The oligomer compound described in item 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. (Item 35) The modified oligonucleotide is, A 5'-region consisting of four linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of six linked 3'-region nucleosides, The oligomer compound according to item 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. (Item 36) The modified oligonucleotide is, A 5'-region consisting of four linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of six linked 3'-region nucleosides, The oligomer compound described in item 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. (Item 37) The modified oligonucleotide is, A 5'-region consisting of four linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of six linked 3'-region nucleosides, The oligomer compound according to item 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. (Item 38) The modified oligonucleotide is, A 5'-region consisting of four linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of six linked 3'-region nucleosides, The oligomer compound described in item 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. (Item 39) The modified oligonucleotide is, A 5'-region consisting of 6 linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of four linked 3'-region nucleosides, The oligomer compound according to item 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. (Item 40) The modified oligonucleotide is, A 5'-region consisting of 6 linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of four linked 3'-region nucleosides, The oligomer compound described in item 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. (Item 41) The modified oligonucleotide is, A 5'-region consisting of five linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of five linked 3'-region nucleosides, The oligomer compound according to item 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. (Item 42) The modified oligonucleotide is, A 5'-region consisting of five linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of five linked 3'-region nucleosides, The oligomer compound described in item 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. (Item 43) The oligomeric compound according to item 29 or item 30, wherein the 5'-region or the 3'-region comprises at least one bicyclic nucleoside. (Item 44) The oligomeric compound according to item 29 or item 30, wherein the 5'-region or the 3'-region comprises at least one nucleoside that is not a bicyclic nucleoside. (Item 45) The oligomer compound according to item 29 or item 30, wherein the 5'-region or the 3'-region comprises at least one nucleoside that is not an LNA nucleoside. (Item 46) The modified oligonucleotide is an oligomer compound according to any one of items 1 to 45, comprising at least one modified nucleoside interbond. (Item 47) The oligomeric compound described in item 46, wherein at least one modified nucleoside bond is a phosphorothioate nucleoside bond. (Item 48) The oligomeric compound described in item 46 or item 47, wherein each internucleoside bond is a modified internucleoside bond. (Item 49) The oligomeric compound described in item 48, wherein each nucleoside bond is a phosphorothioate nucleoside bond. (Item 50) The oligomer compound according to any one of items 46 to 47, wherein at least one nucleoside bond of the modified oligonucleotide is a phosphodiester nucleoside bond. (Item 51) The oligomer compound according to any one of items 1 to 46, wherein each nucleoside bond of the modified oligonucleotide is independently selected from phosphodiester nucleoside bonds or phosphorothioate nucleoside bonds. (Item 52) The oligomer compound according to any one of items 1-47 or 50-51, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. (Item 53) The nucleoside-binding motif of the modified oligonucleotide is selected from soooossssssssssooss, soooossssssssssssss, soooosssssssssssoooss, soosssssssssssoooss, soooossssssssssss, and soooosssssssssooss, The oligomeric compound described in item 46, wherein s = phosphorothioate nucleoside bond and o = phosphodiester nucleoside bond. (Item 54) The modified oligonucleotide is an oligomer compound according to any of items 1 to 53, comprising at least one modified nucleic acid base. (Item 55) The modified nucleic acid base is 5-methylcytosine, as described in item 54 of the oligomer compound. (Item 56) The oligomer compound described in any of items 1 to 55, which, when administered according to a standard in vitro assay, can reduce the amount of SCN2A RNA in vitro by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. (Item 57) An oligomer compound comprising a modified oligonucleotide following the following chemical symbol, G es m C eo A eo T eo A eo A ds T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A eo m Ceo A es A es A e (Sequence ID 2493), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. (Item 58) An oligomer compound comprising a modified oligonucleotide following the following chemical symbols, m C es A eo m C eo G eo A eo m C eo A ds T ds A ds T ds T ds T ds T ds T ds m C ds T ds A eo m C es A es m C e (Sequence ID 2514) During the ceremony, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. (Item 59) An oligomer compound comprising a modified oligonucleotide following the following chemical symbols, m C es m C eo A eo m C eo G eo A eo m C ds A ds T ds A ds T ds T ds T ds T ds T ds m C ds T eo A es m C es A e (Sequence ID 2510) During the ceremony, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. (Item 60) An oligomer compound comprising a modified oligonucleotide following the following chemical symbol, T es m C eo T eo G eo m C eo A eo T ds G ds T ds A ds A ds m C ds m C ds T ds T ds T ds A eo T es A es m C e (Sequence No. 2487), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. (Item 61) An oligomer compound comprising a modified oligonucleotide following the following chemical symbol, G es m C eo A eo T eo A eo A eo T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A ds m C eo A es A es A e (Sequence ID 2493), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. (Item 62) An oligomer compound comprising a modified oligonucleotide following the following chemical symbol, GT m Ces T eo G eo m C eo A es T ds G ds T ds A ds A ds m C ds m C ds T ds T eo T eo A es T es A e (Sequence ID 2534), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. (Item 63) The oligomer compound described in any of items 1 to 62, wherein the oligomer compound is a single-chain oligomer compound. (Item 64) The oligomer compound according to any one of items 1 to 63, wherein the modified oligonucleotide of the oligomer compound is a salt, and the salt is a sodium salt or a potassium salt. (Item 65) An oligomer compound according to any of items 1 to 64, comprising the modified oligonucleotide. (Item 66) The modified oligonucleotide is an RNAi compound, which is an oligomer compound as described in any of items 1 to 62. (Item 67) An oligomer compound according to any one of items 1 to 66, further comprising a conjugate group. (Item 68) The conjugate group comprises a conjugate moiety and a conjugate linker, as described in item 67. (Item 69) The aforementioned conjugate group comprises a GalNAc cluster containing 1 to 3 GalNAc ligands, as described in item 68, which is the oligomer compound. (Item 70) The aforementioned conjugate linker is an oligomeric compound as described in item 68, consisting of a single bond. (Item 71) The conjugate linker is cleavable, as described in item 68, for the oligomeric compound. (Item 72) The aforementioned conjugate linker is an oligomeric compound as described in item 68, comprising 1 to 3 linker-nucleosides. (Item 73) The oligomer compound according to any one of items 67 to 72, wherein the conjugate group is bonded to the modified oligonucleotide at the 5' end of the modified oligonucleotide. (Item 74) The oligomer compound according to any one of items 67 to 72, wherein the conjugate group is bonded to the modified oligonucleotide at the 3' end of the modified oligonucleotide. (Item 75) An oligomeric compound according to any of items 1 to 74, further comprising terminal groups. (Item 76) The oligomer compound described above is an oligomer compound according to any of items 1-71 or 73-75, which does not contain a linker nucleoside. (Item 77) Modified oligonucleotides following the following chemical structure:

change

change

change

change

change

change

change

change

change

change

change

change

[0009] It should be understood that the above general description and the following detailed description are merely illustrative and explanatory, and not limiting. In this specification, the use of the singular includes the plural unless otherwise specified. Where used in this specification, the use of "or" means "and / or" unless otherwise specified. Furthermore, the use of the term "including" and other forms such as "include" and "included" is not limiting. Also, terms such as "element" or "component" include both elements and components containing one unit and elements and components containing multiple subunits, unless otherwise specified.

[0010] The section headings used herein are for structural purposes only and should not be construed as limiting the subject matter described herein. All documents or parts of documents cited herein, including but not limited to patents, patent applications, articles, books, papers, and reference sequence records in GenBank, ENSEMBL, and NCBI, are expressly incorporated by reference, both in part and in whole, of the documents described herein.

[0011] definition Unless otherwise specified, the nomenclature, procedures, and techniques used in relation to analytical chemistry, synthetic organic chemistry, and medicinal chemistry and pharmaceutical chemistry described herein are well known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0012] Unless otherwise specified, the following terms have the following meanings:

[0013] definition As used herein, “2'-deoxynucleoside” means a nucleoside containing a 2'-H(H)deoxyfuranose sugar moiety. In certain embodiments, the 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside and also contains a 2'-β-D-deoxyribose sugar moiety, which has a β-D-ribose configuration as found in natural deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxynucleoside may contain a modified nucleic acid base or an RNA nucleic acid base (uracil).

[0014] As used herein, "2'-MOE" means that the 2'-OH group of the furanose sugar moiety is a 2'-OCH2CH2OCH3 group. "2'-MOE sugar moiety" means the sugar moiety that has a 2'-OCH2CH2OCH3 group instead of the 2'-OH group of the furanose sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety has a β-D-ribose configuration. "MOE" means O-methoxyethyl.

[0015] As used herein, "2'-MOE nucleoside" means a nucleoside containing a 2'-MOE sugar moiety.

[0016] As used herein, "2'-OMe" means that the 2'-OH group of the furanose sugar moiety is a 2'-OCH3 group. "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" means the sugar moiety that has a 2'-OCH3 group instead of the 2'-OH group of the furanose sugar moiety. Unless otherwise indicated, the 2'-OMe sugar moiety has a β-D-ribose configuration.

[0017] As used herein, "2'-OMe nucleoside" means a nucleoside containing a 2'-OMe sugar moiety.

[0018] As used herein, “2'-substituted nucleoside” means a nucleoside containing a 2'-substituted sugar moiety. As used herein, “2'-substituted” means a sugar moiety containing at least one 2'-substituent other than H or OH.

[0019] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleic acid base.

[0020] As used herein, “administer” means to give a drug to a subject.

[0021] As used herein, “antisense activity” means any detectable and / or measurable change resulting from the hybridization of an antisense compound with respect to its target nucleic acid. In certain embodiments, antisense activity is a decrease or reduction in the amount or expression of a target nucleic acid or the protein encoded by the target nucleic acid compared to the level of the target nucleic acid or the target protein in the absence of the antisense compound.

[0022] As used herein, “antisense compound” means an oligomeric compound capable of achieving at least one antisense activity. An antisense compound comprises an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.

[0023] As used herein, “antisense reagent” means an antisense compound and, optionally, one or more additional characteristics such as a sense compound.

[0024] As used herein, “sense compound” means a sense oligonucleotide and optionally one or more additional features such as a conjugate group.

[0025] As used herein, "antisense oligonucleotide" means an oligonucleotide comprising an oligonucleotide portion of an antisense compound, which can hybridize to a target nucleic acid and can have at least one antisense activity. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense ribonuclease H oligonucleotides.

[0026] As used herein, “improvement” in relation to treatment means improvement of at least one symptom or characteristic compared to the same symptom or characteristic without treatment. In certain embodiments, improvement means a reduction in the severity or frequency of a symptom or characteristic, or a delay in the onset or progression of the severity or frequency of a symptom or characteristic. In certain embodiments, such symptom or characteristic is seizures, hypotonia, sensory integration disorder, motor skills impairment, intellectual and cognitive impairment, motor and balance impairment, visual impairment, language and speech delay, neurodevelopmental delay, sudden unexpected death in epilepsy, motor skills development delay, social and language developmental indicators delay, repetitive movements, oral incoordination, gastrointestinal disorders (e.g., gastroesophageal reflux disease, diarrhea, constipation, motor disorders, etc.), or insomnia. In certain embodiments, seizures include focal seizures, clonic seizures, tonic seizures, and generalized tonic-clonic seizures, prolonged seizures (often lasting longer than 10 minutes), or frequent seizures (e.g., convulsive, myoclonic, absence, focal, blunt, or tonic seizures).

[0027] As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, the second of which is formed via a bridge connecting to two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanose moiety. In certain embodiments, the furanose sugar moiety is a ribose moiety. In certain embodiments, the bicyclic sugar moiety does not contain a furanose moiety.

[0028] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside containing a bicyclic sugar moiety.

[0029] As used herein, “cerebrospinal fluid” or “CSF” means the fluid that fills the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.

[0030] As used herein, “cleavable portion” means a bond or atomic base that is cleaved under physiological conditions, such as within a cell, animal, or human body.

[0031] As used herein, “complementary” with respect to oligonucleotides means that at least 70% of the nucleic acid bases or one or more portions of the oligonucleotide and the nucleic acid bases or one or more portions of the other nucleic acid can form hydrogen bonds with each other when the nucleic acid base sequences of the oligonucleotide and the other nucleic acid are aligned in opposing directions. As used herein, complementary nucleic acid bases mean nucleic acid bases that can form hydrogen bonds with each other. Examples of complementary nucleic acid base pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or target nucleic acids do not need to have nucleic acid base complementarity at each nucleoside. Rather, some mismatches are acceptable. As used herein, “perfect complementarity” or “100% complementarity” with respect to an oligonucleotide or portion thereof means that one oligonucleotide or portion thereof is complementary to the other oligonucleotide or target nucleic acid at each nucleic acid base of the shorter of two oligonucleotides, or at each nucleoside if the oligonucleotides are of the same length.

[0032] As used herein, “conjugate group” means an atomic group that directly or indirectly bonds to an oligonucleotide. A conjugate group comprises a conjugate moiety and a conjugate linker that bonds the conjugate moiety to an oligonucleotide.

[0033] As used herein, “conjugate linker” means an atomic group containing a single bond or at least one bond that connects the conjugate portion to an oligonucleotide.

[0034] As used herein, “conjugate moiety” means the atomic group that is bound to the oligonucleotide via a conjugate linker.

[0035] As used herein, “adjacent” in the context of oligonucleotides refers to nucleosides, nucleic acid bases, sugar moieties, or internucleoside bonds that are directly adjacent to each other. For example, “adjacent nucleic acid bases” means nucleic acid bases that are directly adjacent to each other within a sequence.

[0036] As used herein, "cEt" means a 4'-to-2' bridge in place of the 2'OH group of the ribose sugar moiety, where the bridge has the formula 4'-CH(CH3)-O-2' and the methyl group of the bridge is in the S configuration. "cEt sugar moiety" is a bicyclic sugar moiety having a 4'-to-2' bridge in place of the 2'OH group of the ribose sugar moiety, where the bridge has the formula 4'-CH(CH3)-O-2' and the methyl group of the bridge is in the S configuration. "cEt" means constrained ethyl.

[0037] As used herein, "cEt nucleoside" means a nucleoside containing a cEt-modified sugar moiety.

[0038] As used herein, “chiral-enriched population” means multiple molecules of the same molecular formula, where the number or percentage of molecules in the population containing a particular stereochemical configuration at a particular chiral center is higher than the number or percentage of molecules in the population that would be expected to contain the same particular stereochemical configuration at the same particular chiral center if the particular chiral center were stereochemically random. A chiral-enriched population of a molecule having multiple chiral centers in each molecule may contain one or more stereochemically random chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound comprising a modified oligonucleotide.

[0039] As used herein, "chiral-controlled" with respect to nucleoside bonds means that the chirality of that bond is enhanced for a particular stereochemical configuration.

[0040] As used herein, “deoxy region” means a region of 5 to 12 adjacent nucleotides, of which at least 70% are 2'-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from 2'-β-D-deoxynucleosides, bicyclic nucleosides, and 2'-substituted nucleosides. In certain embodiments, the deoxy region supports ribonuclease H activity. In certain embodiments, the deoxy region is the gap or inner region of a gapmer.

[0041] As used herein, “gapmer” means a modified oligonucleotide comprising an inner region having multiple nucleosides supporting ribonuclease H cleavage located between outer regions having one or more nucleosides, wherein the nucleosides comprising the inner region are chemically distinct from the nucleosides comprising the outer region. The inner region may be referred to as a “gap,” and the outer region may be referred to as a “wing” or “wing segment.” In certain embodiments, the inner region is a deoxy region. The position of the inner region or gap refers to the order of the nucleosides in the inner region and is counted starting from the 5' end of the inner region. Unless otherwise indicated, “gapmer” refers to a sugar motif. In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap contains one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remaining nucleosides of the gap are 2'-β-D-deoxynucleosides. As used herein, the term “MOE gapmer” refers to a gapmer having a gap containing a 2'-β-D-deoxynucleoside and a wing containing a 2'-MOE nucleoside. As used herein, the term “mixed-wing gapmer” refers to a gapmer having a wing containing modified nucleosides having at least two different sugar modifications. Unless otherwise indicated, a gapmer may contain one or more modified nucleoside-to-modified bonds and / or modified nucleic acid bases, and such modifications do not necessarily follow a gapmer pattern of sugar modifications.

[0042] As used herein, “hotspot region” is a range of nucleic acid bases on a target nucleic acid that is suitable for reducing the amount or activity of the target nucleic acid through the oligomeric compound.

[0043] As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to specific mechanisms, the most common mechanisms of hybridization involve hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen type hydrogen bonds between complementary nucleic acid bases.

[0044] As used herein, “nucleoside bond” means a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, “modified nucleoside bond” means any nucleoside bond other than a phosphodiester nucleoside bond. A “phosphorothioate nucleoside bond” or “PS nucleoside bond” is a modified nucleoside bond in which one of the non-bridged oxygen atoms of a phosphodiester nucleoside bond is replaced with a sulfur atom.

[0045] As used herein, “linker-nucleoside” means a nucleoside that directly or indirectly links an oligonucleotide to a conjugate moiety. The linker-nucleoside is located within the conjugate linker of the oligomeric compound. The linker-nucleoside is not considered part of the oligonucleotide moiety of the oligomeric compound, even if it is adjacent to the oligonucleotide.

[0046] As used herein, "LNA" means Loc nucleic acid. "LNA sugar moiety" is a bicyclic sugar moiety having a 4'-to-2' crosslink instead of a 2'OH group in the furanose sugar moiety, the crosslink having the formula 4'-CH2-O-2'. "LNA" means Loc nucleic acid. In some embodiments, the furanose sugar moiety is a ribose sugar moiety. As used herein, "LNA nucleoside" means a nucleoside containing an LNA sugar moiety.

[0047] As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that includes modifications such as substitutions that do not form a bridge between two atoms in the sugar to form a second ring.

[0048] As used herein, “mismatch” or “non-complementary” means that, when the first oligonucleotide and the second oligonucleotide are aligned, the nucleic acid bases of the first oligonucleotide are not complementary to the corresponding nucleic acid bases of the second oligonucleotide or the target nucleic acid.

[0049] As used herein, “motif” means the pattern of unmodified and / or modified sugar moieties, nucleic acid bases, and / or nucleoside bonds in an oligonucleotide.

[0050] As used herein, “nucleic acid base” means an unmodified or modified nucleic acid base. As used herein, “unmodified nucleic acid base” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, “modified nucleic acid base” is an unmodified atom other than A, T, C, U, or G that can pair with at least one unmodified nucleic acid base. “5-methylcytosine” is a modified nucleic acid base. A universal base is a modified nucleic acid base that can pair with any one of the five unmodified nucleic acid bases. As used herein, “nucleic acid base sequence” means the sequence of adjacent nucleic acid bases in a target nucleic acid or oligonucleotide, independent of any modification of sugar or nucleoside bonds.

[0051] As used herein, “nucleoside” means a compound or fragment of a compound containing a nucleic acid base and a sugar moiety. The nucleic acid base and sugar moiety are, independently, either unmodified or modified. As used herein, “modified nucleoside” means a nucleoside containing a modified nucleic acid base and / or a modified sugar moiety. Modified nucleosides include baseless nucleosides in which a nucleic acid base is deleted. “Linked nucleosides” are nucleosides linked by adjacent sequences (i.e., there are no further nucleosides between linked nucleosides).

