Inhibitors of microorganism-induced amyloid

Compounds formulated for extra-systemic delivery target microbial-induced amyloid aggregates in the gastrointestinal tract to inhibit α-synuclein aggregation, addressing the blood-brain barrier challenge and reducing the progression of neurodegenerative diseases like Parkinson's disease by preventing aggregate spread from the gut to the brain.

JP7836089B2Active Publication Date: 2026-03-26VERTELLO THERAPEUTICS INC
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-01-08
Publication Date
2026-03-26

AI Technical Summary

Technical Problem

Current pharmaceutical approaches to inhibit α-synuclein aggregation in neurodegenerative diseases like Parkinson's disease face challenges due to the need to cross the blood-brain barrier, and there is a need for inhibitors that can deliver therapeutic effects without crossing this barrier.

Method used

Development of compounds formulated for extra-systemic delivery, such as intra-intestinal or intranasal delivery, and controlled release within the lower intestinal tract or colon, to inhibit amyloid formation by targeting microbial-induced amyloid aggregates, which are believed to initiate the aggregation process in the gastrointestinal tract.

Benefits of technology

These compounds effectively interfere with amyloid aggregate formation in the gastrointestinal tract, potentially reducing the progression of neurodegenerative diseases by preventing the spread of aggregates to the brain, thereby alleviating neurological symptoms and gastrointestinal symptoms associated with conditions like Parkinson's disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007836089000589
    Figure 0007836089000589
  • Figure 0007836089000590
    Figure 0007836089000590
  • Figure 0007836089000591
    Figure 0007836089000591
Patent Text Reader

Abstract

The present disclosure provides compounds useful for preventing amyloid formation and treating amyloid-related disorders, including synucleinopathies such as Parkinson's disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - reference to related applications This application claims priority under 35 U.S.C.§119(e) to U.S. Provisional Patent Application No. 62 / 959,385, filed on January 10, 2020, the entire content of which is incorporated herein by reference.

[0002] The present disclosure relates to inhibitors of amyloid formation, particularly inhibitors of microbial - induced amyloid formation, and methods of using such inhibitors to treat or inhibit neurological and other disorders associated with amyloid accumulation. Methods for identifying compositions that inhibit or promote amyloid formation are also provided.

Background Art

[0003] Many neurodegenerative diseases are associated with the abnormal aggregation of proteins in the brain, which leads to cell death and, as a result, many neurological disorders appear. Disease specificity is thought to be the result of (i) the specific protein involved in the aggregation, (ii) the specific region of the brain affected, and (iii) the specific type of nerve cell affected. In the case of the natural human protein α - synuclein, abnormal aggregation of this protein results in any one of more than 50 "α - synucleinopathies", of which Parkinson's disease is the most common and most widely studied. In Parkinson's disease, the aggregation of α - synuclein causes large precipitated aggregates called Lewy bodies to accumulate within specific types of nerve cells, most typically the type of nerve cell that produces the neurotransmitter dopamine. When sufficient aggregates of α - synuclein are present, neuron death occurs and dopamine production decreases. Dopamine is necessary for the proper control of movement, and once dopaminergic neurons die, they do not return. Over time, the dopamine pool irreversibly decreases until the movement symptoms progress and become debilitating.

[0004] The most pathogenic form of α-synuclein remains unclear; for example, it is unknown whether fully intact Lewy bodies or smaller oligomeric α-synuclein fibrils are significantly involved in disease progression and pathogenesis. Traditional pharmaceutical and biotechnological approaches to inhibit α-synuclein aggregation focus on attacking aggregation processes in the neurons and brain regions most associated with disease symptoms. Small molecule, antibody, and vaccine approaches are all being tried and evaluated as interventions for Parkinson's disease and other α-synucleinopathy. Importantly, all of these strategies currently rely on therapeutic entities that can cross the blood-brain barrier to reach target nerve tissue. Crossing the blood-brain barrier remains one of the most significant pharmacokinetic challenges hindering drug development for neurodegenerative diseases. Therefore, there is a need for amyloid formation inhibitors, particularly α-synuclein aggregation inhibitors, that can deliver therapeutic effects without crossing the blood-brain barrier. [Overview of the project]

[0005] In one embodiment, a compound of formula (I) or a pharmaceutically acceptable salt thereof (wherein R 1 , R 2 , R 3 , R 4 , L 1 , L 2 , A 1 , A 2 (where X, Y, and Z are as defined herein) are provided herein: [ka]

[0006] In some embodiments, the compound of formula (I) may have a structure selected from formulas (II), (III), (IV), (V), (VI), (VII), (VIII), (IX), and (X). [ka]

[0007] The compounds disclosed herein may be used in the form of compositions formulated for extra-systemic delivery of the subject. These compositions may, for example, be formulated for intra-intestinal or intranasal delivery, and / or further formulated for controlled release within the lower intestinal tract or colon. In some embodiments, the compositions may be formulated for oral administration, injection (e.g., intravenous, subcutaneous, intramuscular, intraperitoneal, intraspinal, or intracranial), topical delivery, mucosal delivery, or delivery to the central nervous system or systemic circulation. The compositions may include enteric-coated capsules, tablets, soft gels, spray-dried powders, polymer matrices, hydrogels, enteric-coated solids, crystalline solids, amorphous solids, glassy solids, coated microparticles, liquids, spray liquids, aerosols, or microcapsules.

[0008] This disclosure further provides a method for interfering with the formation of amyloid aggregates, comprising contacting amyloid or an amyloid precursor with a compound or composition thereof described herein.

[0009] This disclosure further provides a method for interfering with the formation of amyloid aggregates in a subject, comprising administering a compound or composition thereof described herein to the subject. Optionally, the subject is further selected or identified as one that would benefit from a molecule that interferes with the formation of amyloid aggregates prior to administration of the composition. Such selection or identification may be made by clinical or diagnostic evaluation prior to administration of the composition. Such selected subject may have been diagnosed or evaluated as having Parkinson's disease, Lewy body dementia, incidental Lewy body disease, Lewy body variant of Alzheimer's disease, multiple system atrophy, or pure autonomic dysfunction, or any combination thereof. Optionally, interference with or inhibition of amyloid aggregate formation in the subject is measured or evaluated before, during, or after administration of the composition.

[0010] This disclosure further provides methods for inhibiting, improving, reducing the likelihood of, delaying the onset of, treating or preventing amyloid damage in subjects requiring such treatment, comprising administering the compounds or compositions described herein to the subjects. Optionally, subjects are further selected or identified as those that would benefit from compounds that inhibit or interfere with amyloid aggregate formation prior to administration of the compositions, for example, by detecting the presence or level of bacterial proteins (such as CsgA) or microorganisms producing such bacterial proteins in an intestinal sample of the subject. Such selection or identification may be made by clinical or diagnostic evaluation prior to administration of the compounds or compositions. Such selected subjects may have been diagnosed or evaluated as having Parkinson's disease, Lewy body dementia, incidental Lewy body disease, Lewy body variant of Alzheimer's disease, multiple system atrophy, or pure autonomic dysfunction, or any combination thereof. Optionally, interference with or inhibition of amyloid aggregate formation in the subjects is measured or evaluated before, during, or after administration of the compounds or compositions.

[0011] In some embodiments, the amyloid aggregates may comprise one or more mammalian amyloids or mammalian amyloid precursors, such as proteins, and / or one or more bacterial or fungal proteins (e.g., compositions containing CsgA). In some embodiments, the amyloid proteins may comprise one or more mammalian amyloids or mammalian amyloid precursors, such as proteins, and / or one or more bacterial or fungal proteins (e.g., compositions containing CsgA). In some embodiments, the amyloid aggregates may be present in the gastrointestinal tract, enteric nerve tissue, dural venous sinuses, oral cavity, or nasal cavity (e.g., olfactory bulb). In some embodiments, the amyloid proteins may be present in the gastrointestinal tract, enteric nerve tissue, dural venous sinuses, oral cavity, or nasal cavity (e.g., olfactory bulb).

[0012] In some embodiments, the methods of the present disclosure further include measuring or evaluating changes in the nervous system of a subject, such as neurological symptoms, motor behavior, or other behaviors of a subject, which may include, for example, anosmia, osmotic dysfunction, bradykinesia, ataxia, tremor, muscle rigidity, postural and balance disorders, loss of automatic movement, dysarthria or other speech changes, changes in handwriting, orthostatic hypotension, memory impairment, dysphagia, incontinence, sleep disorders, cardiac arrhythmias, visual impairment, depression and / or psychiatric problems including hallucinations of sight, hearing, smell and / or touch, dizziness, cognitive impairment, changes in dopamine levels, changes in serotonin levels, changes in kynurenine levels, or one or more of any combination thereof.

[0013] In some embodiments, the methods of the present disclosure further include measuring or evaluating changes in the gastrointestinal system, for example, symptoms or characteristics of the gastrointestinal system of a subject, which may include, for example, dysphagia, decreased bowel motility, gastroparesis, constipation (including chronic constipation and chronic idiopathic constipation), small intestinal bacterial overgrowth (SIBO), diarrhea, abdominal pain and / or cramps, bloating, flatulence, nausea or any other symptoms of irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, increased intestinal permeability, leaky gut, intestinal dysbiosis, excessive salivation (sialorrhea), anorectal dysfunction, defecation coordination disorder, or any combination of these. Such hyperpermeability may result from inflammation of the intestinal lining and / or impaired tight junctions between cells of the intestinal epithelium, thereby allowing substances to pass from the lumen into the surrounding tissues, some of which may enter the peritoneal cavity and / or systemic circulation. Due to this leakage of substances from the gastrointestinal tract or intestinal lumen, increased intestinal permeability is sometimes called "leaky gut" or "leaky gut syndrome."

[0014] In some embodiments, the compounds and compositions of the Disclosure may be administered to subjects before or after the onset of neurological symptoms or conditions. In some embodiments, the compositions of the Disclosure may be administered to subjects before or after the onset of gastrointestinal symptoms or conditions associated with amyloid disorder. In some embodiments, subjects are selected as having been identified, for example, by clinical or diagnostic evaluation, as being at risk of or already having Lewy body dementia, associated Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, pure autonomic dysplasia, or any combination thereof. In some embodiments, subjects are under 18 years of age, 18–30 years, 30–50 years, 50–60 years, 60–70 years, or over 70 years of age. In some embodiments, subjects are identified or selected as having been identified as being at risk of or already having Parkinson's disease, for example, by clinical or diagnostic evaluation or analysis of family history.

[0015] In some embodiments, the compounds or compositions described herein can be administered co-administered with caffeine, nicotine, theophylline, theobromine, xanthine, methylxanthine, or derivatives thereof. In some embodiments, the methods disclosed herein further include administering an α-synuclein aggregation inhibitor to the subject. In some embodiments, the methods disclosed herein further include administering to the subject L-DOPA, carbodopa, levodopa, droxidopa, rasagiline, apomorphine hydrochloride, bromocriptine, rotigotine, pramipexole, ropinirole, benzotropin, trihexyphenidyl, selegiline, entacapone, tolcapone, amantadine, pimabanersin, rivastigmine, or any combination thereof. In some embodiments, the methods disclosed herein include administering an α-synuclein aggregation inhibitor to the subject, further including administering L-DOPA, carbodopa, levodopa, droxidopa, rasagiline, apomorphine hydrochloride, bromocriptine, rotigotine, pramipexole, ropinirole, benzotropin, trihexyphenidyl, selegiline, entacapone, tolcapone, amantadine, pimabanersin, rivastigmine, or any combination thereof to the subject. In some embodiments, the α-synuclein aggregation inhibitor and L-DOPA, carbodopa, levodopa, droxidopa, rasagiline, apomorphine hydrochloride, bromocriptine, rotigotine, pramipexole, ropinirole, benzotropin, trihexyphenidyl, selegiline, entacapone, tolcapone, amantadine, pimabanersin, rivastigmine, etc. are administered in the same composition. In some embodiments, the α-synuclein aggregation inhibitor and L-DOPA, carbodopa, levodopa, droxidopa, rasagiline, apomorphine hydrochloride, bromocriptine, rotigotine, pramipexole, ropinirole, benzotropin, trihexyphenidyl, selegiline, entacapone, tolcapone, amantadine, pimabanersin, rivastigmine, etc. are administered in separate compositions. In some embodiments, these separate compositions are administered simultaneously. In some embodiments, these separate compositions are administered at different times.

[0016] In some embodiments, the compounds or compositions described herein are for medical use. In some embodiments, the compositions described herein are for use in the treatment of amyloid disorders described herein (such as amyloid disorders in Table 2). In some embodiments, the amyloid disorder is selected from the group consisting of Parkinson's disease, Lewy body dementia, incidental Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, or pure autonomic dysfunction, or any combination of two or more of these. In some embodiments, the compounds or compositions described herein are for use in the preparation of pharmaceuticals for the treatment of amyloid disorders described herein (such as amyloid disorders in Table 2). In some embodiments, the amyloid disorder is selected from the group consisting of Parkinson's disease, Lewy body dementia, incidental Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, or pure autonomic dysfunction, or any combination of two or more of these. In some embodiments, the composition comprises one or more compounds of the present invention described herein. In some embodiments, the composition is formulated for delivery to the gastrointestinal tract, for example, by oral or rectal delivery, or by using an enteric coating. In some embodiments, the composition is formulated for delivery to the central nervous system, for example, by intraspinal or intracranial delivery, or by being formulated to cross the blood-brain barrier. In some embodiments, the composition is formulated to bypass the blood-brain barrier. Such formulations can be administered, for example, intranasally. Such formulations can also be administered via the olfactory pathway.

[0017] This disclosure provides methods for identifying compounds or compositions that influence the formation of microbially induced amyloid. In some approaches, the method includes contacting multiple concentrations of microbial amyloid or microbial amyloid precursor with multiple concentrations of α-synuclein and / or other mammalian amyloid or mammalian amyloid precursor in the presence of the compounds or compositions described herein; analyzing or measuring the amyloid formation after the reaction; and comparing the analysis or measurement with a control analysis or measurement, the control including analysis or measurement of amyloid formation after the reaction in the absence of the composition. In some methods and compositions disclosed herein, the microbial amyloid or microbial amyloid precursor comprises CsgA. In some embodiments, the method according to this disclosure also includes stirring during contact and / or before measurement.

[0018] In certain embodiments, the contact of multiple concentrations of microbial amyloid or microbial amyloid precursor (e.g., a composition containing CsgA) with multiple concentrations of α-synuclein and / or other mammalian amyloid or mammalian amyloid precursor is carried out in the presence of an amyloid formation indicator. In some further embodiments, the indicator is a fluorescent indicator, a spin-labeled indicator, an enzyme, an antibody, or a colorimetric indicator. In some further embodiments, the indicator is thioflavin T (ThT). If the amyloid formation indicator is an antibody, the method of the present disclosure may have specificity for aggregated α-synuclein and / or other mammalian amyloid or mammalian amyloid precursor and may optionally be conjugated to a fluorescent label, enzyme, colorimetric label, spin label, metal ion binding moiety, electrochemiluminescence label, nucleic acid, polysaccharide, or polypeptide. In some embodiments of the methods of the present disclosure, CsgA and the α-synuclein and / or other such bacterial amyloid precursors and / or mammalian amyloid / mammalian amyloid precursors are each labeled separately.

[0019] In some embodiments of the methods of this disclosure, contacting multiple concentrations of microbial amyloid or microbial amyloid precursor (e.g., a composition containing CsgA) with multiple concentrations of α-synuclein and / or other mammalian amyloid or mammalian amyloid precursor in the presence of the compounds or compositions described herein, analyzing or measuring the amyloid formation after the above reaction, and comparing the above analysis or measurement with a control analysis or measurement further includes identifying or selecting compounds or compositions that alter or regulate amyloid formation, or are suspected of altering or regulating it. In some embodiments, the methods described herein further include identifying or selecting compounds or compositions that reduce or enhance amyloid formation. In some embodiments, the methods described herein further include identifying or selecting compounds or compositions that reduce or enhance amyloid formation and do not cross the blood-brain barrier. The compounds or compositions identified by these methods can be administered to subjects identified or selected as a population that would benefit from the administration of compounds that alter amyloid formation (e.g., compounds that reduce amyloid formation without crossing the blood-brain barrier). Such selected subjects may have been diagnosed or evaluated as having Parkinson's disease, Lewy body dementia, incidental Lewy body disease, Lewy body variant of Alzheimer's disease, multiple system atrophy, or pure autonomic dysfunction, or any combination thereof.

[0020] The method according to the present disclosure further contemplates a method of producing microbially induced amyloid, which includes contacting a plurality of concentrations of a microbial amyloid or microbial amyloid precursor with a plurality of concentrations of α-synuclein and / or other mammalian amyloid or mammalian amyloid precursor, in the presence or absence of the compounds or compositions described herein, producing microbially induced amyloid, and analyzing or quantifying the microbially induced amyloid. In some further embodiments, the microbial amyloid or microbial amyloid precursor includes CsgA. In some further embodiments, the method according to the present disclosure further includes agitation during the contacting or prior to measurement. In some further embodiments, the method is performed in the presence of an indicator of amyloid formation. In some further embodiments, the indicator of amyloid formation may include a fluorescent indicator, a spin-labeled indicator, or a colorimetric indicator. In some embodiments, the indicator is thioflavin T (ThT). In some embodiments, CsgA and α-synuclein, or other such bacterial amyloid / bacterial amyloid precursor and mammalian amyloid / mammalian amyloid precursor are each separately labeled. In some embodiments, the amyloid formation is analyzed or measured by internal fluorescence, fluorescence of a dye or label, fluorescence resonance energy transfer, fluorescence polarization, fluorescence polarization transfer, UV / Vis spectroscopy, magnetic resonance, Raman scattering, electron paramagnetic spin resonance, light microscopy, electron microscopy, scanning tunneling microscopy, or atomic force microscopy.

[0021] In some embodiments of the methods of the present disclosure, the composition present during contact between multiple concentrations of microbial amyloid or microbial amyloid precursor (e.g., a composition containing CsgA) and multiple concentrations of α-synuclein and / or other mammalian amyloid or mammalian amyloid precursor comprises a mixture of compounds. The composition may comprise tissues, body fluids, or extracts thereof. In some embodiments, the composition comprises feces, urine, blood, cerebrospinal fluid, or saliva, or components thereof. In some embodiments, the composition comprises extracts from natural products. In some further embodiments, the natural product is a herb, plant matter, or food. In some embodiments, the natural product is a fungal tissue, legume, seed, berry, leaf, fruit, flower, plant root, plant stem, or plant bark. In some embodiments, the composition may comprise one or more bacteria, bacterial extracts, lysates, conditioned culture media, lyophilized bacteria, lyophilized lysates, lyophilized culture media, or any combination thereof. In some embodiments, the composition may comprise one or more microorganisms, microbial extracts, lysates, conditioned culture media, lyophilized microorganisms, lyophilized lysates, lyophilized culture media, or any combination thereof. In some embodiments, the above methods further comprise identifying or selecting compositions that increase or decrease amyloid formation, preferably compounds that do not cross the blood-brain barrier. Compounds identified by these methods can be administered to subjects identified or selected as a population that would benefit from the administration of compounds that alter amyloid formation (e.g., compounds that reduce amyloid formation without crossing the blood-brain barrier). Such selected subjects may be diagnosed or evaluated as having Parkinson's disease, Lewy body dementia, incidental Lewy body disease, Lewy body variant of Alzheimer's disease, multiple system atrophy, or pure autonomic dysfunction, or any combination thereof.

[0022] In some embodiments, amyloid formation inhibitors may be intended for systemic or topical administration to the intestines or central nervous system.

[0023] The Disclosure also envisions a kit comprising, in one or more containers within the kit, microbial amyloid or microbial amyloid precursor and α-synuclein and / or other mammalian amyloid or mammalian amyloid precursor, thereby enabling the implementation of the method of the Disclosure. In some embodiments, the microbial amyloid or microbial amyloid precursor comprises CsgA.

[0024] This disclosure provides a method for inhibiting amyloid formation in a subject requiring such inhibition, comprising administering a compound described herein or a pharmaceutically acceptable salt thereof or a pharmaceutically acceptable composition thereof to the subject.

[0025] This disclosure provides a method for preventing or treating amyloid formation-related disorders in subjects requiring such treatment, comprising administering a compound described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable composition thereof, to a subject.

[0026] This disclosure provides a method for preventing or treating amyloid disorders in subjects requiring such treatment, comprising administering a compound described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable composition thereof, to a subject.

[0027] In the methods of this disclosure, the amyloid disorder or disorder related to amyloid formation may be a neurological disorder. The disorder may be Parkinson's disease (PD), Lewy body dementia, multiple system atrophy, multiple sclerosis (MS), frontotemporal dementia (FTD), REM sleep behavior disorder (RBD), alpha-synucleinopathy, PD-related constipation, PD-related hypotension, Huntington's disease, Alexander disease, amyotrophic lateral sclerosis (ALS), or Alzheimer's disease. The disorder may be intestinal dysbiosis, increased intestinal permeability, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, or Crohn's disease.

[0028] The patients may be experiencing gastrointestinal symptoms including one or more of the following: dysphagia, decreased bowel motility, gastroparesis, constipation (including chronic and chronic idiopathic constipation), small intestinal bacterial overgrowth (SIBO), diarrhea, abdominal pain and / or cramps, bloating, flatulence, excessive salivation, anorectal dysfunction, defecation dyscoordination, and nausea. These gastrointestinal symptoms may be associated with alpha-synucleinopathy, Parkinson's disease, or parkinsonism.

[0029] In certain embodiments, amyloid disorders can be diagnosed by detecting the presence or level of enterobacterial amyloid aggregates. In some embodiments, amyloid disorders can be diagnosed by detecting the presence or level of enterobacterial amyloid proteins. In certain embodiments, the aggregates may include bacterial CsgA proteins. In some embodiments, the proteins may include bacterial CsgA proteins. In certain embodiments, the disorders can be diagnosed by detecting the presence or level of enterobacterial genes and gene transcripts.

[0030] The methods of the present disclosure may further include detecting the presence or level of a bacterial protein, such as CsgA, or a microorganism that produces the bacterial protein, in a target intestinal sample. In certain embodiments, the subject is selected as requiring the above-mentioned prevention or treatment if the presence of the bacterial protein, the transcript mRNA of the bacterial protein, or the microorganism that produces the bacterial protein is detected in the intestinal sample, or if the level of the bacterial protein or the microorganism that produces the bacterial protein in the intestinal sample is greater than a predetermined level or a control.

[0031] The methods of the present disclosure may further include confirming a decrease in or absence of intestinal amyloid aggregates after administration of a compound of the composition, or identifying a subject as exhibiting gastrointestinal symptoms. The methods of the present disclosure may further include confirming a decrease in or absence of intestinal amyloid protein after administration, or identifying a subject as exhibiting gastrointestinal symptoms.

[0032] In some embodiments, the method of the present disclosure further includes measuring or evaluating the level of enteric-coated amyloid and / or amyloid aggregation during the administration process. In some embodiments, the method of the present disclosure further includes measuring or evaluating the level of enteric-coated amyloid and / or amyloid protein during the administration process.

[0033] The method disclosed herein is a method for treating or inhibiting an amyloid disorder in a test subject (e.g., a neurological disorder such as Parkinson's disease, Lewy body dementia, accidental Lewy body disease, Lewy body variant of Alzheimer's disease, multiple system atrophy, or pure autonomic dysregulation, or any combination thereof), comprising contacting multiple concentrations of microbial amyloid or microbial amyloid precursor with multiple concentrations of α-synuclein and / or other mammalian amyloid or mammalian amyloid precursor that may be obtained from a biological sample obtained from the test subject, in the presence or absence of the compound or composition described herein, analyzing or measuring amyloid formation, and comparing the analysis or measurement with the analysis or measurement of a control, wherein the control is an analysis or measurement of amyloid formation in the absence of the composition, or a standard, e.g., a healthy subject or amyloid- The present invention provides methods that may include comparing the amount, rate, or formation of amyloid obtained from a subject having cis (e.g., a subject suffering from Parkinson's disease, Lewy body dementia, associated Lewy body disease, Lewy body variant of Alzheimer's disease, multiple system atrophy, or pure autonomic dysplasia, or any combination thereof) with an analysis or measurement of a control; and administering to the subject an effective amount of the pharmaceutical composition suitable for inhibiting or treating the amyloid disorder if the amyloid formation in the presence of the composition is increased compared to the amyloid formation in the absence of the composition, or if the amount, rate, or formation of amyloid in a sample from the subject is the same as or greater than the amount, rate, or formation of amyloid obtained from, for example, a healthy control or a control subject having amyloidosis. In some further embodiments of these methods, the microbial amyloid or microbial amyloid precursor contains CsgA, consists essentially of CsgA, or consists of CsgA.

