Mutant insect olfactory receptor protein

Abstract

The present invention addresses the problem of providing a technology of improving a response activity of an olfactory receptor to chemicals. Said problem is solved by introducing a mutation so as to satisfy a specific condition in a specific site of an insect olfactory receptor protein.

Description

[Technical Field]

[0001] This disclosure relates to mutant insect olfactory receptor proteins, etc. [Background technology]

[0002] Because groups of odor molecules that characterize specific human diseases and mental states have been identified and have high value as diagnostic markers, the development of various odor sensors targeting these molecules is thriving. Since biological olfactory receptors possess superior characteristics in terms of diversity, sensitivity, and selectivity that are not found in conventional odor sensor elements such as semiconductors, the development of new odor sensors using olfactory receptors as sensor elements is highly anticipated.

[0003] Since odor markers are generally present at low concentrations, it is desirable to create highly active olfactory receptors. Currently, amino acid sites in olfactory receptors that, when substituted, alter the selectivity of permeable ions have been reported. [Prior art documents] [Patent Documents]

[0004] [Patent Document 1] Japanese Patent Publication No. 2013-27376 [Patent Document 2] Japanese Patent Publication No. 2018-59786 [Patent Document 3] Japanese Patent Publication No. 2012-78351 [Non-patent literature]

[0005] [Non-Patent Document 1] PLoS ONE, March 2012, Volume 7, Issue 3, e32372. [Overview of the project] [Problems that the invention aims to solve]

[0006] The objective of this disclosure is to provide a technology that improves the response activity of olfactory receptors to chemical substances. [Means for solving the problem]

[0007] In view of the above problems, the inventors diligently conducted research and found that by introducing mutations in specific sites within insect olfactory receptor proteins to satisfy specific conditions, the response activity to chemical substances can be improved. Based on this finding, the inventors furthered their research and completed the invention of this disclosure. That is, this disclosure encompasses the following aspects.

[0008] Item 1. A mutant insect olfactory receptor protein, The general formula in the corresponding wild-type insect olfactory receptor protein (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 [In the formula, X1-X6 and Z1-Z3 represent amino acids derived from the amino acid sequence of wild-type insect olfactory receptors, φ1 represents a hydrophobic amino acid, φ2-φ7 each independently represent an uncharged polar amino acid or a hydrophobic amino acid, and U represents an uncharged polar amino acid.] It includes an amino acid sequence B which is formed by a mutation of the amino acid sequence A shown, Conditions 1-3 below: (Condition 1) In the amino acid sequence B, X3 and / or X4 are substituted, and X3 is a branched-chain amino acid and / or X4 is an uncharged polar amino acid. (Condition 2) If both X5 and X6 are positively charged polar amino acids in amino acid sequence A, then in amino acid sequence B, X6 is an amino acid other than a positively charged polar amino acid, and (Condition 3) If in amino acid sequence A one or both of X1 and X2 are positively charged polar amino acids, then in amino acid sequence B, X1 and / or X2 are substituted, and X1 is an uncharged polar amino acid and / or X2 is a hydrophobic amino acid. Selected from the group consisting of, satisfying at least one condition, Mutant insect olfactory receptor protein.

[0009] Item 2. The mutant insect olfactory receptor protein according to Item 1, which satisfies the condition 1, X3 is isoleucine or leucine and / or X4 is serine or asparagine.

[0010] Item 3. The mutant insect olfactory receptor protein according to Item 1 or 2, which satisfies the condition 2 and X6 is an uncharged polar amino acid.

[0011] Item 4. The mutant insect olfactory receptor protein according to any one of Items 1 to 3, which satisfies the condition 2 and X6 is serine or threonine.

[0012] Item 5. The mutant insect olfactory receptor protein according to any one of Items 1 to 4, which satisfies the condition 3, X1 is serine or glutamine and / or X2 is alanine.

[0013] Item 6. In condition 1, X3 is isoleucine or leucine and / or X4 is serine or asparagine, in condition 2, X6 is serine or threonine, in condition 3, X1 is serine or glutamine and / or X2 is alanine. The mutant insect olfactory receptor protein according to any one of Items 1 to 5.

[0014] Item 7. The following conditions 1A to 3A: (Condition 1A) In the amino acid sequence B, X3 is a branched-chain amino acid and / or X4 is an uncharged polar amino acid, (Condition 2A) In the amino acid sequence B, X6 is an amino acid other than a positively charged polar amino acid, and (Condition 3A) In the amino acid sequence B, X1 is an uncharged polar amino acid and / or X2 is a hydrophobic amino acid, The mutant insect olfactory receptor protein according to any one of Items 1 to 6, which satisfies at least one condition selected from the group consisting of: Item 37. The mutant insect olfactory receptor protein according to any one of Items 1 to 6.

[0015] Item 8. A mutant insect olfactory receptor protein according to any one of items 1 to 7, wherein the amino acid sequence A is a sequence included at the C-terminus of the amino acid sequence of the wild-type insect olfactory receptor protein.

[0016] Item 9. A mutant insect olfactory receptor protein according to any one of items 1 to 8, wherein the wild-type insect olfactory receptor protein is a wild-type olfactory receptor protein of an insect of the superorder Entomoptera.

[0017] Item 10. A polynucleotide comprising the coding sequence of a mutant insect olfactory receptor protein described in any of items 1-9.

[0018] Item 11. A cell containing the polynucleotides described in Item 10.

[0019] Item 12. Non-human animals, including the cells described in Item 11.

[0020] Item 13. A chemical substance detection element comprising a mutant insect olfactory receptor protein as described in any of Items 1 to 9.

[0021] Item 13A. Use of mutant insect olfactory receptor proteins described in any of items 1 to 9 as chemical detection elements.

[0022] Item 13B. Use of any mutant insect olfactory receptor protein described in items 1-9 for the manufacture of chemical detection elements.

[0023] Item 14. A chemical detection sensor comprising a lipid bilayer, cells, or a non-human animal containing the chemical detection element described in Item 13.

[0024] Item 14A. Use of a lipid bilayer, cell, or non-human animal containing the mutant insect olfactory receptor protein described in any of items 1 to 9 as a chemical detection sensor.

[0025] Item 14B. Use of a lipid bilayer, cell, or non-human animal containing the mutant insect olfactory receptor protein described in any of items 1-9 for the manufacture of a chemical detection sensor.

[0026] Item 15. A method for detecting a chemical substance, comprising bringing a mutant insect olfactory receptor protein described in any of Items 1 to 9, a chemical substance detection element described in Item 13, or a chemical substance detection sensor described in Item 14 into contact with a chemical substance. [Effects of the Invention]

[0027] This disclosure provides a technology to improve the response activity of olfactory receptors to chemical substances. [Brief explanation of the drawing]

[0028] [Figure 1] The results of measuring the chemical (pentyl acetate) response activity of Drosophila olfactory receptor 47a and its mutants are shown (Test Example 1). The horizontal axis shows the fluorescence intensity (=activity intensity), and the vertical axis shows the olfactory receptor and its amino acid sequence. The olfactory receptors are, from top to bottom, wild type (Comparative Example 1-1), mutant (RX4S, Example 1-1), mutant (VX3L-RX4S, Example 1-2), and mutant (VX3L-RX4S+alpha, Example 1-3). In the amino acid sequence, "·" indicates the same amino acid as the wild type (no mutation has been introduced). The concentration of the test substance in the culture medium is shown at the top of the graph. [Figure 2] The results of measuring the chemical (cis-jasmon) response activity of silkworm olfactory receptor 56 and its mutants are shown (Test Example 2). The horizontal axis shows the fluorescence intensity (=activity intensity), and the vertical axis shows the olfactory receptor and its amino acid sequence. The olfactory receptors are, from top to bottom, wild type (Comparative Example 2-1), mutant (IX1Q, Example 2-1), mutant (RX2A, Example 2-2), mutant (KX4S, Example 2-3), mutant (KX4N, Example 2-4), and mutant (IX1Q-RX2A-KX4S, Example 2-5). In the amino acid sequence, "·" indicates the same amino acid as the wild type (no mutation has been introduced). The concentration of the test substance in the culture medium is shown at the top of the graph. [Figure 3] The results of measuring the chemical (phenol) response activity of Anopheles mosquito olfactory receptor 1 and its mutants are shown (Test Example 3). The horizontal axis shows the fluorescence intensity (=activity intensity), and the vertical axis shows the olfactory receptor and its amino acid sequence. The olfactory receptors are, from top to bottom, wild type (Comparative Example 3-1), mutant (MX3L-KX4S, Example 3-1), mutant (MX3L-KX4N, Example 3-2), and mutant (MX3L-KX4S+alpha, Example 3-3). In the amino acid sequence, "·" indicates the same amino acid as the wild type (no mutation has been introduced). The concentration of the test substance in the culture medium is shown at the top of the graph. [Figure 4] The results of measuring the chemical (skatole) response activity of the Aedes albopictus olfactory receptor 9 and its variants are shown (Test Example 4). The horizontal axis shows the fluorescence intensity (=activity intensity), and the vertical axis shows the olfactory receptor and its amino acid sequence. The olfactory receptors are, from top to bottom, wild type (Comparative Example 4-1), mutant type (RX6T, Example 4-1), and mutant type (RX6T+alpha, Example 4-2). In the amino acid sequence, "·" indicates the same amino acid as the wild type (no mutation has been introduced). The concentration of the test substance in the culture medium is shown at the top of the graph. [Modes for carrying out the invention]