[0052] As used herein, “oligomer compound” means an oligonucleotide and one or more additional features, optionally such as a conjugate group or terminal group. An oligomer compound may or may not pair with a second oligomer compound that is complementary to a first oligomer compound. A “single-stranded oligomer compound” is an unpaired oligomer compound. The term “oligomer double-stranded” means a double-stranded structure formed by two oligomer compounds having complementary nucleic acid base sequences. Each oligomer compound in an oligomer double-stranded structure may be referred to as a “double-stranded oligomer compound.”

[0053] As used herein, “oligonucleotide” means a chain of linked nucleosides connected via internucleoside bonds, where each nucleoside and internucleoside bond may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not contain any nucleoside modifications or internucleoside modifications.

[0054] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use when administering to a subject. Certain such carriers enable the formulation of pharmaceutical compositions as, for example, tablets, pills, sugars, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0055] As used herein, “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of a compound. A pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not impart any undesirable toxic effects to it.

[0056] As used herein, “pharmaceutical composition” means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in a specific cell line.

[0057] As used herein, “prodrug” means a therapeutic agent in an in vitro form that is converted into a different form within a subject or its cells. Typically, the conversion of a prodrug within a subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cell or tissue, and / or by physiological conditions.

[0058] As used herein, “decreased amount,” “decreased activity,” “decrease in amount,” or “decrease in activity” means a decrease or blockage of transcriptional expression or activity compared to the transcriptional expression or activity in the untreated or control sample, and does not necessarily indicate complete removal of transcriptional expression or activity.

[0059] As used herein, "RNA" means RNA transcripts and, unless otherwise specified, includes mRNA precursors and mature mRNA.

[0060] As used herein, “RNAi compound” means an antisense compound that acts at least in part via RISC or Ago2 to modulate a target nucleic acid and / or the protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNAs, including microRNA mimetic molecules. In certain embodiments, RNAi compounds modulate the quantity, activity, and / or splicing of the target nucleic acid. The term RNAi compound excludes antisense compounds that act via ribonuclease H.

[0061] As used herein, “self-complementary” with respect to oligonucleotides means oligonucleotides that hybridize with themselves, at least partially.

[0062] As used herein, “standard in vitro assay” means the assay described in Example 1 and reasonable variations thereof.

[0063] As used herein, “standard in vivo assay” means the assay described in Example 8 and its reasonable modifications.

[0064] As used herein, “stereochemically random chiral centers” in the context of a group of molecules having the same molecular formula means chiral centers having a random stereochemical configuration. For example, in a group of molecules containing stereochemically random chiral centers, the number of molecules having the (S) configuration of the stereochemically random chiral center may be the same as, but not necessarily the same as, the number of molecules having the (R) configuration of the stereochemically random chiral center. The stereochemical configuration of a chiral center is considered random if it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereochemically random chiral center is a stereochemically random phosphorothioate nucleoside bond.

[0065] As used herein, “subject” means human or non-human animal. In certain embodiments, the subject is human.

[0066] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2'-OH(H) β-D-ribose moiety, such as that found in RNA (“unmodified RNA sugar moiety”), or a 2'-H(H) β-D-deoxyribose sugar moiety, such as that found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen at the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanose sugar moiety or sugar substitute.

[0067] As used herein, “sugar substitute” means a modified sugar moiety other than the furanose moiety that can bind a nucleic acid base to another group in the oligonucleotide, such as an internucleoside bond, a conjugate group, or a terminal group. Modified nucleosides containing sugar substitutes can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides can be hybridized to complementary oligomeric compounds or target nucleic acids.

[0068] As used herein, “symptom or feature” means any physical feature or test result indicating the presence or degree of a disease or disorder. In certain embodiments, the symptom is evident to the subject or to a healthcare professional examining or testing the subject. In certain embodiments, the feature is evident by an invasive diagnostic test, including but not limited to a post-mortem examination. In certain embodiments, the feature is evident by a brain MRI examination.

[0069] As used herein, “target nucleic acid” and “target RNA” mean the nucleic acid on which the antisense compound is designed to act. Target RNA means RNA transcripts and, unless otherwise specified, also includes mRNA precursors and mature mRNA.

[0070] As used herein, “target region” means the portion of a target nucleic acid designed to hybridize with an oligomeric compound.

[0071] As used herein, “terminal group” means a chemical group or atomic group covalently bonded to the end of an oligonucleotide.

[0072] As used herein, “therapeutic dose” means the amount of a drug that produces a therapeutic effect on a subject. For example, a therapeutic dose improves the symptoms or characteristics of a disease or disorder.

[0073] As used herein, “to treat” means to improve the disease or disorder of interest by administering the oligomeric reagent or oligomeric compound described herein. In certain embodiments, treating the subject means that the symptoms are improved compared to the same symptoms without treatment. In certain embodiments, treatment reduces the severity or frequency of symptoms, delays the onset of symptoms, slows the progression of symptoms, or slows the severity or frequency of symptoms.

[0074] Specific Embodiments This disclosure provides the following non-limiting, numbered embodiments.