[0034] In some embodiments, the methods described herein may further include identifying or selecting subjects as those who would benefit from the treatment or inhibition of amyloid disorders, and may further include identifying or selecting subjects as those who are at risk of or exhibit symptoms of one or more of the following: Parkinson's disease, Lewy body dementia, accidental Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, pure autonomic dysregulation, or any combination thereof. [Brief explanation of the drawing]

[0035] [Figure 1A] This graph shows crystal violet staining, evaluated by optical density (OD) data, of biofilm growth by wild-type Escherichia coli after 4 days of static culture using the indicated concentrations of epigallocatechin gallate (EGCG). [Figure 1B] This graph shows in vitro α-syn aggregation, measured by thioflavin T fluorescence, while α-syn amyloid is formed either alone or in the presence of CsgA (25:1 molar ratio) when treated with EGCG (50 μM) and when not treated. [Figure 2A-G]These are a series of graphs and images showing that monocolony formation by curli-sufficient bacteria induces increased α-syn-dependent pathology and inflammatory responses in the brain. Sterile (GF) wild-type (WT) or Thy1-α-syn (ASO) animals were monocolonized with either wild-type, curli-sufficient E. coli (WT), or curli-deficient E. coli (ΔcsgBAC). Figure 2A is a graph showing total α-syn in whole brain lysates quantified by ELISA. Figure 2B is a graph showing quantification of insoluble α-syn fibrils in the striatum by dot blot assay. Figures 2C-2D show quantification of TNFα (Figure 2C) and IL-6 (Figure 2D) from the striatum by ELISA. Figures 2E-2G show staining results of thin sections of brain from ASO mice. Sections were stained for Iba1 (microglia), 3D cell reconstructs were generated, and the morphological characteristics of microglia present in the striatum were quantified. n=3 (Figures 2A-2B), n=6-7 (Figures 2C, 2D), n=4 (Figures 2E-2G) (diameter averaged from 20-40 cells, or branching averaged from 5-7 cells). Points represent individuals, and bars represent the mean and standard error. Figures 2A-2D show data analyzed by one-way ANOVA with Tukey's post-hoc test, while Figures 2E and 2F show data analyzed by one-way ANOVA with a two-tailed t-test. *p≦0.05, **p≦0.01, ***p≦0.001, ****p≦0.0001. [Figure 2H-J] This is a series of graphs showing csgA levels in human fecal samples (Figure 2H), wild-type mice colonized with microorganisms from individuals with PD or matching controls (Figure 2I), or Thy1-αSyn(ASO) mice colonized with microorganisms from individuals with PD or matching controls (Figure 2J). Consistent with these data, csgA is predicted to be abundant in microorganisms derived from individuals with PD. [Figure 3A-I]This is a series of graphs showing that intestinal curli promotes progressive synuclein-dependent pathophysiology. Thy1-αSyn(ASO) animals, reared using conventional methods, were intraintestinally injected with 30 μg of synthetic CsgA hexamer (CsgA; N-QYGGNN-C) or non-amyloidogenic peptide (N122A; N-QYGGNA-C). Figures 3A-3G show motor and GI function measured sequentially at 0, 7, 21, and 70 days post-injection in beam crossing (Figure 3A), pole descent (Figure 3B), adhesive removal (Figure 3C), hindlimb clasping score (Figure 3D), wire hang (Figure 3E), and fecal excretion evaluation (day 70) (Figure 3F). Figure 3G is a graph showing the principal component analysis of the edited motor scores from Figures 3A-3F. Figures 3H to 3I show the quantification of insoluble α-synfibrils in the striatum (Figure 3H) and ventral midbrain (Figure 3I) by dot blot assay. n=8 (Figures 3A to 3G), n=4 (Figure 3H). Dots represent individuals, and bars represent the mean and standard error. Square brackets above each time point indicate the time course and significance between treatments, analyzed by two-way ANOVA with Sidak post-hoc test for group comparisons. Data analyzed by two-sided Mann-Whitney test (Figure 3H). In Figures 3A to 3I, *p≦0.05, **p≦0.01, ***p≦0.001, ****p≦0.0001. [Figure 4A-B] The data from an in vivo experiment using the procedure of Example 27A shows a decrease in csgA expression in mice monocolonized with E. coli MC4100 on day 5, when treated with 30 mg / kg of compound 070(A) or 30 mg / kg of compound 016(B), compared to mice treated with the vehicle alone. [Figure 5] This graph shows the number of fecal pellets excreted at 15-minute intervals by mice aged 12 to 14 weeks. Figure 5 demonstrates an overall increase in the number of fecal pellets when mice were treated with compound 004a compared to the MC4100 control solid feed group (a qualitative trend was observed, but it did not reach a statistically significant difference). The dots represent individual animals, and the bars represent the mean and standard error. The data was analyzed by one-way ANOVA using Dunnett's multiple comparison test. [Figure 6]This graph shows fecal water content measured when animals were 12–14 weeks old. Figure 6 demonstrates a significant decrease in water content % in the MC4100 control solid feed group, suggesting a disease phenotype. Treatment with compound 004a resolved the constipation phenotype induced by the curli operon. Points represent individual animals, and bars represent the mean and standard error. Data analyzed by one-way ANOVA with Dunnett's post-hoc test for between-group comparisons shown above each treatment group, and square brackets indicating significance between treatments, *p≦0.05, **p≦0.01. [Figure 7] This graph shows the time taken to descend from the pole to the home cage at 18-20 weeks of age. Figure 7 demonstrates that the descent time was increased in the MC-4100 control solid feed group (p=0.0741) compared to the KO CsgA group, which suggested a disease-related motor phenotype. Treatment with compound 004a showed a tendency toward phenotypic improvement. Points represent individual animals, and bars represent the mean and standard error. Data were analyzed by one-way ANOVA with Dunnett's post-hoc test. [Figure 8A-D] Figure 8D shows a series of graphs illustrating the reduction in csgA expression in mice monocolonized with E. coli MC4100, induced by early treatment with compound 004a at 12–14 weeks of age. This effect was repeated and observed again at 14–16 weeks of age. Figure 8A shows csgA expression relative to the expression of the housekeeping gene recA at 12–14 weeks of age. Figure 8B shows csgA expression relative to the expression of the housekeeping gene cysG at 12–14 weeks of age. Figure 8C shows csgA expression relative to the expression of the housekeeping gene recA at 14–16 weeks of age. Figure 8D shows csgA expression relative to the expression of the housekeeping gene cysG at 14–16 weeks of age. Dots represent individual animals, and bars represent the mean and standard error. Data analyzed by one-way ANOVA with Dunnett's post-hoc test for between-group comparisons shown above each treatment group, and square brackets indicating significance between treatments, *p≦0.05;**p≦0.01. [Modes for carrying out the invention]

[0036] The majority of neurodegenerative diseases are idiopathic, which has traditionally made it difficult to identify the etiology of most such diseases. A newly emerging theory suggests that many neurodegenerative diseases begin in the periphery rather than the brain or central nervous system (CNS), and gradually progress to the brain over many years. Nevertheless, the molecular etiology in the periphery has remained the focus of study. In the case of Parkinson's disease, it is known that many patients often experience constipation and olfactory dysfunction decades before the onset of the parakinetic symptoms that now define Parkinson's disease. Therefore, not limited to theory, it is thought that α-synuclein aggregation begins in the gastrointestinal (GI) tract and olfactory bulb, and that the aggregated α-synuclein gradually progresses to the brain through a prion-like proliferation process. In this scenario, more generally known as Braak's hypothesis, analyzing the molecular mechanisms involved in these peripheral tissues could lead to unconventional and unintuitive approaches to preventing and / or treating amyloid disorders such as α-synucleinopathy, including Parkinson's disease.

[0037] While not limited by theory, one molecular mechanism considered herein involves bacterial amyloid as a dissemination factor, which either forms nuclei or otherwise leads to α-synuclein aggregation, thereby initiating a pathological process that ultimately results in Lewy body deposition and the clinical manifestations of Parkinson's disease and other α-synucleinopathy. Bacterial amyloid is an aggregated form of secreted bacterial proteins and is thought to play a role in both bacterial adhesion to host cells and biofilm formation. Under the right conditions and in the presence of easily aggregated host proteins, bacterial amyloid itself is thought to act as a direct structural template for host protein aggregation in a prion-like manner, although this is not limited by theory. Bacterial chaperone mechanisms involved in driving bacterial amyloid aggregation can also use host proteins as substrates, thereby promoting the aggregation of host proteins into amyloid structures. Once aggregated, the host protein aggregation persists in a prion-like manner through the enteric nervous system over many years. Ultimately, these aggregates spread to brain tissue, resulting in the typical clinical manifestations of Parkinson's disease. This effect may also lead to the development of other amyloid-driven diseases, such as Alzheimer's disease, which involve the aggregation of host proteins A-beta and / or tau. Consistent with this, analysis of currently published human microbiome datasets has revealed increased expression of the E. coli-derived curli-associated csgA gene in Parkinson's disease patients, and transplantation of fecal microbiota from PD patients into germ-free (GF) wild-type or ASO mice results in greater csgA abundances compared to the microbiome of healthy controls, based on PICRUSt attribution analysis of 16s rRNA sequences (see, for example, International Publication 2019 / 028456, the entire publication of which is incorporated herein by reference, and the references cited therein). Intestinal amyloid aggregates may cause symptoms associated with Parkinson's disease and other amyloid disorders, and treating these animals with compounds that inhibit and / or interfere with amyloid aggregates may improve these symptoms associated with Parkinson's disease and other amyloid disorders.

[0038] This disclosure relates to compounds, compositions, and methods for treating, improving, or preventing amyloid disorders. The compounds disclosed herein alter the ability of bacterial amyloid to promote the aggregation of the eukaryotic protein α-synuclein and amyloid formation. Such alterations may include changes in the degree, rate of formation, stability, and / or rate of degradation of microorganism-induced amyloid, or any combination thereof. Compounds, compositions, and methods useful for treating or inhibiting neurodegenerative diseases, and compounds, compositions, and methods useful for preventing or improving the progression of neurodegenerative diseases are further disclosed herein. Compounds, compositions, and methods useful for treating or inhibiting gastrointestinal dysfunction associated with neurodegenerative diseases are further disclosed herein. Methods for studying the molecular pathogenesis of mammalian amyloid diseases and the molecular relationship between bacterial amyloid production and mammalian amyloid production are further disclosed herein. In some embodiments, the compositions contain, essentially consist of, or comprise the compounds described herein. This disclosure further relates to methods for facilitating the evaluation of aggregation and deaggregation of both host and bacterial amyloid proteins. The method described herein is also useful for identifying drug candidates that affect these processes.

[0039] In some embodiments, compounds, essentially comprising, or comprising, the compounds described herein are useful for preventing α-synuclein aggregation, the seeding of α-synuclein aggregation by CsgA or other microbial amyloids, or the formation of microbial amyloids that can seed α-synuclein aggregation in vivo, or such compounds and compositions are intended to be useful for preventing or treating Parkinson's disease and / or other α-synucleinopathy (see, for example, Example 26 and Tables 3 and 4).

[0040] In some embodiments, compositions comprising, essentially consisting of, or containing the compounds described herein may be useful in preventing α-synuclein aggregation with or without microbial amyloid dissemination, and thereby may be useful in preventing or treating α-synucleinopathy unrelated to microbial amyloid (see, for example, Example 26 and Tables 3 and 4).

[0041] In some embodiments, compositions containing, essentially comprising, or comprising compounds as described herein may be useful in preventing α-synuclein aggregation seeded by microbial amyloid, thereby potentially having therapeutic benefits when administered to sites that may be rich in microbial amyloid (e.g., the gastrointestinal tract).

[0042] In some embodiments, compositions comprising, essentially consisting of, or containing the compounds described herein are intended to have therapeutic benefits in Parkinson's disease and other α-synucleinopathy. While not limited by theory, this benefit may be due to the inhibition of α-synuclein and / or microbial amyloid aggregation by these compounds. For compounds inhibiting two or more types of aggregation, these inhibitory effects may be additive or synergistic (see, for example, Example 26 and Table 2).

[0043] Accordingly, compounds useful for inhibiting, improving, reducing the likelihood of, delaying the onset of, treating and / or preventing amyloid disorders, such as any of the amyloid disorders listed in Table 2 (below), e.g., alpha-synucleinopathy, Parkinson's disease, Lewy body dementia, accidental Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, pure autonomic dysregulation, or any combination of two or more of the listed items, are provided herein.

[0044] The compound of the present invention In one aspect, a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein: [Chemical formula] wherein, A 1 is -C(R 7 )(R 8 ) or -CO-, or when X is -SO2-, CO or -C(R 9 )(R 10 ), A 1 is -N(R 7 )-, A 2 is absent or -C(R 5 )(R 6 ), L 1 is a bond, (-CH2-) m , -CF2-, -(C=O)- or -C(R 9 )(R 10 )-, L 2 is a bond, (-CH2-) m , -CF2-, -(C=O)- or -C(R 9 )(R 10 )-, X is -N(R 11 )-, -N(R 14 )-, -O-, -CO-, -S-, -S(=O)-, -SO2-, -CF2-, -C(R 9 )(R 10 )-, Y is O or S, Z is =C(R 13 )-, =N-, or -N(R 11 )-, R 1 is substituted or unsubstituted phenyl, substituted or unsubstituted heterocyclyl, R 2 is substituted or unsubstituted naphthyl, substituted or unsubstituted phenyl, substituted or unsubstituted quinolinyl, substituted or unsubstituted isoquinolinyl, or substituted or unsubstituted heterocyclyl, R 3and R 4 To the extent that valence allows, they either do not exist independently, or they are -H, substituted or unsubstituted C1-C 10 Alkyl, acyl, -CO2R 7 , -CON(R 7 )(R 8 ), -P=O(OH)2 or -SO2(OH) are selected, R 5 and R 6 As far as valence allows, they do not exist independently, or -H and C1~C 10 Selected from alkyl groups, or combined to form a spirocarbon ring or a spiro(hetero)carbon ring, R 7 and R 8 To the extent that valence allows, they either do not exist independently, or they are -H, substituted or unsubstituted C1-C 10 Alkyl, -(CH2) m -Aryl, -(CH2) m -heteroaryl, -(CH2) m -Substituted or unsubstituted cycloalkyl, -R 14 Selected from, or combined to form a spiropentanyl ring, R 9 and R 10 These are independent of each other, and at each occurrence, they are -H, -Cl, -Br, -F, -CF3, C1~C 10 It is alkyl, R 11 and R 12 These are independent of each other, and at each occurrence, they are -H, acyl, sulfonyl, substituted or unsubstituted C1-C 10 Alkyl, C3-C6 cycloalkyl, C 3~6 Heterocyclyl, substituted or unsubstituted benzyl, -(CH2) o -(substituted or unsubstituted aryl) or -(CH2) o -(substituted or unsubstituted heteroaryl) R 13 -H, -OH, -OR 11 -Cl, -Br, -F, -CN, -CF3, -CH2F, -CHF2, substituted or unsubstituted C1~C 10 Alkyl, C1-C 10Alkenyl, C3-C6 cycloalkyl, substituted or unsubstituted C3-C6 heterocycloalkyl, acyl, -CO2R 7 , -(CH2) m CO2N(R 11 )(R 12 ), -CON(R 7 )(R 8 ), -(CH2) m OH, -(CH2) m CO2H, -(CH2) m NH2, -(CH2) m N(R 11 )(R 12 ), -N(R 11 )(R 12 ), -NR 11 (C=O)(CH2) m CH3, -NR 11 (C=O)R 12 and NR 12 (SO2)(CH2) m CH3 selected from, R 14 is, -H, C1-C 10 alkyl, C1-C 10 alkenyl, C1-C 10 (mono- or poly)hydroxylated alkyl, -(CH2) o -R 15 , -(CH2CH2O) o -R 15 , -(CH2) m -CO2H, -(CH2) m -NH2, -(CH2) m -(CO)NR 16 R 17 , or a protecting group, R 15 is, -CON(R 11 )(R 12) , -N(R 11 )(R 12 ), acyl, -CO2R 7 , substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, R 16 and R 17 are independently, -H or -CH3, m is independently between 0 and 10 at each occurrence. n is independently 1 to 5 at each occurrence. o is independent and ranges from 1 to 20 at each occurrence. [ka] This represents a single bond or a double bond. However, the compound of formula (I) is [ka] isn't it.

[0045] In some embodiments, the compound of formula (I) is formula (Ia) or a pharmaceutically acceptable salt thereof: [ka] During the ceremony, A 1 -C(R 7 )(R 8 ) or -CO-, or X is -SO2-, CO or -C(R 9 )(R 10 ) If A 1 is -N(R 14 )- and, A 2 It does not exist, or -C(R 5 )(R 6 ) and L 1 This is a bond, (-CH2-) m -CF2-, -(C=O)-, or -C(R 9 )(R 10 )- and, L 2 This is a bond, (-CH2-) m -CF2-, -(C=O)-, or -C(R 9 )(R 10 )- and, X is -N(R11 )-, -O-, -CO-, -S-, -S(=O)-, -SO2-, -CF2-, -C(R 9 )(R 10 )- and, Y is either O or S, Z is =C(R 13 )-, =N-, or -N(R 11 )- and, R 1 These are substituted or unsubstituted phenyl, substituted or unsubstituted heterocyclyl, R 2 These are substituted or unsubstituted naphthyl or substituted or unsubstituted heterocyclyl, R 3 and R 4 To the extent that valence allows, they either do not exist independently, or they are -H, substituted or unsubstituted C1-C 10 Alkyl, acyl, -CO2R 7 , -CON(R 7 )(R 8 ), -P=O(OH)2 or -SO2(OH) are selected, R 5 and R 6 As far as valence allows, they do not exist independently, or -H and C1~C 10 Selected from alkyl groups, or combined to form a spirocarbon ring or a spiro(hetero)carbon ring, R 7 and R 8 To the extent that valence allows, they either do not exist independently, or they are -H, substituted or unsubstituted C1-C 10 Alkyl, -(CH2) m -Aryl, -(CH2) m -heteroaryl, -(CH2) m -Substituted or unsubstituted cycloalkyl, -R 14 Selected from, or combined to form a spiropentanyl ring, R 9 and R 10 These are independent of each other, and at each occurrence, they are -H, -Cl, -Br, -F, -CF3, C1~C 10 It is alkyl, R 11 and R12 These are independent of each other, and at each occurrence, they are -H, acyl, sulfonyl, substituted or unsubstituted C1-C 10 Alkyl, C3-C6 cycloalkyl, substituted or unsubstituted benzyl, -(CH2) o -(substituted or unsubstituted aryl) or -(CH2) o -(substituted or unsubstituted heteroaryl) R 13 -H, -OH, -OR 11 -Cl, -Br, -F, -CN, -CF3, -CH2F, -CHF2, substituted or unsubstituted C1~C 10 Alkyl, C1-C 10 Alkenyl, C3-C6 cycloalkyl, substituted or unsubstituted C3-C6 heterocycloalkyl, acyl, -CO2R 7 ,-(CH2) m CO2N(R 11 )(R 12 ), -CON(R 7 )(R 8 ), -(CH2) m OH, -(CH2) m CO2H, -(CH2) m NH2, -(CH2) m N(R 11 )(R 12 ), -N(R 11 )(R 12 ), -NR 11 (C=O)(CH2) m CH3, -NR 11 (C=O)R 12 and NR 12 (SO2)(CH2) m Selected from CH3, R 14 -H, C1~C 10 Alkyl, C1-C 10 Alkenyl, C1~C 10 (Mono or poly)hydroxylated alkyl, -(CH2) o -R 15 ,-(CH2CH2O) o -R 15 ,-(CH2) m -CO2H, -(CH2) m -NH2, -(CH2)m -(CO)NR 16 R 17 , or a protecting group, R 15 -CON(R 11 )(R 12) , -N(R 11 )(R 12 ), acyl, -CO2R 7 , substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, R 16 and R 17 These are independently -H or -CH3, m is independently between 0 and 10 at each occurrence. n is independently 1 to 5 at each occurrence. o is independent and ranges from 1 to 20 at each occurrence. [ka] This represents a single bond or a double bond. However, the compound of formula (Ia) is, or [ka] isn't it.

[0046] In some embodiments, X is -SO2-. In some embodiments, X is -NR 14 -. In some embodiments, X is -S-.

[0047] In some embodiments, A 1 -C(R 7 )(R 8 ) is. In some embodiments, A 1 is -CO-. In some embodiments, A 1 X is -SO2-, CO or -C(R) 9 )(R 10 If ) then -N(R7 )- or -N(R 14 )-. In a particular embodiment, A 1 is -N(R 7 )- or -N(R 14 )- and X is -SO2-. In a particular embodiment, A 1 is -N(R 7 )- and X is -SO2-. In a particular embodiment, A 1 is -N(R 14 )- and X is -SO2-.

[0048] In some embodiments, A 2 It does not exist. In some embodiments, A 2 -C(R 5 )(R 6 )-is.

[0049] In some embodiments, L 1 is, -(CH2)- m In some embodiments, L 1 is -(CH2)-. In some embodiments, L 1 is -CF2-. In some embodiments, L 1 In some embodiments, L 1 -C(R 9 )(R 10 )-. In some embodiments, L 1 It is a combination.

[0050] In some embodiments, L 2 is, -(CH2)- m In some embodiments, L 2 is -(CH2)-. In some embodiments, L 2 is -CF2-. In some embodiments, L 2 In some embodiments, L 2 -C(R 9 )(R 10 )-. In some embodiments, L 2 It is a combination.

[0051] In some embodiments, X is -N(R 11 )-. In some embodiments, X is -O-. In some embodiments, X is -CO-. In some embodiments, X is -S-. In some embodiments, X is -S(=O)-. In some embodiments, X is -SO2-. In some embodiments, X is -CF2-. In some embodiments, X is C(R 9 )(R 10 )-. In some embodiments, X is -N(R 14 )-is.

[0052] In some embodiments, Y is O. In some embodiments, Y is S.

[0053] In some embodiments, Z is =C(R 13 )-. In some embodiments, Z is =N- or -N(R 11 )-. In some embodiments, Z is -N(R 11 )-is.

[0054] In some embodiments, R 1 R is an unsubstituted phenyl compound. In some embodiments, R 1 is a substituted phenyl. In some specific embodiments, R 1 R is trifluoromethylphenyl. In some embodiments, R 1 is an unsubstituted heterocyclyl. In some embodiments, R 1 It is a substituted heterocyclyl.

[0055] In some embodiments, R 2 R is an unsubstituted naphthyl (e.g., 1-naphthyl or 2-naphthyl). In some embodiments, R 2 R is a substituted naphthyl (e.g., 1-naphthyl or 2-naphthyl). In some embodiments, R 2 is an unsubstituted heterocyclyl. In some embodiments, R2 is a substituted heterocyclyl. In some embodiments, R 2 R is an unsubstituted phenyl compound. In some embodiments, R 2 is a substituted phenyl (e.g., tert-butyl substituted phenyl, or biphenyl). In some embodiments, R 2 is an unsubstituted quinolinyl (e.g., 4-quinolinyl, 5-quinolinyl, or 8-quinolinyl). In some embodiments, R 2 R is a substituted quinolinyl (e.g., 4-quinolinyl, 5-quinolinyl, or 8-quinolinyl). In some embodiments, R 2 is an unsubstituted isoquinolinyl (e.g., 4-isoquinolinyl, 5-isoquinolinyl, or 8-isoquinolinyl). In some embodiments, R 2 is a substituted isoquinolinyl (e.g., 4-isoquinolinyl, 5-isoquinolinyl, or 8-isoquinolinyl).

[0056] In some embodiments, R 3 is -H. In some embodiments, R 3 This is unsubstituted C1~C 10 It is alkyl. In some embodiments, R 3 This is the substitution C1~C 10 It is alkyl. In some embodiments, R 3 is an acyl. In some embodiments, R 3 -CO2R 7 (For example, -CO2H). In some embodiments, R 3 -CON(R 7 )(R 8 ) is. In some embodiments, R 3 In some embodiments, R 3 is -SO2(OH). In some embodiments, R 3 It is -CO2H.

[0057] In some embodiments, R 4 It does not exist. In some embodiments, R 4is -H. In some embodiments, R 4 This is unsubstituted C1~C 10 It is alkyl. In some embodiments, R 4 This is the substitution C1~C 10 It is alkyl. In some embodiments, R 4 is an acyl. In some embodiments, R 4 -CO2R 7 (For example, -CO2H). In some embodiments, R 4 -CON(R 7 )(R 8 ) is. In some embodiments, R 4 In some embodiments, R 4 It is -SO2(OH).

[0058] In some embodiments, R 3 is -H, and R 4 This is substitution or non-substitution C1~C 10 Alkyl, acyl, -CO2R 7 , -CON(R 7 )(R 8 ), -P=O(OH)2 or -SO2(OH) is selected. In some specific embodiments, R 3 is -H, and R 4 -CO2R 7 (For example, -CO2H).

[0059] In some embodiments, R 4 is -H, and R 3 This is substitution or non-substitution C1~C 10 Alkyl, acyl, -CO2R 7 , -CON(R 7 )(R 8 ), -P=O(OH)2 or -SO2(OH) is selected. In some specific embodiments, R 4 is -H, and R 3 -CO2R 7 (For example, -CO2H).

[0060] In some specific embodiments, R4 is -Me, and R 3 -CO2R 7 (For example, -CO2H).