[0029] 1. Definition etc. In this specification, the terms “contains” and “includes” include the concepts of “contains,” “includes,” “substantially consist of,” and “consist solely of.”

[0030] In this specification, "identity" of amino acid sequences refers to the degree of agreement between two or more comparable amino acid sequences. Therefore, the higher the agreement between two amino acid sequences, the higher their identity or similarity. The level of amino acid sequence identity can be determined, for example, using the sequence analysis tool FASTA with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes" Proc Natl Acad Sci USA. 87:2264-2268 (1990), Karlin S, Altschul SF. "Applications and statistics for multiple high-scoring segments in molecular sequences." Proc Natl Acad Sci USA. 90:5873-7 (1993)). A program called BLASTX has been developed based on this BLAST algorithm. The specific methods for these analyses are publicly known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). Furthermore, the "identity" of the base sequence is defined in accordance with the above.

[0031] In this specification, "conservative substitution" means that an amino acid residue is substituted for an amino acid residue having a similar side chain. For example, substitutions between amino acid residues having basic side chains, such as lysine, arginine, and histidine, are considered conservative substitutions. Other examples of conservative substitutions include amino acid residues with acidic side chains, such as aspartic acid and glutamic acid; amino acid residues with non-charged polar side chains, such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues with non-polar side chains, such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues with β-branched side chains, such as threonine, valine, and isoleucine; and amino acid residues with aromatic side chains, such as tyrosine, phenylalanine, tryptophan, and histidine.

[0032] In this specification, nucleotides such as DNA and RNA may be subjected to known chemical modifications, as exemplified below. To prevent degradation by hydrolytic enzymes such as nucleases, the phosphate residue of each nucleotide can be replaced with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, or phosphorodithionate. The hydroxyl group at position 2 of the sugar (ribose) of each ribonucleotide may also be replaced with -OR (where R represents, for example, CH3(2'-O-Me), CH2CH2OCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, CH2CH2CN, etc.). Furthermore, the base portion (pyrimidine, purine) may be chemically modified, for example, by introducing a methyl group or cationic functional group at position 5 of the pyrimidine base, or by substituting the carbonyl group at position 2 with a thiocarbonyl group. Furthermore, examples include, but are not limited to, those in which the phosphate or hydroxyl portion is modified with, for example, biotin, an amino group, a lower alkylamine group, or an acetyl group. In addition, BNA (LNA), in which the conformation of the sugar portion of the nucleotide is fixed to the N-type by cross-linking the 2' oxygen and 4' carbon atoms of the sugar portion, can also be preferably used.

[0033] Olfactory receptor proteins are membrane proteins with a seven-transmembrane structure, and are composed of the following domains linked together from the amino terminus (sometimes referred to as the "N terminus") to the carboxyl terminus (sometimes referred to as the "C terminus"): the N-terminal region (NT), the first transmembrane domain (TM1), the first extracellular loop (EC1), the second transmembrane domain (TM2), the first intracellular loop (IC1), the third transmembrane domain (TM3), the second extracellular loop (EC2), the fourth transmembrane domain (TM4), the second intracellular loop (IC2), the fifth transmembrane domain (TM5), the third extracellular loop (EC3), the sixth transmembrane domain (TM6), the third intracellular loop (IC3), the seventh transmembrane domain (TM7), and the C-terminal region (CT). In this disclosure, each region is determined by structural prediction using TMpred (K. Hofmann, W. Stoffel, TMbase - a database of membrane spanning protein segments, Biol. Chem. Hoppe-Seyler, 374 (1993), p. 166, https: / / embnet.vital-it.ch / software / TMPRED_form.html) (default conditions).

[0034] In this specification, amino acid mutations specifically refer to the deletion, substitution, insertion, or addition of amino acids. Olfactory receptor proteins may have deletions of amino acids that have little effect on chemical response activity, and may, for example, be olfactory receptor peptides in which some amino acids other than those in the transmembrane region are deleted.

[0035] In this specification, OR represents olfactory receptor, Orco represents olfactory receptor co-receptor, Dm represents Drosophila melanogaster, Bm represents Bombyx mori, Ag represents Anopheles gambiae, and Aa represents Aedes aegypti.

[0036] In this specification, chemical response activity refers to the property of an olfactory receptor to recognize a chemical substance, and the olfactory receptor complex formed by the olfactory receptor and its coreceptor is activated, exhibiting ion channel activity. The chemical response activity of an olfactory receptor can be measured using the ion channel activity of the olfactory receptor complex formed by the olfactory receptor and its coreceptor in contact with the chemical substance as an indicator. For example, (a) an olfactory receptor, (b) an olfactory receptor coreceptor, and (c) a cell expressing a protein that develops color or emits light in response to ions (such as calcium ions) flowing into the cell when the olfactory receptor responds are brought into contact with a chemical substance, and the amount of light emitted by the cell is measured. The greater the measured amount of light emitted, the higher the chemical response activity of the olfactory receptor is judged to be. Specific examples of measuring chemical response activity are described in Test Examples 1-2 and 1-3 below.

[0037] The chemical substances (odors, etc.) to which each olfactory receptor responds can be determined by known or known screening methods. For example, pentyl acetate is a chemical substance to which DmOR47a responds, cis-jasmon is a chemical substance to which BmOR56 responds, phenol is a chemical substance to which AgOR1 responds, skatole is a chemical substance to which AaOR9 responds, and indole is a chemical substance to which AgOR2 responds.

[0038] 2. Olfactory receptor proteins This disclosure relates, in one aspect, to a mutant insect olfactory receptor protein (sometimes referred to as "the olfactory receptor protein of this disclosure") which contains an amino acid sequence B obtained by mutating amino acid sequence A, represented by the general formula (1):φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 in the corresponding wild-type insect olfactory receptor protein, and satisfies at least one condition selected from the group consisting of conditions 1 to 3. This will be described below.

[0039] The olfactory receptor protein of this disclosure is a mutant insect olfactory receptor protein obtained by mutating amino acids in the wild-type insect olfactory receptor protein.

[0040] Wild-type insect olfactory receptor proteins are not particularly limited as long as they are insect-derived, i.e., olfactory receptors that are intrinsically expressed (proprietarily possessed) by insects, and contain amino acid sequence A represented by general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6.

[0041] In general formula (1), X1 to X6 and Z1 to Z3 represent amino acids derived from the amino acid sequence of the wild-type insect olfactory receptor. For example, in the wild-type insect olfactory receptor, the sequence corresponding to amino acid sequence A is F SSIVRTA MSYITML RS If it is (a part of the amino acid sequence shown in Sequence ID No. 1), the underlined amino acids, from left to right, are X1, X2, Z1, X3, X4, Z2, Z3, X5, and X6.

[0042] In general formula (1), φ1 represents a hydrophobic amino acid. Examples of hydrophobic amino acids include alanine, valine, leucine, isoleucine, methionine, proline, phenylalanine, and tryptophan. Among these, leucine, methionine, isoleucine, valine, alanine, and phenylalanine are preferred, more preferably leucine, methionine, isoleucine, and valine, even more preferably leucine and methionine, and even more preferably leucine.