[0075] Example 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 90% complementary to an equal-length portion of the SCN2A nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. Example 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleic acid base sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 adjacent nucleic acid bases from any of the nucleic acid base sequences of SEQ ID NOs. 16 to 2531, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. Example 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleic acid base sequence containing at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 adjacent nucleic acid bases from any of the nucleic acid base sequences of SEQ ID NOs. 2532 to 2539, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. Example 4. The oligomer compound according to any one of Embodiments 1 to 3, wherein the modified oligonucleotide is at least 90% complementary to the equal-length portion of SEQ ID NO: 2 and 50% or less complementary to the equal-length portion of SEQ ID NO: 1. Example 5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, a) The nucleic acid base sequence of the modified oligonucleotide is the nucleic acid bases of SEQ ID NO: 199863~199905, 227493~22755, 243124~243204, 247823~247921, 254142~254177, 168911~168945, 170026~170061, 183519~183562, 188630~188668, 199912~199962, 227419~227450, or 23817 It contains at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 adjacent nucleic acid bases that are complementary to the equal-length portion from 3 to 238192, provided that the modified oligonucleotide does not contain six or more LNA nucleosides, or b) The nucleic acid base sequence of the modified oligonucleotide contains at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 adjacent nucleic acid bases that are complementary to the equal-length portions of nucleic acid bases 243917-244073, 170174-170200, 176724-176751, 180772-180801, 183968-184016, 202877-202906, 224198-224217, 224199-224218, or 243918-243937 of SEQ ID NO: Modified oligonucleotides are oligomeric compounds comprising at least one modification selected from modified sugar moieties and modified nucleoside interbonding. Example 6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, a) The nucleic acid sequences of the modified oligonucleotides are: SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, 2526; 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, 2521; 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406 ,2527;29,30,107,108,185,186,263,264,341,342,419,420,1796,1871,1948,2025,2101,2178,2254,2330,2503,2517,2522;1016,1093,1104,1169,1246,1323,1400,1477,1554,1708,1785,1860,1937,2014,1631,2090,2539;18,96,485,561,638,7 15, 791, 868, 2247, 2323, 2400; 174, 1328, 1405, 1482, 1559, 1636, 1713, 1790, 1865, 1942, 2019; 20, 98, 253, 332, 410, 1406, 1483, 1560, 1637, 1714, 1791, 1866, 1943; 21, 411, 1407, 1484, 1561, 1638, 1715; 24, 414, 871, 948, 1025, 1100; 25, 337, 415, 490, 5 The modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 adjacent nucleic acids of a sequence selected from 66, 2099, 2176, 2252, 2328, 2405, and 182, wherein the modified oligonucleotide does not contain six or more LNA nucleosides, or b) The nucleic acid base sequences of the modified oligonucleotides are: SEQ ID NOs: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, 2537; 302, 1513, 1667, 1744, 1819, 1896, 1973; 148, 226, 1364, 1441, 1518, 1595, 1672, 1749; 227, 1292, 1369, 1446, 1523, 1600, 1677, 1754, 1829; 228, 1679, 1756, A sequence selected from 1831, 1908, 1985, 2061, 2138, 2214, 2290; 1226, 1303, 1380, 1457, 1534, 1611; 2079; 2523, and 2477, containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 adjacent nucleic acid bases, Modified oligonucleotides are oligomeric compounds comprising at least one modification selected from modified sugar moieties and modified nucleoside interbonding. Example 7. An oligomer compound according to any one of Embodiments 1 to 6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleic acid base sequence containing at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 adjacent nucleic acid bases, as of SEQ ID NO: 2487, 2493, 2510, or 2514. Example 8. An oligomer compound according to any one of Embodiments 1 to 6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, and having a nucleic acid base sequence of SEQ ID NO: 2534, comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 adjacent nucleic acid bases. Example 9. The oligomer compound according to any one of Embodiments 1 to 8, wherein the modified oligonucleotide has a nucleic acid base sequence that, when measured over the entire nucleic acid base sequence of the modified oligonucleotide, is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleic acid base sequence of SEQ ID NO: 1 or SEQ ID NO: 2. Example 10. The oligomer compound according to Embodiment 9, wherein the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the intron region of the nucleic acid sequence of SEQ ID NO: 2, the untranslated region of the nucleic acid sequence of SEQ ID NO: 2, or the intron / exon junction region of the nucleic acid sequence of SEQ ID NO: 2. Example 11. The oligomer compound according to any one of Embodiments 1 to 10, wherein the nucleic acid base sequence of the modified oligonucleotide has a complementarity of 50% or less, 60% or less, 70% or less, 80% or less, 90% or less, or 95% or less with respect to the exon region of the nucleic acid base sequence of Sequence ID No. 2. Example 12. Modified oligonucleotides are available in the following ranges: 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, 17- An oligomer compound according to any of Embodiments 1 to 11, comprising 30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides. Example 13. The modified oligonucleotide is an oligomer compound according to any one of Embodiments 1 to 11, comprising 17 to 19 or 21 to 30 linked nucleosides. Example 14. The modified oligonucleotide is an oligomer compound according to any one of Embodiments 1 to 13, comprising 16, 17, 18, 19, or 20 linked nucleosides. Example 15. The modified oligonucleotide is the oligomer compound described in Embodiment 14, comprising 20 linked nucleosides. Example 16. The modified oligonucleotide is the oligomer compound described in Embodiment 14, comprising 18 linked nucleosides. Example 17. The oligomer compound according to any one of Embodiments 1 to 16, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a modified sugar moiety. Example 18. The oligomer compound according to Embodiment 17, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a bicyclic sugar moiety. Example 19. The oligomer compound according to Embodiment 18, wherein the bicyclic sugar portion includes a 4'-2' crosslink, and the 4'-2' crosslink is selected from -CH2-O- and -CH(CH3)-O-. Example 20. The modified oligonucleotide is an oligomer compound according to any one of embodiments 17 to 19, which does not contain six or more bicyclic sugar moieties. Example 21. The modified oligonucleotide is the oligomer compound according to Embodiment 17, which does not contain a bicyclic sugar moiety. Example 22. The modified oligonucleotide is an oligomer compound according to any one of embodiments 17 to 20, which does not contain six or more LNA sugar moieties. Example 23. The modified oligonucleotide is an oligomer compound according to any one of embodiments 17 to 21, which does not contain the LNA sugar moiety. Example 24. The oligomer compound according to any one of Embodiments 17 to 23, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a non-bicyclic modified sugar moiety. Example 25. The oligomer compound according to Embodiment 24, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety. Example 26. The oligomeric compound according to any one of Embodiments 17 to 25, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a sugar substitute. Example 27. The oligomer compound according to Embodiment 26, wherein the sugar substitute is one of morpholino, modified morpholino, PNA, THP, and F-HNA. Example 28. The modified oligonucleotide is a gapmer, as described in any of Embodiments 1 to 27. Example 29. Modified oligonucleotides are, A 5'-region consisting of 1 to 6 linked 5'-region nucleosides, The central region consists of 6 to 10 linked central nucleosides, It includes a 3'-region consisting of 1 to 6 linked 3'-region nucleosides, The oligomer compound according to any one of Embodiments 1 to 28, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. Example 30. Modified oligonucleotides are, A 5'-region consisting of 1 to 6 linked 5'-region nucleosides, The central region consists of 6 to 10 linked central nucleosides, It includes a 3'-region consisting of 1 to 6 linked 3'-region nucleosides, The oligomer compound according to any one of Embodiments 1 to 28, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. Example 31. Modified oligonucleotides are, A 5'-region consisting of five linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of five linked 3'-region nucleosides, The oligomer compound according to Embodiment 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. Example 32. Modified oligonucleotides are, A 5'-region consisting of five linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of five linked 3'-region nucleosides, The oligomer compound according to Embodiment 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. Example 33. Modified oligonucleotides are, A 5'-region consisting of 6 linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of four linked 3'-region nucleosides, The oligomer compound according to Embodiment 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. Example 34. Modified oligonucleotides are, A 5'-region consisting of 6 linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of four linked 3'-region nucleosides, The oligomer compound according to Embodiment 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. Example 35. Modified oligonucleotides are, A 5'-region consisting of four linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of six linked 3'-region nucleosides, The oligomer compound according to Embodiment 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. Example 36. Modified oligonucleotides are, A 5'-region consisting of four linked 5'-region nucleosides, The central region consists of 10 linked central nucleosides, It includes a 3'-region consisting of six linked 3'-region nucleosides, The oligomer compound according to Embodiment 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. Example 37. Modified oligonucleotides are, A 5'-region consisting of four linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of six linked 3'-region nucleosides, The oligomer compound according to Embodiment 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. Example 38. Modified oligonucleotides are, A 5'-region consisting of four linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of six linked 3'-region nucleosides, The oligomer compound according to Embodiment 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. Example 39. Modified oligonucleotides are, A 5'-region consisting of 6 linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of four linked 3'-region nucleosides, The oligomer compound according to Embodiment 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. Example 40. Modified oligonucleotides are, A 5'-region consisting of 6 linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of four linked 3'-region nucleosides, The oligomer compound according to Embodiment 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. Example 41. Modified oligonucleotides are, A 5'-region consisting of five linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of five linked 3'-region nucleosides, The oligomer compound according to Embodiment 29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and at least six of the central region nucleosides contain a 2'-β-D-deoxyribose sugar moiety. Example 42. Modified oligonucleotides are, A 5'-region consisting of five linked 5'-region nucleosides, The central region consists of eight linked central nucleosides, It includes a 3'-region consisting of five linked 3'-region nucleosides, The oligomer compound according to Embodiment 30, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a 2'-MOE modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribose sugar moiety. Example 43. The oligomer compound according to Embodiment 29 or Embodiment 30, wherein the 5'-region or 3'-region comprises at least one bicyclic nucleoside. Example 44. The oligomer compound according to Embodiment 29 or Embodiment 30, wherein the 5'-region or 3'-region comprises at least one nucleoside that is not a bicyclic nucleoside. Example 45. The oligomer compound according to Embodiment 29 or Embodiment 30, wherein the 5'-region or 3'-region comprises at least one nucleoside that is not an LNA nucleoside. Example 46. The modified oligonucleotide is an oligomer compound according to any one of Embodiments 1 to 45, comprising at least one modified nucleoside interbond. Example 47. The oligomer compound according to Embodiment 46, wherein at least one modified nucleoside bond is a phosphorothioate nucleoside bond. Example 48. The oligomer compound according to Embodiment 46 or Embodiment 47, wherein each nucleoside bond is a modified nucleoside bond. Example 49. The oligomer compound according to Embodiment 48, wherein each nucleoside bond is a phosphorothioate nucleoside bond. Example 50. The oligomer compound according to any one of embodiments 46 to 47, wherein at least one nucleoside bond of the modified oligonucleotide is a phosphodiester nucleoside bond. Example 51. The oligomer compound according to any one of Embodiments 1 to 46, wherein each nucleoside bond of the modified oligonucleotide is independently selected from phosphodiester nucleoside bonds or phosphorothioate nucleoside bonds. Example 52. The oligomer compound according to any one of Embodiments 1 to 47 or 50 to 51, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. Example 53. The nucleoside-binding motif of the modified oligonucleotide is selected from soooossssssssssooss, soooossssssssssssss, soooosssssssssssoooss, soooosssssssssssoooss, soooossssssssssss, and soooosssssssssooss, The oligomer compound according to Embodiment 46, wherein in the formula, s = phosphorothioate nucleoside bond and o = phosphodiester nucleoside bond. Example 54. The modified oligonucleotide is an oligomer compound according to any one of Embodiments 1 to 53, comprising at least one modified nucleic acid base. Example 55. The oligomer compound according to Embodiment 54, wherein the modified nucleic acid base is 5-methylcytosine. Example 56. The oligomer compound according to any of Embodiments 1 to 55, which, when administered according to a standard in vitro assay, can reduce the amount of SCN2A RNA in vitro by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. Example 57. An oligomer compound comprising a modified oligonucleotide following the following chemical symbol, G es m C eo A eo T eo A eo A ds T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A eo m C eo A es A es A e (Sequence ID 2493), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. Example 58. An oligomer compound comprising a modified oligonucleotide following the following chemical symbols, m C es A eo m C eo G eo A eo m C eo A ds T ds A ds T ds T ds T ds T ds T ds m C ds T ds A eo m C es A es m C e (Sequence ID 2514), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. Example 59. An oligomer compound comprising a modified oligonucleotide following the following chemical symbols, m C es m C eo A eo m C eo G eo A eo m C ds A ds T ds A ds T ds T ds T ds T ds Tds m C ds T eo A es m C es A e (Sequence ID 2510), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. Example 60. An oligomer compound comprising a modified oligonucleotide following the following chemical symbol, T es m C eo T eo G eo m C eo A eo T ds G ds T ds A ds A ds m C ds m C ds T ds T ds T ds A eo T es A es m C e (Sequence No. 2487), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. Example 61. An oligomer compound comprising a modified oligonucleotide following the following chemical symbol, G es m C eo A eo T eo A eo A eo T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A ds m C eo A es A es A e (Sequence ID 2493), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. Example 62. An oligomer compound comprising a modified oligonucleotide following the following chemical symbol, GT m C es T eo G eo m C eo A es T ds G ds T ds A ds A ds mC ds m C ds T ds T eo T eo A es T es A e (Sequence ID 2534), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and An oligomeric compound in which o = phosphodiester nucleoside bond. Example 63. The oligomer compound according to any one of Embodiments 1 to 62, wherein the oligomer compound is a single-chain oligomer compound. Example 64. The oligomer compound according to any one of Embodiments 1 to 63, wherein the modified oligonucleotide of the oligomer compound is a salt, and the salt is a sodium salt or a potassium salt. Example 65. An oligomeric compound according to any one of embodiments 1 to 64, comprising a modified oligonucleotide. Example 66. The modified oligonucleotide is an RNAi compound, as described in any of Embodiments 1 to 62. Example 67. The oligomer compound according to any one of embodiments 1 to 66, further comprising a conjugate group. Example 68. The conjugate group comprises a conjugate moiety and a conjugate linker, as described in Embodiment 67 of the oligomer compound. Example 69. The conjugate group comprises a GalNAc cluster containing 1 to 3 GalNAc ligands, as described in Embodiment 68. Example 70. The conjugate linker is the oligomer compound according to Embodiment 68, comprising a single bond. Example 71. The conjugate linker is cleavable, as described in Embodiment 68, of the oligomer compound. Example 72. The conjugate linker is the oligomeric compound according to Embodiment 68, comprising 1 to 3 linker-nucleosides. Example 73. The oligomer compound according to any one of embodiments 67 to 72, wherein the conjugate group is bonded to the modified oligonucleotide at the 5' end of the modified oligonucleotide. Example 74. The oligomer compound according to any one of embodiments 67 to 72, wherein the conjugate group is bonded to the modified oligonucleotide at the 3' end of the modified oligonucleotide. Example 75. An oligomer compound according to any one of Embodiments 1 to 74, further comprising terminal groups. Example 76. The oligomer compound is the oligomer compound according to any of Embodiments 1 to 71 or 73 to 75, which does not contain a linker nucleoside. Example 77. Modified oligonucleotides following the following chemical structure: [ka] (Sequence ID 2493) or a salt thereof. Example 78. A modified oligonucleotide according to Embodiment 77, which is a sodium salt or a potassium salt. Example 79. Modified oligonucleotides following the following chemical structure: [ka] (Sequence ID 2493). Example 80. Modified oligonucleotides following the following chemical structure: [ka] (Sequence ID 2514) or a salt thereof. Example 81. A modified oligonucleotide according to Embodiment 80, which is a sodium salt or a potassium salt. Example 82. Modified oligonucleotides following the following chemical structure: [ka] (Sequence ID 2514). Example 83. Modified oligonucleotides following the following chemical structure: [ka] (Sequence ID 2510) or a salt thereof. Example 84. A modified oligonucleotide according to Embodiment 83, which is a sodium salt or a potassium salt. Example 85. Modified oligonucleotides following the following chemical structure: [ka] (Sequence ID 2510). Example 86. Modified oligonucleotides following the following chemical structure: [ka] (Sequence ID 2487) or a salt thereof. Example 87. A modified oligonucleotide according to Embodiment 86, which is a sodium salt or a potassium salt. Example 88. Modified oligonucleotides following the following chemical structure: [ka] (Sequence number 2487). Example 89. Modified oligonucleotides following the following chemical structure: [ka] (Sequence ID 2493) or a salt thereof. Example 90. A modified oligonucleotide according to Embodiment 89, which is a sodium salt or a potassium salt. Example 91. Modified oligonucleotides following the following chemical structure: [ka] (Sequence ID 2493). Example 92. Modified oligonucleotides following the following chemical structure: [ka] (Sequence ID 2534) or a salt thereof. Example 93. A modified oligonucleotide according to Embodiment 92, which is a sodium salt or a potassium salt. Example 94. Modified oligonucleotides following the following chemical structure: [ka] (Sequence ID 2534). Example 95. A chiral-enriched group of an oligomer compound according to any of Embodiments 1 to 76 or a modified oligonucleotide according to any of Embodiments 77 to 94, wherein the group is enriched with modified oligonucleotides containing at least one specific phosphorothioate nucleoside bond having a specific stereochemical configuration. Example 96. The chiralized population according to Embodiment 95, wherein the population is enriched with modified oligonucleotides containing at least one specific phosphorothioate nucleoside interbond having a (Sp) configuration. Example 97. The chiralized population according to Embodiment 95, wherein the population is enriched with modified oligonucleotides containing at least one specific phosphorothioate nucleoside bond having a (Rp) configuration. Example 98. The chiralized population according to Embodiment 95, wherein the population is enriched with modified oligonucleotides having specific, independently selected stereochemical configurations at each phosphorothioate nucleoside bond. Example 99. The chiralized population according to Embodiment 98, wherein the population is concentrated with modified oligonucleotides having a (Sp) configuration in each phosphorothioate nucleoside bond, or with modified oligonucleotides having a (Rp) configuration in each phosphorothioate nucleoside bond. Example 100. The chiralized population according to Embodiment 98, wherein the population is enriched with modified oligonucleotides having a (Rp) configuration in one specific phosphorothioate nucleoside bond and a (Sp) configuration in each of the remaining phosphorothioate nucleoside bonds. Example 101. The chiralized population according to Embodiment 98, wherein the population is enriched with modified oligonucleotides having at least three adjacent phosphorothioate nucleoside bonds in an Sp, Sp, and Rp configuration in the 5' to 3' direction. Example 102. An oligomeric compound according to any of Embodiments 1 to 76 or a group of modified oligonucleotides according to any of Embodiments 77 to 94, wherein all of the phosphorothioate nucleoside bonds of the modified oligonucleotide are stereochemically random. Example 103. An oligomer double-chain comprising a first oligomer compound and a second oligomer compound comprising a second modified oligonucleotide, wherein the first oligomer compound is the oligomer compound described in any of Embodiments 1 to 76. Example 104. The oligomer double-stranded oligomer according to Embodiment 103, wherein the second oligomer compound comprises a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, and the nucleic acid base sequence of the second modified oligonucleotide includes a complementary region of at least 8 nucleic acid bases, wherein the nucleic acid base sequence of the second modified oligonucleotide is at least 90% complementary to an equal-length portion of the first modified oligonucleotide. Example 105. An antisense reagent comprising an antisense compound, wherein the antisense compound is an oligomeric compound according to any of Embodiments 1 to 76, or a modified oligonucleotide according to any of Embodiments 77 to 94. Example 106. The antisense reagent is the oligomeric double-stranded reagent of Embodiment 103 or Embodiment 104, as described in Embodiment 103. Example 107. Antisense reagents are, i. A ribonuclease H reagent that can reduce the amount of SCN2A nucleic acid through activation of ribonuclease H, or ii. An antisense reagent according to Embodiment 105 or Embodiment 106, which is an RNAi reagent capable of reducing the amount of SCN2A nucleic acid via RISC / Ago2 activation. Example 108. A pharmaceutical composition comprising an oligomeric compound according to any of Embodiments 1 to 76, a modified oligonucleotide according to any of Embodiments 77 to 94, a group according to any of Embodiments 95 to 102, an oligomeric double-strand according to Embodiment 103 or Embodiment 104, or an antisense reagent according to any of Embodiments 105 to 107, and a pharmaceutically acceptable diluent or carrier. Example 109. The pharmaceutical composition according to Embodiment 108, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate-buffered saline (PBS). Example 110. The pharmaceutical composition according to Embodiment 109, wherein the pharmaceutical composition substantially comprises an oligomeric compound, a modified oligonucleotide, a group, an oligomeric double, or an antisense reagent, and aCSF. Example 111. The pharmaceutical composition according to Embodiment 109, wherein the pharmaceutical composition substantially comprises an oligomeric compound, a modified oligonucleotide, a group, an oligomeric double, or an antisense reagent, and PBS. Example 112. A pharmaceutical composition comprising a modified oligonucleotide according to any one of embodiments 77 to 94 and a pharmaceutically acceptable diluent. Example 113. The pharmaceutical composition according to Embodiment 112, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS). Example 114. The pharmaceutical composition according to Embodiment 113, wherein the pharmaceutical composition substantially comprises a modified oligonucleotide and aCSF. Example 115. The pharmaceutical composition according to Embodiment 113, wherein the pharmaceutical composition substantially comprises a modified oligonucleotide and PBS. Example 116. A method comprising administering to a subject an oligomer compound described in any of Embodiments 1 to 76, a modified oligonucleotide described in any of Embodiments 77 to 94, a population described in any of Embodiments 95 to 102, an oligomer double-strand of Embodiment 103 or Embodiment 104, an antisense reagent described in any of Embodiments 105 to 107, or a pharmaceutical composition described in any of Embodiments 108 to 115. Example 117. A method for treating a disease or disorder related to voltage-gated sodium channel proteins, comprising administering a therapeutically effective amount of an oligomer compound according to any of Embodiments 1 to 76, a modified oligonucleotide according to any of Embodiments 77 to 94, a population according to any of Embodiments 95 to 102, an oligomer double-chain according to Embodiment 103 or Embodiment 104, an antisense reagent according to any of Embodiments 105 to 107, or a pharmaceutical composition according to any of Embodiments 108 to 115 to a subject who has or is at risk of developing a disease or disorder related to voltage-gated sodium channel proteins, thereby treating the disease or disorder related to voltage-gated sodium channel proteins. Example 118. A method for reducing the amount of SCN2A protein in CSF of a subject having or at risk of developing a disease or disorder related to voltage-gated sodium channel protein, comprising: using a therapeutically effective amount of an oligomeric compound according to any of Embodiments 1 to 76, a modified oligonucleotide according to any of Embodiments 77 to 94, a population according to any of Embodiments 95 to 102, an oligomeric double-chain according to Embodiment 103 or Embodiment 104, an antisense reagent according to any of Embodiments 105 to 107, or a pharmaceutical composition according to any of Embodiments 108 to 115, thereby reducing the amount of SCN2A protein in CSF. Example 119. The method according to Embodiment 117 or Embodiment 118, wherein the disease or disorder is a neurodevelopmental disorder. Example 120. The method according to Embodiment 117 or Embodiment 118, wherein the disease or disorder is related to SCN1A or SCN2A. Example 121. A method for treating a disease or disorder related to SCN2A, comprising administering to a subject having or at risk of developing a disease or disorder related to SCN2A in a therapeutically effective amount an oligomeric compound according to any of Embodiments 1 to 76, a modified oligonucleotide according to any of Embodiments 77 to 94, a population according to any of Embodiments 95 to 102, an oligomeric double-chain of Embodiment 103 or Embodiment 104, an antisense reagent according to any of Embodiments 105 to 107, or a pharmaceutical composition according to any of Embodiments 108 to 115, thereby treating a disease or disorder related to SCN2A. Example 122. The method according to Embodiment 121, wherein the disease or disorder associated with SCN2A is developmental and epileptic encephalopathy, intellectual disability, or autism spectrum disorder. Example 123. The method according to Embodiment 122, wherein the developmental and epileptic encephalopathy is one of the following: early-onset seizure-onset epileptic encephalopathy (EE), late-onset seizure-onset epileptic encephalopathy, or benign familial neonatal-infant seizures. Example 124. The method according to Embodiment 121, wherein the disease or disorder associated with SCN2A is Ohtahara syndrome, infantile epilepsy with migratory focal seizures, West syndrome, Lennon-Gastaut syndrome, Dravet syndrome, idiopathic / generic generalized epilepsy, lateral temporal lobe epilepsy, myoclonic astatic epilepsy, infantile migraine with partial seizures, or familial epileptic migraine. Example 125. The method according to any one of embodiments 118 to 120, wherein the disease or disorder is associated with SCN1A. Example 126. The method according to Embodiment 125, wherein the diseases or disorders associated with SCN1A are developmental and epileptic encephalopathy. Example 127. The method according to Embodiment 125 or Embodiment 126, wherein the developmental and epileptic encephalopathy is Dravet syndrome. Example 128. The method according to Embodiment 126 or Embodiment 127, wherein the developmental and epileptic encephalopathy is any of Ohtahara syndrome, infantile epilepsy with migratory focal seizures, West syndrome, Lennon-Gastaut syndrome, Dravet syndrome, idiopathic / generic generalized epilepsy, lateral temporal lobe epilepsy, myoclonic astatic epilepsy, infantile migraine with partial seizures, or familial epileptic migraine. Example 129. The method according to any one of embodiments 117 to 128, wherein at least one symptom or characteristic of a disease or disorder is improved. Example 130. The method according to embodiment 129, wherein the symptom or characteristic is a seizure. Example 131. The method according to any one embodiment 130, wherein the seizure is one of the following: focal seizure, clonic seizure, tonic seizure, generalized tonic-clonic seizure, convulsive, myoclonic, absence, or blunt state. Example 132. The method according to Embodiment 130, wherein the seizure is one of a focal seizure, a clonic seizure, a tonic seizure, or a generalized tonic seizure. Example 133. The method according to Embodiment 129, wherein the symptoms or characteristics are any of the following: seizures, hypotonia, sensory integration disorder, motor skills impairment, intellectual and cognitive impairment, motor and balance impairment, visual impairment, language and speech delay, gastrointestinal disorder, neurodevelopmental delay, or sudden, unexpected death due to epilepsy. Example 134. The method according to Embodiment 129, wherein the symptoms or characteristics are any of the following: delayed motor skills development, delayed social and verbal development indicators, repetitive movements, non-coordination of the mouth, gastrointestinal disorders, insomnia, or seizures. Example 135. The method according to any one of embodiments 130 to 134, wherein the seizures are frequent or prolonged. Example 136. The method according to any one of Embodiments 116 to 135, wherein administration of a modified oligonucleotide reduces seizures, sensory integration disorders, motor skill impairments, intellectual and cognitive impairments, motor and balance disorders, visual impairments, language and speech delays, gastrointestinal disorders, neurodevelopmental delays, motor developmental delays, delays in social development indicators, repetitive movements, oral incoordination, or insomnia, or delays death. Example 137. The method according to any one of Embodiments 116 to 136, wherein an oligomeric compound, modified oligonucleotide, population, oligomeric double, antisense reagent, or pharmaceutical composition is administered to the central nervous system or systemically. Example 138. The method according to any one of Embodiments 116 to 136, wherein an oligomeric compound, modified oligonucleotide, population, oligomeric double, antisense reagent, or pharmaceutical composition is administered to the central nervous system and systemically. Example 139. The method according to any one of Embodiments 111 to 131, wherein an oligomeric compound, modified oligonucleotide, population, oligomeric double, antisense reagent, or pharmaceutical composition is administered either intraarachnoidally, systemically, subcutaneously, or intramuscularly. Example 140. The method according to any one of embodiments 116 to 139, wherein the subject is a human. Example 141. A method for reducing the amount of SCN2A RNA in cells, comprising contacting the cells with an oligomeric compound according to any of Embodiments 1 to 76, a modified oligonucleotide according to any of Embodiments 77 to 94, a population according to any of Embodiments 95 to 102, an oligomeric double-strand according to Embodiment 103 or Embodiment 104, an antisense reagent according to any of Embodiments 105 to 107, or a pharmaceutical composition according to any of Embodiments 108 to 115, thereby reducing the amount of SCN2A RNA in the cells. Example 142. A method for reducing the amount of SCN2A protein in cells, comprising contacting the cells with an oligomeric compound according to any of Embodiments 1 to 76, a modified oligonucleotide according to any of Embodiments 77 to 94, a population according to any of Embodiments 95 to 102, an oligomeric double-strand according to Embodiment 103 or Embodiment 104, an antisense reagent according to any of Embodiments 105 to 107, or a pharmaceutical composition according to any of Embodiments 108 to 115, thereby reducing the amount of SCN2A protein in the cells. Example 143. The method according to Embodiment 141 or Embodiment 142, wherein the cells are cortical cells, hippocampal cells, or spinal cord cells. Example 144. The cells are present in an animal, according to any of embodiments 141 to 143. Example 145. The method according to any one of embodiments 141 to 144, wherein the cells are human cells. Example 146. Use of an oligomeric compound according to any of Embodiments 1 to 76, a modified oligonucleotide according to any of Embodiments 77 to 94, a population according to any of Embodiments 95 to 102, an oligomeric double-strand according to Embodiment 103 or Embodiment 104, an antisense reagent according to any of Embodiments 105 to 107, or a pharmaceutical composition according to any of Embodiments 108 to 115 to reduce SCN2A expression in cells. Example 147. The use described in Embodiment 146 reduces the level of SCN2A RNA in cells. Example 148. The use described in Embodiment 146 or Embodiment 147 results in a decrease in the level of SCN2A protein in cells. Example 149. The use according to any one of embodiments 146 to 148, wherein the cells are cortical cells, hippocampal cells, or spinal cord cells.

[0076] I. Specific oligonucleotides In certain embodiments, oligomeric compounds comprising oligonucleotides are provided herein, wherein the oligonucleotide consists of linked nucleosides. The oligonucleotide may be an unmodified oligonucleotide (RNA or DNA) or a modified oligonucleotide. The modified oligonucleotide includes at least one modification compared to the unmodified RNA or DNA. That is, the modified oligonucleotide includes at least one modified nucleoside (including a modified sugar moiety and / or a modified nucleic acid base) and / or at least one modified nucleoside bond.

[0077] A. Specific modified nucleosides Modified nucleosides contain either a modified sugar moiety or a modified nucleic acid base, or both.

[0078] 1. Specific sugar portion In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar substitute. Such sugar substitutes may include one or more substitutions corresponding to substitutions of other types of modified sugar moieties.

[0079] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanose ring having one or more substituents, none of which bridge two atoms of the furanose ring to form a bicyclic structure. Such non-bridged substituents can be at any position of the furanose, including but not limited to substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more non-bridged substituents of the non-bicyclic modified sugar moiety are branched. Examples of 2'- substituents suitable for the non-bicyclic modified sugar moiety include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'- substituents are halo, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1~C10 Alkoxy, O-C1~C 10 Substitutive alkoxy, O-C1~C 10 Alkyl, O-C1~C 10 Substitutive alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-Alkinyl, S-Alkinyl, N(R m )-Alkynyl, O-alkylenyl-O-alkyl, Alkynyl, Alkalyl, Aralkyl, O-Alkalyl, O-Aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ) and each R in the formula m and R n These are independently H, an amino protecting group, or substituted or unsubstituted C1-C1. 10The substituents are alkyl and selected from the 2'-substituents described in Cook et al. U.S. Patent No. 6,531,584, Cook et al. U.S. Patent No. 5,859,221, and Cook et al. U.S. Patent No. 6,005,087. Specific embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of 4' substituents suitable for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al. International Publication No. 2015 / 106128. Examples of 5' substituents suitable for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the non-bicyclic modified sugar moiety includes, for example, a 2'-F-5'-methyl sugar moiety, as well as a plurality of uncrosslinked sugar substituents, such as the modified sugar moieties and modified nucleosides described in International Publication 2008 / 101157 by Migawa et al. and U.S. Patent Publication 2013 / 0203836 by Rajeev et al.

[0080] In certain embodiments, the 2'-substituted non-bicyclic modified nucleosides are F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(R m )(R n )), each R in the formula m and R n These are independently H, an amino protecting group, or substituted or unsubstituted C1-C1. 10 The sugar moiety comprises an alkyl group, with a non-crosslinked 2'-substituted group selected from the alkyl group.

[0081] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-crosslinked 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N-(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0082] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-crosslinked 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0083] In certain embodiments, the modified furanose sugar moieties and the nucleosides containing such modified furanose sugar moieties are further defined by their isomeric configurations. For example, the 2'-deoxyfuranose sugar moiety may have seven isomeric configurations in addition to the natural β-D-deoxyribose configuration. Such modified sugar moieties are described, for example, in International Publication No. 2019 / 157531, which is incorporated herein by reference. The 2'-modified sugar moiety has an additional stereocenter at the 2'-position compared to the 2'-deoxyfuranose sugar moiety. Thus, such sugar moieties have a total of 16 possible isomeric configurations. Unless otherwise specified, the 2'-modified sugar moieties described herein are in the β-D-ribose isomeric configuration.