[0061] In some embodiments, R 5 and R 6 is, A 2 If it does not exist, it does not exist. In some embodiments, R 5 and R 6 Both are -H. In some embodiments, R 5 and R 6 Both are C1~C 10 It is alkyl. In some embodiments, R 5 It does not exist, R 6 -H and C1~C 10 Selected from alkyl groups. In some embodiments, R 5 and R 6 These combine to form a spirocarbocyclic or spiro(hetero)carbocyclic ring.

[0062] In some embodiments, R 7 It does not exist. In some embodiments, R 7 -H, substitution or non-substitution C1~C 10 Alkyl, -(CH2) m -Aryl, -(CH2) m -heteroaryl, -(CH2) m -substituted or unsubstituted cycloalkyl, -R 14 Selected from. In some embodiments, R 7 This is substitution or non-substitution C1~C 10 It is alkyl. In some embodiments, R 7 is, -(CH2) m - is a substituted or unsubstituted cycloalkyl. In some embodiments, R 7 is, -(CH2) m - is a aryl. In some embodiments, R 7 is -H. In some embodiments, R 7 is a substitution or non-substitution C 1~5 It is alkyl. In some embodiments, R7 is -Me. In some embodiments, R 7 This is a substituted or unsubstituted C3 alkyl group.

[0063] In some embodiments, R 8 It does not exist. In some embodiments, R 8 -H, substitution or non-substitution C1~C 10 Alkyl, -(CH2) m -Aryl, -(CH2) m -heteroaryl, -(CH2) m -substituted or unsubstituted cycloalkyl, -R 14 Selected from.

[0064] In some embodiments, R 7 and R 8 These combine to form a spiropentanyl ring.

[0065] In some embodiments, R 9 These are -H, -Cl, -Br, -F, -CF3 and C1~C 10 Selected from alkyl groups. In some embodiments, R 9 The value is selected from -H and -F.

[0066] In some embodiments, R 10 These are -H, -Cl, -Br, -F, -CF3 and C1~C 10 Selected from alkyl groups. In some embodiments, R 10 The value is selected from -H and -F.

[0067] In some embodiments, R 11 C1-C is a -H, acyl, sulfonyl, substituted or unsubstituted C1-C 10 Alkyl, C3-C6 cycloalkyl, and C 3~6 Selected from heterocyclines.

[0068] In some embodiments, R 12 C1-C is a -H, acyl, sulfonyl, substituted or unsubstituted C1-C 10Alkyl, C3-C6 cycloalkyl and C 3~6 Selected from heterocyclines.

[0069] In some embodiments, R 13 is -H. In some embodiments, R 13 This is the substitution C1~C 10 Alkyl (e.g., -(CH2) m CO2N(R 11 )(R 12 ), -CON(R 7 )(R 8 ), -(CH2) m OH, -(CH2) m CO2H, -(CH2) m NH2, or -(CH2) m N(R 11 )(R 12 )) In some embodiments, R 13 This is unsubstituted C1~C 10 It is alkyl. In some embodiments, R 13 is -N(R 11 )(R 12 ) is. In some embodiments, R 13 -NR 11 (C=O)(CH2) m CH3, -NR 11 (C=O)R 12 or NR 12 (SO2)(CH2) m In some embodiments, R1 3 It is either -Br or -Cl.

[0070] In some embodiments, R 14 is -H. In some embodiments, R 14 C1~C 10 Alkyl or C1-C 10 It is an alkenyl. In some embodiments, R 14 C1~C 10 It is a (mono- or poly)hydroxylated alkyl. In some embodiments, R 14 is, -(CH2) o -R 15In some embodiments, R 14 is -(CH2CH2O) o -R 15 In some embodiments, R 14 is, -(CH2) m -CO2H is used in some embodiments. 14 is, -(CH2) m -NH2 is used in some embodiments. 14 is, -(CH2) m -(CO)NR 16 R 17 In some embodiments, R 14 This is a protecting group.

[0071] In some embodiments, R 15 -CON(R 11 )(R 12 ) is. In some embodiments, R 15 is -N(R 11 )(R 12 ) is. In some embodiments, R 15 is an acyl. In some embodiments, R 15 -CO2R 7 In some embodiments, R 15 is a substitution aryl. In some embodiments, R 15 is an unsubstituted aryl. In some embodiments, R 15 is a substituted heteroaryl. In some embodiments, R 15 R is an unsubstituted heteroaryl. In some embodiments, R 15 is a substituted cycloalkyl. In some embodiments, R 15 R is an unsubstituted cycloalkyl. In some embodiments, R 15 is a substituted heterocycloalkyl. In some embodiments, R 15 It is an unsubstituted heterocycloalkyl.

[0072] In some embodiments, R 16 is -H. In some embodiments, R 16It is -CH3.

[0073] In some embodiments, R 17 is -H. In some embodiments, R 17 It is -CH3.

[0074] In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5. In some embodiments, m is 6. In some embodiments, m is 7. In some embodiments, m is 8. In some embodiments, m is 9. In some embodiments, m is 10.

[0075] In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5.

[0076] In some embodiments, o is 1. In some embodiments, o is 2. In some embodiments, o is 3. In some embodiments, o is 4. In some embodiments, o is 5. In some embodiments, o is 6. In some embodiments, o is 7. In some embodiments, o is 8. In some embodiments, o is 9. In some embodiments, o is 10. In some embodiments, o is 11. In some embodiments, o is 12. In some embodiments, o is 13. In some embodiments, o is 14. In some embodiments, o is 15. In some embodiments, o is 16. In some embodiments, o is 17. In some embodiments, o is 18. In some embodiments, o is 19. In some embodiments, o is 20.

[0077] In any of the above embodiments, formula (I) may have a structure selected from formulas (II), (III), (IV), (V), (VI), (VII), (VIII), (IX), and (X), as defined below.

[0078] In some embodiments, formula (I) has the structure of formula (II): [ka]

[0079] In some embodiments, formula (I) has the structure of formula (III): [ka]

[0080] In some embodiments, formula (I) has the structure of formula (IV): [ka]

[0081] In some embodiments, formula (I) has the structure of formula (V): [ka]

[0082] In some embodiments, formula (I) has the structure of formula (VI): [ka]

[0083] In some embodiments, formula (I) has the structure of formula (VII): [ka]

[0084] In some embodiments, formula (I) has the structure of formula (VIII): [ka]

[0085] In some embodiments, formula (I) has the structure of formula (IX): [ka]

[0086] In some embodiments, formula (I) has the same formula structure as formula (X): [ka]

[0087] In some embodiments, formula (II) has the structure of formula (IIa) or formula (IIb): [ka] During the ceremony, L 1 This is a bond, (-CH2-) m , -CF2-, or -(C=O)-, L 2 This is a bond, (-CH2-) m , -CF2-, or -(C=O)-, m is independently between 0 and 10 at each occurrence. R 1 These are substituted or unsubstituted phenyl, substituted or unsubstituted heterocyclyl, R 2 is a substituted or unsubstituted naphthyl, or a substituted or unsubstituted heterocyclyl, R 3 -CO2H, [ka] And, R 5 and R 6 These are H, R 7 This is either substituted or non-substituted C1~C 10 Alkyl, or substituted or unsubstituted cycloalkyl, R 13 -H, -Cl, -Br, -F, -CN, -CF3, -CH2F, -CHF2, substituted or unsubstituted C1~C 10 Selected from alkyl, -NH2, -CONH2, -(CH2)-N(CH3)2, -NH(cyclopentyl), -NH(benzyl), -NH(tetrahydropyran), -NH-(CH2)(cyclopentyl), and -O-(CH2)2-phenyl.

[0088] In some embodiments, formula (II) has the structure of formula (IIc): [ka] During the ceremony, L 2 This is a bond, (-CH2-) m , -CF2-, or -(C=O)-, m is independently between 0 and 10 at each occurrence. R 2 is a substituted or unsubstituted naphthyl, or a substituted or unsubstituted heterocyclyl, R 3 -CO2H, [ka] And, R 5 and R 6 These are H, R 7 This is either substituted or non-substituted C1~C 10Alkyl, or substituted or unsubstituted cycloalkyl, R 13 -H, -Cl, -Br, -F, -CN, -CF3, -CH2F, -CHF2, substituted or unsubstituted C1~C 10 Selected from alkyl, -NH2, -CONH2, -(CH2)-N(CH3)2, -NH(cyclopentyl), -NH(benzyl), -NH(tetrahydropyran), -NH-(CH2)(cyclopentyl), and -O-(CH2)2-phenyl.

[0089] In some embodiments, formula (IX) has the structure of formula (IXa) or formula (IXb): [ka] During the ceremony, L 1 This is a bond, (-CH2-) m , -CF2-, or -(C=O)-, L 2 This is a bond, (-CH2-) m , -CF2-, or -(C=O)-, m is independently between 0 and 10 at each occurrence. o is independently 1 to 20 in each occurrence. R 1 These are substituted or unsubstituted phenyl, substituted or unsubstituted heterocyclyl, R 2 These are substituted or unsubstituted naphthyl, substituted or unsubstituted quinolinyl, substituted or unsubstituted isoquinolinyl, substituted phenyl, or substituted or unsubstituted heterocyclyl. R 3 -CO2H, [ka] And, R 13 -H, -Cl, -Br, -F, -CN, -CF3, -CH2F, -CHF2, -(CH2) m-NMe2, -CONH2, -CO2H, and substituted or unsubstituted C1~C 10 Selected from alkyl groups, R 14 C1~C 10 Alkyl, -(CH2) o -(unsubstituted cycloalkyl), -(CH2) o -(substituted or unsubstituted phenyl), -(CH2) o -Naphthyl or -(CH2) o - It is a biaryl.

[0090] In some embodiments, formula (IX) has the structure of formula (IXc): [ka] During the ceremony, L 2 This is a bond, (-CH2-) m , -CF2-, or -(C=O)-, m is independently between 0 and 10 at each occurrence. o is independently 1 to 20 in each occurrence. R 2 These are substituted or unsubstituted naphthyl, substituted or unsubstituted quinolinyl, substituted or unsubstituted isoquinolinyl, or substituted or unsubstituted heterocyclyl. R 3 -CO2H, [ka] And, R 13 -H, -Cl, -Br, -F, -CN, -CF3, -CH2F, -CHF2, -(CH2) m -NMe2, -CONH2, -CO2H, and substituted or unsubstituted C1~C 10 Selected from alkyl groups, R 14 C1~C 10 Alkyl, -(CH2) o -(unsubstituted cycloalkyl), -(CH2)o -(substituted or unsubstituted phenyl), -(CH2) o -Naphthyl or -(CH2) o - It is a biaryl.

[0091] In a particular embodiment, the compound of formula (II) is selected from compound 015a, compound 016b, compound 024, compound 042, compound 052, compound 068, compound 070, compound 071, compound 072, compound 074, compound 108, compound 109, compound 116, compound 120, compound 121, compound 122, compound 123, compound 126, compound 127, compound 128, compound 138, compound 172, compound 175, compound 176, compound 177, compound 183, and compound 184.

[0092] In a particular embodiment, the compound of formula (V) is selected from compound 051, compound 057, and compound 062.

[0093] In certain embodiments, the compound of formula (VII) is selected from compound 022 and compound 053.

[0094] In a particular embodiment, the compound of formula (IX) is selected from compound 003, compound 004, compound 004a, compound 004b, compound 140, compound 161, compound 162, compound 163, compound 164, compound 167, compound 178, compound 179, compound 180, compound 181, compound 198, compound 200, compound 202, compound 207, compound 208, or compound 216.

[0095] In certain embodiments, the compound of formula (X) is selected from compound 188 and compound 193.

[0096] In certain embodiments, the compound of formula (I) is selected from the compounds in Table 1 and their pharmaceutically acceptable salts. [Table 1] TIFF0007836089000027.tif204170JPEG0007836089000028.jpg212170TIFF0007836089000029.tif204170TIFF0007836089000030.tif246170TIFF0007836089000031.tif246170TIFF0007836089000032.tif246170TIFF0007836089000033.tif194170TIFF0007836089000034.tif238170TIFF0007836089000035.tif221170TIFF0007836089000036.tif246170TIFF0007836089000037.tif229170TIFF0007836089000038.tif254170TIFF0007836089000039.tif254170TIFF0007836089000040.tif246170TIFF0007836089000041.tif229170TIFF0007836089000042.tif221170TIFF0007836089000043.tif229170TIFF0007836089000044.tif238170TIFF0007836089000045.tif246170TIFF0007836089000046.tif204170TIFF0007836089000047.tif254170TIFF0007836089000048.tif246170TIFF0007836089000049.tif229170TIFF0007836089000050.tif229170TIFF0007836089000051.tif229170TIFF0007836089000052.tif254170TIFF0007836089000053.tif254170TIFF0007836089000054.tif254170TIFF0007836089000055.tif254170TIFF0007836089000056.tif254170TIFF0007836089000057.tif111170

[0097] In certain embodiments, the compound of formula (I) is selected from compound 001, compound 003, compound 004, compound 004a, compound 004b, compound 070, compound 094, compound 108, compound 109, compound 116, compound 122, compound 140, and pharmaceutically acceptable salts thereof.

[0098] The above-mentioned compounds and their pharmaceutically acceptable salts can be collectively referred to as the compounds of the present invention.

[0099] The following compounds are referenced herein. reference compound [ka]

[0100] The term "alkyl" refers to a linear or branched saturated hydrocarbon group having 1 to 20 carbon atoms ("C"). 1~20 This refers to an alkyl radical. In some embodiments, the alkyl group has 1 to 10 carbon atoms ("C"). 1~10 (alkyl). In some embodiments, the alkyl group has 1 to 9 carbon atoms ("C"). 1~9 (alkyl). In some embodiments, the alkyl group has 1 to 8 carbon atoms ("C"). 1~8 (alkyl). In some embodiments, the alkyl group has 1 to 7 carbon atoms ("C"). 1~7 ("alkyl"). In some embodiments, the alkyl group has 1 to 6 carbon atoms ("C"). 1~6 (alkyl). In some embodiments, the alkyl group has 1 to 5 carbon atoms ("C"). 1~5 (alkyl). In some embodiments, the alkyl group has 1 to 4 carbon atoms ("C"). 1~4 (alkyl). In some embodiments, the alkyl group has 1 to 3 carbon atoms ("C"). 1~3 Alkyl). In some embodiments, the alkyl group has 1 to 2 carbon atoms ("C"). 1~2In some embodiments, the alkyl group has one carbon atom ("C1 alkyl"). In some embodiments, the alkyl group has two to six carbon atoms ("C1 alkyl"). 2~6 Alkyl). C 1~6 Examples of alkyl groups include methyl (C1), ethyl (C2), propyl (C3) (e.g., n-propyl, isopropyl), butyl (C4) (e.g., n-butyl, tert-butyl, sec-butyl, iso-butyl), pentyl (C5) (e.g., n-pentyl, 3-pentanyl, amyl, neopentyl, 3-methyl-2-butanyl, tertiary amyl), and hexyl (C6) (e.g., n-hexyl). Further examples of alkyl groups include n-heptyl (C7) and n-octyl (C8). Unless otherwise specified, each example of an alkyl group is independently either unsubstituted ("unsubstituted alkyl") or substituted with one or more substituents (e.g., halogens such as F) ("substituted alkyl"). In certain embodiments, the alkyl group is unsubstituted C 1~10 Alkyl (e.g., unsubstituted C) 1~6 Alkyl groups include, for example, -CH3(Me), unsubstituted ethyl (Et), unsubstituted propyl (Pr, for example, unsubstituted n-propyl (n-Pr), unsubstituted isopropyl (i-Pr)), and unsubstituted butyl (Bu, for example, unsubstituted n-butyl (n-Bu), unsubstituted tert-butyl (tert-Bu or t-Bu), unsubstituted sec-butyl (sec-Bu or s-Bu), and unsubstituted isobutyl (i-Bu)). In certain embodiments, the alkyl group is substituted C 1~10 Alkyl (e.g., substituted C) 1~6 The alkyl group is an alkyl group, such as -CH2F, -CHF2, -CF3, or benzyl (Bn). The alkyl group may be branched or unbranched.

[0101] The term "alkenyl" refers to a radical of a linear or branched hydrocarbon group having 1 to 20 carbon atoms and one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 double bonds). In some embodiments, the alkenyl group has 1 to 20 carbon atoms ("C"). 1~20("Alkenyl"). In some embodiments, the alkenyl group has 1 to 12 carbon atoms ("C"). 1~12 ("Alkenyl"). In some embodiments, the alkenyl group has 1 to 11 carbon atoms ("C"). 1~11 ("Alkenyl"). In some embodiments, the alkenyl group has 1 to 10 carbon atoms ("C"). 1~10 ("Alkenyl"). In some embodiments, the alkenyl group has 1 to 9 carbon atoms ("C"). 1~9 ("Alkenyl"). In some embodiments, the alkenyl group has 1 to 8 carbon atoms ("C"). 1~8 ("Alkenyl"). In some embodiments, the alkenyl group has 1 to 7 carbon atoms ("C"). 1~7 ("Alkenyl"). In some embodiments, the alkenyl group has 1 to 6 carbon atoms ("C"). 1~6 ("Alkenyl"). In some embodiments, the alkenyl group has 1 to 5 carbon atoms ("C"). 1~5 ("Alkenyl"). In some embodiments, the alkenyl group has 1 to 4 carbon atoms ("C"). 1~4 ("Alkenyl"). In some embodiments, the alkenyl group has 1 to 3 carbon atoms ("C"). 1~3 ("Alkenyl"). In some embodiments, the alkenyl group has 1 to 2 carbon atoms ("C"). 1~2 "Alkenyl"). In some embodiments, the alkenyl group has one carbon atom ("C1 alkenyl"). One or more carbon-carbon double bonds may be internal (e.g., 2-butenyl) or terminal (e.g., 1-butenyl). C 1~4 Examples of alkenyl groups include methylidenyl (C1), ethenyl (C2), 1-propenyl (C3), 2-propenyl (C3), 1-butenyl (C4), 2-butenyl (C4), and butadienyl (C4). 1~6 An example of an alkenyl group is the aforementioned C 2~4Examples of alkenyl groups include pentenyl (C5), pentadienyl (C5), hexenyl (C6), and the like. Further examples of alkenyls include heptenyl (C7), octenyl (C8), octatrienyl (C8), and the like. Unless otherwise specified, each example of an alkenyl group is independently either unsubstituted ("unsubstituted alkenyl") or substituted with one or more substituents ("substituted alkenyl"). In certain embodiments, the alkenyl group is an unsubstituted C 1~20 It is an alkenyl. In certain embodiments, the alkenyl group is a substituted C 1~20 It is an alkenyl. In the alkenyl group, the stereochemistry of the C=C double bond is not specified (for example, -CH=CHCH3 or [ka] This can be an (E) configuration or a (Z) configuration.

[0102] The term "cycloalkyl" refers to a cyclic alkyl radical having 3 to 10 ring carbon atoms ("C"). 3~10 This refers to a cycloalkyl group ("C"). In some embodiments, the cycloalkyl group has 3 to 8 ring carbon atoms. 3~8 ("Cycloalkyl"). In some embodiments, the cycloalkyl group has 3 to 6 ring carbon atoms ("C"). 3~6 ("Cycloalkyl"). In some embodiments, the cycloalkyl group has 5 to 6 ring carbon atoms ("C"). 5~6 ("Cycloalkyl"). In some embodiments, the cycloalkyl group has 5 to 10 ring carbon atoms ("C"). 5~10 Cycloalkyl). C 5~6 Examples of cycloalkyl groups include cyclopentyl (C5) and cyclohexyl (C5). 3~6 Examples of cycloalkyl groups include the above C 5~6 Examples include cycloalkyl groups, as well as cyclopropyl (C3) and cyclobutyl (C4). 3~8 Examples of cycloalkyl groups include the above C 3~6Examples include cycloalkyl groups, as well as cycloheptyl (C7) and cyclooctyl (C8). Unless otherwise specified, each example of a cycloalkyl group is independently either unsubstituted ("unsubstituted cycloalkyl") or substituted with one or more substituents ("substituted cycloalkyl"). In certain embodiments, the cycloalkyl group is unsubstituted C 3~10 It is a cycloalkyl group. In certain embodiments, the cycloalkyl group is a substituted C 3~10 It is a cycloalkyl group.

[0103] The term "acyl" is derived from the general formula -C(=O)R X1 , -C(=O)OR X1 -C(=O)-OC(=O)R X1 -C(=O)SR X1 -C(=O)N(R X1 )2, -C(=S)R X1 -C(=S)N(R X1 )2, and -C(=S)S(R X1 ), -C(=NR X1 )R X1 -C(=NR X1 )OR X1 -C(=NR X1 )SR X1 , and -C(=NR X1 )N(R X1 ) refers to a group having 2, where R X1This includes hydrogen, halogens, substituted or unsubstituted hydroxyls, substituted or unsubstituted thiols, substituted or unsubstituted aminos, substituted or unsubstituted acyls, cyclic or acyclic, substituted or unsubstituted, branched or unbranched aliphatic, cyclic or acyclic, substituted or unsubstituted, branched or unbranched heteroaliphatic, cyclic or acyclic, substituted or unsubstituted, branched or unbranched alkyls, cyclic or acyclic, substituted or unsubstituted, branched or unbranched alkenyls, substituted or unsubstituted alkynyls, substituted or unsubstituted aryls, substituted or unsubstituted heteroaryls, and aliphatic atoms. Xy, heteroaliphatic oxy, alkyloxy, heteroalkyloxy, aryloxy, heteroaryloxy, aliphatic thiooxy, heteroaliphatic thiooxy, alkyl thiooxy, heteroalkyl thiooxy, aryl thiooxy, heteroaryl thiooxy, mono or dialiphatic amino, mono or di-heteroaliphatic amino, mono or di-alkylamino, mono or di-heteroalkylamino, mono or di-arylamino, or mono or di-heteroarylamino, or two Rs that combine to form a 5- to 6-membered heterocycle X1 This refers to a group. Examples of acyl groups include aldehydes (-CHO), carboxylic acids (-CO2H), ketones, acyl halides, esters, amides, imines, carbonates, carbamates, and urea. The acyl substituents include, but are not limited to, any of the substituents described herein that result in the formation of a stable moiety (e.g., aliphatic, alkyl, alkenyl, alkynyl, heteroaliphatic, heterocyclic, aryl, heteroaryl, acyl, oxo, imino, thiooxo, cyano, isocyano, amino, azide, nitro, hydroxyl, thiol, halo, aliphatic amino, heteroaliphatic amino, alkylamino, heteroalkylamino, arylamino, heteroarylamino, alkylaryl, arylalkyl, aliphatic oxy, heteroaliphatic oxy, alkyloxy, heteroalkyloxy, aryloxy, heteroaryloxy, aliphatic thiooxy, heteroaliphatic thiooxy, alkyl thiooxy, heteroalkyl thiooxy, aryl thiooxy, heteroaryl thiooxy, acyl oxy, etc., each of which may or may not be further substituted).

[0104] The term "sulfonyl" is -SO2N(R bb )2, -SO2R aa , and -SO2OR aa It refers to a group selected from, in the formula, R aa and R bb This is as defined herein.

[0105] The term "aryl" refers to a radical ("C") of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared within a cyclic array) having 6 to 14 ring carbon atoms and no heteroatoms contributing to the aromatic ring system. 6~14 This refers to an aryl group ("C6 aryl," e.g., phenyl). In some embodiments, the aryl group has six ring carbon atoms ("C6 aryl"). In some embodiments, the aryl group has ten ring carbon atoms ("C6 aryl"). 10 "Aryl" (for example, naphthyl such as 1-naphthyl and 2-naphthyl). In some embodiments, the aryl group has 14 ring carbon atoms ("C"). 14 "Aryl" (e.g., anthracyl). "Aryl" also includes ring systems in which the previously defined aryl ring is condensed with one or more carbocyrillic or heterocyclyl groups, and the radical or bond site lies on the aryl ring, in which case the number of carbon atoms refers to the number of carbon atoms in the consecutive aryl ring system. Unless otherwise specified, each example of an aryl group is independently unsubstituted ("unsubstituted aryl") or substituted with one or more substituents (e.g., -F, -OH, or -O(C)). 1~6 Substituted with alkyl ("substituted aryl"). In certain embodiments, the aryl group is unsubstituted C 6~14 It is aryl. In certain embodiments, the aryl group is substituted C 6~14 It is Ariel.