[0043] In general formula (1), φ2 to φ7 each independently represent either an uncharged polar amino acid or a hydrophobic amino acid. Examples of uncharged polar amino acids include glycine, threonine, serine, asparagine, glutamine, tyrosine, and cysteine. Examples of hydrophobic amino acids include alanine, valine, leucine, isoleucine, methionine, proline, phenylalanine, and tryptophan.

[0044] Preferably, hydrophobic amino acids are used as φ2, more preferably leucine, phenylalanine, isoleucine, valine, methionine, etc., and even more preferably leucine.

[0045] Preferably, φ3 includes threonine, alanine, methionine, leucine, and the like, with threonine being more preferred.

[0046] Preferred examples of φ4 include phenylalanine, leucine, tyrosine, isoleucine, valine, and the like, with phenylalanine, leucine, tyrosine, and the like being more preferred.

[0047] Preferred φ5 components include tyrosine, phenylalanine, isoleucine, cysteine, methionine, and the like, with tyrosine being more preferred.

[0048] Preferred φ6 components include tyrosine, phenylalanine, glycine, tryptophan, valine, leucine, isoleucine, alanine, serine, methionine, and the like; more preferably, tyrosine, phenylalanine, glycine, tryptophan, and even more preferably, tyrosine, phenylalanine, and the like.

[0049] Preferably, φ7 includes phenylalanine, tyrosine, leucine, methionine, asparagine, serine, valine, cysteine, alanine, glycine, threonine, etc. More preferably, phenylalanine, tyrosine, leucine, etc., and even more preferably, phenylalanine, tyrosine, etc.

[0050] In general formula (1), U represents an uncharged polar amino acid. Examples of uncharged polar amino acids include glycine, threonine, serine, asparagine, glutamine, tyrosine, and cysteine. Among these, serine, threonine, glutamine, asparagine, and glycine are preferred, more preferably serine, threonine, and glutamine, and even more preferably serine and threonine.

[0051] The position of amino acid sequence A in the wild-type insect olfactory receptor protein is not particularly limited. Due to its sequence characteristics, amino acid sequence A is usually located on the C-terminal side of the amino acid sequence of the wild-type insect olfactory receptor protein. The C-terminal side refers to, for example, the range from the C-terminus of the amino acid sequence of the wild-type insect olfactory receptor protein to, for example, the 70th, preferably the 60th, more preferably the 50th, even more preferably the 40th, and even more preferably the 35th amino acid, counting from the C-terminal amino acid.

[0052] The insects from which the wild-type insect olfactory receptor protein is derived are preferably insects of the superorder Enptera, more preferably Diptera insects such as Culicidae and Drosophilidae; Lepidoptera insects such as Bombycidae; Hymenoptera insects such as Apidae, and even more preferably Diptera insects such as Culicidae and Drosophilidae, and even more preferably Culicidae insects. Examples of Culicidae insects include Anopheles gambiae, Aedes aegypti, and Culex quinquefasciatus. Examples of Drosophilidae insects include Drosophila melanogaster, Drosophila pseudoobscura, and Drosophila virillis. Examples of insects in the Bombycidae family include the silkworm moth (Bombyx mori), the wild mulberry moth (Bombyx mandarina), and the fig moth (Trilocha varians). Examples of insects in the Apidae family include the European honeybee (Apis mellifera), the dwarf honeybee (Apis florea), the giant honeybee (Apis dorsata), and the European bumblebee (Bombus terrestris).

[0053] Examples of wild-type insect olfactory receptor proteins include, for example, DmOR47a (amino acid sequence: SEQ ID NO: 1), BmOR56 (amino acid sequence: SEQ ID NO: 2), AgOR1 (amino acid sequence: SEQ ID NO: 3), AaOR9 (amino acid sequence: SEQ ID NO: 4), AgOR28 (amino acid sequence: SEQ ID NO: 65), AgOR47 (amino acid sequence: SEQ ID NO: 66), AgOR11 (amino acid sequence: SEQ ID NO: 67), AgOR27 (amino acid sequence: SEQ ID NO: 68), AaOR5 (amino acid sequence: SEQ ID NO: 69), AaOR31 (amino acid sequence: SEQ ID NO: 70), AaOR72 (amino acid sequence: SEQ ID NO: 71), AaOR110 (amino acid sequence: SEQ ID NO: 72), AgOR2 (amino acid sequence: SEQ ID NO: 73), AgOR10 (amino acid sequence: SEQ ID NO: 74), and AaOR15 (amino acid sequence: SEQ ID NO: 75).

[0054] The olfactory receptor protein of this disclosure contains an amino acid sequence B which is obtained by mutating amino acid sequence A. The mutation is preferably a substitution.

[0055] The olfactory receptor protein of this disclosure satisfies at least one condition selected from the group consisting of conditions 1 to 3 with respect to amino acid sequence B.

[0056] Condition 1 is that in amino acid sequence B, X3 and / or X4 are substituted, X3 is a branched-chain amino acid and / or X4 is an uncharged polar amino acid.

[0057] In condition 1, "X3 and / or X4 are substituted" means that X3 and / or X4 in amino acid sequence B are substituted for X3 and / or X4 in amino acid sequence A (i.e., they are different amino acids).

[0058] In condition 1, the branched-chain amino acid represented by X3 in amino acid sequence B can be, for example, valine, leucine, isoleucine, etc. Among these, isoleucine, leucine, etc. are preferred.

[0059] In condition 1, the uncharged polar amino acid represented by X4 in amino acid sequence B can be, for example, glycine, threonine, serine, asparagine, glutamine, tyrosine, or cysteine. Among these, serine and asparagine are preferred.

[0060] In condition 1, it is preferable that in amino acid sequence B, X3 is a branched-chain amino acid and X4 is an uncharged polar amino acid.

[0061] Condition 2 is that if both X5 and X6 in amino acid sequence A are positively charged polar amino acids, then in amino acid sequence B, X6 is an amino acid other than a positively charged polar amino acid. In other words, Condition 2 is a condition limited to the case where both X5 and X6 in amino acid sequence A are positively charged polar amino acids.

[0062] In condition 2, the positively charged polar amino acid represented by X5 or X6 in amino acid sequence A is, for example, lysine, arginine, histidine, etc., and preferably lysine, arginine, etc.

[0063] In condition 2, the amino acid indicated by X6 in amino acid sequence B is not particularly limited, as long as it is an amino acid other than a positively charged polar amino acid. Preferably, the amino acid is an uncharged polar amino acid. Examples of uncharged polar amino acids include glycine, threonine, serine, asparagine, glutamine, tyrosine, and cysteine. Among these, serine and threonine are particularly preferred.

[0064] Condition 3 is that, in amino acid sequence A, if one or both of X1 and X2 are positively charged polar amino acids, then in amino acid sequence B, X1 and / or X2 are substituted, and X1 is an uncharged polar amino acid and / or X2 is a hydrophobic amino acid. In other words, condition 3 is limited to the case where one or both of X1 and X2 are positively charged polar amino acids in amino acid sequence A.

[0065] In condition 3, it is preferable that at least X2 of X1 and X2 in amino acid sequence A is a positively charged polar amino acid, and it is more preferable that only X2 is a positively charged polar amino acid.

[0066] In condition 3, the positively charged polar amino acid represented by X1 or X2 in amino acid sequence A is, for example, lysine, arginine, histidine, etc., preferably lysine, arginine, etc., and more preferably arginine.

[0067] In condition 3, "X1 and / or X2 are substituted" means that X1 and / or X2 in amino acid sequence B are substituted for X1 and / or X2 in amino acid sequence A (i.e., they are different amino acids).

[0068] In condition 3, the uncharged polar amino acid represented by X1 in amino acid sequence B can be, for example, glycine, threonine, serine, asparagine, glutamine, tyrosine, cysteine, etc. Among these, serine, glutamine, etc. are preferred.

[0069] In condition 3, examples of hydrophobic amino acids represented by X2 in amino acid sequence B include alanine, valine, leucine, isoleucine, methionine, proline, phenylalanine, and tryptophan. Among these, alanine, valine, leucine, and isoleucine are preferred, and alanine is more preferred.