[0084] Certain modified sugar moieties include substituents that bridge two atoms of a furanose ring to form a second ring, resulting in a bicyclic sugar moiety. Nucleosides containing such bicyclic sugar moieties are referred to as bicyclic nucleosides (BNAs), loc nucleosides, or conformationally fixed nucleotides (CRNs). Specific such compounds are described in U.S. Patent Application Publication 2013 / 0190383 and the PCT Application Publication International Publication 2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of sugar substituents that bridge the 4' to 2' positions include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "restricted ethyl" or "cEt" when in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("restricted MOE" or "cMOE") and their analogues (e.g., Seth et al., U.S. Patent No. 7,399,845; Bhat et al., U.S. Patent No. 7 See U.S. Patent Nos. 569,686, 7,741,457 by Swayze et al., and 8,022,193 by Swayze et al.), 4'-C(CH3)(CH3)-O-2' and its analogues (see, for example, U.S. Patent No. 8,278,283 by Seth et al.), 4'-CH2-N(OCH3)-2' and its analogues (see, for example, U.S. Patent No. 8,278,425 by Prakash et al.), 4'-CH2-ON(CH3)-2' (see, for example, U.S. Patent Nos. 7,696,345 by Allerson et al. and 8,124,745 by Allerson et al.), 4'-CH2-C(H)(CH3)-2' (see, for example, Zhou, See et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and its analogues (see, for example, U.S. Patent No. 8,278,426 by Seth et al.), 4'-C(R a R b)-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', where each R, R a , and R b These are independently H, protecting groups, or C1-C 12 Examples include alkyl groups (see, for example, U.S. Patent No. 7,427,672 by Imanishi et al.). In certain embodiments, such 4'-to-2' crosslinking independently comprises 1 to 4 linked groups independently selected from:-[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-,-C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x -, and -N(R a )-, During the ceremony, x is 0, 1, or 2. n is 1, 2, 3, or 4. Each R a and R b These are independently H, protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2~C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2~C 12 Alkinyl, substituted C2-C 12 Alkinyl, C5~C 20 Aryl, substituted C5~C 20Aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), and Each J1 and J2 is independently H, C1~C 12 Alkyl, substituted C1-C 12 Alkyl, C2~C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2~C 12 Alkinyl, substituted C2-C 12 Alkinyl, C5~C 20 Aryl, substituted C5~C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic group, substituted heterocyclic group, C1~C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl group or a protecting group.

[0085] Freier et al., Nucleic Acids Research, 1997, 252, 2017 4429-4443、Albaek et al., J. Org. Chem., 2006, 71, 7731-7740、Singh et al., Chem. Commun., 1998, 4, 455-456、Koshkin et al., Tetrahedron, 1998, 54, 3607-3630、Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638、Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222、Singh et al., J. Org. Chem., 1998, 63, 10035-10039、Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379、Elayadi et al., Curr. Inventive Opinion. Drugs, 2001, 2, 558-561、Braasch et al., Chem. Biol., 2001, 8, 1-7、Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243, Wengel et al. U.S. Patent No. 7,053,207, Imanishi et al. U.S. Patent No. 6,268,490, Imanishi et al. U.S. Patent No. 6,770,748, U.S. Reissue Patent No. RE44,779 by Imanishi et al., U.S. Patent No. 6,794,499 by Wengel et al., U.S. Patent No. 6,670,461 by Wengel et al., U.S. Patent No. 7,034,133 by Wengel et al., U.S. Patent No. 8,080,644 by Wengel et al., U.S. Patent No. 8,034,909 by Wengel et al., U.S. Patent No. 8,153,365 by Wengel et al., U.S. Patent No. 7,572,582 by Wengel et al., and U.S. Patent No. 6,525,191 by Ramasamy et al., International Publication No. 2004 / 106356 by Torsten et al., International Publication No. 1999 / 014226 by Wengel et al., International Publication No. 20 See U.S. Patent No. 07 / 134181, U.S. Patent No. 7,547,684, U.S. Patent No. 7,666,854, U.S. Patent No. 8,088,746, U.S. Patent No. 7,750,131, U.S. Patent No. 8,030,467, U.S. Patent No. 8,268,980, U.S. Patent No. 8,546,556, U.S. Patent No. 8,530,640, U.S. Patent No. 9,012,421, U.S. Patent No. 8,501,805 by Migawa et al., U.S. Patent Publication No. 2008 / 0039618 by Allerson et al., and U.S. Patent Publication No. 2015 / 0191727 by Migawa et al.

[0086] In certain embodiments, the bicyclic sugar moiety and the nucleoside containing such bicyclic sugar moiety are further defined by their isomer configuration. For example, an LNA nucleoside (as described herein) may have an α-L configuration or a β-D configuration. [ka]

[0087] Bicyclic nucleosides of α-L-methyleneoxy(4'-CH2-O-2') or α-L-LNA have been incorporated into oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, a general description of bicyclic nucleosides includes both isomer configurations. Where the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is specified in embodiments illustrated herein, they are β-D configuration unless otherwise specified.

[0088] In certain embodiments, the modified sugar moiety comprises one or more uncrosslinked sugar substituents and one or more crosslinked sugar substituents (e.g., sugars that are 5'-substituted and crosslinked from 4' to 2').

[0089] In certain embodiments, the modified sugar moiety is a sugar substitute. In certain such embodiments, the oxygen atom of the sugar moiety is substituted with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging substituents and / or non-bridging substituents as described herein. For example, certain sugar substitutes include a 4' sulfur atom and substitutions at the 2' position (see, for example, U.S. Patent No. 7,875,733 and U.S. Patent No. 7,939,677 by Bhat et al.) and / or at the 5' position.

[0090] In certain embodiments, the sugar substitute includes a ring other than a five-atom ring. For example, in certain embodiments, the sugar substitute includes a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acids ("HNA"), anitol nucleic acids ("ANA"), manitol nucleic acids ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), and the following fluoroHNAs: [ka] (See “F-HNA”, for example, Swayze et al. U.S. Patent No. 8,088,904, Swayze et al. U.S. Patent No. 8,440,803, Swayze et al. U.S. Patent No. 8,796,437, and Swayze et al. U.S. Patent No. 9,005,906; F-HNA may also be called F-THP or 3'fluorotetrahydropyran), and the following formula: [ka] A nucleoside comprising a further modified THP compound having, where independently for each of the modified THP nucleosides, Bx is the nucleic acid base portion, T3 and T4 are, independently, nucleoside-linking groups that link a modified THP nucleoside to the rest of the oligonucleotide, or one of T3 and T4 is a nucleoside-linking group that links a modified THP nucleoside to the rest of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3' terminal group. q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl, and Examples of nucleosides include those in which R1 and R2 are independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and J1, J2, and J3 are independently H or C1-C6 alkyl.

[0091] In certain embodiments, a modified THP nucleoside is provided, and its q 1、 q 2、 q 3、 q4、 q 5、 q6 and q7 are H, respectively. In certain embodiments, q 1、 q 2、 q 3、 q 4、 q 5、 At least one of q6 and q7 is not H. In certain embodiments, q 1、 q 2、 q 3、 q 4、 q 5、 At least one of q6 and q7 is methyl. In certain embodiments, a modified THP nucleoside is provided, where R1 and R2 are F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0092] In certain embodiments, the sugar substitute comprises a ring having five or more atoms and one or more heteroatoms. For example, the use of nucleosides containing morpholino sugar moieties and oligonucleotides has been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and U.S. Patents 5,698,685, 5,166,315, 5,185,444, and 5,034,506 by Summerton et al.). As used herein, the term “morpholino” means a sugar substitute having the following structure: [ka]

[0093] In certain embodiments, morpholino may be modified, for example, by adding or changing various substituents from the morpholino structure described above. Such sugar substitutes are referred to herein as “modified morpholino.”

[0094] In certain embodiments, the sugar substitute includes an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar substitutes include, but are not limited to, peptide nucleic acids ("PNA"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in International Publication No. 2011 / 133876 by Manoharan et al.

[0095] Numerous other bicyclic and tricyclic sugars, as well as cyclic sugar substitutes, are known in the art and can be used with modified nucleosides.

[0096] 2. Specific modified nucleic acid bases In certain embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleic acid bases. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides containing modified nucleic acid bases. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides that do not contain nucleic acid bases, which are referred to as base-free nucleosides.

[0097] In certain embodiments, the modified nucleic acid base is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2-substituted purines, N-6-substituted purines, and O-6-substituted purines. In certain embodiments, the modified nucleic acid base is selected from: 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl(-C) =C-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothimine, 5-ribosyluracil (pseudracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleic acid bases include tricyclic pyrimidines such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleic acid bases may also include those in which purine or pyrimidine bases are substituted with other heterocycles, such as 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleic acid bases include those disclosed in U.S. Patent No. 3,687,808 by Merigan et al., The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, those disclosed in Chapter 15 of Antisense Research and Applications, Sanghvi, YS, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and those disclosed in Chapters 6 and 15 of Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0098] Publications teaching the preparation of the specific modified nucleic acid bases and other modified nucleic acid bases mentioned above include, but are not limited to, U.S. Patent Application Publication No. US2003 / 0158403 by Manoharan et al., U.S. Patent Application Publication No. 2003 / 0175906 by Manoharan et al., U.S. Patent No. 4,845,205 by Dinh et al., U.S. Patent No. 5,130,302 by Spielvogel et al., U.S. Patent No. 5,134,066 by Rogers et al., and U.S. Patent No. Bischofberger et al. Japanese Patent No. 5,175,273, U.S. Patent No. 5,367,066 by Urdea et al., U.S. Patent No. 5,432,272 by Benner et al., U.S. Patent No. 5,434,257 by Matteucci et al., U.S. Patent No. 5,457,187 by Gmeiner et al., U.S. Patent No. 5,459,255 by Cook et al., U.S. Patent No. 5,484,908 by Froehler et al., U.S. Patent No. 5,502,177 by Matteucci et al., U.S. Patent No. 5,525,71 U.S. Patent No. 1, Haralambidis et al. No. 5,552,540, Cook et al. No. 5,587,469, Froehler et al. No. 5,594,121, Switzer et al. No. 5,596,091, Cook et al. No. 5,614,617, Froehler et al. No. 5,645,985, Cook et al. No. 5,681,941, Cook et al. No. 5,811,534, Cook et al. Examples include U.S. Patent No. 5,750,692, U.S. Patent No. 5,948,903 by Cook et al., U.S. Patent No. 5,587,470 by Cook et al., U.S. Patent No. 5,457,191 by Cook et al., U.S. Patent No. 5,763,588 by Matteucci et al., U.S. Patent No. 5,830,653 by Froehler et al., U.S. Patent No. 5,808,027 by Cook et al., U.S. Patent No. 6,166,199 by Cook et al., and U.S. Patent No. 6,005,096 by Matteucci et al.

[0099] 3. Specific modified nucleoside inter-binding In certain embodiments, the nucleosides of modified oligonucleotides may be linked together using any internucleoside bond. Two main classes of internucleoside bond groups are determined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside bonds include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates ("P(O2)=S"), and phosphorodithioates ("HS-P=S"), which contain phosphodiester bonds ("P(O2)=O") (also called unmodified or naturally occurring bonds). Representative phosphorus-free internucleoside bonds include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiesters, thionocarbamates (-OC(=O)(NH)-S-), siloxanes (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside bonds can typically alter or enhance the nuclease resistance of oligonucleotides compared to naturally occurring phosphodiester internucleoside bonds. In certain embodiments, internucleoside bonds having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and phosphorus-free internucleoside bonds are well known to those skilled in the art.

[0100] Representative nucleoside bonds having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing nucleoside bonds having a chiral center can be prepared as a group of modified oligonucleotides containing stereochemically random nucleoside bonds, or as a group of modified oligonucleotides containing phosphorothioate nucleoside bonds in a specific stereochemical configuration. In a particular embodiment, the group of modified oligonucleotides contains phosphorothioate nucleoside bonds, in which case all of the phosphorothioate nucleoside bonds are stereochemically random. Such modified oligonucleotides can be produced using a synthesis method that results in a random selection of the stereochemical configuration of each phosphorothioate nucleoside bond. Nevertheless, as will be well understood by those skilled in the art, each individual phosphorothioate in each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides containing one or more specific phosphorothioate nucleoside bonds in a specific stereochemical configuration independently selected. In certain embodiments, the specific stereochemical configuration of the specific phosphorothioate nucleoside bond is present in at least 65% of the molecules in the population. In certain embodiments, the specific stereochemical configuration of the specific phosphorothioate nucleoside bond is present in at least 70% of the molecules in the population. In certain embodiments, the specific stereochemical configuration of the specific phosphorothioate nucleoside bond is present in at least 80% of the molecules in the population. In certain embodiments, the specific stereochemical configuration of the specific phosphorothioate nucleoside bond is present in at least 90% of the molecules in the population. In certain embodiments, the specific stereochemical configuration of the specific phosphorothioate nucleoside bond is present in at least 99% of the molecules in the population.Such chiral-enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, e.g., Oka et al., JACS 2003, 125, 8307, Wan et al. Nuc. Acid. Res., 2014, 42, 13456, and the method described in International Publication No. 2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides containing (Rp) and / or (Sp) phosphorothioates each contain one or more of the following formulas, where "B" represents a nucleic acid base: [ka] Unless otherwise specified, the chiral nucleoside bonds of the modified oligonucleotides described herein may be stereochemically random or in a specific stereochemical configuration.

[0101] Examples of neutral nucleoside interbonding include, but are not limited to, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Further examples of neutral nucleoside bonds include nonionic bonds containing siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonic acid esters, and amides (see, for example, *Carbohydrate Modifications in Antisense Research*; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580, Chapters 3 and 4, pp. 40-65). Further examples of neutral nucleoside bonds include nonionic bonds containing mixed moieties of N, O, S, and CH2 components.

[0102] B. Specific motifs In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides containing a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides containing a modified nucleic acid base. In certain embodiments, a modified oligonucleotide comprises one or more modified nucleoside bonds. In such embodiments, the modified sugar moiety, unmodified sugar moiety, and differently modified sugar moieties, nucleic acid bases, and / or nucleoside bonds of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleic acid bases, and nucleoside bonds are independent of each other. Thus, a modified oligonucleotide can be described by its sugar motif, nucleic acid base motif, and / or nucleoside bond motif (wherein used herein, the nucleic acid base motif describes the modification to the nucleic acid base independently of the sequence of the nucleic acid base).

[0103] 1. Specific sugar motifs In certain embodiments, the oligonucleotide comprises one or more types of modified sugar moieties and / or unmodified sugar moieties, which are arranged along the oligonucleotide or its moieties in a defined pattern or sugar motif. In certain examples, such sugar motifs include, but are not limited to, any of the sugar modifications considered herein.

[0104] In certain embodiments, the modified oligonucleotide has a gapmer motif defined by two outer regions or "wings" and a central or inner region or "gap". The three regions of the gapmer motif (5'-wing, gap, and 3'-wing) form a continuous sequence of nucleosides, where at least a portion of the sugar moiety of the nucleosides in each wing is different from at least a portion of the sugar moiety of the nucleosides in the gap. Specifically, at least the sugar moiety of the nucleosides in each wing closest to the gap (the 3'-terminal nucleosides of the 5'-wing and the 5'-terminal nucleosides of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleosides, thereby defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to each other. In certain embodiments, the gap contains one or more nucleosides having sugar moieties different from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmer).

[0105] In certain embodiments, the gapmer wing contains 1 to 6 nucleosides. In certain embodiments, each nucleoside in each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least one nucleoside in each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least two nucleosides in each wing of the gapmer contain modified sugar moieties. In certain embodiments, at least three nucleosides in each wing of the gapmer contain modified sugar moieties. In certain embodiments, at least four nucleosides in each wing of the gapmer contain modified sugar moieties. In certain embodiments, at least five nucleosides in each wing of the gapmer contain modified sugar moieties.

[0106] In certain embodiments, the gap of the gapmer contains 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gapmer contains a 2'-deoxyribose sugar moiety. In certain embodiments, at least six nucleosides of the gapmer contain a 2'-β-D-deoxyribose sugar moiety. In certain embodiments, each nucleoside of the gapmer contains a 2'-β-D-deoxyribose sugar moiety. In certain embodiments, at least one nucleoside of the gapmer contains a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer contains a 2'-OMe sugar moiety.

[0107] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, the nucleoside on the gap side of each wing / gap junction contains a 2'-deoxyribose sugar moiety, and the nucleoside on the wing side of each wing / gap junction contains a modified sugar moiety. In certain embodiments, at least six nucleosides of the gapmer's gap contain a 2'-β-D-deoxyribose sugar moiety. In certain embodiments, each nucleoside of the gapmer's gap contains a 2'-deoxyribose sugar moiety. In certain embodiments, each nucleoside of each wing of the gapmer contains a modified sugar moiety. In certain embodiments, one nucleoside of the gap contains a modified sugar moiety, and the remaining nucleosides of the gap each contain a 2'-deoxyribose sugar moiety.

[0108] In certain embodiments, a modified oligonucleotide includes or comprises a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide includes a modified sugar moiety. In certain embodiments, each nucleoside of a fully modified oligonucleotide includes a modified sugar moiety. In certain embodiments, a modified oligonucleotide includes or comprises a portion having a fully modified sugar motif, and each nucleoside within the fully modified portion includes the same modified sugar moiety, which is referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide includes the same 2'-modification.

[0109] In this specification, the lengths (number of nucleosides) of the three regions of a gapmer may be given using the notation [5'-number of nucleosides in the wing#]-[number of nucleosides in the gap#]-[3'-number of nucleosides in the wing#]. Thus, a 5-10-5 gapmer consists of five linked nucleosides in each wing and ten linked nucleosides in the gap. When such a name is followed by a specific modification, that modification is located within each sugar moiety of each wing, and the gap nucleoside contains a 2'-β-D-deoxyribose sugar moiety. Therefore, the 5-10-5MOE gapmer consists of a 2'-MOE nucleoside formed by the linkage of 5 units within the 5'-wing, a 2'-β-D-deoxynucleoside formed by the linkage of 10 units within the gap, and a 2'-MOE nucleoside formed by the linkage of 5 units within the 3'-wing. The 3-10-3cEt gapmer consists of a cEt nucleoside formed by the linkage of 3 units within the 5'-wing, a 2'-β-D-deoxynucleoside formed by the linkage of 10 units within the gap, and a cEt nucleoside formed by the linkage of 3 units within the 3'-wing. A 5-8-5 gapmer consists of a 5-unit linked nucleoside containing a modified sugar moiety in the 5'-wing, an 8-unit linked 2'-β-D-deoxynucleoside in the gap, and a 5-unit linked nucleoside containing a modified sugar moiety in the 3'-wing. A mixed-wing gapmer has at least two different modified sugar moieties in the 5'-wing and / or 3'-wing. A 5-8-5 or 5-8-4 mixed-wing gapmer has at least two different modified sugar moieties in the 5'-wing and / or 3'-wing.

[0110] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-8-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-8-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is an XYZ MOE gapmer, where X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2'-MOE nucleosides, and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.

[0111] In certain embodiments, the modified oligonucleotide has the following sugar motifs (5' to 3'): eeeeedyddddddddeeeee, eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents the 2'-deoxyribose sugar moiety, "e" represents the 2'-MOE sugar moiety, and "y" represents the 2'-OMe sugar moiety.