[0106] The term “heterocyclyl” or “heterocyclic” refers to a radical of a 3- to 14-membered non-aromatic ring system having a ring carbon atom and 1 to 4 ring heteroatoms, each heteroatom independently selected from nitrogen, oxygen, and sulfur (“3- to 14-membered heterocyclyl”). In heterocyclyl groups containing one or more nitrogen atoms, the bond sites can be carbon atoms or nitrogen atoms, as long as the valence allows. Heterocyclyl groups can be monocyclic (“monocyclic heterocyclyl”) or polycyclic (e.g., fused rings, bridging rings, or spiro-ring systems, e.g., bicyclic (“bicyclic heterocyclyl”) or tricyclic (“tricyclic heterocyclyl”)), and can be saturated or contain one or more carbon-carbon double or triple bonds. Heterocyclyl polycyclic systems may contain one or more heteroatoms in one or both rings. "Heterocyclyl" also includes a ring system in which the previously defined heterocyclyl ring is fused with one or more carbocykyl groups, and the bond site is either a carbocykyl or a heterocyclyl ring, or a ring system in which the previously defined heterocyclyl ring is fused with one or more aryl or heteroaryl groups, and the bond site is on the heterocyclyl ring, in which case the number of ring members successively specifies the number of ring members in the heterocyclyl ring system. Unless otherwise specified, each example of a heterocyclyl is independently either unsubstituted ("unsubstituted heterocyclyl") or substituted with one or more substituents ("substituted heterocyclyl"). In certain embodiments, the heterocyclyl group is an unsubstituted 3- to 14-membered heterocyclyl. In certain embodiments, the heterocyclyl group is a substituted 3- to 14-membered heterocyclyl. In certain embodiments, the heterocyclyl is a substituted or unsubstituted 3- to 7-membered monocyclic heterocyclyl, where one, two, or three atoms of the heterocyclic ring system are independently oxygen, nitrogen, or sulfur, to the extent their valences allow.

[0107] In some embodiments, the heterocyclyl group is a 5-10 membered non-aromatic ring system having a ring carbon atom and 1-4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-10 membered heterocyclyl"). In some embodiments, the heterocyclyl group is a 5-8 membered non-aromatic ring system having a ring carbon atom and 1-4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-8 membered heterocyclyl"). In some embodiments, the heterocyclyl group is a 5-6 membered non-aromatic ring system having a ring carbon atom and 1-4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-6 membered heterocyclyl"). In some embodiments, the 5-6 membered heterocyclyl has 1-3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5-6 membered heterocyclyl has 1-2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5-6 membered heterocyclyl has one ring heteroatom selected from nitrogen, oxygen, and sulfur.

[0108] Examples of three-membered heterocyclyl groups containing one heteroatom include azilidinyl, oxylanil, and thiranil. Examples of four-membered heterocyclyl groups containing one heteroatom include azetidinyl, oxetanil, and thietanil. Examples of five-membered heterocyclyl groups containing one heteroatom include tetrahydrofuranil, dihydrofuranil, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl, and pyrrolyl-2,5-dione. Examples of five-membered heterocyclyl groups containing two heteroatoms include dioxolanil, oxathiolanil, and dithiolanil. Examples of five-membered heterocyclyl groups containing three heteroatoms include triazolinil, oxadiazolinil, and thiadiazolinil. Examples of six-membered heterocyclyl groups containing one heteroatom include piperidinyl, tetrahydropyranil, dihydropyridinyl, and thianil. Examples of six-membered heterocyclyl groups containing two heteroatoms include piperazinyl, morpholinyl, dithianyl, and dioxanil. An example of a six-membered heterocyclyl group containing three heteroatoms is triazinyl. Examples of seven-membered heterocyclyl groups containing one heteroatom include azepanyl, oxepanyl, and thiepanyl. Examples of eight-membered heterocyclyl groups containing one heteroatom include azokanyl, oxecanyl, and thiokanyl.Examples of bicyclic heterocyclyl groups include indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, tetrahydrobenzothienyl, tetrahydrobenzofuranyl, tetrahydroindolyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, decahydroisoquinolinyl, octahydroclomenyl, octahydroisoclomenyl, decahydronaphthilidinyl, decahydro-1,8-naphthilidinyl, octahydropyrrolo[3,2-b]pyrrole, indolinyl, phthaliumidyl, naphthaliumidyl, chromanyl, clomenyl, 1H-benzo[e][1,4]diazepinyl, 1 Examples include 4,5,7-tetrahydropyrano[3,4-b]pyrrolyl, 5,6-dihydro-4H-fl[3,2-b]pyrrolyl, 6,7-dihydro-5H-fl[3,2-b]pyranyl, 5,7-dihydro-4H-thieno[2,3-c]pyranyl, 2,3-dihydro-1H-pyrrolo[2,3-b]pyridinyl, 2,3-dihydrofl[2,3-b]pyridinyl, 4,5,6,7-tetrahydro-1H-pyrrolo[2,3-b]pyridinyl, 4,5,6,7-tetrahydrofl[3,2-c]pyridinyl, 4,5,6,7-tetrahydrothieno[3,2-b]pyridinyl, and 1,2,3,4-tetrahydro-1,6-naphthilidinyl.

[0109] The term "heteroaryl" refers to a radical of a 5-14 membered monocyclic or polycyclic (e.g., bicyclic, tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared within a cyclic array) in which a ring carbon atom and 1-4 ring heteroatoms are provided to the aromatic ring system, each heteroatom independently selected from nitrogen, oxygen, and sulfur ("5-14 membered heteroaryl"). In heteroaryl groups containing one or more nitrogen atoms, the bond site can be a carbon atom or a nitrogen atom, as long as the valence allows. Heteroaryl polycyclic ring systems may contain one or more heteroatoms in one or both rings. "Heteroaryl" includes ring systems in which the previously defined heteroaryl ring is fused with one or more carbocyryl or heterocyclyl groups, and the bond site lies on the heteroaryl ring, in which case the number of ring members refers to the number of ring members in a consecutive heteroaryl ring system. "Heteroaryl" also includes a ring system in which a heteroaryl ring, as defined above, is fused with one or more aryl groups, and the bond site is located either on the aryl ring or the heteroaryl ring, in which case the number of ring members refers to the number of ring members in the fused polycyclic (aryl / heteroaryl) ring system. One ring is a polycyclic heteroaryl group that does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl), and the bond site may be located either on the ring, for example, on the ring with a heteroatom (e.g., 2-indolyl) or on the ring without a heteroatom (e.g., 5-indolyl). In certain embodiments, the heteroaryl is a substituted or unsubstituted 5 or 6-membered monocyclic heteroaryl, and one, two, three or four atoms of the heteroaryl ring system are independently oxygen, nitrogen, or sulfur. In certain embodiments, the heteroaryl is a substituted or unsubstituted 9 or 10-membered bicyclic heteroaryl, and one, two, three or four atoms of the heteroaryl ring system are independently oxygen, nitrogen, or sulfur.

[0110] In some embodiments, the heteroaryl group is a 5-10 member aromatic ring system having a ring carbon atom and 1-4 ring heteroatoms provided to the aromatic ring system, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-10 member heteroaryl"). In some embodiments, the heteroaryl group is a 5-8 member aromatic ring system having a ring carbon atom and 1-4 ring heteroatoms provided to the aromatic ring system, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-8 member heteroaryl"). In some embodiments, the heteroaryl group is a 5-6 member aromatic ring system having a ring carbon atom and 1-4 ring heteroatoms provided to the aromatic ring system, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-6 member heteroaryl"). In some embodiments, the 5-6 member heteroaryl has 1-3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5-6 member heteroaryl has 1-2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5- to 6-membered heteroaryl group has one ring heteroatom selected from nitrogen, oxygen, and sulfur. Unless otherwise specified, each example of a heteroaryl group is independently either unsubstituted ("unsubstituted heteroaryl") or substituted with one or more substituents ("substituted heteroaryl"). In certain embodiments, the heteroaryl group is an unsubstituted 5- to 14-membered heteroaryl. In certain embodiments, the heteroaryl group is a substituted 5- to 14-membered heteroaryl.

[0111] Exemplary five-membered heteroaryl groups containing one heteroatom include pyrrolyl, furanyl, and thiophenyl. Exemplary five-membered heteroaryl groups containing two heteroatoms include imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary five-membered heteroaryl groups containing three heteroatoms include triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary five-membered heteroaryl groups containing four heteroatoms include tetrazolyl. Exemplary six-membered heteroaryl groups containing one heteroatom include pyridinyl. Exemplary six-membered heteroaryl groups containing two heteroatoms include pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary six-membered heteroaryl groups containing three or four heteroatoms include triazinyl and tetradinyl, respectively. Exemplary seven-membered heteroaryl groups containing one heteroatom include azepinyl, oxepinyl, and thiepinyl. Examples of 5,6-bicyclic heteroaryl groups include indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranil, benzoisofuranil, benzimidazolyl, benzoxazolyl, benzoisoxazolyl, benzoxadiazolyl, benzothiazolyl, benzoisothiazolyl, benzothiadiazolyl, indolidinyl, and prinyl. Examples of 6,6-bicyclic heteroaryl groups include naphthilidinyl, pteridinyl, quinolinil, isoquinolinil, sinnolinil, quinoxalinil, phthalazinyl, and quinazolinil. Examples of tricyclic heteroaryl groups include phenanthidinyl, dibenzofuranil, carbazolyl, acridinyl, phenothiazinyl, phenoxazinyl, and phenazinyl.

[0112] Where used herein in relation to stereochemistry, the term “any” indicates that the relative or absolute stereochemistry of a compound has not been determined.

[0113] The terms “reduce,” “decreased,” “decrease,” “inhibit,” or “interfere” are all used herein to mean a reduction of a statistically significant amount. In some embodiments, “reduce,” “decrease,” “decrease,” “inhibit,” or “interfere” typically mean a reduction of at least 10% compared to a reference level (e.g., the absence of a given treatment), and may include reductions of, for example, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or greater. As used herein, “reduce” or “inhibit” does not include complete inhibition or reduction compared to a reference level. “Complete inhibition” is 100% inhibition compared to a reference level. The decrease may preferably be a decline to a level that is considered within the normal range for a given non-disabled individual.

[0114] Treatment method Amyloid is produced in the gastrointestinal tract by members of the gastrointestinal microbiome, such as Escherichia coli and several other proteobacteria. These microbial amyloids can interact with cells they come into contact with in the gastrointestinal tract and may affect α-synuclein expression and / or α-synuclein aggregation. The STC-1 cell line originates from a mouse small intestinal tumor and possesses many characteristics of native gastrointestinal endocrine cells (McCarthy et al. (2015), STC-1 Cells. In: Verhoeckx K. et al. (eds) The Impact of Food Bioactives on Health. Springer, Cham.). In an in vitro assay measuring α-synuclein expression in STC-1 cells by Western blotting, exposure to E. coli strains expressing wild-type CsgA significantly increased α-synuclein expression, while exposure to isogenic mutants lacking csgA had little effect on α-synuclein levels (see, for example, International Publication No. 2019 / 028456 and the references cited therein). Thus, although the exact mechanism by which CsgA affects α-synuclein expression is unknown, it is possible that CsgA interacts with enteroendocrine-like cells in the gastrointestinal tract, causing in vitro overexpression of α-synuclein, and that a similar effect may occur in vivo when pathogenic microbial amyloid comes into contact with enteroendocrine cells or other cells in the gastrointestinal tract. While mouse α-synuclein is generally not observed to aggregate, overexpression of human α-synuclein can lead to aggregation, which in turn impairs cellular function and can proliferate in adjacent cells in a prion-like manner in the gastrointestinal tract and enteric nervous system, potentially causing adverse effects on gastrointestinal function. These adverse effects may include one or more of the following: intestinal dysbiosis, increased intestinal permeability, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, or Crohn's disease. These disorders may be associated with one or more symptoms, including dysphagia, decreased bowel motility, gastroparesis, constipation (including chronic and chronic idiopathic constipation), small intestinal bacterial overgrowth (SIBO), diarrhea, abdominal pain and / or cramps, bloating, flatulence, excessive salivation, anorectal dysfunction, defecation dyscoordination, and nausea.In some cases, neurological and gastrointestinal symptoms of amyloid disorders may be associated. For example, in Parkinson's disease and parkinsonism (a clinical syndrome characterized by tremor, bradykinesia, rigidity, and postural instability), decreased dopamine levels can lead to neurological symptoms of dyskinesia and gastrointestinal symptoms of chronic idiopathic constipation. Therefore, treatments that improve intestinal motility, including the method of the present invention, can improve dopamine absorption in the gastrointestinal tract and thereby reduce dyskinesia. Thus, treatments that manage constipation (or, more generally, intestinal dysbiosis or increased intestinal permeability) can not only slow the progression of motor symptoms of Parkinson's disease but also increase the "on-time" period in which Parkinson's disease symptoms are well controlled.

[0115] Consistent with the ability of STC-1 cells to respond to E. coli CsgA in vitro, gastrointestinal cells have been observed to sense and respond to microbial amyloid. For example, Salmonella enterica CsgA is known to regulate gastrointestinal permeability in mice via activation of the TLR2 / PI3K pathway. Furthermore, U.S. Patent No. 9,814,756 discloses a method for regulating gastrointestinal permeability via administration of CsgA and / or CsgB variants. U.S. Patent No. 9,814,756 discloses, in particular, that administration of a composition comprising isolated curli fibrils having epithelial permeability-reducing activity reduces the permeability of the epithelium of the small or large intestine, for example, (i) a CsgA polypeptide variant that differs from the naturally occurring CsgA polypeptide in that 1 to 5 amino acids are substituted, deleted or added; (ii) a CsgB polypeptide variant that differs from the naturally occurring CsgB polypeptide in that 1 to 5 amino acids are substituted, deleted or added; or (iii) a combination of the above CsgA polypeptide variant and the above CsgB polypeptide variant. Therefore, there may be further mechanisms by which microbial amyloid interacts with gastrointestinal cells, but at least one such mechanism is intended herein.

[0116] In one embodiment, a method for inhibiting amyloid formation in a subject requiring such inhibition is provided herein, comprising administering a compound described herein or a pharmaceutically acceptable salt thereof or a pharmaceutically acceptable composition thereof to the subject.

[0117] In another embodiment, methods for inhibiting, improving, reducing the likelihood of, delaying the onset of, treating or preventing amyloid disorders in subjects requiring such treatment, comprising administering a compound described herein (e.g., a compound of formula (I), or a compound of Table 1) or a pharmaceutically acceptable salt thereof to the subject. Such amyloid disorders include neurological disorders, as well as Parkinson's disease (PD), Lewy body dementia, multiple system atrophy, multiple sclerosis (MS), frontotemporal dementia (FTD), REM sleep behavior disorder (RBD), alpha-synucleinopathy, PD-related constipation, PD-related hypotension, Huntington's disease, Alexander disease, amyotrophic lateral sclerosis (ALS), or Alzheimer's disease, and / or other diseases involving amyloid. In some embodiments, amyloid disorders include intestinal dysbiosis, increased intestinal permeability, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, or Crohn's disease.

[0118] In another embodiment, a method for preventing or treating an inflammatory disorder in a subject requiring such treatment is provided herein, comprising administering a compound described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable composition thereof, to the subject. In some embodiments, the inflammatory disorder is selected from bacterial sepsis, autoimmune diseases, lupus erythematosus, ischemia-reperfusion injury, stroke, metabolic diseases, obesity-related metabolic inflammation, gout, and cancer. In some embodiments, the inflammatory disorder is lupus erythematosus.

[0119] In individuals with lupus erythematosus, such as systemic lupus erythematosus (SLE), infection is a common environmental trigger for flare-ups (20–55%) and is associated with increased morbidity / mortality. Recombinant curli-DNA complexes derived from Salmonella typhimurium act as potent immunostimulants by activating innate / adaptive immunity and inducing autoantibody formation, activating dendritic cells in vitro and in vivo in lupus-prone mice. For example, administration of recombinant curli-DNA complexes (50ug, once or three times / week) to ip lupus-prone mice results in the formation of dsDNA and chromatin antibodies, which are signs of SLE onset. Infection with curli-producing bacteria (Escherichia coli or S. typhimurium) also promotes autoimmunity in lupus-prone mice in vivo. For example, see Gallo, PM, et al. Immunity, 2015, 42, 1171-1184. These findings suggest that inhibitors of bacterial curli formation may prevent or inhibit autoimmune activation, and in such cases, could be a treatment for SLE.

[0120] In individuals with multiple sclerosis (MS), focal lymphocyte infiltration has been shown to lead to myelin and axonal damage and is associated with dysbiosis of the gut microbiota. For example, in individuals with MS, levels of Akkermansia muciniphila and Acinetobacter calcoaceticus are elevated, while levels of Parabacteroides distasonis are decreased. See, for example, Cekanaviciute, E. et al. Proc. Nat. Acad. Sci., 114, 10713-10718. Furthermore, in individuals with MS, levels of Pseudomonas, Mycoplana, Haemophilus, Blautia, and Dorea are elevated, while levels of Parabacteroides, Adlercreutzia, and Prevotella species are decreased. See, for example, Chen, J. et al. Nature Sci. Rep., 2016, 6:28484. Also, see Liu, JQ et al. J Exp Neuropath. Exp. Neurol. 2009, 68, 179, and Papadopoulos D. et al. Mol. Cell Neurosci. 2006, 31, 597.

[0121] Synucleinopathies have been observed in the brains of deceased MS patients and in experimental autoimmune encephalomyelitis (EAE) rat models. Transplantation of patient-derived microbiome in EAE models was found to exacerbate disease severity (compared to transplantation of healthy controls). These findings suggest that inhibitors of bacterial curli formation may be a potential treatment for MS.

[0122] In some embodiments, subjects are selected as requiring the composition by detecting the presence and / or level of aggregates in their intestinal samples (e.g., fecal samples). The presence or level of intestinal aggregates greater than that of a negative control (e.g., a healthy control subject or a control subject known not to have amyloid disorder) may indicate that the subject requires the composition. In some embodiments, subjects are selected as requiring the composition by detecting the presence and / or level of aggregates in their intestinal samples in combination with other factors, such as genetic susceptibility.

[0123] In some embodiments, detecting the presence and / or level of intestinal aggregates in a sample of interest includes detecting the presence and / or level of bacterial proteins, such as curli-related proteins like CsgA, in the sample. In some embodiments, detecting the presence and / or level of intestinal aggregates in a sample of interest includes detecting the level of amyloid-producing bacteria, such as curli-related proteins like CsgA, in the sample. For example, bacterial amyloid can be detected directly, or nucleic acids encoding amyloid, i.e., nucleic acids indicating the presence of amyloid-producing bacteria in the digestive tract of interest, can be detected in the sample. Examples of amyloid-producing bacteria include CsgA-producing Enterobacteriaceae such as Escherichia coli.

[0124] Compounds of formula (I) and pharmaceutically acceptable salts thereof can be administered in the form of a composition. In some embodiments, the composition comprises, or essentially comprises, one or more compounds selected from the group consisting of compounds identified by the compound activity range "++++" in any column of Table 3 or Table 4 (below). In some embodiments, the composition comprises, or essentially comprises, one or more compounds selected from the group consisting of compounds identified by the compound activity range "+++" in any column of Table 3 or Table 4. In some embodiments, the composition comprises, or essentially comprises, one or more compounds selected from the group consisting of compounds identified by the compound activity range "+++" or "++++" in any column of Table 3 or Table 4. In some embodiments, the composition comprises, or essentially comprises, one or more compounds selected from the group consisting of compounds identified by the compound activity range "++" or "+++" in any column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of a set of compounds identified by the compound activity ranges "++", "+++", or "++++" in any column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of a set of compounds identified by the compound activity ranges "+", "++", "+++", or "++++" in any column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of compounds identified by the compound activity range "+++" in the "αSyn ThT Assay" column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of a set of compounds identified by the compound activity ranges "++" or "+++" in the "αSyn ThT Assay" column of Table 4. In some embodiments, the composition comprises, or essentially consists of, one or more compounds selected from the group consisting of a set of compounds identified by the compound activity ranges of "+", "++", or "+++" in the "αSyn ThT Assay" column of Table 3 or Table 4.In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of compounds identified by the compound activity range "++++" in the "CsgA ThT Assay" column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of compounds identified by the compound activity range "+++" in the "CsgA ThT Assay" column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of a set of compounds identified by the compound activity range "+++" or "++++" in the "CsgA ThT Assay" column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of a set of compounds identified by the compound activity range "++", "+++", or "++++" in the "CsgA ThT Assay" column of Table 3 or Table 4. In some embodiments, the composition comprises, or essentially consists of, one or more compounds selected from the group consisting of a set of compounds identified by the compound activity ranges of "+", "++", "+++", or "++++" in the "CsgA ThT Assay" column of Table 3 or Table 4.

[0125] Compounds of formula (I) and pharmaceutically acceptable salts thereof can be administered in the form of a composition. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of compounds identified by the compound activity range "****" in any column of Table 3 or Table 4 (below). In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of compounds identified by the compound activity range "***" in any column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of compounds identified by the compound activity range "**" or "***" in any column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of compounds identified by the compound activity range "**" or "***" in any column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of a set of compounds identified by the compound activity range "**", "***", or "****" in any column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of a set of compounds identified by the compound activity ranges "*", "**", "***", or "****" in any column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of compounds identified by the compound activity ranges "****" in the "Reporter Assay" column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of compounds identified by the compound activity ranges "***" in the "Reporter Assay" column of Table 3 or Table 4. In some embodiments, the composition comprises or essentially comprises one or more compounds selected from the group consisting of a set of compounds identified by the compound activity ranges "***" or "****" in the "Reporter Assay" column of Table 3 or Table 4.In some embodiments, the composition comprises, or essentially comprises, one or more compounds selected from the group consisting of a set of compounds identified by the compound activity ranges "**", "***", or "****" in the "Reporter Assay" column of Table 3 or Table 4. In some embodiments, the composition comprises, or essentially comprises, one or more compounds selected from the group consisting of a set of compounds identified by the compound activity ranges "*", "**", "***", or "****" in the "Reporter Assay" column of Table 3 or Table 4. In some embodiments, a subject is selected as requiring the composition by detecting the presence and / or level of aggregates in an intestinal sample of that subject (e.g., a fecal sample). The presence or level of intestinal aggregates greater than that of a negative control (e.g., a healthy control subject or a fecal sample of a control subject known not to have amyloid damage) may indicate that the subject requires the composition.

[0126] In some embodiments, the composition is an IC with a minimum molecular weight of 150 μM. 50 The composition comprises or essentially consists of one or more compounds of formula (I) having . In some embodiments, the composition has an IC of less than 80 μM. 50 The composition comprises, or essentially consists of, one or more compounds of formula (I) having . In some embodiments, the composition has an IC of less than 35 μM. 50 The composition comprises, or essentially consists of, one or more compounds of formula (I) having . In some embodiments, the composition has an IC of less than 20 μM. 50 The composition comprises, or essentially consists of, one or more compounds of formula (I) having . In some embodiments, the composition has an IC of less than 10 μM. 50 The composition comprises, or essentially consists of, one or more compounds of formula (I) having . In some embodiments, the composition has an IC of less than 4.6 μM. 50 The composition comprises or essentially consists of one or more compounds of formula (I) having . In some embodiments, the composition contains less than 1.3 μM IC 50The composition comprises, or essentially consists of, one or more compounds of formula (I) having . In some embodiments, the composition comprises 1.3 to 4.5 μM IC 50 The composition comprises, or essentially consists of, one or more compounds of formula (I) having . In some embodiments, the composition has an IC of 4.6 to less than 10 μM. 50 The composition comprises, or essentially consists of, one or more compounds of formula (I) having . In some embodiments, the composition has an IC of more than 10 μM. 50 It contains, or essentially consists of, one or more compounds of formula (I) having .

[0127] In some embodiments, this composition has shown a control B level of 125% or less in the ThT assay for CsgA aggregation. max The composition contains, or essentially consists of, one or more compounds of formula (I) having a percentage. In some embodiments, the composition contains less than 100% of control B. max The composition contains, or essentially consists of, one or more compounds of formula (I) having a percentage. In some embodiments, the composition contains 90% or less of control B. max The composition contains, or essentially consists of, one or more compounds of formula (I) having a percentage. In some embodiments, the composition contains 80% or less of control B. max The composition contains, or essentially consists of, one or more compounds of formula (I) having a percentage. In some embodiments, the composition contains 70% or less of control B. max The composition contains, or essentially consists of, one or more compounds of formula (I) having a percentage. In some embodiments, the composition contains 60% or less of control B. max The composition contains, or essentially consists of, one or more compounds of formula (I) having a percentage. In some embodiments, the composition contains 50% or less of control B. max The composition contains, or essentially consists of, one or more compounds of formula (I) having a percentage. In some embodiments, the composition contains 40% or less of control B. max The composition contains, or essentially consists of, one or more compounds of formula (I) having a percentage. In some embodiments, the composition contains 30% or less of control B. maxThe composition contains, or essentially consists of, one or more compounds of formula (I) having a percentage. In some embodiments, the composition contains 20% or less of control B. max The composition contains, or essentially consists of, one or more compounds of formula (I) having a %. In some embodiments, the composition contains 10% or less of control B max The composition contains, or essentially consists of, one or more compounds of formula (I) having a percentage of %. In some embodiments, the composition contains more than 60% of control B. max The composition contains, or essentially consists of, one or more compounds of formula (I) having %. In some embodiments, the composition contains 31 to 60% control B max The composition contains, or essentially consists of, one or more compounds of formula (I) having %. In some embodiments, the composition contains 11 to 31% control B max It contains, or essentially consists of, one or more compounds of formula (I) having %. In some embodiments, control B max The percentage is determined relative to a vehicle control that includes all components of the assay except for one or more compounds of formula (I). In some embodiments, control B max The percentage is determined relative to the vehicle control, which includes the solvent and reporter strain. In some embodiments, the solvent is DMSO. The assay and control (for the CsgA ThT assay) are described in Example 26, and control B max The percentages are described in paragraph [000336].