[0070] In condition 3, it is preferable that in amino acid sequence B, X1 is an uncharged polar amino acid and X2 is a hydrophobic amino acid.

[0071] In one aspect of the present disclosure, it is preferable that the olfactory receptor protein of the present disclosure satisfies at least one condition selected from the group consisting of conditions 1A to 3A with respect to amino acid sequence B.

[0072] Condition 1A is that in amino acid sequence B, X3 is a branched-chain amino acid and / or X4 is an uncharged polar amino acid. Condition 1A is the same as Condition 1 except that it does not matter whether X3 and / or X4 are substituted in amino acid sequence B. In other words, Condition 1A also includes the case where X3 and / or X4 are not substituted from amino acid sequence A in amino acid sequence B.

[0073] Condition 2A is that in amino acid sequence B, X6 is an amino acid other than a positively charged polar amino acid. Condition 2A is the same as condition 2, except that it does not matter whether X5 and X6 are both positively charged polar amino acids in amino acid sequence A. In other words, condition 2A also includes the case where X5 and / or X6 are not substituted in amino acid sequence B.

[0074] Condition 3A is that in amino acid sequence B, X1 is an uncharged polar amino acid and / or X2 is a hydrophobic amino acid. Condition 3A is the same as condition 3 except that it does not matter whether one or both of X1 and X2 are positively charged polar amino acids in amino acid sequence A. In other words, condition 3A also includes the case where X1 and / or X2 in amino acid sequence B are not substituted from amino acid sequence A.

[0075] The olfactory receptor proteins of this disclosure may contain other amino acid mutations other than those specified in conditions 1 to 3 above, as long as the chemical response activity is not significantly reduced. "Not significantly reduced" means, for example, that the chemical response activity of the olfactory receptor proteins of this disclosure containing other amino acid mutations is higher than that of the corresponding wild-type insect olfactory receptor, and is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, even more preferably 80% or more, and even more preferably 90% or more, relative to 100% of the chemical response activity of the olfactory receptor proteins of this disclosure without other amino acid mutations.

[0076] The amino acid sequence of the olfactory receptor protein of this disclosure has, for example, 85% or more, more preferably 90% or more, even more preferably 95% or more, and even more preferably 97% or more identity with the amino acid sequence of a mutant insect olfactory receptor containing only mutations under at least one condition selected from the group consisting of conditions 1 to 3.

[0077] If the olfactory receptor protein of this disclosure contains other amino acid mutations, the amino acid sequence of the olfactory receptor protein of this disclosure is preferably an amino acid sequence in which one or more amino acids are mutated from the amino acid sequence of a mutant insect olfactory receptor containing only mutations under at least one condition selected from the group consisting of conditions 1 to 3. "More than one" means, for example, 2 to 50, preferably 2 to 30, more preferably 2 to 20, even more preferably 2 to 10, and even more preferably 2 to 5.

[0078] Other amino acid mutations include substitutions, deletions, additions, and insertions, with substitutions being preferred, and conservative substitutions being even more preferred. In addition, in the case of mutations in φ2 to φ7 of general formula (1), substitutions between uncharged polar amino acids and hydrophobic amino acids are also preferred.

[0079] The chemical response activity of the olfactory receptor proteins of this disclosure is higher than that of the corresponding wild-type insect olfactory receptors. The chemical response activity of the olfactory receptor proteins of this disclosure is, for example, 1.2 times, 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, or 20 times higher than that of the corresponding wild-type insect olfactory receptors.

[0080] The olfactory receptor proteins of this disclosure may have other amino acid sequences, such as protein tags, fluorescent proteins, luminescent proteins, signal sequences, or other proteins or peptides attached to them, as long as their chemical response activity is not significantly impaired. Examples of protein tags include biotin, His tags, FLAG tags, Halo tags, MBP tags, HA tags, Myc tags, V5 tags, and PA tags.

[0081] The olfactory receptor proteins of this disclosure may be chemically modified, provided that their chemical response activity is not significantly impaired.

[0082] The olfactory receptor proteins disclosed herein have a carboxyl group (-COOH) at the C-terminus, and a carboxylate (-COOH) at the C-terminus. - It may be any of the following: ), amide (-CONH2), or ester (-COOR).

[0083] Here, R in esters can be C such as methyl, ethyl, n-propyl, isopropyl, n-butyl, etc. 1-6 Alkyl groups; for example, cyclopentyl, cyclohexyl, etc. 3-8 Cycloalkyl groups; for example, phenyl, α-naphthyl, etc. 6-12 Aryl group; for example, phenyl-C such as benzyl and phenethyl. 1-2 Alkyl groups; such as α-naphthylmethyl and α-naphthyl-C 1-2 C such as alkyl groups 7-14 Aralkyl groups and pivaloyloxymethyl groups are used.

[0084] The olfactory receptor proteins of this disclosure may have carboxyl groups (or carboxylates) other than the C-terminus amidated or esterified. In this case, the ester may be, for example, the C-terminal ester described above.

[0085] Furthermore, the olfactory receptor proteins of this disclosure have a protecting group (e.g., a formyl group, an acetyl group, etc.) at the amino group of the N-terminal amino acid residue. 1-6C such as alkanoyl 1-6 Those protected with an acyl group etc. 1-6 , those in which the N-terminal glutamine residue that can be generated by cleavage in vivo is pyroglutaminated, substituents on the side chains of amino acids in the molecule (e.g., -OH, -SH, amino group, imidazole group, indole group, guanidino group, etc.) are protected with an appropriate protecting group (e.g., C 1-6 C such as alkanoyl group 1-6 Those protected with an acyl group etc. 1-6 , or complex proteins such as so-called glycoproteins to which sugar chains are to be bound are also included.

[0086] The olfactory receptor protein of the present disclosure may be in the form of a salt with an acid or a base. The salt is not particularly limited, and either an acidic salt or a basic salt can be employed. For example, examples of acidic salts include inorganic acid salts such as hydrochloride, hydrobromide, sulfate, nitrate, phosphate, etc.; organic acid salts such as acetate, propionate, tartrate, fumarate, maleate, malate, citrate, methanesulfonate, p-toluenesulfonate, etc.; amino acid salts such as aspartate, glutamate, etc. Examples of basic salts include alkali metal salts such as sodium salt, potassium salt, etc.; alkaline earth metal salts such as calcium salt, magnesium salt, etc.

[0087] The olfactory receptor protein of the present disclosure may be in the form of a solvate. The solvent is not particularly limited, and examples include water, ethanol, glycerol, acetic acid, etc.

[0088] The olfactory receptor protein of the present disclosure can be easily produced according to known genetic engineering techniques. For example, it can be produced using techniques such as PCR, restriction enzyme cleavage, DNA ligation, in vitro transcription and translation techniques, recombinant protein production techniques, etc.

[0089] 3. Polynucleotides, cells, non-human animals In one aspect, this disclosure relates to polynucleotides (which may be referred to herein as "the polynucleotides of the disclosure") containing the coding sequence of the olfactory receptor protein of the disclosure, cells (which may be referred to herein as "the cells of the disclosure") containing the polynucleotides of the disclosure, and non-human animals (which may be referred to herein as "the non-human animals of the disclosure") containing the cells of the disclosure. These are described below.

[0090] The coding sequence of the olfactory receptor protein of this disclosure is not particularly limited, as long as it is a polynucleotide consisting of a base sequence encoding the olfactory receptor protein of this disclosure.

[0091] In one embodiment, the polynucleotides of the Disclosure include an expression cassette of the olfactory receptor protein of the Disclosure.

[0092] The expression cassette for the olfactory receptor protein of this disclosure is not particularly limited, as long as it is a polynucleotide capable of expressing the olfactory receptor protein of this disclosure in a cell. Typical examples of the expression cassette for the olfactory receptor protein of this disclosure include a polynucleotide comprising a promoter and a coding sequence for the olfactory receptor protein of this disclosure, positioned under the control of the promoter.

[0093] The promoters included in the olfactory receptor protein expression cassette of this disclosure are not particularly limited and can be appropriately selected depending on the target cells. Various pol II system promoters can be used as promoters. Pol II system promoters are not particularly limited, but examples include the CMV promoter, EF1 promoter, SV40 promoter, MSCV promoter, etc. Other examples of promoters include tryptophan promoters such as trc and tac, lac promoter, T7 promoter, T5 promoter, T3 promoter, SP6 promoter, arabinose-inducible promoter, cold shock promoter, tetracycline-inducible promoter, etc.