[0112] 2. Specific nucleic acid base motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleic acid bases, which are arranged along the oligonucleotide or a portion thereof in a defined pattern or motif. In certain embodiments, each nucleic acid base is modified. In certain embodiments, none of the nucleic acid bases are modified. In certain embodiments, each purine or pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleic acid bases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleic acid bases are 5-methylcytosine, and all of the other nucleic acid bases in the modified oligonucleotide are unmodified nucleic acid bases.

[0113] In certain embodiments, the modified oligonucleotide includes a block of modified nucleic acid bases. In certain such embodiments, the block is located at the 3'-terminus of the oligonucleotide. In certain embodiments, the block is within the range of three nucleosides at the 3'-terminus of the oligonucleotide. In certain embodiments, the block is located at the 5'-terminus of the oligonucleotide. In certain embodiments, the block is within the range of three nucleosides at the 5'-terminus of the oligonucleotide.

[0114] In certain embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside containing a modified nucleic acid base. In certain such embodiments, one nucleoside containing a modified nucleic acid base is located within the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-β-D-deoxyribose sugar moiety. In certain embodiments, the modified nucleic acid base is selected from 2-thiopyrimidine and 5-propympyrimidine.

[0115] 3. Specific nucleoside bond motifs In certain embodiments, the oligonucleotide includes modified and / or unmodified nucleoside bonds, which are arranged along the oligonucleotide or a portion thereof within a defined pattern or motif. In certain embodiments, each nucleoside bond is a phosphodiester nucleoside bond (P=O). In certain embodiments, each nucleoside bond is a phosphorothioate nucleoside bond (P=S). In certain embodiments, each nucleoside bond in the modified oligonucleotide is independently selected from phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, each phosphorothioate nucleoside bond is independently selected from stereochemically random phosphorothioate, (Sp)phosphorothioate, and (Rp)phosphorothioate. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all nucleoside bonds within the gap are modified. In certain embodiments, some or all of the nucleoside bonds within the wings are unmodified phosphodiester nucleoside bonds. In certain embodiments, the terminal nucleoside bonds are modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the nucleoside bond motif contains at least one phosphodiester nucleoside bond within at least one wing, wherein the at least one phosphodiester nucleoside bond is not a terminal nucleoside bond, and the remaining nucleoside bonds are phosphorothioate nucleoside bonds. In certain embodiments, all of the phosphorothioate nucleoside bonds are stereochemically random. In certain embodiments, all of the phosphorothioate nucleoside bonds within the wings are (Sp)phosphorothioates, and the gap contains at least one Sp,Sp,Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides containing such nucleoside-linking motifs.

[0116] In a specific manner, modified oligonucleotides have the following nucleoside-linking motifs (5' to 3'): sooosssssssssssssss, soooosssssssssssssss, soooosssssssssssssss, soooossssssssssssss, soooossssssssssssss, soooosssssssssssss, or sooossssssssssss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage.

[0117] C. specific length The length of oligonucleotides can be increased or decreased without eliminating their activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) investigated the ability of a series of oligonucleotides with lengths of 13 to 25 nucleic acid bases to induce cleavage of target nucleic acids in an oocyte injection model. Oligonucleotides with 25 nucleic acid bases and 8 or 11 mismatched bases near the end of the oligonucleotide were able to induce specific cleavage of the target nucleic acid, albeit to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using oligonucleotides with 13 nucleic acid bases, some containing 1 or 3 mismatches.

[0118] In certain embodiments, oligonucleotides (including modified oligonucleotides) may have any of a range of lengths. In certain embodiments, the oligonucleotide consists of X to Y linked nucleosides, where X represents the smallest number of nucleosides in the range and Y represents the largest number of nucleosides in the range. In certain such embodiments, X and Y are independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, where X ≤ Y. For example In a particular embodiment, oligonucleotides are 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-29, 18-30, 19-20, 19-21, 19-22,19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28, It consists of nucleosides linked together in groups of 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30.

[0119] D. Specific modified oligonucleotides In certain embodiments, the above modifications (sugars, nucleic acid bases, nucleoside bonds) are incorporated into the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is characterized by its modification motif and its overall length. In certain embodiments, these parameters are independent of each other. Therefore, unless otherwise indicated, each nucleoside bond in an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of the sugar modification. For example, the nucleoside bonds in the wing region of a sugar gapmer may be identical or different from each other, and may be identical or different from the nucleoside bonds in the gap region of the sugar motif. Similarly, such a sugar gapmer oligonucleotide may contain one or more modified nucleic acid bases independently of the gapmer pattern of the sugar modification. Unless otherwise indicated, all modifications are independent of the nucleic acid base sequence.

[0120] E. A specific group of modified oligonucleotides A population of modified oligonucleotides in which all modified oligonucleotides have the same molecular formula can be a stereochemically random population or a chirally concentrated population. All chiral centers of all modified oligonucleotides are stereochemically random within a stereochemically random population. In a chirally concentrated population, at least one specific chiral center is not stereochemically random in the modified oligonucleotides of that population. In certain embodiments, the modified oligonucleotides of a chirally concentrated population are concentrated in the β-D-ribose sugar moiety, and all of the phosphorothioate nucleoside bonds are stereochemically random. In certain embodiments, the modified oligonucleotides of a chirally concentrated population are concentrated in both the β-D-ribose sugar moiety and at least one of the specific phosphorothioate nucleoside bonds in a particular stereochemical configuration.

[0121] F. Nucleic acid base sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleic acid base sequences. In certain embodiments, oligonucleotides have a nucleic acid base sequence complementary to a second oligonucleotide or to an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a portion of the oligonucleotide has a nucleic acid base sequence complementary to a second oligonucleotide or to an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleic acid base sequence of a portion or the entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a second oligonucleotide or nucleic acid, such as a target nucleic acid.

[0122] II. Specific oligomer compounds In certain embodiments, oligomeric compounds comprising oligonucleotides (modified or unmodified) and optionally one or more conjugate groups and / or terminal groups are provided herein. A conjugate group comprises one or more conjugate moieties and a conjugate linker that links the conjugate moieties to an oligonucleotide. The conjugate group can be attached to one or both ends of the oligonucleotide and / or at any internal position. In certain embodiments, the conjugate group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate group attached to one or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3'-end and / or 5'-end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3'-end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3'-end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5'-end of the oligonucleotide. In certain embodiments, the conjugate group is bonded near the 5'-terminus of the oligonucleotide.

[0123] Examples of terminal groups include, but are not limited to, conjugate groups, capping groups, phosphate moieties, protecting groups, baseless nucleosides, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

[0124] A. specific conjugate groups In certain embodiments, an oligonucleotide is covalently bonded to one or more conjugate groups. In certain embodiments, the conjugate groups modify one or more properties of the conjugated oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cell distribution, cell uptake, charge, and clearance. In certain embodiments, the conjugate groups impart novel properties to the conjugated oligonucleotide, such as a fluorophore or reporter group that enables the detection of the oligonucleotide. Specific conjugate groups and conjugate moieties include, for example, the cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309, Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, e.g., dodecanediol residues or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118, Kabanov et al., FEBS Lett., 1990, 259, 327-330, Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654, Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetate palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, This has been previously described in 734-740) or in the N-acetylgalactosamine (GalNAc) cluster (e.g., International Publication No. 2014 / 179620).

[0125] In a particular embodiment, the conjugate group may be selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0126] In certain embodiments, the conjugate group may be selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0127] 1. Conjugate portion The conjugate portion may include, but is not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin portions, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid portions, folic acid, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and pigments.

[0128] In certain embodiments, the conjugate portion is an active pharmaceutical ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansyl sarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethicin, barbiturates, cephalosporins, sulfonamides, antidiabetic agents, antibacterial agents, or antibiotics.

[0129] 2. Conjugate Linker The conjugate moiety is bound to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly bound to the oligonucleotide via a single bond). In certain oligomeric compounds, the conjugate moiety is bound to the oligonucleotide via a more complex conjugate linker, which includes one or more conjugate linker moieties that constitute the conjugate linker. In certain embodiments, the conjugate linker includes a chain-like structure, such as a hydrocarbyl chain, or a repeating unit oligomer, such as ethylene glycol, a nucleoside, or an amino acid unit.

[0130] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral bonding group.

[0131] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety known in the art that is useful for attaching a conjugate group to a parent compound, such as an oligonucleotide provided herein. Generally, a bifunctional linking moiety comprises at least two functional groups. One functional group is selected to bond to a specific site on the parent compound, and the other is selected to bond to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include, but are not limited to, electrophiles that react with nucleophiles, and nucleophiles that react with electrophiles. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl groups.

[0132] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C13 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 Examples of alkynyl substituents include hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, and aryl, alkenyl, and alkynyl substituents.

[0133] In certain embodiments, the conjugate linker contains 1 to 10 linker-nucleosides. In certain embodiments, the conjugate linker contains 2 to 5 linker-nucleosides. In certain embodiments, the conjugate linker contains exactly 3 linker-nucleosides. In certain embodiments, the conjugate linker contains a TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides contain a modified sugar moiety. In certain embodiments, the linker-nucleosides are unmodified. In certain embodiments, the linker-nucleosides contain a purine, a substituted purine, a pyrimidine, or an optionally protected heterocyclic base selected from substituted pyrimidines. In certain embodiments, the cleavable portion is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is typically desirable that the linker-nucleoside be cleaved from the oligomer compound after reaching the target tissue. Therefore, the linker-nucleosides typically link to one another, connecting to the rest of the oligomer compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0134] In this specification, linker nucleosides are not considered part of oligonucleotides. Therefore, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group containing a conjugate linker containing linker nucleosides, these linker nucleosides are not counted against the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides, and (2) a conjugate group containing 1 to 10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. The total number of adjacently linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, the oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and not containing a conjugate group. The total number of adjacently linked nucleosides in such oligomer compound is 30 or less. Unless otherwise indicated, the conjugate linker contains 10 or fewer linker-nucleosides. In certain embodiments, the conjugate linker contains 5 or fewer linker-nucleosides. In certain embodiments, the conjugate linker contains 3 or fewer linker-nucleosides. In certain embodiments, the conjugate linker contains 2 or fewer linker-nucleosides. In certain embodiments, the conjugate linker contains 1 or fewer linker-nucleosides.

[0135] In certain embodiments, it is desirable that the conjugate group be cleaved from the oligonucleotide. For example, in certain circumstances, an oligomeric compound containing a particular conjugate moiety is better taken up by a particular cell type, but once the oligomeric compound is taken up, it is desirable that the conjugate group be cleaved to release the unconjugated oligonucleotide or parent oligonucleotide. Therefore, a particular conjugate linker may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group containing at least one cleavable bond. In certain embodiments, the cleavable moiety contains an atomic group having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0136] In certain embodiments, the cleavable bond is selected from amides, esters, ethers, one or both phosphodiesters, phosphate esters, carbamates, or disulfides. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond or phosphodiester bond between an oligonucleotide and a conjugate moiety or conjugate group.

[0137] In certain embodiments, the cleavable portion comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to each other and / or to the rest of the oligomeric compound via cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable portion is a 2'-deoxynucleoside, which is bonded to either the 3'-terminal or 5'-terminal nucleoside of the oligonucleotide by a phosphodiester nucleoside bond and covalently bonded to the conjugate linker or the rest of the conjugate portion by a phosphate nucleoside bond or a phosphorothioate nucleoside bond. In certain such embodiments, the cleavable portion is 2'-deoxyadenosine.

[0138] 3. Cell targeting portion In certain embodiments, the conjugate group includes a cell-targeting moiety. In certain embodiments, the conjugate group has the following general formula: [ka] In the formula, n is between 1 and approximately 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

[0139] In a particular embodiment, n is 1, j is 1, and k is 0. In a particular embodiment, n is 1, j is 0, and k is 1. In a particular embodiment, n is 1, j is 1, and k is 1. In a particular embodiment, n is 2, j is 1, and k is 0. In a particular embodiment, n is 2, j is 0, and k is 1. In a particular embodiment, n is 2, j is 1, and k is 1. In a particular embodiment, n is 3, j is 1, and k is 0. In a particular embodiment, n is 3, j is 0, and k is 1. In a particular embodiment, n is 3, j is 1, and k is 1.

[0140] In certain embodiments, the conjugate group includes a cell-targeting moiety having at least one tether ligand. In certain embodiments, the cell-targeting moiety includes two tether ligands covalently bonded to the branching group. In certain embodiments, the cell-targeting moiety includes three tether ligands covalently bonded to the branching group.

[0141] B. specific terminal groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Examples of stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates, and include, but are not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more baseless nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are baseless nucleosides.

[0142] III. Oligomer double strand In certain embodiments, the oligomeric compounds described herein include oligonucleotides having a nucleic acid base sequence complementary to the nucleic acid sequence of the target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex includes a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex includes or comprises (1) a modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both of the oligomeric compounds of the oligomeric duplex may include a conjugate group. Each oligonucleotide of the oligomeric compound in the oligomeric duplex may include a nucleoside, which is a non-complementary overhang.

[0143] IV. Antisense activation In certain embodiments, oligomeric compounds and oligomeric doubles can hybridize to target nucleic acids, thereby yielding at least one antisense activity. Such oligomeric compounds and oligomeric doubles are antisense compounds. In certain embodiments, an antisense compound has antisense activity if it reduces the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, an antisense compound selectively affects one or more target nucleic acids. Such an antisense compound comprises nucleic acid base sequences that hybridize to one or more target nucleic acids, thereby yielding one or more desired antisense activities, and does not hybridize to one or more non-target nucleic acids, or does not hybridize to one or more non-target nucleic acids in a manner that yields significantly undesirable antisense activity.

[0144] In certain antisense activities, hybridization of the antisense compound with the target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in ribonuclease H-mediated cleavage of the target nucleic acid. Ribonuclease H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA double strand. The DNA in the RNA:DNA double strand is not necessarily unmodified DNA. In certain embodiments, antisense compounds that are sufficiently "DNA-like" to induce ribonuclease H activity are described herein. In certain embodiments, one or more non-DNA-like nucleosides within the gapmer gap are acceptable.

[0145] In certain antisense activities, the antisense compound or a portion of the antisense compound is loaded into the RNA-induced silencing complex (RISC), ultimately resulting in the cleavage of the target nucleic acid. For example, certain antisense compounds cause cleavage of the target nucleic acid via Argonaut. The antisense compound loaded into the RISC is an RNAi compound. The RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).

[0146] In certain embodiments, hybridization of an antisense compound with a target nucleic acid does not result in the recruitment of proteins that cleave the target nucleic acid. In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in inhibition of binding interactions between the target nucleic acid and proteins or other nucleic acids. In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in a change in the translation of the target nucleic acid.

[0147] Antisense activity can be observed directly or indirectly. In certain embodiments, observation or detection of antisense activity involves observing or detecting changes in the amount of target nucleic acid or the protein encoded by such target nucleic acid, changes in the ratio of splice variants of nucleic acid or protein, and / or changes in phenotype in cells or subjects.

[0148] V. Specific target nucleic acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide containing a portion complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and mRNA precursors, including intron regions, exon regions, and untranslated regions. In certain embodiments, the target nucleic acid is mature mRNA. In certain embodiments, the target nucleic acid is an mRNA precursor. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region extends to an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0149] A. Complementarity / mismatch with target nucleic acid It is possible to introduce mismatched bases without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA had the ability to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide showed potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14-nucleotide oligonucleotides, as well as 28-nucleotide and 42-nucleotide oligonucleotides composed of two or three sequences of tandem oligonucleotides, respectively, to halt human DHFR translation in a rabbit reticulocyte assay. Only each of the three 14-nucleotide oligonucleotides was able to inhibit translation, albeit at a more modest level than the 28-nucleotide or 42-nucleotide oligonucleotides.

[0150] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid throughout its entire length. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid throughout its entire length and also includes portions that are 100% or completely complementary to the target nucleic acid. In certain embodiments, the completely complementary portions have a length of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleic acid bases.

[0151] In certain embodiments, the oligonucleotide contains one or more mismatched nucleic acid bases compared to the target nucleic acid. In certain embodiments, the antisense activity against the target is reduced by these mismatches, but the activity against the non-target is reduced by a greater amount. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are located in particular within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5' end of the gap region. In certain embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, or 6 from the 5' end of the 5' wing region or 3' wing region.

[0152] B. SCN2A In certain embodiments, the oligomer compound comprises or consists of an oligonucleotide complementary to the target nucleic acid, the target nucleic acid being SCN2A nucleic acid. In certain embodiments, the SCN2A nucleic acid has the sequence described by SEQ ID NO: 1 (GENBANK accession number NM_001040142.2) or SEQ ID NO: 2 (GENBANK accession number NC_000002.12, cleaved from nucleotide 165127001 to 165395000).

[0153] In certain embodiments, contact with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in the cells, and in certain embodiments, reduces the amount of SCN1A protein in the cells. In certain embodiments, contact with a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in the cells, and in certain embodiments, reduces the amount of SCN2A protein in the cells. In certain embodiments, the cells are in vitro. In certain embodiments, the cells are within a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contact with cells in a subject of an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 improves one or more symptoms or characteristics of a disease or disorder related to voltage-gated sodium channel protein. In certain embodiments, the voltage-gated sodium channel protein is SCN2A. In certain embodiments, the subject is a disease or disorder related to a voltage-gated sodium channel protein other than SCN2A. In certain embodiments, the subject is a disease or disorder related to SCN1A. In certain embodiments, the disease or disorder is a developmental or epileptic encephalopathy such as early-onset seizure-induced epileptic encephalopathy, late-onset seizure-induced epileptic or encephalopathy, or benign familial neonatal infantile seizures; in certain embodiments, the disease or disorder is intellectual disability or autism spectrum disorder; and in certain embodiments, the disease or disorder is Dravet syndrome.

[0154] In certain embodiments, the symptoms or features are any of the following: seizures, hypotonia, sensory integration disorders, motor skills impairments, intellectual and cognitive impairments, motor and balance disorders, visual impairments, language and speech delays, gastrointestinal disorders (e.g., gastroesophageal reflux disease, diarrhea, constipation, motor disorders, etc.), neurodevelopmental delays, sudden unexpected death in epilepsy, motor skills development delays, social and language developmental indicators delays, repetitive movements, oral incoordination, and insomnia. In certain embodiments, seizures are any of the following: focal seizures, clonic seizures, tonic seizures, and generalized tonic-clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (e.g., convulsive, myoclonic, absence, focal, blunt, and tonic seizures).

[0155] In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the amount of SCN2A RNA detected in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in a standard in vitro assay. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce in vivo detectable amounts of SCN2A RNA by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vivo assay. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the amount of SCN2A RNA in the target CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the detectable amount of SCN2A protein in the target CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0156] In certain embodiments, the oligomer compound does not contain a bicyclic sugar moiety. In certain embodiments, the oligomer compound does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, the oligomer compound includes one or two wing segments containing a nucleoside that is not a bicyclic nucleoside. In certain embodiments, the oligomer compound does not contain an LNA sugar moiety. In certain embodiments, the oligomer compound does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, the oligomer compound includes one or two wing segments containing a nucleoside that is not an LNA nucleoside.