[0128] In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of less than 125% in a ThT fluorescence assay for CsgA aggregation. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 100% or less. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 90% or less. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 80% or less. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 70% or less. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 60% or less. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 50% or less. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 40% or less. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 30% or less. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 20% or less. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 10% or less. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of more than 60%. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 31 to 60%. In some embodiments, the composition comprises or essentially consists of one or more compounds of formula (I) having a control AUC% of 11 to 31%.In some embodiments, the control AUC% is determined against a vehicle control comprising all components of the assay except for one or more compounds of formula (I). In some embodiments, the control AUC% is determined against a vehicle control comprising the solvent and a reporter strain. In some embodiments, the solvent is DMSO. The assay and controls are described in Example 26, and the calculation of AUC is described in paragraph [000335].

[0129] In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce at least 10% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce at least 20% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce at least 30% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce at least 40% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce at least 50% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce at least 60% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce at least 70% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce at least 80% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce at least 90% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce less than -10% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce -10 to 10% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce 11 to 30% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce 31 to 60% inhibition. In some embodiments, the composition contains or essentially consists of one or more compounds of formula (I) that produce more than 60% inhibition.

[0130] In some embodiments, subjects are selected as requiring the composition by detecting the presence and / or level of aggregates in their intestinal samples (e.g., fecal samples). The presence or level of intestinal aggregates greater than that in negative controls (e.g., fecal samples from healthy control subjects or control subjects known not to have amyloid damage) may indicate that the subject requires the composition.

[0131] Pharmaceutical compositions, formulations, administration, and drug delivery. In another embodiment, pharmaceutical compositions comprising the compounds described herein and a pharmaceutically acceptable carrier are provided herein. The pharmaceutical compositions described herein are useful for inhibiting amyloid formation.

[0132] In certain embodiments, the pharmaceutical composition is formulated for delivery to the extracirculation of the target. In certain embodiments, the pharmaceutical composition is formulated for delivery to the central nervous system of the target. The composition may be formulated for intraintestinal delivery, and / or the composition may be further formulated for controlled release in the lower intestinal tract or colon, and / or for topical, oral, or mucosal delivery. The aforementioned compositions may include enteric-coated capsules, tablets, soft gels, spray-dried powders, polymer matrices, hydrogels, enteric-coated solids, crystalline solids, amorphous solids, glassy solids, coated microparticles, liquids, spray liquids, aerosols, or microcapsules.

[0133] In certain embodiments, the pharmaceutical composition is formulated for oral administration. In certain embodiments, the pharmaceutical composition is formulated for administration by injection. The injection may be intravenous, subcutaneous, intramuscular, intraperitoneal, intraspinal, or intracranial.

[0134] Standard pharmaceutical and / or dietary supplement formulation techniques, such as those described in Remington's The Science and Practice of Pharmacy, 21st Ed. Lippincott Williams & Wilkins (2005), which is incorporated herein by reference in whole, may be used. Accordingly, some embodiments include pharmaceutical and / or dietary supplement compositions comprising (a) one or more of the compounds described herein or pharmaceutically acceptable salts thereof in a safe and therapeutically effective amount, and (b) a pharmaceutically acceptable carrier, diluent, excipient or combination thereof.

[0135] The pharmaceutical composition contains an effective amount of one or more of the compounds of the present invention. This effective amount is sufficient to achieve one or more desired biological and / or pharmacological effects, such as interference with or inhibition of amyloid aggregate formation, treatment or prevention of neurological disorders or symptoms of neurological disorders, or treatment or prevention of gastrointestinal disorders or symptoms. The “effective amount” or “effective dose” of a compound (e.g., the compounds described herein) or a composition containing such a compound refers to an amount sufficient to achieve the desired biological and / or pharmacological effect when delivered to cells or organisms according to a selected dosage form, route and / or schedule. The terms “effective amount” and “therapeutic effective dose” may be used interchangeably. As will be understood by those skilled in the art, the absolute amount of a particular effective compound or composition may vary depending on factors such as the desired biological or pharmacological endpoint, the drug being delivered, and the target tissue. Those skilled in the art will further understand that in various embodiments, the “effective amount” may be administered to a subject in a single dose or by use in multiple doses.

[0136] "Administering" has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It means providing a drug, dietary supplement, or composition to a subject, including, but not limited to, administration by a medical professional and self-administration. Administration of the compounds disclosed herein or their pharmaceutically acceptable salts may be by any mode of administration acceptable for similar drugs, such as oral, intraperitoneal, or rectal. Oral administration is customary in the administration of compositions that are the subject of preferred embodiments. However, in some embodiments, compositions administered according to the methods of this disclosure are administered rectally, such as by enema or suppository. In some embodiments, the compound may be administered extracorporeally, for example, by apheresis or dialysis.

[0137] The term “agent” has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It includes any substance, molecule, element, compound, entity, or combination thereof. This includes, but is not limited to, proteins, polypeptides, peptides or mimics, small organic molecules, polysaccharides, polynucleotides, polymers, resins, organic or inorganic fine particles, organic or inorganic nanoparticles, etc. It may be a natural product, a synthetic compound, or a chemical compound, or a combination of two or more substances.

[0138] The terms “pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” have their customary and ordinary meanings as understood by those skilled in the art in view of this disclosure. This includes all kinds of solvents, diluents, emulsifiers, binders, buffers, dispersion media, coatings, antimicrobial and antifungal agents, isotonic and absorption retardants, or any other such compounds known to those skilled in the art to be useful in the preparation of pharmaceutical formulations. The use of such media and agents for pharmaceutically active substances is well known in the art. Any conventional media or agent is intended to be used in the therapeutic composition unless it is incompatible with the active ingredient. Co-active ingredients may also be incorporated into the composition. Furthermore, various excipients as commonly used in the art may be included. These and other such compounds are described in the literature, e.g., the Merck Index, Merck & Company, Rahway, NJ. Considerations for including various components in pharmaceutical compositions are described, for example, in Gilman et al. (Eds.) (1990) and Goodman and Gilman's: The Pharmacological Basis of Therapeutics, 8th Ed., Pergamon Press.

[0139] Some examples of substances that can act as pharmaceutically acceptable carriers or components thereof according to the methods and compositions of some embodiments herein are sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; celluloses and their derivatives such as sodium carboxymethylcellulose, ethylcellulose, and methylcellulose; tragacanth powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and theobroma oil; polyols such as propylene glycol, glycerin, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifiers such as TWEENS; wetting agents such as sodium lauryl sulfate; colorants; flavoring agents; tableting agents; stabilizers; antioxidants; preservatives; pyrogenic water; isotonic saline; and / or phosphate buffer, or any combination thereof.

[0140] The selection of a pharmaceutically acceptable carrier to be used in conjunction with one or more compounds for administration described herein may be determined by the manner in which the compounds will be administered.

[0141] Furthermore, this disclosure includes compositions comprising isotopic substitution analogs such as various salts, esters, hydrates, prodrugs, fluorinated analogs, or deuterated forms of the compounds described herein.

[0142] The term "pharmaceutically acceptable salt" refers to a salt that, within the bounds of proper medical judgment, is suitable for use in contact with human and lower animal tissues without excessive toxicity, irritation, or allergic reactions, and that is commensurate with a reasonable benefit / risk ratio. pharmaceutically acceptable salts are well known in the art. For example, Berge et al., incorporated herein by reference, describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19. pharmaceutically acceptable salts of the compounds of the present invention include those derived from appropriate inorganic and organic acids and bases. Examples of pharmaceutically acceptable, non-toxic acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by other methods known in the art, such as ion exchange. Other pharmaceutically acceptable salts include adipine, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphor, camphor sulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, and 2-hydroxyethanesulfonate. Examples include lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, and valerate. Salts derived from appropriate bases include alkali metals, alkaline earth metals, ammonium, and N+(C1~4alkyl)4-salts.Typical alkali metal salts or alkaline earth metal salts include sodium, lithium, potassium, calcium, and magnesium. Further pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfons, and aryl sulfons, where appropriate.

[0143] "Solvate" has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It refers to a compound formed by the interaction of a solvent with an active pharmaceutical ingredient (or API), metabolite, or salt. A suitable solvate is a pharmaceutically acceptable solvate, including a hydrate.

[0144] As used herein, “systemic circulation” has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It refers to circulation within the blood or circulatory system of the subject.

[0145] As used herein, “enteric coating” has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It refers to a pharmaceutical excipient that coats or is placed around particles, thereby increasing the likelihood that the particles will be protected from the solvent until they reach a desired portion of the gastrointestinal tract, for example, by controlling their solubility or the timing of their dissolution, by conferring resistance to gastric acid, or by having higher solubility at neutral or basic pH. Typical enteric coatings include, for example, those described in Remington's The Science and Practice of Pharmacy, 21st Ed. Lippincott Williams & Wilkins (2005). Examples of enteric coatings include, but are not limited to, shellac, sodium alginate, zein, cellulose trimellitate acetate, methyl methacrylate-methacrylate copolymer, polyvinyl phthalate acetate, polylactic acid, polylactic acid-coglycolic acid, hypromellose acetate, hypromellose succinate acetate, hydroxypropyl methylcellulose phthalate, cellulose succinate acetate, cellulose phthalate acetate, methyl acrylate-methacrylate copolymer, polyvinyl phthalate acetate, Opadry®, and others known in the field of drug delivery and formulation. According to the methods and compositions of some embodiments, compositions comprising the compounds described herein further include enteric coatings.

[0146] As used herein, the term “enteric-selective” has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It refers to a composition or formulation that is released into the gastrointestinal tract of a subject and is preferably not absorbed, or, if absorption occurs, does not enter the systemic circulation.

[0147] As used herein, the term “essentially enteric-coated” has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. With respect to pharmaceutical formulations, it refers to a composition having the ability to prevent disintegration or release in the gastric environment.

[0148] The compositions for administration to subjects described herein are preferably provided in unit dosage forms. As used herein, “unit dosage form” has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It refers to a composition containing an amount of the compound suitable for administration to a subject in a single dose, in accordance with appropriate medical practice. However, the preparation of a single or unit dosage form does not mean that the dosage form is administered once daily or once per course of treatment. A unit dosage form may include a single daily dose or a divided dose in which several unit dosage forms are administered throughout the day to complete a daily dose. According to this disclosure, a unit dosage form may be administered more or less frequently than once daily and may be administered multiple times in the course of treatment. Such dosage forms may be administered in any manner suitable for their formulation, such as orally, rectally, intranasally and / or parenterally. Compositions administered according to the methods described herein, although single doses are particularly intended, may also be administered in the form of continuous infusion or via an implantable infusion pump.

[0149] The methods described herein can utilize any of the various appropriate forms for various routes of administration, e.g., oral, nasal, rectal, or parenteral administration routes. Depending on the desired specific route of administration, various pharmaceutically acceptable carriers known in the art can be used. Examples of pharmaceutically acceptable carriers include solid or liquid fillers, diluents, hydrotropes, surfactants, and encapsulating materials. Optional pharmaceutically active materials that do not substantially interfere with the activity of one or more compounds in the formulation may be included. The amount of carrier used with the compound is sufficient to provide a practical amount of material for administration per unit dose of the compound. The techniques and compositions for producing useful dosage forms in the methods described herein are described in the following references, namely, Modern Pharmaceutics, 4th Ed., Chapters 9 and 10 (Banker & Rhodes, editors, 2002), Lieberman et al., Pharmaceutical Dosage Forms: Tablets (1989), and Ansel, Introduction to Pharmaceutical Dosage Forms 8th Edition (2004), all of which are incorporated herein by reference.

[0150] Various oral dosage forms can be used, including solid forms such as tablets, capsules, granules, and / or bulk powders. Tablets may be compressed, powder tablets, enteric coated, sugar-coated, film-coated, or multi-compressed, containing a suitable binder, lubricant, diluent, disintegrant, colorant, flavoring agent, flow inducer, and / or melting agent. Further solid dosage forms may include crushed powder, spray-dried powder, crystalline, amorphous, and glassy forms, and may be administered as tablets or as aerosols or airborne particles, for example, for nasal or pulmonary delivery. Liquid oral dosage forms include aqueous solutions, emulsions, suspensions, solutions, and / or suspensions reconstituted from non-foaming granules, and effervescent preparations reconstituted from effervescent granules, containing a suitable solvent, preservative, emulsifier, suspending agent, diluent, sweetener, melting agent, colorant, and / or flavoring agent, or any combination thereof. Further liquid dosage forms may include forms for intranasal or pulmonary delivery. Such dosage forms may include liquids for intranasal injection, nasal lavage, lung lavage, spray, or aerosol delivery.

[0151] Pharmaceutically acceptable carriers suitable for the preparation of unit dosage forms for oral administration by methods and compositions of some embodiments herein are well known in the art. Tablets typically contain conventional pharmaceutically acceptable adjuvants as inert diluents such as calcium carbonate, sodium carbonate, mannitol, lactose and / or cellulose; binders such as starch, gelatin and / or sucrose; disintegrants such as starch, alginic acid and / or croscarmellose; and lubricants such as magnesium stearate, stearic acid, microcrystalline cellulose, carboxymethylcellulose and / or talc. Tablets may also contain solubilizers or emulsifiers, e.g., poloxamer, cremophor / Kolliphor® / Lutrol®, or methylcellulose, hydroxypropylmethylcellulose, or others known in the art, or any combination thereof. Lubricants such as silicon dioxide can be used to improve the flow properties of powder mixtures. Colorants, e.g., FD&C dyes, can be added for appearance. Sweeteners and flavorings such as aspartame, saccharin, menthol, peppermint, and / or fruit flavors, or any combination thereof, are useful adjuvants for chewable tablets. Capsules typically contain one or more of the previously disclosed solid diluents. The selection of carrier components depends on secondary considerations such as taste, cost, and storage stability, which can be readily determined by those skilled in the art.

[0152] Oral (PO) compositions according to some embodiments of the methods and compositions herein also include liquid solutions, emulsions, or suspensions. Pharmacochemically acceptable carriers suitable for the preparation of such compositions are well known in the art. Typical components of carriers for syrups, elixirs, emulsions, and / or suspensions include ethanol, glycerol, propylene glycol, polyethylene glycol, liquid sucrose, sorbitol, and / or water. For suspensions, typical suspending agents include methylcellulose, sodium carboxymethylcellulose, AVICEL RC-591, tragacanth, and / or sodium alginate; typical wetting agents include lecithin and / or polysorbate 80; and typical preservatives include methylparaben and / or sodium benzoate, or any combination thereof. Oral liquid compositions may also contain one or more components, such as sweeteners, flavorings, and / or colorants, as previously disclosed.

[0153] Such compositions may also be coated by conventional methods, typically by pH or time-dependent coatings, resulting in the release of one or more compounds of the subject into the gastrointestinal tract near the desired application or at various timings to extend the desired effect. Exemplary dosage forms for release into the gastrointestinal tract may incorporate one or more of the following: cellulose phthalate acetate, polyvinyl phthalate acetate, hydroxypropyl methylcellulose phthalate, ethylcellulose, eudragit coating, wax, alginate and / or shellac, or other excipients known to those skilled in the art, or any combination thereof. In some embodiments, the compositions administered according to the methods herein are formulated for release into the gastrointestinal tract. In some embodiments, the compositions administered according to the methods herein are formulated for release into the lower gastrointestinal tract. In some embodiments, the compositions are provided as enteric-coated capsules, tablets, soft gels, or essentially enteric-coated capsules.

[0154] The actual unit dose of a composition according to the methods and compositions of some embodiments herein depends on one or more compounds in the formulation. In some embodiments, the dose in milligrams per kilogram of body weight of the subject in the formulation may be 0.01 mg / kg to 0.05 mg / kg per day, 0.04 mg / kg to 0.1 mg / kg per day, 0.09 mg / kg to 0.15 mg / kg per day, 0.14 mg / kg to 0.2 mg / kg per day, 0.2 mg / kg to 0.5 mg / kg per day, 0.4 mg / kg to 1 mg / kg per day, 1 mg / kg to 6 mg / kg per day, 5 mg / kg to 500 mg / kg or more per day, 10 mg / kg or less to 70 mg / kg per day, 50 mg / kg to 80 mg / kg per day, 70 mg / kg to 120 mg / kg per day, 100 mg / kg to 300 mg / kg per day, or 250 mg / kg to 500 mg / kg per day. In some embodiments, the above dose may be an amount within the range defined by less than 100 mg / kg, less than 500 mg / kg, less than 300 mg / kg, less than 200 mg / kg, less than 150 mg / kg, less than 100 mg / kg, less than 50 mg / kg, less than 40 mg / kg, less than 30 mg / kg, less than 25 mg / kg, less than 20 mg / kg, less than 10 mg / kg, less than 7.5 mg / kg, less than 6 mg / kg, less than 5 mg / kg, less than 4 mg / kg, less than 3 mg / kg, less than 2.5 mg / kg, or less than 1 mg / kg, or any two of the above amounts. In some embodiments, the actual unit dose is an amount within the range defined by 5, 10, 25, 50, 75, 100, 150, or 200 mg / kg per day, or any two of the above amounts.Therefore, when administered to a person weighing 70 kg, for example, the dosage range is within the range defined by any two of the above amounts: 0.1 mg to 1 mg, 0.9 mg to 2 mg, 1.5 mg to 5 mg, 4 mg to 10 mg, 9 mg to 20 mg, 15 mg to 50 mg, 40 mg to 75 mg, 50 mg to 100 mg, 75 mg to 200 mg, 100 mg to 300 mg, 200 mg to 400 mg, 350 mg to 750 mg, 500 mg to 1 g, 750 mg to 2 g, 1 g to 5 g, 2.5 g to 6 g, 4 g to 10 g, 8 g to 20 g, 15 g to 35 g, or 1 g or less to 35 g or more. In some embodiments, the actual unit dose is 6 g. In some embodiments, the actual unit dose is 10 g. In some embodiments, the actual unit dose is 35 g. In some embodiments, the actual unit dose is 1 g or less, but not 0. In some embodiments, the actual unit dose is 10 g or less, but not zero. In some embodiments, the actual unit dose is 35 mg or less, but not zero.

[0155] As used herein, "loading dose" refers to an initial dose of a compound that is higher than the subsequent dose.

[0156] As used herein, “maintenance dose” refers to a subsequent dose following a loading dose, occurring chronologically after the loading dose. Those skilled in the art will be aware that the dosage form or mode of administration of the maintenance dose may differ from that used for the loading dose. In any of the embodiments disclosed herein, the maintenance dose may include administration of a unit dosage form on any dosing schedule contemplated herein (including, but not limited to, once or more times per month, once or more times every two weeks, once or more times per week, or once or more times per day). In this disclosure, it is intended that a drug-free period may be incorporated into the maintenance dose administration period. Such a drug-free period may be provided immediately after the administration of the loading dose or at any time during the maintenance dose administration period. As used herein, the maintenance dose administration period may be referred to as the “maintenance phase” of the treatment period.

[0157] As used herein, “mode of administration” refers to the means by which one or more compounds are administered to a subject. As used herein, “mode of administration” includes the dosage form (e.g., tablets, powders, diluents, suspensions, emulsions, etc.) and the mechanism by which the dosage form is administered to the subject (e.g., by injection, topically, e.g., by cream, lotion, or patch, e.g., orally, e.g., by pills, diluents, oral suspensions, oral films, or mouth rinses). As used herein, “mode of administration” also includes the dose, dosage, and administration schedule by which the compound is administered to the subject.

[0158] In some embodiments, the compositions administered according to the methods of the present disclosure are provided with or mixed with food, beverages, or other edible articles. In some embodiments, the beverages, food, or other edible articles may include one or more of the following: candy, applesauce, yogurt, soft pudding, gelatinous food, juice, milk, soy or nut beverage, thickening beverage, or cheese, or any combination thereof. Those skilled in the art will readily understand that combinations of compositions administered according to the methods of the present disclosure can be combined with any suitable food or beverage to facilitate the consumption of the compositions.

[0159] In some embodiments, the methods and compositions of some embodiments of this specification include administering a maintenance dose after administering a loading dose. In some embodiments, the loading dose is an amount within the range defined by 20 g or less but not 0, 15 g or less but not 0, 10 g or less but not 0, 6 g or less but not 0, 4 g or less but not 0, 2 g or less but not 0, or 1 g or less but not 0, or any two of the aforementioned amounts. In some embodiments, the maintenance dose is an amount within the range defined by 20 g or less but not 0, 10 g or less but not 0, 6 g or less but not 0, 4 g or less but not 0, 2 g or less but not 0, 1 g or less but not 0, 500 mg or less but not 0, or 250 mg or less but not 0, or any two of the aforementioned amounts.

[0160] In some embodiments, according to the methods and compositions of some embodiments herein, the loading dose is administered over a period of 1 day or 24 hours. In some embodiments, the loading dose is administered as a single dose. In some embodiments, the loading dose is administered in multiple doses. In some embodiments, the loading dose is administered in multiple doses over a period of 1 day or 24 hours. In some embodiments, the loading dose is administered over 2 days. In some embodiments, the loading dose is administered over 3 days. In some embodiments, the loading dose is administered over 4 days. In some embodiments, the loading dose is administered over 5, 6, or 7 days. In some embodiments, the loading dose is administered over a period of 8 to 14 days or less. In some embodiments, the loading dose is administered over 14 days.

[0161] The methods described herein are intended to modify or control the timing of administration of the compositions described herein in order to enhance the effectiveness of any treatment administered. In some embodiments, the compositions administered according to the methods described herein may be administered with food, for example, simultaneously with a meal or other intake of food. In some further embodiments, the compositions administered according to the methods described herein may be administered immediately before or after a meal or other intake of food. In some further embodiments, the compositions administered according to the methods described herein may be administered within 1 to 5 minutes, 3 to 10 minutes, 6 to 15 minutes, 10 to 20 minutes, 15 to 30 minutes, 20 to 45 minutes, or within 1 hour before or after a meal or other intake of food. In some embodiments, the compositions administered according to the methods described herein may be administered without food, for example, 1 to 3 hours before or after, 2 to 5 hours before or after, 4 to 8 hours before or after, 6 to 12 hours before or after, 9 to 18 hours before or after, 12 to 24 hours before or after, or more than 24 hours before or after a meal or other intake of food.

[0162] As used herein, “duration of treatment” means the time from the administration of the first dose to the administration of the final dose, which is determined by a person skilled in the art to treat neuropathy or disorders involving increased intestinal permeability or “leaky gut,” with reference to the symptoms and health condition of the subject being treated. Such duration may be determined by reference to periodic, sporadic, or continuous monitoring of amyloid levels, as disclosed herein or known to a person skilled in the art to treat neuropathy.

[0163] As used herein, “drug-free period” refers to a period of 24 hours or longer during which the subject receives no dose or a reduced dose. As used herein, “reduced dose” refers to a dose less than the total daily dose that would be administered to the subject.

[0164] According to this disclosure, the administration schedule can be modified to achieve the desired therapeutic effect. In each embodiment disclosed herein, modifications to the administration schedule may be repeated throughout the entire duration of the treatment protocol being implemented. In each embodiment disclosed herein, the first dose may be greater than, less than, or the same as subsequent doses. In each of the embodiments disclosed herein, the loading dose may precede the disclosed drug regimen, and the drug-free period may or may not follow the administration of the loading dose.

[0165] In some embodiments, the methods of the Disclosure include administering one or more compositions provided herein daily or less frequently, for example, every two days, every three days, every four days, every five days, every six days, or every seven days, or over a period of time defined by any two of the aforementioned intervals. In some embodiments, the compositions described herein are formulated for such administration.

[0166] According to the methods disclosed herein, treatment or inhibition of disorders involved in amyloid formation may be achieved by adjusting the administration schedule for the administration of the composition, so that the subject experiences intermittent, partial, or complete reduction of the drug over a period of time, followed by a resumption of the drug. In some embodiments, the dose is administered daily for 1 to 30 days, followed by a drug-free period of 1 to 30 days. In some embodiments, no dose is administered during the drug-free period. In some further embodiments, the composition of the Disclosure may be completely removed from the subject's body before the administration of the next dose. In some other embodiments, a dose less than the usual daily dose is administered during the drug-free period. In some further embodiments, it is possible for an amount less than a therapeutically effective amount of the administered composition to remain in the subject during the drug-free period. In some further embodiments, it is possible for an amount sufficient to maintain a therapeutic level of the administered composition in the affected tissue to remain in the subject. In some embodiments, the composition is administered at any point after the onset of one or more of the aforementioned symptoms of amyloid formation-related neurological disorders. In some embodiments, the composition according to the methods described herein is administered before the onset of one or more of the symptoms of the above disorders. In some embodiments, compositions according to the methods described herein are administered simultaneously with or after the onset of one or more symptoms of the above-mentioned disorder.