[0094] The olfactory receptor protein expression cassette of this disclosure may optionally include other elements (e.g., a multicloning site (MCS), a drug resistance gene, an origin of replication, an enhancer sequence, a repressor sequence, an insulator sequence, a reporter protein (e.g., a fluorescent protein) coding sequence, a drug resistance gene coding sequence, etc.).

[0095] The polynucleotides of this disclosure may be in the form of vectors. An appropriate vector is selected depending on the intended use (cloning, protein expression) and the type of host cell. Examples of vectors that use Escherichia coli as a host include M13 phage or its variants, λ phage or its variants, pBR322 or its variants (pB325, pAT153, pUC8, etc.), examples of vectors that use yeast as a host include pYepSec1, pMFa, pYES2, pPIC3.5K, examples of vectors that use insect cells as a host include pAc, pVL, etc., and examples of vectors that use mammalian cells as a host include pcDNA, pCDM8, pMT2PC, etc.

[0096] The cells of this disclosure are not particularly limited in that they contain the polynucleotides of this disclosure. Examples of cells include Escherichia coli K12 and other Escherichia coli, Bacillus bacteria such as Bacillus subtilis MI114, yeast such as Saccharomyces cerevisiae AH22, Sf cell lines derived from Spodoptera frugiperda or HighFive cell lines derived from Trichoplusia ni, insect cells such as olfactory nerve cells, and animal cells such as COS7 cells. Preferably, animal cells are cultured cells derived from mammals, specifically COS7 cells, CHO cells, HEK293 cells, HEK293FT cells, Hela cells, PC12 cells, N1E-115 cells, SH-SY5Y cells, etc.

[0097] The cells of this disclosure preferably contain the coding sequence of an insect olfactory receptor coreceptor, from the viewpoint that they can be used directly for chemical substance detection applications described later. Although the insect olfactory receptor coreceptor is a membrane protein having a seven-transmembrane structure, similar to the olfactory receptor, it does not recognize odor substances itself, but functions by forming a heterocomplex with the olfactory receptor. The olfactory receptor complex, which is a heterocomplex composed of the olfactory receptor and the olfactory receptor coreceptor, has ion channel activity that is activated by odor substances, and when activated, it attracts sodium ions (Na + ), calcium ions (Ca 2+ It causes positive ions such as ) to flow into the cell.

[0098] From a similar viewpoint, the cells of this disclosure preferably contain a coding sequence for a protein that emits color or light in response to ions (such as calcium ions) that flow into the cell when an olfactory receptor responds. Examples of such proteins include aequorin, Yellow Cameleon (YC), and GCaMP. Alternatively, the cells of this disclosure preferably contain a calcium ion-dependent fluorescent dye (e.g., Fura-2, Fluo-3, Fluo-4).

[0099] From a similar perspective, the cells of the Disclosure contain the olfactory receptor protein of the Disclosure, that is, the olfactory receptor protein of the Disclosure is expressed in the cells of the Disclosure. In this case, since the olfactory receptor protein of the Disclosure has a seven-transmembrane structure, it is positioned on the cell membrane as a membrane protein.

[0100] The non-human animals of this disclosure are not particularly limited in that they include the cells of this disclosure. While there are no particular limitations on the non-human animals, insects are preferred from the viewpoint of suitability for chemical substance detection applications described later. The description of insects is the same as in "2. Olfactory Receptor Proteins" above. Also, from a similar viewpoint, the cells of this disclosure in the non-human animals of this disclosure are preferably olfactory nerve cells.

[0101] 4.Applications The olfactory receptor proteins described herein respond to chemical substances by releasing cations (sodium ions (Na) into the cell). + ), calcium ions (Ca 2+ It has the activity to allow cations (etc.) to flow in. Chemical substances can be detected by detecting these cations, or by detecting behavioral changes based on the activation of olfactory nerve cells induced by the influx of these cations. For this reason, the olfactory receptor protein of this disclosure can be used as a chemical substance detection element.

[0102] In one embodiment, this disclosure relates to a chemical substance detection element (detection element of the disclosure) comprising an olfactory receptor protein of the disclosure, and further to a chemical substance detection sensor (detection sensor of the disclosure) comprising a cell containing the detection element of the disclosure, a lipid bilayer (artificial cell membrane), or a non-human animal containing said cell.

[0103] Chemical detection sensors utilizing cells, lipid bilayers, or non-human animals are already known, and their specific configurations can be adopted from, for example, those described in Patent Documents 1, 2, and 3. A chemical detection sensor comprising cells or lipid bilayers according to this disclosure comprises, for example, a container for holding the cells or lipid bilayers according to this disclosure, a sensor that outputs a signal when it detects a chemical response (e.g., light) in the cells according to this disclosure, and a determination device that detects chemical substances based on the signal. A chemical detection sensor comprising non-human animals according to this disclosure comprises, for example, a detection unit (e.g., motion sensor, vibration sensor, sound sensor, etc.) for detecting the movement of the non-human animals according to this disclosure. [Examples]

[0104] An embodiment of the present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0105] The wild-type olfactory receptor genes used in the following examples are as follows:

[0106] [Table 1]

[0107] Test Example 1. Measurement of the chemical response activity of DmOR47a The response activity of olfactory receptors (wild-type DmOR47a and mutant DmOR47a) to chemical substances was measured.

[0108] Test Example 1-1. Production of Expression Plasmids < Comparative Example 1-1 .Construction of wild-type DmOR47a expression plasmid> Adult RNA from Drosophila melanogaster (TAKARA Corporation) was used as a template, and Super Script III reverse transcriptase (Invitrogen Corporation) was added. The reverse transcription reaction was performed by incubation at 55°C for 50 minutes, followed by 75°C for 15 minutes, to obtain cDNA. Using 1 μL of the obtained cDNA as a template, PCR was performed using 10 μL of forward primer DmOR47a-5' (5'-caccatggacagttttctgcaagtacagaa; SEQ ID NO: 9), 1 μL of 10 μM reverse primer DmOR47a-3' (5'-ttaggagaatgatctcagcattgtgatgta; SEQ ID NO: 10), and 1 μL of KOD Plus neo DNA polymerase (Toyobo Corporation). The PCR reaction was performed at (1) 94°C for 2 minutes, (2) 98°C for 10 seconds, and (3) 68°C for 1.5 minutes, with steps (2) and (3) repeated 35 times. The obtained PCR products were subjected to agarose gel electrophoresis, and approximately 1.2 kb of DNA detected on the gel was recovered. The recovered DNA was introduced into a pENTR / D-TOPO vector (Invitrogen) to obtain a plasmid named pENTR-DmOR47a. 4 μL of pENTR-DmOR47a, 1 μL of pcDNA6.2V5-DEST, and 2 μL of LR clonase II (Invitrogen) were mixed and kept at room temperature for 1 hour. The resulting mixture was introduced into E. coli and cultured to obtain an expression plasmid named pcDNA6.2-DmOR47a. DNA sequencing analysis of the expression plasmid pcDNA6.2-DmOR47a revealed that it contains the sequence shown in SEQ ID NO: 5. The sequence shown in SEQ ID NO: 5 encodes the amino acid sequence shown in SEQ ID NO: 1. Figure 1 shows the correspondence between the amino acid sequence represented by general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 and a portion of the amino acid sequence in SEQ ID NO: 1 that corresponds to this amino acid sequence.

[0109] < Example 1-1 Construction of mutant DmOR47a(RX4S) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 12) of the mutant DmOR47a(RX4S) (amino acid sequence: SEQ ID NO: 11), in which arginine at amino acid residue 372 (X4 in general formula (1)) of the wild-type DmOR47a is mutated to serine, was constructed as follows.