[0157] Specific target nucleic acids in specific organizations In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide containing a portion complementary to a target nucleic acid, the target nucleic acid being expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is cells and tissues including the central nervous system. Such tissues include the cortex, hippocampus, and spinal cord.

[0158] VI. Specific pharmaceutical compositions In certain embodiments, pharmaceutical compositions comprising one or more oligomeric compounds are described herein. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises sterile saline and one or more oligomeric compounds, or comprises sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and sterile water, or comprises one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and phosphate-buffered saline (PBS), or comprises one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"), or comprises one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0159] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition substantially consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0160] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain embodiments, the excipients are selected from water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0161] In certain embodiments, the oligomeric compound may be mixed with pharmaceutically acceptable active and / or inactive substances for the preparation of a pharmaceutical composition or formulation. The compositions and methods for formulation of the pharmaceutical composition are not limited but depend on several criteria, including the route of administration, the severity of the disease, or the dose administered.

[0162] In certain embodiments, a pharmaceutical composition comprising an oligomeric compound includes any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such ester. In certain embodiments, a pharmaceutical composition comprising an oligomeric compound comprising one or more oligonucleotides can, when administered to a subject including a human, provide (directly or indirectly) a physiologically active metabolite or a residue thereof. Thus, for example, this disclosure is also directed to oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrug comprises one or more conjugate groups bonded to an oligonucleotide, which are cleaved by endogenous nucleases in the body.

[0163] Lipid moieties have been used in nucleic acid therapy in various ways. In certain methods, nucleic acids, such as oligomeric compounds, are introduced into pre-formed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In certain methods, DNA complexes having monocationic or polycationic lipids are formed without the presence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of a drug to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of a drug to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of a drug to muscle tissue.

[0164] In certain embodiments, the pharmaceutical composition includes a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems, including those containing hydrophobic compounds, are useful for preparing certain pharmaceutical compositions. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0165] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceuticals, including the oligomeric compounds provided herein, to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0166] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Some of these cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such cosolvent systems are used with hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of anhydrous ethanol containing 3 w / v% benzyl alcohol, 8 w / v% nonpolar surfactant Polysorbate 80™, and 65 w / v% polyethylene glycol 300. The proportions of these cosolvent systems may vary significantly so as not to significantly alter their solubility and toxicity properties. Furthermore, the distribution of cosolvent components may vary as follows: for example, other surfactants may be used instead of Polysorbate 80™, the fraction size of polyethylene glycol may vary, other biocompatible polymers may be used, such as polyethylene glycol being replaced by polyvinylpyrrolidone, and other sugars or polysaccharides may be used instead of dextrose.

[0167] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, subarachnoid (IT), intraventricular (ICV), intraneuronal, perineurial, etc.). In some of these embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution such as water, or in a physiologically compatible buffer such as Hanks' solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other components are included (e.g., components that aid solubility or act as preservatives). In certain embodiments, the injectable suspension is prepared using a suitable liquid carrier, suspension agent, etc. Specific pharmaceutical compositions for injection are provided in unit dosage forms, for example, in ampoules or multi-dose containers. Specific pharmaceutical compositions for injection are suspensions, solutions, or emulsions in an oily or aqueous vehicle and may also contain formulations such as suspension agents, stabilizers, and / or dispersants. Specific solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents, fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.

[0168] Under certain conditions, certain compounds disclosed herein act as acids. Such compounds may be depicted or described in protonated (free acid) form, ionized, or associated with cationic (salt) forms, but aqueous solutions of such compounds exist in equilibrium in these forms. For example, in aqueous solution, the phosphate bond of an oligonucleotide exists in equilibrium between free acid, anionic, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, oligonucleotides in solution exist in equilibrium in a collection of these forms at multiple positions. The term “oligonucleotide” is intended to include all such forms. Illustrated structures always depict a single form. Nevertheless, unless otherwise indicated, such illustrations are also intended to include the corresponding forms. In this specification, structures showing the term “its salt” following the free acid of a compound explicitly include all such forms that can be fully or partially protonated / deprotonated / associated with cationic forms. In certain cases, one or more specific cations are identified.

[0169] In certain embodiments, the modified oligonucleotide or oligomer compound is in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomer compound is in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomer compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomer compound is in water. In certain such embodiments, the pH of the solution is adjusted using NaOH and / or HCl to obtain the desired pH.

[0170] In this specification, specific doses are described. Dose may be in the form of dosage units. For clarity, a dose (or dosage unit) of a modified oligonucleotide or oligomer compound in milligrams represents the mass of the modified oligonucleotide or oligomer compound in its free acid form. As described above, in aqueous solutions, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating doses, it is assumed that the modified oligonucleotide or oligomer compound exists as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, if the modified oligonucleotide or oligomer compound is in a sodium-containing solution (e.g., physiological saline), the modified oligonucleotide or oligomer compound may be partially or completely deprotonated and associated with Na+ ions. However, the mass of the proton is nevertheless counted against the weight of the dose, while the mass of the Na+ ion is not counted against the weight of the dose. Therefore, for example, a dose or dosage unit of compound number 1348259 of 10 mg is equal to the number of fully protonated molecules weighing 10 mg. This is equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodium compound number 1348259. If the oligomeric compound contains a conjugate group, the mass of the conjugate group is included when calculating the dose of such oligomeric compound. If the conjugate group also contains an acid, it is similarly assumed that the conjugate group is fully protonated for the purpose of calculating the dose.

[0171] VII. Specific composition 1. Compound number 1348259 In a particular embodiment, compound number 1348259 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') GCATAATCCCATTATACAAA (SEQ ID NO: 2493), where nucleosides 1-5 and 16-20 (5' to 3') are each 2'-MOE nucleosides, and nucleosides 6-15 are each 2'-β-D-deoxynucleosides, and nucleosides 2- The nucleoside bonds between nucleosides 3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside bonds, the nucleoside bonds between nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate nucleoside bonds, and each cytosine is 5-methylcytosine.

[0172] In certain embodiments, compound number 1348259 is represented by the following chemical symbol: G es m C eo A eo T eo A eo A ds T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A eo m C eo A es A es A e (Sequence ID 2493), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and o = phosphodiester nucleoside interbonding.

[0173] In certain embodiments, compound number 1348259 is represented by the following chemical structure: [ka] (Sequence ID 2493).

[0174] Structure 1. Compound number 1348259 In certain embodiments, the sodium salt of compound number 1348259 is represented by the following chemical structure: [ka] (Sequence ID 2493).

[0175] Structure 2. Sodium salt of compound number 1348259 2. Compound number 1348289 In a particular embodiment, compound number 1348289 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') CACGACATATTTTTCTACAC (SEQ ID NO: 2514), where nucleosides 1-6 and 17-20 (5' to 3') are each 2'-MOE nucleosides, and nucleosides 7-16 are each 2'-β-D-deoxynucleosides, and nucleosides 2- The nucleoside bonds between nucleosides 3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester nucleoside bonds, the nucleoside bonds between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate nucleoside bonds, and each cytosine is 5-methylcytosine.

[0176] In certain embodiments, compound number 1348289 is represented by the following chemical symbol: mC es A eo m C eo G eo A eo m C eo A ds T ds A ds T ds T ds T ds T ds T ds m C ds T ds A eo m C es A es m C e (Sequence ID 2514), in the formula A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and o = phosphodiester nucleoside interbonding.

[0177] In certain embodiments, compound number 1348289 is represented by the following chemical structure: [ka] (Sequence ID 2514).

[0178] Structure 3. Compound number 1348289 In certain embodiments, the sodium salt of compound number 1348289 is represented by the following chemical structure: [ka] (Sequence ID 2514).

[0179] Structure 4. Sodium salt of compound number 1348289 3. Compound number 1348290 In a particular embodiment, compound number 1348290 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') CCACGACATATTTTTCTACA (SEQ ID NO: 2510), where nucleosides 1-6 and 17-20 (5' to 3') are each 2'-MOE nucleosides, and nucleosides 7-16 are each 2'-β-D-deoxynucleosides, and nucleosides 2- The nucleoside bonds between nucleosides 3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester nucleoside bonds, the nucleoside bonds between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate nucleoside bonds, and each cytosine is 5-methylcytosine.

[0180] In certain embodiments, compound number 1348290 is represented by the following chemical symbol: m C es m C eo A eo m C eo G eo A eo m C ds A ds T ds A ds T ds T ds T ds T ds T ds m C ds T eo A es m C es A e (Sequence ID 2510), in the formula A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and o = phosphodiester nucleoside interbonding.

[0181] In certain embodiments, compound number 1348290 is represented by the following chemical structure: [ka] (Sequence ID 2510).

[0182] Structure 5: Compound number 1348290 In certain embodiments, the sodium salt of compound number 1348290 is represented by the following chemical structure: [ka] (Sequence ID 2510).

[0183] Structure 6: Sodium salt of compound number 1348290 4. Compound number 1348331 In a particular embodiment, compound number 1348331 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') TCTGCATGTAACCTTTATAC (SEQ ID NO: 2487), where nucleosides 1-6 and 17-20 (5' to 3') are each 2'-MOE nucleosides, and nucleosides 7-16 are each 2'-β-D-deoxynucleosides, and nucleosides 2- The nucleoside bonds between nucleosides 3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester nucleoside bonds, the nucleoside bonds between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate nucleoside bonds, and each cytosine is 5-methylcytosine.

[0184] In certain embodiments, compound number 1348331 is represented by the following chemical symbol: T es m C eo T eo G eo m C eo A eo T ds G ds T ds A ds A ds m C ds m C ds T ds T ds T ds A eo T es A es m C e (Sequence No. 2487), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and o = phosphodiester nucleoside interbonding.

[0185] In certain embodiments, compound number 1348331 is represented by the following chemical structure: [ka] (Sequence number 2487).

[0186] Structure 7: Compound number 1348331 In certain embodiments, the sodium salt of compound number 1348331 is represented by the following chemical structure: [ka] (Sequence number 2487).

[0187] Structure 8: Sodium salt of compound number 1348331 5. Compound number 1348347 In a particular embodiment, compound number 1348347 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') GCATAATCCCATTATACAAA (SEQ ID NO: 2493), where nucleosides 1-6 and 17-20 (5' to 3') are each 2'-MOE nucleosides, and nucleosides 7-16 are each 2'-β-D-deoxynucleosides, and nucleosides 2- The nucleoside bonds between nucleosides 3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester nucleoside bonds, the nucleoside bonds between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate nucleoside bonds, and each cytosine is 5-methylcytosine.

[0188] In certain embodiments, compound number 1348347 is represented by the following chemical symbol: G es m C eo A eo T eo A eo A eo T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A ds m C eo A es A es A e (Sequence ID 2493), in the formula, A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and o = phosphodiester nucleoside interbonding.

[0189] In certain embodiments, compound number 1348347 is represented by the following chemical structure: [ka] (Sequence ID 2493).

[0190] Structure 9: Compound number 1348347 In certain embodiments, the sodium salt of compound number 1348347 is represented by the following chemical structure: [ka] (Sequence ID 2493).

[0191] Structure 10: Sodium salt of compound number 1348347 6. Compound number 1348937 In a particular embodiment, compound number 1348937 is characterized as a 5-8-5 MOE gapmer having the sequence (5' to 3') CTGCATGTAACCTTTATA (SEQ ID NO: 2534), where each of nucleosides 1-5 and 14-18 (5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6-13 is a 2'-β-D-deoxynucleoside. The nucleoside bonds between sides 2-3, 3-4, 4-5, 14-15, and 15-16 are phosphodiester nucleoside bonds, the nucleoside bonds between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 16-17, and 17-18 are phosphorothioate nucleoside bonds, and each cytosine is 5-methylcytosine.

[0192] In certain embodiments, compound number 1348937 is represented by the following chemical symbol: m C es T eo G eo m C eo A es T ds G ds T ds A ds A ds m C ds m C ds T ds T eo T eo A es T es A e (Sequence ID 2534), in the formula A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and o = phosphodiester nucleoside interbonding.

[0193] In certain embodiments, compound number 1348937 is represented by the following chemical structure: [ka] (Sequence ID 2534).

[0194] Structure 11: Compound number 1348937 In certain embodiments, the sodium salt of compound number 1348937 is represented by the following chemical structure: [ka] (Sequence ID 2534).

[0195] Structure 12: Sodium salt of compound number 1348937 VIII. Specific hotspot areas In certain embodiments, nucleic acid bases within the range specified below constitute the hotspot region of the SCN2A nucleic acid. In certain embodiments, a modified oligonucleotide complementary to equal-length portions within the hotspot region of the SCN2A nucleic acid achieves an average reduction of 69.9% or more in vitro in a standard in vitro assay. In certain embodiments, a modified oligonucleotide complementary to equal-length portions within the hotspot region of the SCN2A nucleic acid achieves an average reduction of 59% or more in vivo in a standard in vivo assay.

[0196] 1. Nucleic acid bases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 In certain embodiments, nucleic acid bases 2306-2367 of SEQ ID NO: 1, or nucleic acid bases 199863-199905 of SEQ ID NO: 2, contain a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of equal length within the range of nucleic acid bases 2306-2367 of SEQ ID NO: 1, or nucleic acid bases 199863-199905 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide has a length of 20 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 18 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.

[0197] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has the following sugar motifs in order from 5' to 3': eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0198] In certain embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not bicyclic nucleosides. In certain embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not LNA nucleosides.

[0199] In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") nucleoside bonds are arranged in a 5'-to-3' order. In certain embodiments, the modified nucleotide has the following nucleoside-to-nucleoside bonding motifs (from 5' to 3'): soooosssssssssssooss, soooossssssssssssss, soooosssssssssssoooss, soooosssssssssssoooss, soooossssssssssss, or soooosssssssssooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0200] The nucleic acid base sequences of SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, and 2526 are complementary to portions of equal length within the range of nucleic acid bases 2306-2367 of SEQ ID NO: 1 or nucleic acid bases 199863-199905 of SEQ ID NO: 2.

[0201] The nucleic acid base sequences of compounds IDs 909979, 1248427, 1248428, 1248429, 1248430, 1248431, 1248432, 1248433, 1348279, 1348282, 1348286, 1348297, 1348328, 1348343, 1348358, 1348360, 1348361, 1348362, 1348364, 1348365, 1348366, 1348367, 1348378, and 1348380 are complementary to portions of equal length within the range of nucleic acid bases 2306-2367 of SEQ ID NO: 1 or nucleic acid bases 199863-199905 of SEQ ID NO: 2.

[0202] In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an in vitro reduction of at least 53% of SCN2A RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an in vitro reduction of an average of 69.9% of SCN2A RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an in vivo reduction of an average of 77.1% of SCN2A RNA in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 2306-2367 of SEQ ID NO: 1 or nucleic acid bases 199863-199905 of SEQ ID NO: 2 achieve a mean 63.2% reduction of SCN2A RNA in vivo in a standard in vivo assay.

[0203] 2. Nucleic acid bases 3499-3557 of SEQ ID NO: 1 or Nucleic acid bases 227493-227551 In certain embodiments, nucleic acid bases 3499-3557 of SEQ ID NO: 1, or nucleic acid bases 227493-227551 of SEQ ID NO: 2, contain a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of equal length within the range of nucleic acid bases 3499-3557 of SEQ ID NO: 1, or nucleic acid bases 227493-227551 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide has a length of 20 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 18 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.

[0204] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has the following sugar motifs in order from 5' to 3': eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0205] In certain embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not bicyclic nucleosides. In certain embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not LNA nucleosides.

[0206] In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") nucleoside bonds are arranged in a 5'-to-3' order. In certain embodiments, the modified nucleotide has the following nucleoside-to-nucleoside bonding motifs (from 5' to 3'): soooosssssssssssooss, soooossssssssssssss, soooosssssssssssoooss, soooosssssssssssoooss, soooossssssssssss, or soooosssssssssooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0207] The nucleic acid base sequences of SEQ ID NOs: 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, and 2521 are complementary to equal-length portions within nucleic acid bases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2.

[0208] Compound ID909989, 909990, 1248487, 1248488, 1248489, 1348289, 1348290, 1348291, 1348292, 1348295, 1348298, 1348302, 1348303 , 1348304, 1348306, 1348307, 1348369, 1348370, 1348371, 1348373, 1348374, 1348375, 1348376, 1348377, 1348381, 1348382, 13 The nucleic acid base sequences of 48383, 1348384, 1348385, 1348386, 1348387, 1348405, 1348411, 1348423, 1348439, 1348440, 1348441, 1348442, 1348443, 1348444, 1348446, 1348447, and 1348456 are complementary to portions of equal length within the range of nucleic acid bases 3499-3557 of SEQ ID NO: 1 or nucleic acid bases 227493-227551 of SEQ ID NO: 2.

[0209] In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 3499-3557 of SEQ ID NO: 1 or nucleic acid bases 227493-227551 of SEQ ID NO: 2 achieve at least a 75% reduction of SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 3499-3557 of SEQ ID NO: 1 or nucleic acid bases 227493-227551 of SEQ ID NO: 2 achieve an average 81.6% reduction of SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 3499-3557 of SEQ ID NO: 1 or nucleic acid bases 227493-227551 of SEQ ID NO: 2 achieve an average 76.6% reduction of SCN2A RNA in vivo in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 3499-3557 of SEQ ID NO: 1 or nucleic acid bases 227493-227551 of SEQ ID NO: 2 achieve a mean 67.2% reduction of SCN2A RNA in vivo in a standard in vivo assay.

[0210] 3. Nucleic acid bases 243124~243204 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 243124-243204 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of equal length within the range of nucleic acid bases 243124-243204 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide has a length of 20 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 18 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.

[0211] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has the following sugar motifs in order from 5' to 3': eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0212] In certain embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not bicyclic nucleosides. In certain embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not LNA nucleosides.

[0213] In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") nucleoside bonds are arranged in a 5'-to-3' order. In certain embodiments, the modified nucleotide has the following nucleoside-to-nucleoside bonding motifs (from 5' to 3'): soooosssssssssssooss, soooossssssssssssss, soooosssssssssssoooss, soooosssssssssssoooss, soooossssssssssss, or soooosssssssssooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0214] The nucleic acid base sequences of SEQ ID NOs. 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406, and 2527 are complementary to the equal-length portions of nucleic acid bases in the range of 243124 to 243204 of SEQ ID NO. 2.

[0215] The nucleic acid base sequences of compounds IDs 1248507, 1248508, 1248509, 1248510, 1248511, 1248512, 1248513, 1248514, 1248515, 1250138, 1348299, 1348379, 1348388, and 1348397 are complementary to portions of equal length within the range of nucleic acid bases 243124 to 243204 of SEQ ID NO: 2.

[0216] In certain embodiments, modified oligonucleotides complementary to equal-length portions of nucleic acid bases 243124-243204 in SEQ ID NO: 2 achieve an in vitro reduction of at least 51% of SCN2A RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions of nucleic acid bases 243124-243204 in SEQ ID NO: 2 achieve an in vitro reduction of an average of 71.4% of SCN2A RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions of nucleic acid bases 243124-243204 in SEQ ID NO: 2 achieve an in vivo reduction of an average of 61.3% of SCN2A RNA in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions of nucleic acid bases 243124-243204 in SEQ ID NO: 2 achieve an in vivo reduction of an average of 61.5% of SCN2A RNA in a standard in vivo assay.