[0167] How to use This disclosure provides methods for inhibiting, improving, reducing the likelihood of, delaying the onset of, treating and / or preventing amyloid disorders, including methods for inhibiting or interfering with one or more of the following: (1) aggregation of bacterial amyloid on bacterial surfaces or in the proximal extracellular space; (2) interaction between bacterial amyloid and α-synuclein in the gastrointestinal tract or olfactory system (including enteroendocrine cells and enteric nerve cells); and / or (3) aggregation of α-synuclein in the gastrointestinal tract (including enteroendocrine cells and enteric nerve cells).

[0168] According to the methods of this disclosure, α-synuclein should be considered a representative amyloid protein of a broader range of known host amyloid proteins, including one or more of the following: beta-amyloid, mezin, tau, apolipoprotein AI, atrial natriuretic factor, beta-amyloid, cystatin, IAPP (amylin), beta-2 microglobulin, transthyretin, PrP, gelzolin, lysozyme, huntingtin, keratoepithelin, calcitonin, prolactin, serum amyloid A, superoxide dismutase 1 (SOD1), and / or immunoglobulin light chain AL. The compositions and methods disclosed herein can be adapted by those skilled in the art to inhibit the aggregation of any amyloid protein (bacterial or human) that promotes the aggregation of another amyloid protein.

[0169] Representative amyloidogenesis-presenting disorders and proteins involved in these disorders that can be inhibited or interfered with using the methods disclosed herein include, but are not limited to, those disclosed in Table 2. [Table 2]

[0170] The compositions and methods of the present invention can also be used to treat amyloid-mediated disorders of the gastrointestinal tract, such as intestinal dysbiosis, increased intestinal permeability, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, and / or Crohn's disease. These disorders may be associated with one or more symptoms, including dysphagia, decreased bowel motility, gastroparesis, constipation (including chronic constipation and chronic idiopathic constipation), small intestinal bacterial overgrowth (SIBO), diarrhea, abdominal pain and / or cramps, bloating, flatulence, excessive salivation, anorectal dysfunction, defecation dyscoordination, and nausea.

[0171] As used herein, the term “intestinal dysbiosis” has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure, and refers to an imbalance and / or maladjustment of the bacterial or microbiome of the gastrointestinal tract or intestines, particularly the small intestine. Such dysbiosis is characterized by a change in the composition of the species / strains present in the intestinal or gastrointestinal microbiome, and / or a change in the relative abundance or proportion of the species / strains present, the change having adverse effects on the host organism. Adverse effects on the host organism may result from changes in microbiome-mediated electrolyte balance, biofilm formation, integrity of the barrier formed by the intestinal epithelium, or the release of metabolites from the microbiome that are harmful directly (e.g., as toxins or effectors) or indirectly (e.g., as precursors to toxins or effectors) to the health of the host.

[0172] As used herein, the term “increased intestinal permeability” has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It refers to the abnormally increased permeability of the barrier formed by the lining of the intestinal epithelium between the intestinal lumen and the surrounding tissue. Such hyperpermeability may result from inflammation of the lining of the intestinal tract and / or failure of tight junctions between cells of the intestinal epithelium, thereby allowing substances to pass from the lumen into the surrounding tissue, some of which may enter the peritoneal cavity and / or the systemic circulation. Due to this leakage of substances from the gastrointestinal tract or intestinal lumen, increased intestinal permeability is sometimes referred to as “leaky gut” or “leaky gut syndrome.”

[0173] As used herein, the term “amyloid disorder” (including variations of the root term) includes, but is not limited to, any or all of the disorders listed in Table 2, as well as amyloid-mediated disorders of the gastrointestinal tract.

[0174] As used herein, the term “mammalian amyloid or mammalian amyloid precursor” includes, but is not limited to, one or more of the following: tau, beta-amyloid derived from amyloid precursor proteins, mezin, apolipoprotein AI, atrial natriuretic factor, beta-amyloid, cystatin, IAPP (amylin), beta-2 microglobulin, transthyretin, PrP, gelzolin, lysozyme, huntingtin, keratoepithelin, calcitonin, prolactin, serum amyloid A, and / or immunoglobulin light chain AL. In certain methods and compositions disclosed herein, the above-mentioned microbial amyloid or microbial amyloid precursor includes CsgA.

[0175] The terms "amyloid aggregates" and "amyloid protein aggregates" are used interchangeably.

[0176] Some embodiments include methods for inhibiting, improving, reducing the likelihood of, delaying the onset of, treating or preventing amyloid disorders, the methods including administering compositions described herein to subjects in need thereof. Amyloid disorders may be selected from the group consisting of alpha-synucleinopathy, Parkinson's disease, Lewy body dementia, incidental Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, and pure autonomic dysfunction, or any combination thereof. Amyloid disorders may be selected from the group consisting of intestinal dysbiosis, increased intestinal permeability, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, or Crohn's disease. In some embodiments, the compositions administered by the Method include, essentially consist of, or comprise any of the compounds in Table 1. In some embodiments, the compositions administered by the Method include, essentially consist of, or comprise any of the compounds described herein. In some embodiments of the Method, the amyloid disorder includes intestinal amyloid aggregates. For example, the aggregates may contain bacterial proteins, such as curli-related proteins like CsgA. Therefore, in some embodiments, the method further includes detecting the presence or level of such bacterial proteins in the target intestinal sample, the presence or level of nucleic acids encoding microbial (e.g., bacterial) proteins, or the level of microorganisms producing bacterial proteins (e.g., curli-related proteins like CsgA) in the target intestinal sample, such as a fecal sample. For example, proteins can be detected by immunoassays such as ELISA, Western blotting, lateral flow assays, and no-wash assays. For example, microorganisms producing microbial proteins can be detected by nucleic acid analysis (qualitative or quantitative PCR, microarray analysis, or sequencing). For example, nucleic acids encoding microbial proteins can be detected by qualitative or quantitative PCR, microarray analysis, sequencing, or branched DNA analysis.A subject can be identified as requiring the composition by the presence of protein-producing bacterial proteins or microorganisms in the intestines, or by the level of bacterial proteins (or microorganisms producing such proteins) being higher than that of a control. For example, suitable controls may include subjects that are negative for bacterial proteins (or microorganisms producing bacterial proteins), such as healthy individuals, or individuals identified as not having bacterial proteins (or microorganisms producing bacterial proteins) in their intestines. In some embodiments, the method includes detecting the presence or level of intestinal curli (or curli-related proteins such as CsgA) in a sample of the subject, or the intestinal level of microorganisms producing intestinal curli-related proteins (such as CsgA). In some embodiments, the subject is identified as a member of a subpopulation of subjects with amyloid damage and requiring the composition. In some embodiments, the method further includes confirming a decrease or absence of intestinal amyloid aggregates after administration. In some embodiments, the method further includes confirming a decrease or absence of intestinal amyloid proteins after administration.

[0177] In some embodiments, the compositions of this disclosure inhibit the formation of α-synuclein aggregates (e.g., fibrils, Lewy bodies, or other aggregates) or other host amyloids at the point of their initiation in the gastrointestinal tract, thereby reducing microorganism-induced amyloid aggregation, which is thought to function as a template or seed for α-synuclein or other host amyloid aggregation, and can reduce it without crossing the blood-brain barrier. Targeting α-synuclein or other host amyloid aggregation in the gastrointestinal tract eliminates the need for the drug to cross the blood-brain barrier, resulting in efficacy at lower doses and fewer side effects due to reduced systemic exposure. Furthermore, targeting α-synuclein or other host amyloid aggregation at the point of its initiation allows for intervention in the early stages of the disease process, preventing or inhibiting disease progression before motor symptoms or other neurodegenerative symptoms develop. For example, according to compositions and methods of some embodiments herein, gastrointestinal dysfunction can be addressed and / or improved by targeting α-synuclein aggregation in the gastrointestinal tract, which may include, for example, dysphagia, decreased bowel motility, gastroparesis, constipation (including chronic constipation and chronic idiopathic constipation), small intestinal bacterial overgrowth (SIBO), diarrhea, abdominal pain and / or cramps, bloating, flatulence, nausea or any other symptom of irritable bowel syndrome (IBS), inflammatory bowel disease (IBD, e.g., ulcerative colitis and Crohn's disease), increased intestinal permeability, increased salivation (excessive salivation), anorectal dysfunction, defecation coordination disorder, or any combination of these.

[0178] In addition to targeting host amyloid aggregation in the brain as an approach to treat or inhibit neurodegenerative diseases, targeting bacterial amyloid aggregation provides novel therapeutic options for infectious diseases such as urinary tract infections (UTIs). In both cases, the compounds described herein have been identified as having the ability to inhibit the amyloid aggregation process in the tissue of interest (e.g., the brain for α-synuclein, and the urinary mucosa for UTIs).

[0179] In some embodiments, the compositions and methods of the present disclosure intend to use the compounds described herein as inhibitors of interactions between host amyloid, such as α-synuclein, and bacterial amyloid, such as Curli or adhesive cilia. In some embodiments, the compositions and methods of the present disclosure intend to use the compounds described herein as inhibitors of host amyloid aggregation and / or promoters of amyloid deaggregation in peripheral tissues such as the gastrointestinal tract or nasopharynx, rather than in the brain. The compositions and methods of the present disclosure further intend to use modified derivatives of the compounds described herein that act locally in the gastrointestinal tract and are not essentially absorbed into peripheral tissues, for example, parenteral bioavailable derivatives that retain amyloid inhibitory activity but do not pass through the gastrointestinal epithelium or enter the primary circulation.

[0180] In some embodiments, the compositions and methods of the present disclosure are intended to provide formulations that enable delivery of the compositions to sites of action in the lower small intestine, large intestine, and / or colon. The formulations may include enteric-coated tablets, capsules, liquid gels, or powders, such as those that inhibit the release of the drug in the stomach or upper GI duct. Alternatively, the compositions may include endogenous enteric-coated capsules or similar solid dosage forms, the capsule compositions comprising polymers or materials that dissolve at or near the site of action, and may include, for example, EnTrinsic® endogenous enteric-coated capsules that dissolve preferably in the lower GI duct, more specifically in the lower small intestine, large intestine, or colon. In some embodiments, the compositions are not absorbed and remain in the GI duct.

[0181] The compositions and methods of this disclosure intend to provide intestinal restricting small molecule inhibitors that target one or more elements of amyloid formation. Exemplary compounds of the present invention include polyphenol moieties, many of which are orally bioavailable. The compositions and methods of this disclosure also intend to provide intestinal selective or intestinal restricting parenterally absorbable derivatives of non-polyphenol classes known to have the ability to inhibit amyloid formation. The compositions and methods of this disclosure further intend to provide parenterally absorbable intestinal selective derivatives or formulations of the polyphenol or non-polyphenol compounds described above.

[0182] As used herein, “Subject” has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It refers to human or non-human mammals, including but not limited to dogs, cats, horses, donkeys, mules, cattle, domesticated buffalo, camels, llamas, alpacas, bison, yaks, goats, sheep, pigs, moose, deer, domesticated antelopes, or non-human primates, selected or identified for the diagnosis, treatment, inhibition, or improvement of neurological disorders or neurological conditions associated with microbially induced amyloid, such as Parkinson’s disease, Lewy body disease, accidental Lewy body disease, Lewy body variants of Alzheimer’s disease, multiple system atrophy, pure autonomic dysfunction, intestinal dysbiosis, increased intestinal permeability, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, Crohn’s disease, or any combination thereof.

[0183] "Diagnosing" has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It may mean the act or process of determining whether the subject exhibits any symptoms or signs of a neurological disorder or neurodegenerative condition associated with microorganism-induced amyloid, such as Parkinson's disease, Lewy body dementia, accidental Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, pure autonomic dysregulation, or any combination thereof. It may also mean the act or process of determining whether the subject exhibits any symptoms or signs of a gastrointestinal disorder associated with microorganism-induced amyloid, such as intestinal dysbiosis, increased intestinal permeability, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, and / or Crohn's disease. Diagnosing may further include determining whether the body of the subject or any of its tissues, fluids, components, organs, or parts contain microorganism-induced amyloid. Diagnosis may further include determining whether the body in question, or any of its tissues, fluids, components, organs, or parts, contains any factor that may affect the rate of amyloid aggregation or deaggregation.

[0184] "Subject suspected of having" has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It refers to a subject exhibiting one or more clinical signs of a disease or condition. In certain embodiments, the disease or condition may include one or more of the following: Parkinson's disease, Lewy body dementia, accidental Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, pure autonomic dysfunction, or any combination thereof. In some embodiments, the above-mentioned disorder may be selected from the group consisting of intestinal dysbiosis, increased intestinal permeability, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, or Crohn's disease.

[0185] "Subjects requiring it" has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It refers to subjects selected or identified as requiring the diagnosis of a disorder related to amyloid formation, or the treatment, inhibition, or improvement of a neurological disorder or neurodegenerative disorder related to microorganism-induced amyloid, such as Parkinson's disease, Lewy body dementia, accidental Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, pure autonomic dysregulation, or any combination thereof. In other embodiments, the disorders may be selected from the group consisting of intestinal dysbiosis, increased intestinal permeability, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, or Crohn's disease.

[0186] "Bacteria" and "microorganisms" (and related terms "bacterial" and "microbial") are, as used herein, terms recognized in the art, encompassing bacteria, fungi, viruses, protists, archaea, and the like.

[0187] As used herein, “microbe-induced amyloid” has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It refers to amyloid fibrils or aggregates produced by the contact of a mammalian or microbial protein with one or more microbial proteins. The microbial proteins may include one or more proteins of bacterial or fungal origin, but this disclosure intends amyloid produced by interaction with proteins of bacteriophage, virus, bacteria, archaea, fungi, and other eukaryotes, regardless of their origin.

[0188] "Therapeutic effect" has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It includes alleviating to some extent the symptoms of one or more diseases or disorders, and curing a disease or disorder. "Cure" means that the symptoms of an active disease are eliminated. However, even after a cure has been achieved, certain long-term or permanent effects of the disease may remain (such as tissue damage).

[0189] "Improvement" has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It refers to a reduction in the severity of at least one sign of a condition or disease. In certain embodiments, improvement includes a delay or slowing of the progression of one or more signs of a condition or disease. The severity of a sign can be determined by subjective or objective measures known to those skilled in the art.

[0190] "Modification" has its customary and ordinary meaning as understood by those skilled in the art in view of this disclosure. It means the presence, absolute level, relative level, function or activity of any factor in the body of the subject or any tissue, fluid, component, organ or part thereof. In certain embodiments, modulation means an increase in gene expression. In certain embodiments, modulation means a decrease in gene expression. In certain embodiments, modulation means an increase or decrease in the total serum level of a particular protein. In certain embodiments, modulation means an increase or decrease in the free serum level of a particular protein. In certain embodiments, modulation means an increase or decrease in the aggregated state of a protein. In certain embodiments, modulation means increasing or decreasing the stability of amyloid fibrils. In certain embodiments, modulation means increasing or decreasing the length, width, spacing or density of amyloid fibrils. In certain embodiments, modulation means an increase or decrease in the total serum level of a particular non-protein factor, e.g., metabolites. In certain embodiments, modulation means an increase or decrease in the free serum level of a particular non-protein factor. In certain embodiments, modulation means an increase or decrease in the total bioavailability of a particular protein. In certain embodiments, regulation refers to an increase or decrease in the total bioavailability of a particular non-protein factor. In certain embodiments, regulation refers to a change in the aggregation state of a protein. In certain embodiments, regulation refers to a change in the rate or degree of aggregation or deaggregation of microorganism-induced amyloid.

[0191] In some compositions and methods of some embodiments of this disclosure, subjects are selected or identified to receive administration of the compositions described herein. In some embodiments, subjects are selected or identified as having high levels of Curli in the gastrointestinal tract. Such selection can be made by clinical or diagnostic evaluation. In some embodiments, subjects are selected or identified as having high levels of microorganism-induced amyloid in the gastrointestinal tract. Such selection can also be made by clinical or diagnostic evaluation. In some embodiments, subjects are selected or identified as having high levels of α-synuclein in the gastrointestinal tract. Similarly, such selection can be made by clinical or diagnostic evaluation. In some further embodiments, the subject exhibits one or more symptoms of neurodegenerative disorders, such as anosmia, osmotic dysfunction, bradykinesia, ataxia, tremor, muscle rigidity, postural and balance disorders, loss of automatic movement, dysarthria or other speech alterations, altered handwriting, orthostatic hypotension, memory impairment, dysphagia, incontinence, sleep disorders, cardiac arrhythmias, visual impairment, psychiatric problems including depression and hallucinations of sight, hearing, smell or touch, dizziness, cognitive impairment, altered dopamine levels, altered serotonin levels, and / or altered kynurenine levels, gastroparesis, anorectal dysfunction, defecation coordination disorder, or any combination thereof. In some embodiments, the subject is diagnosed with amyloid disorder according to methods known in the field of diagnosis of neurological disorders and amyloid disorders. In some further embodiments, the subjects are diagnosed with or at risk of having Lewy body dementia, accidental Lewy body disease, Lewy body variant of Alzheimer's disease, multiple system atrophy, pure autonomic dysfunction, or any combination thereof. In some embodiments, the subjects further exhibit gastrointestinal symptoms. In some further embodiments, the gastrointestinal symptoms may include one or more other symptoms of constipation, diarrhea, abdominal pain and / or cramps, bloating, flatulence, nausea, or any other symptoms of irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, increased intestinal permeability, or any other symptoms of any combination thereof.

[0192] In some embodiments, the compound or pharmaceutical composition is administered before the onset of neurological symptoms or conditions such as anosmia, osmotic dysfunction, bradykinesia, ataxia, tremor, muscle rigidity, postural and balance disorders, loss of automatic movement, dysarthria or other speech alterations, altered handwriting, orthostatic hypotension, memory impairment, dysphagia, incontinence, sleep disorders, cardiac arrhythmias, visual disturbances, psychiatric problems including depression and hallucinations of the visual, auditory, olfactory or tactile senses, dizziness, cognitive impairment, altered dopamine levels, altered serotonin levels, altered kynurenine levels, and / or any combination thereof.

[0193] In some embodiments of the compositions and methods of this disclosure, the subject selected for treatment may be under 18 years of age. In some embodiments, the subject selected for treatment may be between 17 and 30 years of age. In some embodiments, the subject selected for treatment may be between 29 and 50 years of age. In some embodiments, the subject selected for treatment may be between 49 and 60 years of age. In some embodiments, the subject selected for treatment may be between 59 and 70 years of age. In some embodiments, the subject selected for treatment by the compositions and methods described herein may be over 69 years of age.

[0194] In some embodiments of the present disclosure, the administration of one or more of the compositions described herein results in an effect that prevents the formation of amyloid or microorganism-induced amyloid in the gastrointestinal tract, nasal cavity, olfactory bulb, or enteric nerve tissue, or promotes the deaggregation of amyloid or microorganism-induced amyloid, for example, without crossing the blood-brain barrier. In some embodiments, the administration of one or more of the compositions described herein results in an effect that inhibits further aggregation of amyloid or microorganism-induced amyloid in the gastrointestinal tract, nasal cavity, olfactory bulb, or enteric nerve tissue, for example, without crossing the blood-brain barrier. In some embodiments, the administration of one or more of the compositions described herein results in an effect that causes or enhances the deaggregation of amyloid or microorganism-induced amyloid in the gastrointestinal tract, nasal cavity, olfactory bulb, or enteric nerve tissue, for example, without crossing the blood-brain barrier. In some embodiments, the administration of one or more of the compositions described herein results in an effect that causes or enhances the deaggregation of existing amyloid or microorganism-induced amyloid in the gastrointestinal tract, nasal cavity, olfactory bulb, or enteric nerve tissue, for example, without crossing the blood-brain barrier. In some embodiments, administration of one or more of the compositions described herein provides the effect of preventing the onset of one or more symptoms of one or more neurological or neurodegenerative disorders. In some embodiments, administration of one or more of the compositions described herein provides the effect of improving one or more symptoms of one or more neurological or neurodegenerative disorders. In some embodiments, administration of one or more of the compositions described herein provides the effect of reversing one or more symptoms of one or more neurological or neurodegenerative disorders. In some embodiments, the one or more symptoms of one or more neurological disorders include one or more of the following: anosmia, osmosis, bradykinesia, ataxia, tremor, muscle rigidity, postural and balance disorders, loss of automatic movement, dysarthria or other speech alterations, altered handwriting, orthostatic hypotension, memory impairment, dysphagia, incontinence, sleep disorders, cardiac arrhythmias, visual disturbances, psychiatric problems including depression and hallucinations of sight, hearing, smell or touch, dizziness, cognitive impairment, altered dopamine levels, altered serotonin levels, and / or altered kynurenine levels, gastroparesis, anorectal dysfunction, defecation coordination disorder, or any combination thereof.In some embodiments, the one or more neurological disorders described above may include amyloid disorders. In some further embodiments, the one or more neurological disorders described above may include one or more of Lewy body dementia, accidental Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, and / or pure autonomic dysfunction, or any combination thereof.

[0195] In other embodiments, the inhibitor of amyloid formation may be for systemic or topical administration to the intestine of the central nervous system. For example, an inhibitor effective against the aggregation of mammalian amyloid or mammalian amyloid precursor protein may be useful for the treatment of one or more of the amyloid disorders described herein (Table 2). Accordingly, in such embodiments, the composition comprising the inhibitor of amyloid formation may be formulated for parenteral administration, including systemic administration (e.g., intravenous, subcutaneous, intramuscular, intraperitoneal) or topical administration (e.g., local injection near the vagus nerve, intrathecal injection, or intracranial injection). For delivery to the CNS, the inhibitor must cross the blood-brain barrier. Accordingly, in such embodiments, the inhibitor may preferably be a lipid-soluble molecule, or may be modified to increase its lipid solubility, or may be administered co-administered with a compound that enhances crossing of the blood-brain barrier (see, for example, International Publication Nos. 2014076655, 2012159052, and 1992018529).

[0196] In some embodiments of the present disclosure, the levels of amyloid and / or microorganism-induced amyloid in the tissue, body fluid, or feces of the subject are monitored or evaluated during the course of treatment. In some further embodiments, the levels of amyloid and / or microorganism-induced amyloid are monitored before and / or after the course of treatment. In some embodiments, the levels of α-synuclein in the tissue, body fluid, or feces of the subject are monitored during the course of treatment. In some embodiments, the levels of α-synuclein are monitored before and / or after the course of treatment. In some embodiments, the measurements of amyloid, microorganism-induced amyloid, and / or α-synuclein are measured in a fecal sample obtained from the subject. In some embodiments, the measurements of amyloid, microorganism-induced amyloid, and / or α-synuclein are measured in a tissue sample obtained from the subject. In some embodiments, the measurements of amyloid, microorganism-induced amyloid, and / or α-synuclein are measured in a tissue sample obtained from the subject. In some embodiments, the tissue sample includes intestinal epithelium, peritoneum, enteric nerve tissue, olfactory tissue, nasal endothelium, paranasal sinus endothelium, brain, and / or nerve tissue. In some embodiments, the tissue sample includes cerebrospinal fluid or synovial fluid. In some embodiments, the tissue sample includes blood, lymph, or plasma.

[0197] Methods for identifying compounds A method for identifying compounds that alter the ability of bacterial amyloid to promote the aggregation and amyloid formation of the eukaryotic protein α-synuclein is disclosed herein. A method for screening entities useful for the treatment or inhibition of neurodegenerative diseases, and a method for screening entities useful for the prevention or improvement of the progression of neurodegenerative diseases are further disclosed herein. A method for screening entities useful for the treatment or inhibition of gastrointestinal dysfunction associated with neurodegenerative diseases is further disclosed herein. A method for studying the molecular pathogenesis of mammalian amyloid diseases and the molecular relationship between bacterial amyloid production and mammalian amyloid production is further disclosed herein. According to the methods of this disclosure, the neurodegenerative diseases and / or mammalian amyloid diseases described herein may include Parkinson's disease (PD), Lewy body dementia, multiple system atrophy, multiple sclerosis (MS), frontotemporal dementia (FTD), REM sleep behavior disorder (RBD), alpha-synucleinopathy, PD-related constipation, PD-related hypotension, Huntington's disease, Alexander disease, amyotrophic lateral sclerosis (ALS), or Alzheimer's disease, and other diseases involving amyloid.

[0198] The methods disclosed herein include a series of in vitro assays that measure one or more of the following: (1) aggregation of bacterial amyloid on the bacterial surface or in the proximal extracellular space; (2) interaction between bacterial amyloid and α-synuclein in the gastrointestinal tract or olfactory system (including enteroendocrine cells and enteric nerve cells); or (3) aggregation of α-synuclein in the gastrointestinal tract (including enteroendocrine cells and enteric nerve cells). According to the methods disclosed herein, α-synuclein should be considered a representative amyloid protein of a broader range of known mammalian amyloid or mammalian amyloid precursor proteins, and the methods disclosed herein can be adapted by those skilled in the art to evaluate the aggregation of any amyloid protein in which one amyloid protein (bacterial or human) causes the aggregation of another amyloid protein. Representative disorders presenting amyloid formation and the proteins involved in these disorders can be evaluated using the methods disclosed herein and include, but are not limited to, those disclosed in Table 2. Accordingly, in some embodiments, the method includes contacting multiple concentrations of microbial amyloid or microbial amyloid precursor with multiple concentrations of α-synuclein and / or other mammalian amyloid or mammalian amyloid precursor in the presence of the composition, analyzing or measuring the formation or deaggregation of amyloid after the above reaction, and comparing the above analysis or measurement with the analysis or measurement of a control, the control including analyzing or measuring the formation of amyloid after the above reaction in the absence of the composition. In certain methods and compositions disclosed herein, the microbial amyloid or microbial amyloid precursor comprises CsgA.