[0110] PCR primers were synthesized (Primer F: CCTTCTCATCGATTGTTAGCACGGCGATGTCCTAC (SEQ ID NO: 13) and Primer R: GTAGGACATCGCCGTGCTAACAATCGATGAGAAGG (SEQ ID NO: 14)) designed to convert arginine, the 372nd amino acid residue (X4 in general formula (1)) of the amino acid sequence of wild-type DmOR47a, to serine. Using these primers, PCR amplification was performed using pcDNA6.2-DmOR47a as a template (reaction procedure and conditions were standard). After amplification, the PCR reaction mixture was digested with DpnI and then transformed into E. coli (DH5α). The transformed E. coli were seeded on a 25 cm square plate (with ampicillin added) and cultured at 37°C to form colonies. Two colonies were selected and cultured again in LB liquid medium. Subsequently, the nucleotide sequences of the plasmids they contained were determined to obtain mutant DmOR47a (RX4S) expression plasmids.

[0111] < Examples 1-2 Construction of mutant DmOR47a (VX3L-RX4S) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 16) of a mutant DmOR47a (VX3L-RX4S) (amino acid sequence: SEQ ID NO: 15), in which valine at amino acid residue 371 (X3 in general formula (1)) of wild-type DmOR47a is mutated to leucine, and arginine at amino acid residue 372 (X4 in general formula (1)) is mutated to serine, was prepared. Specifically, the plasmid was prepared in the same manner as in Example 1-1, except that primer F: CCTTCTCATCGATTCTTAGCACGGCGATGTCC (SEQ ID NO: 17) and primer R: GGACATCGCCGTGCTAAGAATCGATGAGAAGG (SEQ ID NO: 18) were used as PCR primers, and the mutant DmOR47a (RX4S) expression plasmid (Example 1-1) was used as the PCR template.

[0112] < Examples 1-3 Construction of the mutant DmOR47a (VX3L-RX4S+alpha) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 20) of the mutant DmOR47a(VX3L-RX4S+alpha) (amino acid sequence: SEQ ID NO: 19), which has several additional mutations added to the mutant DmOR47a(VX3L-RX4S), was constructed. The mutation sites are shown in Figure 1. Specifically, the mutant DmOR47a(VX3L-RX4S) expression plasmid (Example 1-2) was used as a PCR template, and the mutations were sequentially introduced using each mutation introduction primer set.

[0113] < Reference example 1-1 .Construction of Chimeric Orco Expression Plasmids> In accordance with a previously reported study (Japanese Patent Publication No. 2018-50556), a plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 22) of the fusion protein Dm(NT-TM4)AmORCO (amino acid sequence: SEQ ID NO: 21), which is a combination of a portion of the Drosophila coreceptor and a portion of the honeybee coreceptor, was constructed. In Dm(NT-TM4)AmORCO, the amino acid sequence from the N-terminal region (NT) to the fourth transmembrane domain (TM4) (the amino acid sequence from the N-terminal amino acid residue to the 234th amino acid residue) is derived from the Drosophila coreceptor (Dm(NT-TM4)), and the amino acid sequence from the second intracellular loop to the C-terminal region is derived from the honeybee coreceptor (Am(IC2-CT)).

[0114] Test Example 1-2. Introduction of Expression Plasmid into Cells HEK293FT cells (purchased from Invitrogen) were seeded in 10cm petri dishes at a rate of 3 × 10^6 cells / dish and cultured in DMEM medium (Nacalai Tesque) containing 10% FBS at 37°C under 5% CO2 conditions for approximately 24 hours. 1.5 μg of one of the prepared olfactory receptor expression plasmids, 3.0 μg of an olfactory receptor co-receptor expression plasmid, and 8 μg of a GFP-aequorin (GAP) expression plasmid were mixed with 12.5 μL of Plus reagent and 31.25 μL of lipofectamine LTX (Invitrogen) and held for 10 minutes. This mixture was then transfected into the cells. Four hours after the start of transfection, cells were seeded at 9 × 10^4 cells / well in a 96-well plate and cultured in DMEM medium (Nacalai Tesque) containing 10% FBS at 37°C and 5% CO2 for approximately 24 hours. This yielded transformed cells in which olfactory receptor expression plasmids, olfactory receptor coreceptor expression plasmids, and GAP expression plasmids were transiently introduced.

[0115] Test Example 1-3. Activity Measurement GFP-aequorin (GAP) is activated when it binds to calcium ions and emits green fluorescence in the presence of substrates such as coelenterazine. Therefore, an increase in intracellular calcium ion concentration in cells expressing GAP directly manifests as an increase in fluorescence intensity. Thus, by adding a test substance, it is possible to measure whether the olfactory receptor complex is functioning as an ion channel by observing the change in fluorescence intensity.

[0116] The culture medium of the transformed cells described above was removed and replaced with Assay buffer (Hanks-HEPES (20 mM pH 7.4) containing 0.5 μM coelenterazine h (Promega) and 0.3% BSA), and the cells were left to stand at room temperature for a further 4 hours. Then, using Flexstation 3 (Molecular Devices), the test substance corresponding to the olfactory receptor was added to the cell culture medium, and the fluorescence intensity of the cells was measured.

[0117] In this test example, pentyl acetate, a chemical recognized by DmOR47a, was used as the test substance.

[0118] The results are shown in Figure 1. It was found that the mutant DmOR47a from Examples 1-1 to 1-3 had higher chemical response activity compared to wild-type DmOR47a.

[0119] Test Example 2. Measurement of the chemical response activity of BmOR56 The response activity of olfactory receptors (wild-type BmOR56 and mutant BmOR56) to chemical substances was measured.

[0120] Test Example 2-1. Production of Expression Plasmids < Comparative Example 2-1 .Construction of wild-type BmOR56 expression plasmid> Double-stranded DNA having the base sequence shown in SEQ ID NO: 6 on one of the DNA strands was synthesized. Using 100 ng of this double-stranded DNA as a template, PCR was performed using 1 μL of 10 μM forward primer BmOR56-5'(5'-tggaattctgcagatcaccatgaagctcctggagaagctag; SEQ ID NO: 23), 1 μL of 10 μM reverse primer BmOR56-3'(5'-gccactgtgctggattcatgttttattcatttgcgactgac; SEQ ID NO: 24), and 1 μL of KOD Plus neoDNA polymerase (Toyobo). The PCR reaction was performed at (1) 94°C for 2 minutes, (2) 98°C for 10 seconds, (3) 63°C for 30 seconds, and (4) 68°C for 1.5 minutes, and steps (2) to (4) were repeated for 35 cycles. The obtained PCR product was ligated to pcDNA6.2 (Invitrogen) digested with EcoRV using the In-Fusion HD Cloning Kit (TAKARA). The ligated DNA was introduced into E. coli and cultured to obtain an expression plasmid named pcDNA6.2-BmOR56. DNA sequencing analysis of the expression plasmid pcDNA6.2-BmOR56 revealed that it contains the sequence shown in SEQ ID NO: 6. The sequence shown in SEQ ID NO: 6 encodes the amino acid sequence shown in SEQ ID NO: 2. Figure 2 shows the correspondence between the amino acid sequence represented by the general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 and a portion of the amino acid sequence in SEQ ID NO: 2, which corresponds to this amino acid sequence.

[0121] < Example 2-1 Construction of mutant BmOR56(IX1Q) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 26) of mutant BmOR56(IX1Q) (amino acid sequence: SEQ ID NO: 25), in which isoleucine at amino acid residue 380 (X1 in general formula (1)) of the wild-type BmOR56 amino acid sequence is mutated to glutamine, was constructed as follows.

[0122] PCR primers were synthesized (Primer F: CGGTCGCCACTTTTCAGAGGATCCTCAAAGGAG (SEQ ID NO: 27) and Primer R: CTCCTTTGAGGATCCTCTGAAAAGTGGCGACCG (SEQ ID NO: 28)) designed to convert isoleucine, the 380th amino acid residue (X1 in general formula (1)) in the amino acid sequence of wild-type BmOR56, to glutamine. Using pcDNA6.2-BmOR56 as a template, mutations were introduced by PCR using these primers in the same manner as in the above example to obtain a mutant BmOR56 (IX1Q) expression plasmid.

[0123] < Example 2-2 Construction of mutant BmOR56(RX2A) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 30) of a mutant BmOR56 (RX2A) (amino acid sequence: SEQ ID NO: 29), in which arginine at amino acid residue 381 (X2 in general formula (1)) of the wild-type BmOR56 amino acid sequence is mutated to alanine, was constructed. Specifically, it was constructed in the same manner as in Example 2-1, except that primer F:GTCGCCACTTTTATCGCAATCCTCAAAGGAGCC (SEQ ID NO: 31) and primer R:GGCTCCTTTGAGGATTGCGATAAAAGTGGCGAC (SEQ ID NO: 32) were used as PCR primers.