[0217] 4. Nucleic acid bases 243917~244073 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 243917-244073 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of equal length within the range of nucleic acid bases 243917-244073 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide has a length of 20 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 18 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.

[0218] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has the following sugar motifs in order from 5' to 3': eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0219] In certain embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not bicyclic nucleosides. In certain embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not LNA nucleosides.

[0220] In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") nucleoside bonds are arranged in a 5'-to-3' order. In certain embodiments, the modified nucleotide has the following nucleoside-to-nucleoside bonding motifs (from 5' to 3'): soooosssssssssssooss, soooossssssssssssss, soooosssssssssssoooss, soooosssssssssssoooss, soooossssssssssss, or soooosssssssssooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0221] The nucleic acid base sequences of SEQ ID NOs. 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, and 2537 are complementary to the equal-length portions of nucleic acid bases 243917–244073 in SEQ ID NO. 2.

[0222] Compound ID1250148, 1250149, 1348250, 1348251, 1348253, 1348259, 1348265, 1348266, 1348267, 1348331, 1348 332, 1348333, 1348338, 1348342, 1348344, 1348345, 1348347, 1348419, 1348420, 1348421, 1348427, 134842 The nucleic acid base sequences of 8, 1348435, 1348436, 1348437, 1348920, 1348922, 1348923, 1348925, 1348927, 1348928, 1348929, 1348931, 1348934, 1348935, 1348937, and 1348938 are complementary to portions of equal length within the range of nucleic acid bases 243917 to 244073 of SEQ ID NO: 2.

[0223] In certain embodiments, modified oligonucleotides complementary to equal-length portions of nucleic acid bases 243917-244073 in SEQ ID NO: 2 achieve an in vitro reduction of at least 80% of SCN2A RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions of nucleic acid bases 243917-244073 in SEQ ID NO: 2 achieve an average in vitro reduction of 80.5% of SCN2A RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions of nucleic acid bases 243917-244073 in SEQ ID NO: 2 achieve an average in vivo reduction of 67.7% of SCN2A RNA in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions of nucleic acid bases 243917-244073 in SEQ ID NO: 2 achieve an average in vivo reduction of 62.1% of SCN2A RNA in a standard in vivo assay.

[0224] 5. Nucleic acid bases 4389-4487 of SEQ ID NO: 1 or Nucleic acid bases 247823-247921 In certain embodiments, nucleic acid bases 4389-4487 of SEQ ID NO: 1, or nucleic acid bases 247823-247921 of SEQ ID NO: 2, contain a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of equal length within the range of nucleic acid bases 4389-4487 of SEQ ID NO: 1, or nucleic acid bases 247823-247921 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide has a length of 20 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 18 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.

[0225] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has the following sugar motifs in order from 5' to 3': eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0226] In certain embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not bicyclic nucleosides. In certain embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not LNA nucleosides.

[0227] In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") nucleoside bonds are arranged in a 5'-to-3' order. In certain embodiments, the modified nucleotide has the following nucleoside-to-nucleoside bonding motifs (from 5' to 3'): soooosssssssssssooss, soooossssssssssssss, soooosssssssssssoooss, soooosssssssssssoooss, soooossssssssssss, or soooosssssssssooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0228] The nucleic acid base sequences of SEQ ID NOs: 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, and 2522 are complementary to portions of equal length within the range of nucleic acid bases 4389-4487 of SEQ ID NO: 1 or nucleic acid bases 247823-247921 of SEQ ID NO: 2.

[0229] Compound ID910009, 910010, 910011, 910012, 910013, 910014, 910015, 910016, 910017, 910018, 91001 9, 910020, 1248528, 1248529, 1248530, 1248531, 1248532, 1248533, 1248534, 1248535, 1348269 The nucleic acid base sequences of 1348270, 1348271, 1348275, 1348277, 1348348, 1348353, 1348355, 1348356, 1348396, and 1348450 are complementary to portions of equal length within the range of nucleic acid bases 4389-4487 of SEQ ID NO: 1 or nucleic acid bases 247823-247921 of SEQ ID NO: 2.

[0230] In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an in vitro reduction of at least 27% of SCN2A RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an in vitro reduction of an average of 71.1% of SCN2A RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an in vivo reduction of an average of 63.4% of SCN2A RNA in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 4389-4487 of SEQ ID NO: 1 or nucleic acid bases 247823-247921 of SEQ ID NO: 2 achieve a mean 59.1% reduction of SCN2A RNA in vivo in a standard in vivo assay.

[0231] 6. Nucleic acid bases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 In certain embodiments, nucleic acid bases 4774-4809 of SEQ ID NO: 1, or nucleic acid bases 254142-254177 of SEQ ID NO: 2, contain a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of equal length within the range of nucleic acid bases 4774-4809 of SEQ ID NO: 1, or nucleic acid bases 254142-254177 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide has a length of 20 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 18 nucleic acid bases. In certain embodiments, the modified oligonucleotide has a length of 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.

[0232] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has the following sugar motifs in order from 5' to 3': eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0233] In certain embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not bicyclic nucleosides. In certain embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not LNA nucleosides.

[0234] In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") nucleoside bonds are arranged in a 5'-to-3' order. In certain embodiments, the modified nucleotide has the following nucleoside-to-nucleoside bonding motifs (from 5' to 3'): soooosssssssssssooss, soooossssssssssssss, soooosssssssssssoooss, soooosssssssssssoooss, soooossssssssssss, or soooosssssssssooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0235] The nucleic acid base sequences of SEQ ID NOs: 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, and 2539 are complementary to portions of equal length within the range of nucleic acid bases 4774-4809 of SEQ ID NO: 1 or nucleic acid bases 254142-254177 of SEQ ID NO: 2.

[0236] The nucleic acid base sequences of compounds IDs 1248544, 1250225, 1250226, 1250227, 1250228, 1250229, 1250230, 1250231, 1250232, 1250233, 1250234, 1250235, 1250236, 1250237, 1250238, 1250239, 1348936, and 1348939 are complementary to portions of equal length within the range of nucleic acid bases 4774-4809 of SEQ ID NO: 1 or nucleic acid bases 254142-254177 of SEQ ID NO: 2.

[0237] In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an in vitro reduction of at least 51% of SCN2A RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average in vitro reduction of SCN2A RNA of 89% in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average in vivo reduction of SCN2A RNA of 74.8% in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to equal-length portions within the range of nucleic acid bases 4774-4809 of SEQ ID NO: 1 or nucleic acid bases 254142-254177 of SEQ ID NO: 2 achieve an average 67.8% reduction of SCN2A RNA in vivo in a standard in vivo assay.

[0238] 7. Further Hotspot Areas In certain embodiments, the ranges described in the following table include the hotspot regions. Each hotspot region begins with the nucleic acid base of SEQ ID NO: 2, as specified in the "Start Site SEQ ID NO: 2" column, and ends with the nucleic acid base of SEQ ID NO: 2, as specified in the "Stop Site SEQ ID NO: 2" column. In certain embodiments, the modified oligonucleotide is complementary to a portion of equal length within any of the ranges 1 to 17 of the hotspot regions as defined in the following table. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17 to 19 or 21 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.

[0239] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has the following sugar motifs in order from 5' to 3': eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0240] In certain embodiments, the modified oligonucleotide does not contain a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not bicyclic nucleosides. In certain embodiments, the modified oligonucleotide does not contain an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not contain more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, the modified oligonucleotide includes one or two wing segments containing nucleosides that are not LNA nucleosides.

[0241] In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") nucleoside bonds are arranged in a 5'-to-3' order. In certain embodiments, the modified nucleotide has the following nucleoside-to-nucleoside bonding motifs (from 5' to 3'): soooosssssssssssooss, soooossssssssssssss, soooosssssssssssoooss, soooosssssssssssoooss, soooossssssssssss, or soooosssssssssooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0242] The nucleic acid sequences of the compounds listed in the "Compound ID within Range" column of the table below are complementary to SEQ ID NO: 2 within the identified hotspot region. The nucleic acid sequences of the oligonucleotides listed in the "SEQ ID NO: 2 within Range" column of the table below are complementary to the target sequence, SEQ ID NO: 2, within the identified hotspot region.

[0243] In certain embodiments, modified oligonucleotides complementary to the nucleoside bases within the hotspot region achieve at least the "Min.% Red. in vitro" (minimum reduction %) of SCN2A RNA in a standard in vitro assay, as shown in the table below. In certain embodiments, modified oligonucleotides complementary to the nucleoside bases within the hotspot region achieve the "Avg.% Red. in vitro" (average reduction %) of the average SCN2A RNA in a standard in vitro assay, as shown in the table below. In certain embodiments, modified oligonucleotides complementary to the nucleoside bases within the hotspot region achieve the "Max.% Red. in vitro" (maximum reduction %) of SCN2A RNA in a standard in vitro assay, as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleic acid bases within the hotspot region achieve the mean "average reduction rate in vivo (Avg. % Red. in vivo Cortex)" (average reduction rate compared to PBS-treated animals) of SCN2A RNA in a standard in vivo assay in cortical tissue, as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleic acid bases within the hotspot region achieve the mean "average reduction rate in vivo (Avg. % Red. in vivo Spinal)" (average reduction rate compared to PBS-treated animals) of SCN2A RNA in a standard in vivo assay in spinal cord tissue, as shown in the table below. "nd" indicates that in vivo data are not available for compounds within that range. In other cases, the mean reduction rate in vivo includes a subset of compounds in any given hotspot, as not all compounds have been tested in vivo. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5]

[0244] IX. Specific control compounds Control compound number 1506060 was selected as the control compound in the experiment described in Example 4 of this specification. Control compound number 1506060, previously described in International Publication No. 2020 / 041348 incorporated herein by reference, is a 4-8-4 LNA gapmer having the sequence (5' to 3') TGGGTCTCTTAGCTTT (SEQ ID NO: 2540), where the central gap segment consists of eight 2'-β-D-deoxynucleosides, and the 5' and 3' wing segments each consist of four LNA-modified nucleosides, with each nucleoside bond being a phosphorothioate nucleoside bond.

[0245] In certain embodiments, the compounds described herein are more tolerable than control compound number 1506060.

[0246] For example, as described herein (see Example 4), control compound number 1506060 had a 3-hour FOB of 6.00 in mice, while compounds 1348290, 1348331, and 1348347 each had a 3-hour FOB of 0.00 in mice, and compounds 1348259, 1348289, and 1348937 each had a 3-hour FOB of 0 or 1.00 in mice. Therefore, certain compounds described herein are more tolerable than control compound number 1506060 in this assay.

[0247] Non-exclusive disclosure and incorporation by reference Each of the documents and patent publications listed herein is incorporated in their entirety by reference.

[0248] The specific compounds, compositions, and methods described herein are Although specifically illustrated to certain embodiments, the following examples are: This specification serves only to describe the compounds described herein and is not intended to limit them. References and GenBank are listed herein. Accession numbers and other similar terms are incorporated herein by reference in their entirety.

[0249] The sequence listings attached to this application identify each sequence as either "RNA" or "DNA" as necessary, but in practice, these sequences can be modified with any combination of chemical modifications. It will be readily apparent to those skilled in the art that the designations "RNA" or "DNA" used to describe modified oligonucleotides are arbitrary in certain examples. For example, an oligonucleotide containing a nucleoside with a 2'-OH sugar moiety and a thymine base may be described as DNA with a modified sugar (a 2'-OH instead of one of the 2'-H in the DNA) or as RNA with a modified base (thymine (methylated uracil) instead of uracil in the RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those included in the sequence listings, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, and such nucleic acids have modified nucleic acid bases, but are not limited to these. As further examples, but not limited to, oligomeric compounds having the nucleic acid base sequence "ATCGATCG" include any oligomeric compounds having such nucleic acid base sequence, whether modified or unmodified, including, for example, compounds having the sequence "AUCGAUCG" and RNA bases such as some DNA bases and some RNA bases such as "AUCGATCG", as well as, for example, "AT mCGAUCG" and in the formula m C represents a cytosine base containing a methyl group at position 5, known as "AT". m This includes, but is not limited to, oligomeric compounds having other modified nucleic acid bases such as "CGAUCG".

[0250] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers, thus resulting in enantiomers, diastereomers, and other stereoisomer configurations, which can be defined in terms of absolute stereochemistry as (R) or (S), for example as α or β for sugar anomers, or as (D) or (L) for amino acids. Compounds provided herein that are described or depicted as having a specific stereoisomer configuration include only those compounds indicated. Compounds provided herein that are described or depicted with an undefined stereochemistry include all such possible isomers, including their stereochemically random and optically pure forms, unless otherwise specified. Similarly, all cis and trans isomers and tautomers of the compounds herein are also included unless otherwise specified. The oligomeric compounds described herein include mixtures with high chiral purity or chiral concentration, as well as racemic mixtures. For example, oligomeric compounds having multiple phosphorothioate nucleoside interbondings include compounds in which the chirality of the phosphorothioate nucleoside interbondings is controlled or random. Unless otherwise specified, the compounds described herein are intended to include the corresponding salt forms.

[0251] The compounds described herein include variants in which one or more atoms are substituted with non-radioactive or radioactive isotopes of the elements shown. For example, the compounds described herein that contain a hydrogen atom are: 1 This includes all possible deuterium substitutions for each of the hydrogen atoms of H. Isotope substitutions included by the compounds herein include, but are not limited to, the following: 1A substitute for H 2 H or 3 H, 12 A substitute for C 13 C or 14 C, 14 A substitute for N 15 N, 16 A substitute for O 17 O or 18 O, and 32 A substitute 33 S, 34 S, 35 S, or 36 S. In certain embodiments, non-radioactive isotope substitution can impart novel properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make compounds suitable for research or diagnostic purposes, such as imaging. [Examples]

[0252] The following examples illustrate, but are not limited to, specific embodiments of the present disclosure. Furthermore, where specific embodiments are provided, the inventors intend for common applications of those specific embodiments. For example, the disclosure of oligonucleotides having a particular motif is reasonably supported for additional oligonucleotides having the same or similar motif. Also, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered preferable unless otherwise indicated.

[0253] Example 1: Effect of 5-10-5MOE gapmer-modified oligonucleotides on human SCN2A RNA in vitro, single dose. Modified oligonucleotides complementary to human SCN2A nucleic acid were designed, and their effects on SCN2A RNA with a single dose were tested in vitro. The modified oligonucleotides were tested in a series of experiments under similar culture conditions.

[0254] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers having mixed PO / PS nucleoside bonds. The gapmer has a length of 20 nucleosides, with its central gap segment consisting of ten 2'-β-D-deoxynucleosides, and its 5' and 3' wing segments each consisting of five 2'-MOE modified nucleosides. The sugar motif of the gapmer (from 5' to 3') is eeeeeddddddddddeeeee, where "d" represents the 2'-β-D-deoxyribose sugar and "e" represents the 2'-MOE sugar moiety. The nucleoside-to-nucleoside bonding motif of the gapmer (from 5' to 3') is soooosssssssssssooss, where each "o" represents a phosphodiester nucleoside bond and each "s" represents a phosphorothioate nucleoside bond. Each cytosine residue is 5-methylcytosine.

[0255] The "start site" indicates the furthest 5'-terminal nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "stop site" indicates the furthest 3'-terminal nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to either or both of the human SCN2A mRNA shown herein as Sequence ID 1 (GENBANK accession number NM_001040142.2), or the human SCN2A genome sequence shown herein as Sequence ID 2 (GENBANK accession number NC_000002.12, cleaved from nucleotide 165127001 to 165395000). "N / A" indicates that the modified oligonucleotide is not 100% complementary to its particular target nucleic acid sequence.

[0256] Cultured SH-SY5Y cells were treated with modified oligonucleotides at a concentration of 4000 nM or 5000 nM at a cell density of 20,000 cells per well using electroporation. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and SCN2A RNA levels were measured by quantitative real-time RTPCR. SCN2A RNA levels were measured using the human primer probe set RTS36041 (forward sequence CCTTGAACCTGAAGCCTGTT, shown herein as SEQ ID NO: 10; reverse sequence CGAACCAATTGTGCTCCACTA, shown herein as SEQ ID NO: 11; probe sequence TTCCACCAGAGTTTCCCTTTGCCT, shown herein as SEQ ID NO: 12). SCN2A RNA levels were normalized to total RNA content as measured by RIBOGREEN®. The decrease in SCN2A RNA is shown in the table below as a percentage of SCN2A RNA amount compared to the amount in untreated control cells (% control). Each table represents results from separate assay plates. Values ​​marked with "†" indicate that the modified oligonucleotide is complementary to the unit replication sequence region of the primer-probe set. Additional assays may be used to measure the potency and efficacy of modified oligonucleotides complementary to the unit replication sequence region. [Table 2-1] [Table 2-2] [Table 3-1] [Table 3-2] [Table 4-1] [Table 4-2] Table 5-1 Table 5-2 Table 6-1 Table 6-2 Table 7-1 Table 7-2 Table 8-1 Table 8-2 Table 9-1 Table 9-2 Table 10-1 Table 10-2 Table 11-1 Table 11-2 Table 12-1 Table 12-2 Table 13-1 Table 13-2 Table 14-1 Table 14-2 Table 15-1 Table 15-2 Table 16-1 Table 16-2 Table 17-1 Table 17-2 Table 18-1 Table 18-2 Table 19-1 Table 19-2 Table 20-1 Table 20-2 Table 21-1 Table 21-2 Table 22-1 Table 22-2 Table 23-1 Table 23-2 Table 24-1 Table 24-2 Table 25-1 Table 25-2 Table 26-1 Table 26-2 Table 27-1 Table 27-2 Table 28-1 Table 28-2 Table 29-1 Table 29-2 Table 30-1 [Table 30-2] [Table 31-1] [Table 31-2] [Table 32-1] [Table 32-2] [Table 33-1] [Table 33-2]

[0257] Example 2: Effect of modified oligonucleotides on human SCN2A RNA in vitro, multiple doses. Modified oligonucleotides selected from Example 1 above were tested at various doses in SH-SY5Y cells. Cultured SH-SY5Y cells were treated at a density of 20,000 cells per well using electroporation with various concentrations of modified oligonucleotides, as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and SCN2A RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured as described above using the human SCN2A primer probe set RTS36041 (described herein in Example 1). SCN2A RNA levels were normalized to the total RNA content as measured by RIBOGREEN®. The decrease in SCN2A RNA is shown in the table below as a percentage of SCN2A RNA compared to the amount in untreated control cells (% control).

[0258] Half-number inhibitory concentration (IC) of each modified oligonucleotide 50This was calculated using linear regression on a logarithmic / linear plot of the data in Excel. [Table 34] [Table 35] [Table 36] [Table 37] [Table 38] [Table 39] [Table 40] [Table 41] [Table 42] [Table 43] [Table 44] [Table 45] [Table 46] [Table 47] [Table 48] [Table 49] [Table 50]

[0259] Example 3: Design of MOE gapmer-modified oligonucleotides complementary to human SCN2A nucleic acid. Modified oligonucleotides complementary to human SCN2A nucleic acid were designed as shown in the table below. In the table below, the "start site" indicates the furthest 5'-terminal nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "stop site" indicates the furthest 3'-terminal nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (GENBANK accession number NM_001040142.2) or SEQ ID NO: 2 (GENBANK accession number NC_000002.12, cleaved from nucleotide 165127001 to 165395000), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to its particular target nucleic acid sequence.