[0199] In some embodiments, the methods according to the present disclosure are intended to contact microbial amyloid or microbial amyloid precursor (e.g., a composition containing CsgA) with various concentrations of mammalian amyloid or mammalian amyloid precursor in the presence of a composition, the composition comprising a compound or mixture to be tested for its ability to inhibit amyloid formation or to enhance amyloid deaggregation. In some further embodiments, the above combinations of microbial amyloid or microbial amyloid precursor, mammalian amyloid or mammalian amyloid precursor, and the test composition are analyzed or measured for changes in the amount of amyloid present. In some further embodiments, the rate and / or extent of amyloid formation in the above combinations of microbial amyloid or microbial amyloid precursor, mammalian amyloid or mammalian amyloid precursor, and the test composition are compared to the rate of amyloid formation in a control sample lacking the composition. In some embodiments, the rate of amyloid formation is measured. In some further embodiments, the total amount of amyloid formation is measured. In some further embodiments, the assay temperature is varied to measure the stability of newly formed amyloid fibrils compared to those formed under innate conditions. In some embodiments, the method is carried out by placing the composition in the wells of a multiwell assay plate. In some further embodiments, the method according to the present disclosure is carried out in the presence of a physical agitator. In some further embodiments, the physical agitator includes glass, Teflon®, or polymer beads. In some further embodiments, the polymer beads may include polystyrene, polylactic acid, polylactic acid-co-glycolic acid, polycarbonate, or polytetrafluoroethylene (Teflon®) beads. In some embodiments, the beads or objects used for agitation have a maximum dimension of 10 to 1000 μm.In some embodiments, the beads or objects used for stirring have a maximum dimension of 10-100 μm, 80-200 μm, 180-300 μm, 280-400 μm, 380-500 μm, 480-600 μm, 580-700 μm, 680-800 μm, 780-900 μm, or 880-1000 μm. In some embodiments, the beads or objects used for stirring have a maximum dimension of more than 1 mm. In some embodiments, the beads or objects used for stirring have a maximum dimension of less than 10 mm. In certain embodiments, the beads or objects are 1-3 mm, 1-5 mm, 2-5 mm, 3-5 mm, 4-5 mm, 5-6 mm, 5-7 mm, 5-8 mm, 5-9 mm, 5-10 mm, 2-10 mm, 4-10 mm, 6-10 mm, or 8-10 mm. In a particular embodiment, the beads or objects have a maximum dimension of 1 mm, 2 mm, 3 mm, 4 mm, 5 mm, 6 mm, 7 mm, 8 mm, 9 mm, or 10 mm.

[0200] In some embodiments, the microbial amyloid or microbial amyloid precursor comprises CsgA, the major protein component of Curli, also known as adhesive cilia, or any analogue or homolog thereof. In some embodiments, the microbial amyloid or microbial amyloid precursor comprises CsgB, which is the core of the conversion of CsgA to its amyloid form or the polypeptide derived therefrom. In some embodiments, the mammalian amyloid or mammalian amyloid precursor comprises α-synuclein.

[0201] In some embodiments, contact between microbial amyloid or microbial amyloid precursor (e.g., a composition containing CsgA) and various concentrations of mammalian amyloid or mammalian amyloid precursor is carried out in the presence of an amyloid formation indicator. In some further embodiments, the indicator may include a fluorescent indicator, the fluorescence intensity of which varies in correlation with the amount of amyloid present in the sample. This variation may be caused by a change in fluorescence related to a change in the molecular environment involving the intervention of the label on the amyloid fibrils. In some further embodiments, the indicator may include thioflavin T (ThT). In some embodiments, a label bound to an amyloid precursor molecule may exhibit a change in emission intensity or wavelength due to intermolecular fluorescence quenching or fluorescence resonance energy transfer that correlates with amyloid fibril formation. Exemplary fluorescent labels are disclosed in the Molecular Probe Handbook (Invitrogen, Inc., 2010), which is incorporated herein by reference with respect to its teachings on FRET pairs, fluorescence quenching, and fluorescent probes conjugateable to proteins. Other exemplary fluorescent labels may include, but are not limited to, fluorescent proteins such as green fluorescent protein (GFP), yellow fluorescent protein (YFP), AmCyan1, AsREd2, mBanana, mCherry, Dendra2, DsRed2, DsRed-express, DsRed-monomer, DsRed, E2-Crimson, GFP-UV, blue fluorescent protein (BFP), HcRed1, mOrange, PAmCherry, mPlum, mRaspberry, mStrawberry, tdTomato, ZsGreen1, ZsYellow1, or AcGFP1, or derivatives thereof, or other fluorescent proteins known in the art. In some further embodiments, labels bound to mammalian amyloid precursors differ from labels bound to bacterial amyloid or bacterial amyloid precursors. In some embodiments, bacterial amyloid or bacterial amyloid precursors are unlabeled. In some embodiments, mammalian amyloid, mammalian amyloid precursors, bacterial amyloid precursors, or bacterial amyloid include two or more labels.In some further embodiments, the indicator may include a colorimetric indicator, a spin label (e.g., 3H, 15N, or 13C), a metal ion-binding compound (e.g., porphyrin, chelating agent, polyhistidine, or other metal-binding polypeptide), an enzyme, or an amyloid-specific antibody. In some embodiments, the development of amyloid fibrils is directly observed by optical microscopy. In some embodiments, amyloid formation is observed by direct light transmission or by reflectance. In some embodiments, amyloid formation is observed by total internal reflection FTIR. In some embodiments, amyloid formation is observed by NMR, FTIR, SPIR, or SPR spectroscopy. In some embodiments, amyloid formation is observed and / or confirmed by optical birefringence. In some embodiments, the sample is stained with Congo red dye before visualization. In some embodiments, amyloid formation is observed by Raman scattering. In some embodiments, amyloid formation is observed by monitoring changes in the internal fluorescence of a sample, for example, changes resulting from internal tryptophan, tyrosine, phenylalanine, histidine, and arginine residues. In some embodiments, amyloid formation is observed by monitoring the binding of an amyloid-specific antibody by means known in the art, for example, by fluorescent labeling, colorimetric labeling, spin labeling, radioisotopes, and conjugation of the antibody to enzymes, fluorescent proteins, metal-binding domains, or by other methods known to those skilled in the art for the detection or visualization of the antibody. According to the methods described herein, the antibody may include an antibody having selective binding activity to either amyloid or amyloid precursors.

[0202] In some embodiments, the method of the present disclosure may be carried out by monitoring the dynamics of the fluorescence intensity of an amyloid-specific dye in the presence of a mammalian amyloid precursor and one or more bacterial amyloid precursors or aggregates. In some embodiments, the mammalian amyloid precursor is α-synuclein. In some embodiments, the bacterial amyloid precursor or aggregate is CsgA. In some embodiments, the amyloid-specific dye is thioflavin T.

[0203] In some embodiments, this disclosure intends to provide a kit for carrying out the methods described herein. In some embodiments, the kit comprises at least mammalian amyloid or mammalian amyloid precursor, bacterial amyloid or bacterial amyloid precursor, and an amyloid formation indicator as described herein, which may or may not be conjugated to the mammalian amyloid or mammalian amyloid precursor, bacterial amyloid or bacterial amyloid precursor, and one or more reaction vessels. The kit may comprise a multiwell plate. The kit may further comprise instructions for carrying out the methods described herein.

[0204] The methods disclosed herein provide a method for screening candidate compounds to identify compounds that modulate the aggregation and / or deaggregation of amyloid, particularly microbially induced amyloid. In some embodiments, the methods disclosed herein include screening a library of candidate compounds. In some further embodiments, the composition to be contacted with mammalian amyloid or mammalian amyloid precursor and bacterial amyloid precursor or bacterial amyloid according to the methods disclosed herein comprises one or more compounds or combinations thereof suspected in the art to inhibit amyloid formation or destabilize or deaggregate existing amyloid. In certain embodiments, the composition to be contacted with mammalian amyloid or mammalian amyloid precursor and bacterial amyloid precursor or bacterial amyloid according to the methods disclosed herein comprises natural products or extracts from natural products. In some embodiments, the composition to be contacted with mammalian amyloid or mammalian amyloid precursor and bacterial amyloid precursor or bacterial amyloid according to the methods disclosed herein comprises herbs, herbal extracts or plant substances. In some embodiments, the compositions may include tissues or fluids obtained from animals, plants or fungi. In some further embodiments, the composition may include tissues, fluids, or extracts of tissues or fluids obtained from plant seeds, fruits, flowers, leaves, stems, cambium, or roots, or combinations thereof. In some further embodiments, the composition may include tissues, fluids, or extracts of tissues or fluids obtained from animal feces, urine, blood, lymph, synovial fluid, cerebrospinal fluid, saliva, or any internal organs. In some embodiments, the composition may include one or more bacteria, or lysates, extracts, conditioned culture media, lyophilized bacteria, lyophilized lysates, their lyophilized culture media, or any combination thereof.In some embodiments, the bacteria include one or more of the following: Bacteroides, Prevotella, Parabacteroides, Faecalibacterium, Eubacterium, Roseburia, Blautia, Coprococcus, and Bifidobacterium, or any combination thereof.

[0205] In some embodiments, the methods of the Disclosure can be used to diagnose or assess the risk of developing amyloid disorder in question. The methods of the Disclosure can be used to treat, prevent and / or improve one or more neurological disorders, including Parkinson's disease, Lewy body dementia, accidental Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, pure autonomic dysfunction, or any combination thereof. The disorders may include neurological disorders such as tremors, paralysis, and dyskinesia, as well as / or physical symptoms known in the field of diagnosis and treatment of gastrointestinal symptoms such as constipation, diarrhea, abdominal pain and / or cramps, bloating, flatulence, nausea, or any other symptoms of irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, increased intestinal permeability, or any combination thereof, as well as behavioral symptoms known in the field of clinical diagnosis and treatment of neurological disorders such as communication symptoms, stereotyped behaviors, sensorimotor problems, and / or anxiety-like behaviors. Accordingly, using such clinical and / or diagnostic evaluations and decisions, one or more subjects to receive one or more compounds described herein can be identified and / or selected according to one or more methods provided herein. In some embodiments, the methods of the disclosure may include monitoring behavioral, physical, and / or gastrointestinal symptoms, as is known in the field of diagnosis and treatment of neurological disorders. In some embodiments, the methods according to the disclosure incorporate monitoring of changes in the behavior of the subject. In some further embodiments, the methods according to the disclosure incorporate monitoring of the subject for behavioral symptoms known to be associated with Parkinson's disease, Lewy body dementia, accidental Lewy body disease, Lewy body variants of Alzheimer's disease, multiple system atrophy, pure autonomic dysfunction, or any combination thereof.In some further embodiments, the methods according to the Disclosure incorporate monitoring a subject for bradykinesia, ataxia, tremor, muscle rigidity, postural and balance disorders, loss of automatic movement, dysarthria or other speech alterations, altered handwriting, orthostatic hypotension, memory impairment, dysphagia, incontinence, sleep disorders, cardiac arrhythmias, visual disturbances, psychiatric problems including depression and visual, auditory, olfactory or tactile hallucinations, dizziness, cognitive impairment, or any combination thereof, or any other symptoms known to those in the field of neurological diagnosis or treatment that are useful in diagnosing amyloid disorders, particularly alpha-synucleinopathy. In some further embodiments, the methods according to the Disclosure incorporate monitoring a subject for bowel motility, including gastroparesis, colonic motility, anorectal dysfunction, and defecation coordination disorders. In these cases as well, such clinical and / or diagnostic assessments and decisions can be used to identify and / or select one or more subjects for diagnosis and / or treatment in accordance with the methods described herein. In some embodiments, the methods of the Disclosure may include, in addition to the clinical monitoring described herein, monitoring of levels of bacterial amyloid, host-derived amyloid, and microorganism-induced amyloid as disclosed herein. According to the methods of the Disclosure, the amyloid may be monitored in the gastrointestinal tract, feces, urine, blood, saliva, cerebrospinal fluid, and / or synovial fluid of the subject. The methods of the Disclosure are intended to monitor the amyloid in any tissue or body fluid that can be obtained from the subject in the course of treatment, thereby determining whether the sample contains factors that promote or inhibit amyloid formation. In some embodiments, subjects from which tissue, body fluid, or other samples from which assays described herein indicate the presence of factors that promote or accelerate amyloid formation may be considered to be at high risk of developing amyloid disorders. In some embodiments, the subjects may be administered drugs or treatments to improve or prevent the amyloid disorders. In this case as well, such clinical and / or diagnostic evaluations and decisions may be used to identify and / or select one or more subjects to receive one or more compounds described herein according to one or more methods provided herein.

[0206] According to the methods disclosed herein, treatment or inhibition of disorders involved in amyloid formation may be achieved by adjusting the administration schedule for the administration of the composition, so that the subject experiences intermittent, partial, or complete reduction of the drug over a period of time, followed by a resumption of the drug. In some embodiments, the dose is administered daily for 1 to 30 days, followed by a drug-free period of 1 to 30 days. In some embodiments, no dose is administered during the drug-free period. In some further embodiments, the composition of the Disclosure may be completely removed from the subject's body before the administration of the next dose. In some other embodiments, a dose less than the usual daily dose is administered during the drug-free period. In some further embodiments, it is possible for an amount less than a therapeutically effective amount of the administered composition to remain in the subject during the drug-free period. In some further embodiments, it is possible for an amount sufficient to maintain a therapeutic level of the administered composition in the affected tissue to remain in the subject. In some embodiments, the composition is administered at any point after the onset of one or more of the aforementioned symptoms of amyloid formation-related neurological disorders. In some embodiments, the composition according to the methods described herein is administered before the onset of one or more of the symptoms of the above disorders. In some embodiments, compositions according to the methods described herein are administered simultaneously with or after the onset of one or more symptoms of the above-mentioned disorder.

[0207] The following items are described according to some embodiments of this specification.

[0208] 1. A method for interfering with and / or inhibiting the formation of amyloid protein aggregates, comprising contacting amyloid or an amyloid precursor with a composition comprising the compounds described herein.

[0209] 2. A method for inhibiting the formation of amyloid protein aggregates, comprising contacting amyloid or an amyloid precursor with a composition comprising the compound described herein.

[0210] 3. A method for inhibiting the formation of amyloid protein aggregates in a target, Administering a composition containing the compounds described herein to the above subjects, and Optionally, before administering the above composition, select the subjects who should benefit from molecules that inhibit amyloid aggregate formation, based on clinical or diagnostic evaluation, and / or A method comprising, optionally, measuring interference with or inhibition of amyloid aggregate formation in the subject after administration of the composition.

[0211] 4. A method for inhibiting the formation of amyloid protein aggregates, comprising contacting amyloid or an amyloid precursor with a composition comprising the compounds described herein.

[0212] 5. A method for inhibiting, improving, reducing the likelihood of, delaying the onset of, treating or preventing amyloid disorders, comprising administering a compound or a pharmaceutical composition thereof described herein to a subject in need thereof.

[0213] 6. The method according to paragraph 5, wherein the amyloid disorder is selected from the group consisting of alpha-synucleinopathy, Parkinson's disease, Lewy body dementia, incidental Lewy body disease, Lewy body variant of Alzheimer's disease, multiple system atrophy, or pure autonomic dysregulation, or any combination thereof.

[0214] 7. The method according to any one of claims 5 to 6, wherein the amyloid disorder comprises intestinal amyloid protein or aggregates, such as bacterial proteins including CsgA.

[0215] 8. The method according to any one of paragraphs 5 to 7, wherein the amyloid disorder is intestinal dysbiosis, increased intestinal permeability, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, and Crohn's disease.

[0216] 9. The method according to any one of claims 5 to 8, further comprising detecting the presence or level of bacterial proteins such as CsgA, nucleic acids encoding microbial proteins, or microorganisms producing bacterial proteins in the above-mentioned intestinal sample.

[0217] 10. The method according to paragraph 9, selected when the presence of bacterial proteins or microorganisms producing bacterial proteins is detected in an intestinal sample, or when the level of bacterial proteins or microorganisms producing bacterial proteins in an intestinal sample is greater than a predetermined level or a control, and the subject requires the composition.

[0218] 11. The method according to any one of the claims 7 to 10, further comprising confirming a decrease in or absence of intestinal amyloid protein after administration.

[0219] 12. The method according to any one of paragraphs 7 to 11, further comprising identifying a subject as having gastrointestinal symptoms.

[0220] 14. The method according to any one of paragraphs 5 to 12, wherein the subject is suffering from one or more gastrointestinal symptoms, including dysphagia, decreased bowel motility, gastroparesis, constipation (including chronic constipation and chronic idiopathic constipation), small intestinal bacterial overgrowth (SIBO), diarrhea, abdominal pain and / or cramps, bloating, flatulence, excessive salivation, anorectal dysfunction, defecation dyscoordination, and nausea.

[0221] 16. The method according to any one of claims 1 to 14, wherein the composition is formulated for intra-intestinal, oral, or intranasal delivery.

[0222] 17. The method according to any one of claims 1 to 16, wherein the composition is formulated for controlled release in the lower intestinal tract or colon.

[0223] 18. The method according to any one of claims 1 to 17, wherein the composition is enteric-coated capsules, tablets, soft gels, spray-dried powders, polymer matrices, hydrogels, enteric-coated solids, crystalline solids, amorphous solids, glassy solids, coated fine particles, liquids, spray liquids, aerosols, or microcapsules.

[0224] 19. The method according to any one of claims 1 to 18, wherein the amyloid protein comprises one or more mammalian proteins, such as α-synuclein, tau, beta-amyloid derived from amyloid precursor protein, mezin, apolipoprotein AI, atrial natriuretic factor, beta-amyloid, cystatin, IAPP (amylin), beta-2 microglobulin, transthyretin, PrP, gelzolin, lysozyme, huntingtin, keratoepithelin, calcitonin, prolactin, serum amyloid A, SOD1, and / or immunoglobulin light chain AL.

[0225] 20. The method according to any one of items 1 to 19, wherein the amyloid protein comprises one or more bacterial or fungal proteins.

[0226] 21. The method according to any one of items 1 to 20, wherein the amyloid protein includes a bacterial protein such as CsgA.

[0227] 22. The method according to any one of items 1 to 21, wherein the amyloid protein is present in the gastrointestinal tract, dural venous sinus, oral cavity, or nasal cavity.

[0228] 23. The method according to any one of items 1 to 22, wherein the above amyloid protein is present in enteric nerve tissue or the olfactory bulb.

[0229] 24. The method according to any one of the items 1 to 23, wherein the composition is administered daily.

[0230] 25. The method according to any one of claims 1 to 24, wherein the composition is administered multiple times a day.

[0231] 26. The method according to any one of claims 1 to 25, wherein the composition is administered at a frequency less than daily.

[0232] 27. The method according to any one of the items 1 to 24 or 26, wherein the composition is administered every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, or every 7 days.

[0233] 28. The method according to any one of paragraphs 1 to 27, further comprising measuring or evaluating the level of enteric-coated amyloid and / or amyloid protein during the administration process.

[0234] 29. The method according to any one of paragraphs 1 to 28, further comprising measuring or evaluating the level of enteric-coated amyloid and / or amyloid protein after the administration process.

[0235] 30. The method according to any one of paragraphs 1 to 29, further comprising measuring or evaluating changes in the nervous system, such as neurological symptoms or characteristics of the subject.

[0236] 31. The method described in any one of paragraphs 1 to 30, for the above subject being under 18 years of age, 18 to 30 years of age, 30 to 50 years of age, 50 to 60 years of age, 60 to 70 years of age, or over 70 years of age.

[0237] 32. The method according to any one of paragraphs 1 to 31, further comprising measuring or evaluating changes in the gastrointestinal system, such as symptoms or characteristics of the gastrointestinal tract of the subject.

[0238] 33. The method described in paragraph 32, wherein the gastrointestinal symptoms described above include constipation.

[0239] 34. The method according to any one of paragraphs 1 to 33, wherein the subject is suffering from a gastrointestinal condition including one or more of the following: constipation, diarrhea, abdominal pain and / or cramps, bloating, flatulence, nausea, or any other symptoms of irritable bowel syndrome (IBS), inflammatory bowel disease (IBD) (e.g., ulcerative colitis and Crohn's disease), increased intestinal permeability, or any other symptoms of any combination thereof.

[0240] 35. The method according to any one of the items 1 to 34, wherein the composition is administered after neurological symptoms or conditions have appeared.

[0241] 36. The method according to paragraph 35, wherein the neurological symptoms or conditions described above include anosmia, osmosis, bradykinesia, ataxia, tremor, muscle rigidity, postural and balance disorders, loss of automatic movement, dysarthria or other speech alterations, altered handwriting, orthostatic hypotension, memory impairment, dysphagia, incontinence, sleep disorders, cardiac arrhythmias, visual disturbances, psychiatric problems including depression and hallucinations of sight, hearing, smell or touch, dizziness, cognitive impairment, altered dopamine levels, altered serotonin levels, altered kynurenine levels, and / or any combination thereof.

[0242] 37. The method according to any one of claims 1 to 36, wherein the composition is administered before the appearance of neurological symptoms or conditions.

[0243] 38. The method described in any one of paragraphs 1 to 37, wherein the method is repeated.

[0244] 39. The method according to any one of claims 1 to 38, wherein, with respect to a given dose, the composition is different from a previously administered composition.

[0245] 40. The method according to any one of paragraphs 1 to 39, wherein, with respect to a given administration, the dose administered is different from a previously administered dose.

[0246] 41. The method according to any one of claims 1 to 40, wherein the composition is administered concurrently with caffeine, nicotine, theophylline, theobromine, xanthine, methylxanthine, or a derivative thereof.

[0247] 42. The method according to any one of claims 1 to 41, further comprising administering an α-synuclein aggregation inhibitor to the subject described above.

[0248] 43. The method according to any one of paragraphs 1 to 42, wherein the subject is identified or selected as being at risk of developing or already having Parkinson's disease based on clinical or diagnostic evaluation or other means.

[0249] 44. The method according to any one of paragraphs 1 to 43, wherein the subject is identified or selected, for example, by clinical or diagnostic evaluation, as being at risk of or already having developed Lewy body dementia, associated Lewy body disease, Lewy body variant of Alzheimer's disease, multiple system atrophy, pure autonomic dysregulation, or any combination thereof.

[0250] 45. The method according to paragraph 14, wherein gastrointestinal symptoms are related to Parkinson's disease or parkinsonism.

[0251] 46. ​​The method according to any one of paragraphs 1 to 44, wherein amyloid disorder can be diagnosed by detecting the presence or level of intestinal bacterial amyloid protein.

[0252] Additional options The following options are described according to some embodiments herein.

[0253] A method for identifying compositions that affect the formation of microorganism-induced amyloid, (a) Contacting multiple concentrations of microbial amyloid or microbial amyloid precursor (e.g., CsgA) with multiple concentrations of α-synuclein in the presence of a composition containing the compounds described herein, (b) Analyze or measure the formation of amyloid produced by the reaction described in (a), and A method comprising comparing the analysis or measurement performed in (c)(b) with the analysis or measurement of a control, wherein the control includes analyzing or measuring the formation of amyloid after the reaction described in (a) in the absence of the composition.

[0254] 2. The method according to option 1, wherein the microbial amyloid or microbial amyloid precursor contains CsgA.

[0255] 3. The method according to option 1 or 2, further comprising stirring during (a).

[0256] The method described in options 1-3, wherein the contact performed in 4.(a) is carried out in the presence of an amyloid formation indicator.

[0257] 5. The method according to option 4, wherein the indicator is a fluorescent indicator, a spin-labeled indicator, an enzyme, an antibody, or a colorimetric indicator.

[0258] 6. The method according to option 4, wherein the indicator is thioflavin T.

[0259] 7. The method according to option 4, wherein the antibody has specificity for aggregated α-synuclein, and the antibody is optionally conjugated with a fluorescent label, an enzyme, a colorimetric label, a spin label, a metal ion binding moiety, a nucleic acid, a polysaccharide, or a polypeptide.

[0260] 8. The method according to any of options 1 to 7, wherein the above-mentioned CsgA and the above-mentioned α-synuclein are each labeled separately.

[0261] 9. The method according to any one of options 1 to 8, wherein the formation described above is analyzed or measured by internal fluorescence, fluorescence of a dye or label, fluorescence resonance energy transfer, fluorescence polarization, fluorescence polarization transfer, UV / Vis spectroscopy, magnetic resonance, Raman scattering, electron paramagnetic spin resonance, optical microscopy, electron microscopy, scanning tunneling microscopy, or atomic force microscopy.