[0124] < Examples 2-3 Construction of mutant BmOR56(KX4S) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 34) of a mutant BmOR56 (KX4S) (amino acid sequence: SEQ ID NO: 33), in which lysine at amino acid residue 384 (X4 in general formula (1)) of the wild-type BmOR56 amino acid sequence is mutated to serine, was prepared. Specifically, it was prepared in the same manner as in Example 2-1, except that primer F: CACTTTTATCAGGATCCTCAGCGGAGCCTATAGTTACTAC (SEQ ID NO: 35) and primer R: GTAGTAACTATAGGCTCCGCTGAGGATCCTGATAAAAGTG (SEQ ID NO: 36) were used as PCR primers.

[0125] < Examples 2-4 Construction of mutant BmOR56(KX4N) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 38) of mutant BmOR56(KX4N) (amino acid sequence: SEQ ID NO: 37), in which lysine at amino acid residue 384 (X4 in general formula (1)) of the wild-type BmOR56 amino acid sequence is mutated to asparagine, was prepared. Specifically, it was prepared in the same manner as in Example 2-1, except that primer F: CACTTTTATCAGGATCCTCAACGGAGCCTATAGTTACTAC (SEQ ID NO: 39) and primer R: GTAGTAACTATAGGCTCCGTTGAGGATCCTGATAAAAGTG (SEQ ID NO: 40) were used as PCR primers.

[0126] < Examples 2-5 Construction of a mutant BmOR56 (IX1Q-RX2A-KX4S) expression plasmid. A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 42) of a mutant BmOR56 (IX1Q-RX2A-KX4S) (amino acid sequence: SEQ ID NO: 41) was constructed. This mutant BmOR56 had a mutation in the amino acid sequence of wild-type BmOR56, in which isoleucine at amino acid position 380 (X1 in general formula (1)) was mutated to glutamine, arginine at amino acid position 381 (X2 in general formula (1)) was mutated to alanine, and lysine at amino acid position 384 (X4 in general formula (1)) was mutated to serine. Specifically, the plasmid was constructed by sequentially introducing mutations using each mutation introduction primer set, in the same manner as in the above example.

[0127] Test Example 2-2. Introduction of expression plasmid into cells and measurement of activity. The expression plasmid was introduced into cells in the same manner as in Test Example 1-2, and the activity was measured in the same manner as in Test Example 1-3. In this test example, cis-jasmon was used as the test substance.

[0128] The results are shown in Figure 2. It was found that the mutant BmOR56 from Examples 2-1 to 2-5 had higher chemical response activity compared to wild-type BmOR56.

[0129] Test Example 3. Measurement of the chemical response activity of AgOR1 The response activity of olfactory receptors (wild-type AgOR1 and mutant AgOR1) to chemical substances was measured.

[0130] Test Example 3-1. Production of Expression Plasmids < Comparative Example 3-1 .Construction of wild-type AgOR1 expression plasmid> Double-stranded DNA having the base sequence shown in SEQ ID NO: 7 on one of the DNA strands was synthesized. Using 100 ng of this double-stranded DNA as a template, PCR was performed using 1 μL of 10 μM forward primer AgOR1-5'(5'- tggaattctgcagatcaccatgaagctgaacaaactgaac; SEQ ID NO: 43), 1 μL of 10 μM reverse primer AgOR1-3'(5'- gccactgtgctggatttactctgattccatgctctg; SEQ ID NO: 44), and 1 μL of KOD Plus neoDNA polymerase (Toyobo). The PCR reaction was performed at (1) 94°C for 2 minutes, (2) 98°C for 10 seconds, (3) 63°C for 30 seconds, and (4) 68°C for 1.5 minutes, and steps (2) to (4) were repeated 35 times. The obtained PCR product was ligated to pcDNA6.2 (Invitrogen) digested with EcoRV using the In-Fusion HD Cloning Kit (TAKARA). By introducing the ligated DNA into E. coli and culturing it, an expression plasmid named pcDNA6.2-AgOR1 was obtained. DNA sequencing analysis of the expression plasmid pcDNA6.2-AgOR1 revealed that it contains the nucleotide sequence shown in SEQ ID NO: 7. The nucleotide sequence shown in SEQ ID NO: 7 encodes the amino acid sequence shown in SEQ ID NO: 3. Figure 3 shows the correspondence between the amino acid sequence shown by general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 and a portion of the amino acid sequence in SEQ ID NO: 3 that corresponds to this amino acid sequence.

[0131] < Example 3-1 Construction of mutant AgOR1 (MX3L-KX4S) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 46) of a mutant AgOR1 (MX3L-KX4S) (amino acid sequence: SEQ ID NO: 45), in which the amino acid residue at position 401 (X3 in general formula (1)), methionine, is mutated to leucine, and the amino acid residue at position 402 (X4 in general formula (1)), lysine, is mutated to serine, was constructed as follows.

[0132] PCR primers F:CACATTTTTGCAGATTTTGAGCCTATCGTACTCCTATC (SEQ ID NOs: 47 and 49) and R:GATAGGAGTACGATAGGCTCAAAATCTGCAAAAATGTG (SEQ ID NOs: 48 and 50) were synthesized, designed to convert methionine at amino acid residue 401 (X3 in general formula (1)) of wild-type AgOR1 to leucine, and lysine at amino acid residue 402 (X4 in general formula (1)) to serine. Using pcDNA6.2-AgOR1 as a template, mutations were sequentially introduced by PCR using these primers in the same manner as in the above example to obtain mutant AgOR1 (MX3L-KX4S) expression plasmids.

[0133] < Example 3-2 Construction of mutant AgOR1 (MX3L-KX4N) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 52) of a mutant AgOR1 (MX3L-KX4N) (amino acid sequence: SEQ ID NO: 51), in which the amino acid sequence of wild-type AgOR1 is mutated in such a way that methionine at amino acid position 401 (X3 in general formula (1)) is mutated to leucine, and lysine at amino acid position 402 (X4 in general formula (1)) is mutated to asparagine, was constructed. Specifically, PCR primers F:CACATTTTTGCAGATTTTGAACCTATCGTACTCCTATC (SEQ ID NO: 53) and R:GATAGGAGTACGATAGGTTCAAAATCTGCAAAAATGTG (SEQ ID NO: 54) were synthesized and prepared in the same manner as in Example 3-1.

[0134] < Example 3-3 Construction of mutant AgOR1 (MX3L-KX4S+alpha) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 56) of mutant AgOR1(MX3L-KX4S+alpha) (amino acid sequence: SEQ ID NO: 55), which has several additional mutations added to mutant AgOR1(MX3L-KX4S), was constructed. The mutation sites are shown in Figure 3. Specifically, the mutant AgOR1(MX3L-KX4S) expression plasmid (Example 3-1) was used as a PCR template, and the mutations were sequentially introduced using each mutation introduction primer set.

[0135] Test Example 3-2. Introduction of expression plasmid into cells and measurement of activity. The expression plasmid was introduced into cells in the same manner as in Test Example 1-2, and the activity was measured in the same manner as in Test Example 1-3. In this test example, phenol was used as the test substance.

[0136] The results are shown in Figure 3. It was found that the mutant AgOR1 from Examples 3-1 to 3-3 had higher chemical response activity compared to wild-type AgOR1.

[0137] Test Example 4. Measurement of the chemical response activity of AaOR9 The response activity of olfactory receptors (wild-type AaOR9 and mutant AaOR9) to chemical substances was measured.