[0260] The modified oligonucleotides in Table 51 are 5-10-5MOE gapmers. These gapmers have a length of 20 nucleosides, with a central gap segment consisting of ten 2'-β-D-deoxynucleosides, and its 5' and 3' wing segments each consisting of five 2'-MOE nucleosides. The sugar motif of the gapmer (from 5' to 3') is eeeeeddddddddddeeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. The gapmer has a nucleoside-to-nucleoside linkage motif (from 5' to 3'), soooosssssssssssooss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine residue is 5-methylcytosine. [Table 51-1] [Table 51-2]

[0261] The modified oligonucleotides in Table 52 below are 6-10-4MOE gapmers. These gapmers have a length of 20 nucleosides, with a central gap segment consisting of ten 2'-β-D-deoxynucleosides, a 5' wing segment consisting of six 2'-MOE nucleosides, and a 3' wing segment consisting of four 2'-MOE nucleosides. The sugar motif of the gapmer (from 5' to 3') is eeeeeeddddddddddeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. The gapmer has a nucleoside-to-nucleoside bonding motif (from 5' to 3') soooooossssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond. Each cytosine residue is 5-methylcytosine. [Table 52-1] [Table 52-2]

[0262] The modified oligonucleotides in Table 53 below are 4-10-6MOE gapmers. These gapmers have a length of 20 nucleosides, with a central gap segment consisting of ten 2'-β-D-deoxynucleosides, a 5' wing segment consisting of four 2'-MOE nucleosides, and a 3' wing segment consisting of six 2'-MOE nucleosides. The sugar motif of the gapmer (from 5' to 3') is eeeeddddddddddeeeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. The gapmer has a nucleoside-to-nucleoside bonding motif (from 5' to 3') sooossssssssssoooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond. Each cytosine residue is 5-methylcytosine. [Table 53-1] [Table 53-2]

[0263] The modified oligonucleotides in Table 54 below are 4-8-6MOE gapmers. These gapmers have a length of 18 nucleosides, with the central gap segment consisting of eight 2'-β-D-deoxynucleosides, the 5' wing segment consisting of four 2'-MOE nucleosides, and the 3' wing segment consisting of six 2'-MOE nucleosides. The sugar motif of the gapmer (from 5' to 3') is eeeeddddddddeeeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. The gapmer has a nucleoside-to-nucleoside bonding motif (from 5' to 3') soossssssssssoooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond. Each cytosine residue is 5-methylcytosine. [Table 54]

[0264] The modified oligonucleotides in Table 55 below are 6-8-4MOE gapmers. These gapmers have a length of 18 nucleosides, with the central gap segment consisting of eight 2'-β-D-deoxynucleosides, the 5' wing segment consisting of six 2'-MOE nucleosides, and the 3' wing segment consisting of four 2'-MOE nucleosides. The sugar motif of the gapmer (from 5' to 3') is eeeeeeddddddddeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. The gapmer has a nucleoside-to-nucleoside bonding motif (from 5' to 3') sooooosssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond. Each cytosine residue is 5-methylcytosine. [Table 55]

[0265] The modified oligonucleotides in Table 56 below are 5-8-5MEO gapmers. These gapmers have a length of 18 nucleosides, with the central gap segment consisting of eight 2'-β-D-deoxynucleosides, the 5' wing segment consisting of five 2'-MOE nucleosides, and the 3' wing segment consisting of five 2'-MOE nucleosides. The sugar motif of the gapmer (from 5' to 3') is eeeeeddddddddeeeee, where "d" represents the 2'-β-D-deoxyribose sugar moiety and "e" represents the 2'-MOE sugar moiety. The gapmer has a nucleoside-to-nucleoside bonding motif (from 5' to 3') sooosssssssssooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond. Each cytosine residue is 5-methylcytosine. [Table 56]

[0266] Example 4: Tolerability of modified oligonucleotides complementary to human SCN2A in wild-type mice in a 3-hour test. The modified oligonucleotides described above were tested in wild-type female C57 / Bl6 mice to evaluate their tolerability. Furthermore, control compound number 1506060 was tested. Each wild-type female C57 / Bl6 mouse received a single ICV dose of 700 μg of the modified oligonucleotide, as listed in the table below. Each treatment group consisted of three mice. Groups of four mice were administered PBS as a negative control for each experiment (specified in a separate table below). Three hours after injection, the mice were evaluated according to seven different criteria: (1) the mouse was bright, attentive, and responsive; (2) the mouse was standing or kyphotic without stimulation; (3) the mouse showed movement without stimulation; (4) the mouse showed forward movement after being lifted; (5) the mouse showed any movement after being lifted; (6) the mouse responded to tail constriction; and (7) normal respiration. For each of the seven criteria, a subscore of 0 was assigned if a mouse met the criterion, and a subscore of 1 if it did not (Functional Observation Battery Score or FOB). After evaluating all seven criteria, the scores were totaled for each mouse and averaged within each treatment group. [Table 57] [Table 58] [Table 59] [Table 60-1] [Table 60-2] [Table 61] [Table 62-1] [Table 62-2] [Table 63-1] [Table 63-2] [Table 64] [Table 65] [Table 66]

[0267] Example 5: Tolerability of a 3 mg dose of a modified oligonucleotide complementary to human SCN2A in rats. The modified oligonucleotides described above were tested in rats to evaluate their tolerability. Each Sprague Dolly rat received a single intra-articular (IT) dose of 3 mg of the modified oligonucleotides listed in the table below. Each treatment group consisted of 3-4 rats. A group of 4 rats was administered PBS as a negative control for each experiment (identified in a separate table below). Three hours after injection, movement was assessed in seven different body parts for each rat. The seven body parts were: (1) rat tail, (2) rat posterior posture, (3) rat hind limb, (4) rat hind foot, (5) rat fore foot, (6) rat anterior posture, and (7) rat head. For each of the seven body parts, each rat was given a subscore of 0 if the body part was moving, or a subscore of 1 if the body part was paralyzed (Functional Observation Battery Score or FOB). After assessing each of the seven body parts, the subscores were totaled for each rat and then averaged across the groups. For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after administration of 3 mg of IT, the total score would be 0. In another rat, if the tail was not moving 3 hours after administration of 3 mg of IT, but all other evaluated body parts were moving, a score of 1 would be given. The scores were averaged across each treatment group and are shown in the table below. Values ​​marked with the symbol "‡" indicate groups with three or fewer animals. [Table 67] [Table 68] [Table 69] [Table 70] [Table 71] [Table 72] [Table 73] [Table 74] [Table 75] [Table 76] [Table 77] [Table 78] [Table 79] [Table 80] [Table 81]

[0268] Example 6: Effect of modified oligonucleotides on human SCN2A RNA in vitro, multiple doses. Modified oligonucleotides selected from the above examples were tested at various doses in SH-SY5Y cells. Cultured SH-SY5Y cells were treated at a density of 20,000 cells per well using electroporation with various concentrations of modified oligonucleotides, as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and SCN2A RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured using the human SCN2A primer probe set RTS36041 (described herein above). SCN2A RNA levels were normalized to the total RNA content as measured by GAPDH. GAPDH levels were measured using the human primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, shown herein as SEQ ID NO: 7; reverse sequence GAAGATGGTGATGGGATTTC, shown herein as SEQ ID NO: 8; probe sequence CAAGCTTCCCGTTCTCAGCC, shown herein as SEQ ID NO: 9). The reduction in SCN2A RNA is shown in the table below as a percentage of SCN2A RNA compared to the amount in untreated control cells (% control). The results of each individual experiment are shown in the individual tables below.

[0269] Half-number inhibitory concentration (IC) of each modified oligonucleotide 50 This was calculated using linear regression on a logarithmic / linear plot of the data in Excel. [Table 82] [Table 83] [Table 84] [Table 85] [Table 86] [Table 87]

[0270] Example 7: Effect of modified oligonucleotides on human SCN2A RNA in vitro, multiple doses. Modified oligonucleotides selected from the above examples were tested at various doses in SH-SY5Y cells. Cultured SH-SY5Y cells were treated at a density of 35,000 cells per well using electroporation with various concentrations of modified oligonucleotides, as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and SCN2A RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured using the human SCN2A primer probe set RTS36041 (described herein above). SCN2A RNA levels were normalized to the total RNA content as measured by GAPDH. GAPDH levels were measured using the human primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, shown herein as SEQ ID NO: 7; reverse sequence GAAGATGGTGATGGGATTTC, shown herein as SEQ ID NO: 8; probe sequence CAAGCTTCCCGTTCTCAGCC, shown herein as SEQ ID NO: 9). The reduction in SCN2A RNA is shown in the table below as a percentage of SCN2A RNA compared to the amount in untreated control cells (% control).

[0271] Half-number inhibitory concentration (IC) of each modified oligonucleotide 50 The result was calculated using Graphpad Prism with log(inhibitor) vs normalized response-variable gradient curve fitting. [Table 88]

[0272] Example 8: Effect of modified oligonucleotides on human SCN2A in genetically modified mice The modified oligonucleotides described above were tested in a human SCN2A gene-transfected mouse model. Transgenic mice expressing the human SCN2A transcript were generated in a C57B1 / 6 background. Transgenic mice may be prepared or are available from commercial and academic research institutions. For example, for an example of a transgenic mouse expressing a human neuronal gene, see, for example, Heintz et al., 2002, Nature reviews Neuroscience 2, 861-870.

[0273] process Human SCN2A gene-transformed mice were divided into groups of two. Each mouse received a single ICV bolus of 350 μg of modified oligonucleotide. A group of four mice received PBS as a negative control.

[0274] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from cerebral cortical tissue and spinal cord for quantitative real-time RTPCR analysis. The amount of SCN2A RNA was measured using the human primer probe set RTS36041 (described in Example 1 above). Results are presented as the percentage of human SCN2A RNA (% control) compared to the amount in PBS-treated animals, normalized to mouse GAPDH RNA. Mouse GAPDH RNA was amplified using the primer probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, shown herein as SEQ ID NO: 13; reverse sequence GGGTCTCGCTCCTGGAAGAT, shown herein as SEQ ID NO: 14; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, shown herein as SEQ ID NO: 15).

[0275] As shown in the table below, treatment with modified oligonucleotides resulted in a reduction of SCN2A RNA compared to the PBS control. [Table 89-1] [Table 89-2] [Table 90-1] [Table 90-2] [Table 90-3] [Table 91-1] [Table 91-2] [Table 92] [Table 93-1] [Table 93-2]

[0276] Example 9: Efficacy of complementary modified oligonucleotides against human SCN2A RNA in transgenic mice The modified oligonucleotides described above were tested in human SCN2A gene-transformed mice (as described above in this specification).

[0277] process Human SCN2A gene-transformed mice were divided into groups of four. Each mouse received a single ICV bolus of modified oligonucleotides at the doses shown in the table below. A group of eight mice received PBS as a negative control.

[0278] RNA analysis Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the cortex and spinal cord for quantitative real-time RTPCR analysis of SCN2A RNA expression using the primer probe set RTS36041 (described in Example 1 above). Results are presented as the percentage of human SCN2A RNA compared to the amount in PBS-treated animals, normalized to mouse GAPDH RNA. Mouse GAPDH was amplified using the primer probe set mGapdh_LTS00102 (described herein above). The half-effective amount (ED) of each modified oligonucleotide was calculated. 50 The calculations were performed using GraphPad Prism 7 software (GraphPad Software, San Diego, California). ED 50 Values ​​were calculated from dose and SCN2A RNA levels in individual animals using a custom equation Motulsky: Agonist vs. Response - Variable Gradient (4 parameters) Y=Bottom+(Top-Bottom) / (1+(10^logEC50 / X)^HillSlope), under the following conditions: Bottom value greater than the lowest value in the dataset for comparison between ASOs (4.5 and 9.4 in the cortex and spinal cord, respectively), top=100, and HillSlope <-1 and >-2.

[0279] As shown in the table below, treatment with modified oligonucleotides resulted in a dose-dependent reduction of SCN2A RNA compared to the PBS control. [Table 94-1] [Table 94-2]

Claims

1. It is an oligomeric compound, Array (from 5' to 3') 【Chemistry 43】 Includes a 6-10-4 MOE gapmer having (Sequence ID 2510), Nucleosides 1-6 and 17-20 (from 5' to 3') are 2'-MOE nucleosides, and nucleosides 7-16 are 2'-β-D-deoxynucleosides. The nucleoside bonds between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate nucleoside bonds. Each cytosine is 5-methylcytosine, an oligomeric compound.

2. The oligomer compound is a modified oligonucleotide represented by the following chemical symbols 【Chemistry 44】 (Sequence ID 2510) Includes, During the ceremony, A = adenine nucleic acid base, m C = 5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribose sugar portion, s = phosphorothioate nucleoside interbonding, and The oligomer compound according to claim 1, wherein o = phosphodiester nucleoside interbonding.

3. The oligomer compound is a modified oligonucleotide represented by the following chemical structure: 【Chemistry 45】 The oligomer compound according to claim 2, comprising (SEQ ID NO: 2510) or a salt thereof.

4. The oligomer compound according to claim 3, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

5. The oligomer compound according to claim 4, wherein the modified oligonucleotide is a sodium salt.

6. The oligomer compound is a modified oligonucleotide represented by the following chemical structure: 【Chemistry 46】 The oligomer compound according to claim 2, comprising (SEQ ID NO: 2510).

7. A pharmaceutical composition comprising an oligomer compound according to any one of claims 1 to 6, and a pharmaceutically acceptable diluent or carrier.

8. The pharmaceutical composition according to claim 7, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate-buffered saline (PBS).

9. The pharmaceutical composition according to claim 8, wherein the pharmaceutical composition comprises the modified oligonucleotide and aCSF.

10. The pharmaceutical composition according to claim 8, wherein the pharmaceutical composition comprises the modified oligonucleotide and PBS.

11. A composition comprising the oligomer compound according to any one of claims 1 to 6 or a pharmaceutical composition according to any one of claims 7 to 10 for use in treating a voltage-gated sodium channel protein-related disease or disorder in a subject who has or is at risk of developing a voltage-gated sodium channel protein-related disease or disorder.

12. A composition comprising the oligomer compound according to any one of claims 1 to 6 or a pharmaceutical composition according to any one of claims 7 to 10, for use in reducing the amount of SCN2A protein in the CSF of subjects having or at risk of developing a disease or disorder related to voltage-gated sodium channel protein.

13. The composition for use or pharmaceutical composition according to claim 12, wherein the disease or disorder is a neurodevelopmental disorder.

14. The composition for use or pharmaceutical composition according to claim 13, wherein the disease or disorder is related to SCN1A or SCN2A.

15. The composition for use or pharmaceutical composition according to claim 14, wherein the disease or disorder is related to SCN2A and is a developmental and epileptic encephalopathy, intellectual disability, or autism spectrum disorder.

16. The composition for use or pharmaceutical composition according to claim 15, wherein the developmental and epileptic encephalopathy is early-onset seizure-induced epileptic encephalopathy (EE), late-onset seizure-induced epileptic encephalopathy, or benign familial neonatal infantile seizures.

17. The composition for use or pharmaceutical composition according to claim 14, wherein the disease or disorder associated with SCN1A or SCN2A is selected from the group consisting of Ohtahara syndrome, infantile epilepsy with migratory focal seizures, West syndrome, Lennox-Gastaut syndrome, Dravet syndrome, idiopathic / generic generalized epilepsy, lateral temporal lobe epilepsy, myoclonic apoptosis, infantile migraine with partial seizures, and familial epileptic migraine.

18. The composition for use or pharmaceutical composition according to claim 14, wherein the disease or disorder is associated with SCN1A and is developmental and epileptic encephalopathy.

19. The composition for use or pharmaceutical composition according to claim 18, wherein the developmental and epileptic encephalopathy is Dravet syndrome.

20. The composition for use or pharmaceutical composition according to claim 11, wherein at least one symptom or characteristic of the disease or disorder is improved in the subject.

21. The composition for use or pharmaceutical composition according to claim 20, wherein the symptom or characteristic is a seizure.

22. The composition for use or pharmaceutical composition according to claim 21, wherein the seizure is any of a focal seizure, a clonic seizure, a tonic seizure, a generalized tonic-clonic seizure, a convulsive seizure, a myoclonic seizure, an absence seizure, or a hypoesthesia seizure.

23. The composition for use or pharmaceutical composition according to claim 20, wherein the symptoms or characteristics are selected from the group consisting of seizures, hypotonia, sensory integration disorder, motor skills impairment, intellectual and cognitive impairment, motor and balance impairment, visual impairment, language and speech delay, gastrointestinal disorder, neurodevelopmental delay, sudden unexpected death in epilepsy, motor skills developmental delay, social and language developmental indicators delay, repetitive movements, oral noncoordination, gastrointestinal disorder, and insomnia.

24. The composition for use or pharmaceutical composition according to claim 21, wherein the seizures are frequent or prolonged.

25. The composition for use or pharmaceutical composition according to claim 11, wherein the oligomer compound or the pharmaceutical composition reduces seizures, sensory integration disorders, motor skills impairments, intellectual and cognitive impairments, motor and balance disorders, visual impairments, language and speech delays, gastrointestinal disorders, neurodevelopmental delays, motor skills development delays, delayed social development indicators, repetitive movements, non-coordinated movements of the mouth, insomnia, hypotonia, nystagmus, optic nerve atrophy, dyspnea, speech disorders, spasticity, ataxia, seizures, or choreiform movements in the subject.

26. The composition for use or pharmaceutical composition according to claim 11, wherein the use comprises administering the oligomer compound to the central nervous system of the subject or systemically to the subject.

27. ​​The composition for use or pharmaceutical composition according to claim 11, wherein the use comprises administering the oligomer compound to the subject intraarachnoid space, systemically, subcutaneously, or intramuscularly.

28. The composition for use or pharmaceutical composition according to any one of claims 11 to 27, wherein the subject is a human.

29. A composition comprising the oligomer compound according to any one of claims 1 to 6 or a pharmaceutical composition according to any one of claims 7 to 10 for use in reducing the amount of SCN2A RNA or SCN2A protein in cells.

30. The composition for use or pharmaceutical composition according to claim 29, wherein the cells are cortical cells, hippocampal cells, or spinal cord cells.

31. The composition for use or pharmaceutical composition according to claim 29, wherein the cells are animal cells.

32. The composition for use or pharmaceutical composition according to any one of claims 29 to 31, wherein the cells are human cells.

Citation Information

Patent Citations

  • Antisense oligomers for treatment of non-sense mediated RNA decay based conditions and diseases

    WO2019084050A1

  • Compositions and methods for increasing expression of SCN2a

    WO2019143831A1

  • Antisense oligonucleotides targeting SCN2a for the treatment of SCN1a encephalopathies

    WO2020041348A1

  • Antisense oligonucleotides targeting SCN2a retained introns

    WO2020154462A1