[0138] Test Example 4-1. Production of Expression Plasmids < Comparative Example 4-1 .Construction of wild-type AaOR9 expression plasmid> Double-stranded DNA having the base sequence shown in SEQ ID NO: 8 on one of the DNA strands was synthesized. Using 100 ng of this double-stranded DNA as a template, PCR was performed using 1 μL of 10 μM forward primer AaOR9-5' (5'- tggaattctgcagatcaccatgtccgtcgagaagatcctggc; SEQ ID NO: 57), 1 μL of 10 μM reverse primer AaOR9-3' (5'- gccactgtgctggatttagctataaacacgtttcaaaagag; SEQ ID NO: 58), and 1 μL of KOD Plus neoDNA polymerase (Toyobo). The PCR reaction was performed at (1) 94°C for 2 minutes, (2) 98°C for 10 seconds, (3) 63°C for 30 seconds, and (4) 68°C for 1.5 minutes, and steps (2) to (4) were repeated 35 times. The obtained PCR product was ligated to pcDNA6.2 (Invitrogen) digested with EcoRV using the In-Fusion HD Cloning Kit (TAKARA). By introducing the ligated DNA into E. coli and culturing it, an expression plasmid named pcDNA6.2-AaOR9 was obtained. DNA sequencing analysis of the expression plasmid pcDNA6.2-AaOR9 revealed that it contains the nucleotide sequence shown in SEQ ID NO: 8. The nucleotide sequence shown in SEQ ID NO: 8 encodes the amino acid sequence shown in SEQ ID NO: 4. Figure 4 shows the correspondence between the amino acid sequence shown by general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 and a portion of the amino acid sequence shown in SEQ ID NO: 4, which corresponds to this amino acid sequence.

[0139] < Example 4-1 Construction of mutant AaOR9(RX6T) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 60) of mutant AaOR9 (RX6T) (amino acid sequence: SEQ ID NO: 59), in which arginine at amino acid residue 374 (X6 in general formula (1)) of wild-type AaOR9 is mutated to threonine, was constructed as follows.

[0140] PCR primers were synthesized (Primer F: CTCATATTTCACTCTTTTGAAAACGGTTTATAGCTAA (SEQ ID NO: 61) and Primer R: TTAGCTATAAACCGTTTTCAAAAGAGTGAAATATGAG (SEQ ID NO: 62)) designed to convert arginine, the 374th amino acid residue (X6 in general formula (1)) of the wild-type AaOR9 amino acid sequence, to threonine. Using pcDNA6.2-AaOR9 as a template, mutations were introduced by PCR using these primers in the same manner as in the above example to obtain a mutant AaOR9 (RX6T) expression plasmid.

[0141] < Example 4-2 Construction of mutant AaOR9 (RX6T+alpha) expression plasmid > A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 64) of mutant AaOR9(RX6T+alpha) (amino acid sequence: SEQ ID NO: 63), which has several additional mutations added to mutant AaOR9(RX6T), was constructed. The mutation sites are shown in Figure 4. Specifically, the mutant AaOR9(RX6T) expression plasmid (Example 4-1) was used as a PCR template, and the mutations were sequentially introduced using each mutation introduction primer set.

[0142] Test Example 4-2. Introduction of expression plasmid into cells and measurement of activity. The expression plasmid was introduced into cells in the same manner as in Test Example 1-2, and the activity was measured in the same manner as in Test Example 1-3. In this test example, skatole was used as the test substance.

[0143] The results are shown in Figure 4. It was found that the mutant AaOR9s of Examples 4-1 to 4-2 had higher chemical response activity compared to wild-type AaOR9.

[0144] Test Example 5. Measurement of the chemical response activity of other insect olfactory receptors. Based on the results of test examples 1-4, (A) Mutate X3 so that it is a branched-chain amino acid and / or X4 is an uncharged polar amino acid. (B) In the wild type, if both X5 and X6 are positively charged polar amino acids, mutate X6 so that it becomes an amino acid other than a positively charged polar amino acid, and (C) In the wild type, if one or both of X1 and X2 are positively charged polar amino acids, mutate X1 so that it becomes an uncharged polar amino acid and / or X2 becomes a hydrophobic amino acid. It was found that at least one selected from the group consisting of [the specified group] can improve the chemical response activity of insect olfactory receptors.

[0145] Furthermore, when we conducted tests comparing the chemical response activity of wild-type and mutant forms of numerous insect olfactory receptors (some examples including AgOR28, AgOR47, AgOR11c, AgOR27a, AaOR5, AaOR31, AaOR72a, AaOR110, etc.) in the same manner as in Test Examples 1-4, we obtained results that support the above rule.

Claims

1. A mutant insect olfactory receptor protein, The general formula (1) in the region from the C-terminus to the 70th amino acid of the corresponding wild-type insect olfactory receptor protein: φ 7 X 1 X 2 Z 1 X 3 X 4 Z 2 Z 3 φ 6 Uφ 5 φ 4 φ 3 φ 2 φ 1 X 5 X 6 [In the formula, X 1 ~X 6 and Z 1 ~Z 3 This shows amino acids derived from the amino acid sequence of wild-type insect olfactory receptors, φ 1 It exhibits hydrophobic amino acids, φ 2 ~φ 7 Each of these independently represents either an uncharged polar amino acid or a hydrophobic amino acid, and U represents an uncharged polar amino acid. It includes an amino acid sequence B which is formed by a mutation of the amino acid sequence A shown, Conditions 1-3 below: (Condition 1) In the above amino acid sequence B, X 3 and / or X 4 D is replaced by X 3 is a branched-chain amino acid and / or X 4 It is an uncharged polar amino acid. (Condition 2) In the above amino acid sequence A, X 5 and X 6 When both are positively charged polar amino acids, in the amino acid sequence B, X 6 (Condition 3) In the amino acid sequence A, X 1 and X 2 If one or both of the amino acids are positively charged polar amino acids, then in the amino acid sequence B, 1 and / or X 2 D is replaced by X 1 is an uncharged polar amino acid and / or X 2 The fact that it is a hydrophobic amino acid Satisfying at least one condition selected from the group consisting of and If condition 1 is met, X 3 isoleucine or leucine and / or X 4 It is serine or asparagine. If condition 2 is met, X 6 The fact that it is serine or threonine, and If condition 3 is met, X 1 is serine or glutamine and / or X 2 It is alanine. Satisfying at least one selected from the group consisting of, The wild-type insect olfactory receptor protein is the wild-type olfactory receptor protein of insects of the superorder Enptera. A mutant insect olfactory receptor protein with higher chemical response activity than the corresponding wild-type insect olfactory receptor protein.

2. The above condition 1 is satisfied, X 3 isoleucine or leucine and / or X 4 The mutant insect olfactory receptor protein according to claim 1, wherein is serine or asparagine.

3. The above condition 2 is satisfied, X 6 A mutant insect olfactory receptor protein according to claim 1 or 2, wherein is an uncharged polar amino acid.

4. The above condition 2 is satisfied, X 6 A mutant insect olfactory receptor protein according to any one of claims 1 to 3, wherein is serine or threonine.

5. The above condition 3 is satisfied, X 1 is serine or glutamine and / or X 2 A mutant insect olfactory receptor protein according to any one of claims 1 to 4, wherein is alanine.

6. Conditions 1A to 3A below: (Condition 1A) In the above amino acid sequence B, X 3 is a branched-chain amino acid and / or X 4 It is an uncharged polar amino acid. (Condition 2A) In the above amino acid sequence B, X 6 The fact that it is an amino acid other than a positively charged polar amino acid, and (Condition 3A) In the above amino acid sequence B, X 1 is an uncharged polar amino acid and / or X 2 The fact that it is a hydrophobic amino acid Selected from the group consisting of, satisfying at least one condition, A mutant insect olfactory receptor protein according to any one of claims 1 to 5.

7. The mutant insect olfactory receptor protein according to any one of claims 1 to 6, wherein the amino acid sequence A is a sequence included in the region from the C-terminal amino acid to the 50th amino acid of the wild-type insect olfactory receptor protein.

8. The mutant insect olfactory receptor protein according to any one of claims 1 to 7, wherein the endoptera insect is a diptera, lepidoptera, or hymenoptera insect.

9. A polynucleotide comprising the coding sequence of a mutant insect olfactory receptor protein according to any one of claims 1 to 8.

10. A cell comprising the polynucleotide described in claim 9.

11. A non-human animal comprising the cells described in claim 10.

12. A chemical substance detection element comprising a mutant insect olfactory receptor protein according to any one of claims 1 to 8.

13. A chemical substance detection sensor comprising a lipid bilayer containing the chemical substance detection element described in claim 12, cells, or a non-human animal containing said cells.

Images