[0262] 10. The method according to any one of options 1 to 9, wherein the composition described above comprises a mixture of compounds.

[0263] 11. The method according to any one of options 1 to 10, wherein the composition comprises tissue, body fluid, or an extract thereof.

[0264] 12. The method according to any one of options 1 to 11, wherein the composition comprises feces, urine, blood, cerebrospinal fluid, or saliva, or components thereof.

[0265] 16. The method according to any one of Options 1 to 10, wherein the composition comprises one or more bacteria, bacterial extracts, lysates, conditioned culture media, lyophilized bacteria, lyophilized lysates, lyophilized culture media, or any combination thereof.

[0266] 17. The method according to any one of options 1 to 16, further comprising identifying or selecting a composition that alters amyloid formation.

[0267] 18. The method according to any one of options 1 to 17, further comprising identifying or selecting a composition that reduces amyloid formation.

[0268] In 19.(b), the method by any of options 1 to 18, wherein the rate of amyloid formation is analyzed or measured.

[0269] 20. A method for producing microbially induced amyloid, (a) Contacting multiple concentrations of microbial amyloid or microbial amyloid precursor (e.g., CsgA) with multiple concentrations of α-synuclein in the presence of a composition containing the compounds described herein, (b) To provide conditions that enable the formation of new microbially induced amyloid, and A method comprising (c) analyzing or quantifying the microorganism-induced amyloid formed in (b).

[0270] 21. The method according to option 20, wherein the microbial amyloid or microbial amyloid precursor contains CsgA.

[0271] The method according to option 20 or 21, further comprising stirring during 22.(a).

[0272] The method according to any of options 20-22, wherein the contact performed in 23.(a) is performed in the presence of an amyloid formation indicator.

[0273] 24. The method according to option 23, wherein the indicator is a fluorescent indicator, a spin-labeled indicator, or a colorimetric indicator.

[0274] 25. The method according to option 23 or 24, wherein the indicator is thioflavin T.

[0275] 26. The method according to any of options 20 to 25, wherein the above-mentioned CsgA and the above-mentioned α-synuclein are each labeled separately.

[0276] 27. The method according to any one of options 20 to 26, wherein the formation described above is analyzed or measured by internal fluorescence, fluorescence of a dye or label, fluorescence resonance energy transfer, fluorescence polarization, fluorescence polarization transfer, UV / Vis spectroscopy, magnetic resonance, Raman scattering, electron paramagnetic spin resonance, optical microscopy, electron microscopy, scanning tunneling microscopy, or atomic force microscopy.

[0277] 28. The method according to any one of options 20 to 27, wherein the composition comprises a mixture of compounds.

[0278] 29. The method according to any one of options 20 to 28, wherein the composition comprises tissue, body fluid, or an extract thereof.

[0279] 30. The method according to any one of options 20 to 29, wherein the composition comprises feces, urine, blood, cerebrospinal fluid, or saliva, or components thereof.

[0280] 31. The method according to any one of options 28 to 30, wherein the composition comprises one or more bacteria, bacterial extracts, lysates, conditioned culture media, lyophilized bacteria, lyophilized lysates, lyophilized culture media, or any combination thereof.

[0281] 35. The method according to any one of options 20 to 34, further comprising identifying or selecting a composition that reduces amyloid formation.

[0282] In 36.(c), the method according to any of options 20 to 35, wherein the rate of amyloid formation is analyzed or quantified.

[0283] 37. A kit comprising microbial amyloid or microbial amyloid precursor and α-synuclein, wherein microbial amyloid or microbial amyloid precursor and α-synuclein are present in one or more containers within the kit.

[0284] 38. The kit described in option 37, wherein the microbial amyloid or microbial amyloid precursor contains CsgA.

[0285] 39. A method for treating or inhibiting amyloid disorders, (a) Contacting multiple concentrations of microbial amyloid or microbial amyloid precursor with multiple concentrations of α-synuclein in the presence of the composition. (b) Analyze or measure the formation of new amyloid after the reaction described in (a), (c) Comparing the analysis or measurement performed in (b) with the analysis or measurement of a control, wherein the control includes analyzing or measuring the formation of amyloid after the reaction described in (a) in the absence of the composition, and, (d) A method comprising administering to a subject an effective amount of the pharmaceutical composition suitable for inhibiting or treating the amyloid disorder if the formation of amyloid in the presence of the composition is increased compared to the formation of amyloid in the absence of the composition.

[0286] 40. The method according to option 39, wherein the microbial amyloid or microbial amyloid precursor contains CsgA.

[0287] 41. The method according to any one of options 39 to 40, wherein the composition comprises tissue, body fluid, or an extract thereof.

[0288] 42. The method according to any one of options 39 to 41, wherein the composition comprises feces, urine, blood, cerebrospinal fluid, or saliva, or components thereof.

[0289] 43. The method according to options 39 to 42, wherein the pharmaceutical composition comprises one or more probiotic bacteria.

[0290] 44. The method according to options 39 to 43, wherein the pharmaceutical composition contains one or more bacteria selected from the group consisting of Bacteroides, Prevotella, Parabacteroides, Faecalibacterium, Eubacterium, Roseburia, Blautia, Coprococcus, and Bifidobacterium, or any combination thereof.

[0291] 45. The method according to options 39 to 44, wherein the pharmaceutical composition comprises one or more bacteria selected from the group consisting of B. fragilis, B. vulgatus, and B. thetaiotaomicron, or any combination thereof.

[0292] In 46.(b), the method according to any of options 39 to 45, wherein the rate of amyloid formation is analyzed or quantified.

[0293] 47. The method of any one of options 39 to 46, further comprising identifying or selecting subjects to benefit from the treatment or inhibition of amyloid disorders.

[0294] 48. The method according to any of options 39 to 47, further comprising identifying or selecting subjects as those at risk for or exhibiting symptoms of one or more of the following: Parkinson's disease, Lewy body dementia, accidental Lewy body disease, Lewy body variant of Alzheimer's disease, multiple system atrophy, pure autonomic dysregulation, or any combination thereof. [Examples]

[0295] Example 1 The subjects are given one or more of the compounds (or compositions thereof) described herein on a regular basis, for example, daily, by oral or rectal administration. The levels of bacterial amyloid formation in the gastrointestinal tract and / or α-synuclein aggregation in the gastrointestinal tract are monitored by stool sampling or biopsy. Treatment is continued to prevent bacterial amyloid (curli) formation and / or α-synuclein aggregation. Changes in the patient's gastrointestinal function and motor symptoms are monitored. In subjects in whom administration of one or more of the above compounds results in a reduction in the formation of microorganism-induced amyloid in the gastrointestinal tract, improvement in one or more gastrointestinal symptoms, one or more motor symptoms and / or one or more neurological symptoms is observed.

[0296] Example 2 One or more of the compounds described herein are obtained or synthesized and incorporated into an enteric-coated or colon-selective formulation to release the substance at the site of action and bypass most of the stomach and small intestine. This makes it possible to deliver the composition to the site of curli production and / or α-synuclein aggregation, minimizing the absorption of the composition into the systemic circulation.

[0297] Example 3 One or more of the compounds described herein are obtained or synthesized and incorporated into a formulation for controlled release in the lower small intestine or colon. This allows for lower and / or less frequent administration and minimizes side effects. Controlled release in the lower small intestine or colon can be achieved by any of the various approaches known in the art, including enteric-coated capsules, tablets, soft gels, endogenous enteric-coated capsules, multilayer formulations, and microparticle forms coated with polymer materials.

[0298] Example 4 The subjects are administered a combination of two or more compounds described herein. When a Curli inhibitor is combined with an α-synuclein aggregation inhibitor, aggregation is blocked simultaneously at two critical points. In subjects in whom administration of one or more of the above compounds results in a reduction in the formation of microorganism-induced amyloid in the gastrointestinal tract, improvement in one or more GI symptoms, one or more motor symptoms, and / or one or more neurological symptoms is observed or measured.

[0299] Example 5 Using the techniques described in International Publication No. 2018 / 213204, the entirety of which is incorporated herein by reference, we investigated the role of functional amyloid formation in curli-driven pathophysiology in mice. First, we examined the effect of epigallocatechin gallate (EGCG) on biofilm growth by wild-type E. coli, along with the effect of EGCG on in vitro α-Syn amyloid formation. Figure 1A is a graph showing crystal violet staining, data evaluated by optical density (OD), of biofilm growth by wild-type E. coli after 4 days of static culture using the indicated concentrations of EGCG. Figure 1B is a graph showing in vitro α-Syn aggregation, measured by thioflavin T fluorescence, while α-Syn amyloid was formed alone or in the presence of CsgA (25:1 molar ratio) with and without EGCG (50 μM).

[0300] Example 6 Additional experiments using the techniques described in International Publication No. 2018 / 213204, the full content of which is incorporated herein by reference, demonstrated that monocolony formation by curli-sufficient bacteria induces increased α-Syn-dependent pathology and inflammatory responses in the brain. Sterile (GF) wild-type (WT) or Thy1-αSyn (ASO) mice were monocolonized with either wild-type, curli-sufficient E. coli (WT), or curli-deficient E. coli (ΔcsgBAC). Figure 2A is a graph showing total α-Syn in whole brain lysates quantified by ELISA. Figure 2B is a graph showing quantification of insoluble α-Syn fibrils in the striatum by dot blot assay. Figures 2C-2D show quantification of TNFα (Figure 2C) and IL-6 (Figure 2D) from the striatum by ELISA. Figures 2E to 2G show the results of quantifying the morphological characteristics of microglia present in the striatum by staining thin sections of brain tissue derived from ASO mice for Iba1 (microglia), generating 3D cell reconstructs, and analyzing n=3 (Figures 2A to 2B), n=6 to 7 (Figures 2C and 2D), and n=4 (Figures 2E to 2G) (diameter was averaged from 20 to 40 cells, or branching from 5 to 7 cells). Dots represent individuals, and bars represent the mean and standard error. Figures 2A to 2D show data analyzed by one-way ANOVA using Tukey's post-hoc test, while Figures 2E and 2F show data analyzed by one-way ANOVA using a two-tailed t-test. *p≦0.05, **p≦0.01, ***p≦0.001, ****p≦0.0001. Consistent with this effect of sufficient bacteria on a mouse model, the relative abundance of csgA has been shown to increase in the gastrointestinal tract of human Parkinson's disease (PD) patients. The relative abundance of csgA was determined by PICRUSt analysis of 16S RNA data available from human fecal samples (ENA accession: PRJNA268515, PRJEB4927, and PRJEB14674). Based on this analysis, a higher relative abundance of csgA was observed in the gastrointestinal tract of PD patients (Figure 2H).Furthermore, when wild-type (Figure 2I) or Thy1-αSyn(ASO) (Figure 2J) mice were colonized with microorganisms derived from humans with PD or the corresponding control (ENA accession: PRJEB17694), PICRUSt attribution analysis of 16s rRNA sequences showed greater abundance in the PD-inoculated microbiome compared to healthy controls (Figure 2K). In Figures 2H-2J, dots represent individuals and bars represent the mean, and data were analyzed by a two-sided Mann-Whitney test. *p≦0.05, **p≦0.01. Thus, the presence or elevated levels of bacterial proteins such as csgA in the gastrointestinal tract (compared to healthy controls) can be seen to correlate with amyloid disorders such as PD.

[0301] Example 7 Further experiments demonstrate that intestinal curli promotes progressive synuclein-dependent pathophysiology. Thy1-αSyn(ASO) animals, housed using conventional methods, were intrafetalized with 30 μg of either a synthetic CsgA hexamer (CsgA; N-QYGGNN-C) or a non-amyloidogenic peptide (N122A; N-QYGGNA-C). Each peptide reached the aggregation domain of CsgA. Motor and GI function were assessed at 0, 7, 21, and 70 days post-injection using beam cross-section (Figure 3A), pole descent (Figure 3B), adhesive removal (Figure 3C), hindlimb clasping score (Figure 3D), wire hang (Figure 3E), and fecal excretion assessment (day 70) (Figure 3F). Figure 3G is a graph showing the principal component analysis of the edited motor scores from Figures 3A-3F. Figures 3H–3I show the quantification of insoluble α-syn fibrils in the striatum (Figure 3H) and ventral midbrain (Figure 3I) by dot blot assay. n=8 (Figures 3A–3G), n=4 (Figure 3H). Dots represent individuals, and bars represent the mean and standard error. Square brackets above each time point indicate the time course analyzed by two-way ANOVA with Sidak post-hoc test for group comparisons, and significance between treatments. Data in Figure 3H were analyzed by two-sided Mann-Whitney test. In Figures 3A–3I, *p≦0.05, **p≦0.01, ***p≦0.001, ****p≦0.0001. Editing of motor function by PCA shows a symptomatic shift in mice injected with CsgA peptide compared to controls, demonstrating impaired overall motor function in these animals (Figure 3G). Furthermore, an increase in α-Syn fibrils was detected in the midbrain of amyloidogenic CsgA-injected animals (Figure 3H), demonstrating changes in central nervous system (CNS) pathology after direct administration of amyloid into the GI duct. Thus, intestinal exposure to CsgA peptides capable of amyloid formation is sufficient to exacerbate long-term persistent motor impairment in α-Syn overexpressing mice.

[0302] Thus, this specification found that intestinal curli increased transverse time, descent time, removal time, and hindlimb score, while decreasing drop time and fecal pellets per mouse. The increases in transverse time, descent time, and hindlimb score, as well as the decrease in fecal pellets per mouse, were statistically significant at the levels described (see Figures 3B-3D and 3F). Therefore, it is considered that intestinal curli may induce symptoms of amyloidosis in vivo.

[0303] Example 8 A library of potential amyloid formation inhibitors is obtained. Such libraries can be found in existing repositories or can be produced de novo, for example, by combinatorial synthesis or by solid-phase peptide synthesis using methods well known in the art. For example, see Jensen, K.Jetal, eds, Peptide Synthesis and Applications (2nd edition), 2913, incorporated herein by reference for teachings on solid-phase peptide synthesis, combinatorial peptide synthesis, and the production of peptide libraries. Natural product libraries can also be used. In a multi-well assay plate, bacterial amyloid-emitting factors such as E. coli CsgA are placed in one dimension at different concentrations, and host-derived amyloid-forming proteins such as α-synuclein are placed in the other dimension at different amounts, so that each well contains amyloid-emitting factors and amyloid precursors in different ratios. A fixed amount of an amyloid formation indicator such as thioflavin (ThT), and a fixed amount of the individual test compound are added to each well. Each tray is stirred to initiate amyloid formation, and thioflavin fluorescence is monitored. Compounds that show a shift in fluorescence emission rate over time are identified as candidates that promote or inhibit amyloid formation.

[0304] Example 9 The suspected amyloid formation inhibitor was combined with bacterial amyloid-activating factor and amyloid precursor in the presence of thioflavin T (ThT). Separately, as a control, bacterial amyloid-activating factor, amyloid precursor, and thioflavin T were combined in the absence of the suspected amyloid formation inhibitor. Thioflavin T fluorescence was monitored over time. The decrease in the rate of increase of thioflavin T fluorescence and / or the decrease in the maximum level of thioflavin T fluorescence in the sample containing the suspected inhibitor compared to the control sample supported the conclusion that the suspected amyloid formation inhibitor actually functions to inhibit amyloid formation.

[0305] Example 10 A sample of tissue, body fluid, feces, or intestinal contents is collected from the subject. The sample is combined with a bacterial amyloid-evolving factor, e.g., *E. coli* CsgA, a host-derived amyloid-forming protein, e.g., α-synuclein, and an amyloid formation indicator, e.g., thioflavin T (ThT). Thioflavin T fluorescence is monitored. An increase in fluorescence consistent with an increase in the amyloid formation rate in the presence of the sample, compared to the amyloid formation rate in the absence of the sample, indicates an increased risk of α-synucleinopathy, such as Parkinson's disease and / or Lewy body dementia. This increased risk further correlates with the results of conventional neurological examinations used to calculate a defined risk for the onset and / or progression of α-synucleinopathy or other neurodegenerative disorders associated with amyloid formation.

[0306] Example 11 In a 96-well plate of unbound black plastic, 50 μM–100 μM of α-synuclein is incubated in 0.01 M Tris buffer (pH 7.4) or 0.05 M potassium phosphate buffer (pH 7.3) in the presence of 12 μM thioflavin T (prepared in water). Purified CsgA monomer in 0.05 M potassium phosphate buffer (pH 7.3) is added to each well in molar ratios of 1:10, 1:25, 1:50, or 1:100. Inhibitory compounds are prepared in an appropriate buffer solution based on solubility, e.g., 0.05 M potassium phosphate buffer (pH 7.3) or DMSO. The compounds and appropriate buffer controls are added to the wells containing α-synuclein and CsgA to a final volume of 150 μL per well. The concentration of each compound depends on the type of compound being screened, but is generally expected to be in the range of 1 μM–200 μM in the initial screening. Details regarding the addition of such compounds depend on the types of compounds available in the available small molecule library. Separate wells containing α-synuclein alone and CsgA alone serve as specificity controls or, in the absence of potential inhibitors, in combination. Add one sterile glass or Teflon bead with a diameter of approximately 1–2 mm to each well. Incubate the plate in a fluorescence microplate reader with continuous orbital shaking (approximately 100–250 rpm) at 37°C. Measure fluorescence every 1–2 hours with excitation at 440±10 nm and emission at 490±10 nm. Measurements are performed over 24–72 hours. As α-synuclein amyloid forms, the emission spectrum follows a sigmoid curve and reaches maximum intensity at approximately 24–72 hours under these conditions. After this time, the emission intensity may decrease as the amyloid becomes insoluble and non-fluorescent.

[0307] Amyloid formation is observed through the following three stages (see, for example, Figure 1B): (1) a delay phase with low fluorescence intensity for the first approximately 0–24 hours; (2) a logarithmic phase from approximately 2–48 hours in which fluorescence intensity increases logarithmically; and (3) a plateau phase in which fluorescence intensity reaches its maximum and remains unchanged for the remainder of the period, or begins to decrease due to the precipitation of insoluble α-synuclein from the solution. Maximum intensity generally occurs between 24 and 72 hours.

[0308] Aggregation kinetics measured by thioflavin fluorescence in the presence of the compound can be normalized to kinetics observed using α-synuclein and CsgA individually. Potential inhibitors may act to prolong the delay phase, reduce the rate of change in the logarithmic phase, reduce the maximum intensity reached, or any combination thereof.

[0309] Once initial candidates are identified, dose-responses over a wide range of concentrations can be determined, along with specificity for CsgA:synuclein aggregates, or specificity for CsgA and α-synuclein individually. In some variations of this screening, CsgA:synuclein aggregates can be monitored up to the logarithmic phase, at which point potential inhibitory compounds can be introduced. Subsequently, inhibitors that may act when amyloid formation is already underway can be identified (see, for example, Figure 1B).

[0310] Example 12 The assay is carried out as described in Example 11, and a total concentration curve is created for each compound. This makes it possible to accurately determine the EC50 of each compound and to identify the limits of specific compounds (e.g., identify compounds that do not provide complete inhibition of aggregation).

[0311] Example 13 The assay is carried out as described in Example 11 and formatted for high-throughput screening in various ways. For example, a three-point concentration curve is used instead of a complete concentration curve for each compound to distinguish compounds with dose-response effects from those with non-specific and concentration-independent effects. For even higher-throughput screening, the assay is formatted in 96-well, 384-well, or 1536-well plates and compounds are tested at a single concentration (e.g., 100 μM) and a single time point (e.g., 24–72 hours). This allows the observer to distinguish potential candidates from compounds that are ineffective or ineffective at appropriate concentrations.

[0312] Example 14 The assay is carried out as described in Example 11, and a complete time-course curve is generated for each compound. The time-course curve indicates whether the compound inhibits over time in a linear or sigmoid manner, and / or whether complete inhibition can be achieved with a given compound.

[0313] Example 15 This assay is carried out as described in Example 11 and further modified to evaluate mechanistic processes and compound activity in a more dynamic environment in which both α-synuclein (or other host amyloid protein) and Curli (or other bacterial amyloid) are present in the assay. The observer then evaluates the ability of the compound to inhibit the aggregation of one or more proteins in the presence of an aggregation template. For example, the bacterial amyloid component CsgA is known to promote and / or accelerate α-synuclein aggregation. In an in vivo environment, candidate compounds with α-synuclein aggregation inhibitory activity are exposed to the aggregation-promoting or template activity induced by bacterial amyloid. Thus, formatting the assay to include both monomeric α-synuclein (or other host amyloid) and aggregated bacterial amyloid allows for the evaluation of drug candidates in a more physiologically appropriate in vitro environment.

[0314] Example 16 The assay was carried out as described in Example 11, and this method further includes combining a Curli (bacterial amyloid) aggregation inhibitor with an α-synuclein aggregation inhibitor. This combination has the additional advantage of simultaneously inhibiting aggregation at two critical points. This assay utilizes both monomeric forms of α-synuclein and Curli (CsgA) and yields measurements similar to those shown in Figure 1B.

[0315] Example 17 The assay was carried out as described in Example 11, and this method further includes combining a Curli (bacterial amyloid) deaggregation promoter with an α-synuclein deaggregation promoter. This combination has the additional advantage of performing deaggregation simultaneously at two critical points. This assay utilizes the fully aggregated forms of both α-synuclein and Curli, yielding measurements similar to those shown in Figure 1B.

[0316] Example 18 The assay was carried out as described in Example 11, and this method further comprises combining a curli(CsgA, bacterial amyloid) aggregation inhibitor with an α-synuclein deaggregation promoter. This combination has the additional advantage of inhibiting amyloid nucleation or development while simultaneously resulting in deaggregation of an already initiated process. This assay utilizes fully aggregated α-synuclein and monomeric Curli(CsgA) and yields measurements similar to those shown in Figures 2A to 3I.

[0317] Example 19 The assay was carried out as described in Example 11, and this method further comprises combining a Curli (bacterial amyloid) deaggregation promoter with an α-synuclein aggregation inhibitor. This combination has the additional advantage of simultaneously disrupting pathogenic bacterial amyloid and inhibiting α-synuclein aggregation. This assay utilizes Curli in both monomeric and fully aggregated forms of α-synuclein, yielding measurements similar to those shown in Figures 2A to 3I.

[0318] Example 20 The assay is performed in the same manner as in Examples 16-24, except that it includes non-aggregating CsgA variants. Compounds that depend on the presence of structured (aggregated) CsgA in these processes show reduced efficacy in this version of the assay.

[0319] Example 21 Human α-synuclein was expressed in Escherichia coli BL21(DE3) from a pT7 or pET11a plasmid containing the full-length, untagged human α-synuclein gene. Cells were induced in OD600 0.6 containing 0.8 mMIPTG for 4 hours, harvested by centrifugation, and suspended in a lysis buffer equivalent to 1 / 10 of the culture volume (10 mM Tris (pH 8.0), 1 mM EDTA, and 1 mM PMSF), and lysed by boiling for 20 minutes. Cell debris was pelletized by centrifugation, and the clarified lysate was treated with 136 μL / mL of 10% streptomycin sulfate, followed by 228 μL / mL of glacial acetic acid. The lysate was centrifuged, the supernatant was transferred to a new tube, and the protein was precipitated by adding an equal volume of saturated (100%) ammonium sulfate. The mixture was incubated at 4°C for 1 hour using an oscillating shaker. The protein was pelletized by centrifugation, washed with 100 mM ammonium acetate in an equal volume of chilled ethanol, pelletized again by centrifugation, washed twice with chilled ethanol, dried overnight, resuspended in 50 mM potassium phosphate buffer (pH 7.3) or 10 mM Tris (pH 7.4), and passed through a 50 kDa cutoff column. Immediately before use, the purified α-synuclein was filtered through a 0.2 μm nylon filter. The concentration of α-synuclein was determined by absorption at 280 nm or by BCA assay.

[0320] Example 22 Full-length recombinant CsgA monomers can be prepared as described in Zhou et al. (2012). Journal of Biological Chemistry 287(42). In short, csgA is cloned into a pET11d vector containing a C-terminal 6xHis tag. After growth in nutrient-rich medium, CsgA production is increased by 0.5 mM IPTG to approximately 0.9 OD. 600 The bacteria were induced at 37°C for 1 hour. The bacteria were dissolved in 8M guanidine hydrochloride in 50 mM potassium phosphate buffer (pH 7.3) on a rocking platform at room temperature overnight or for about 1-2 hours. After centrifugation at 10,000 × g for 20 minutes, the supernatant was sonicated six times for 10 seconds on ice, incubated with nickel-nitrilotriacetate resin (Sigma) at room temperature for 1 hour, and then packed into a disposable polypropylene column (Thermo). This column was washed with 50 mM potassium phosphate buffer (pH 7.3) and 50 mM potassium phosphate buffer (pH 7.3) containing 12.5 mM imidazole. The proteins were eluted with 50 mM potassium phosphate buffer (pH 7.3) containing 125 mM imidazole. To obtain monomeric CsgA, the fractions containing the target protein were combined and placed in a 30 kDa centrifugal filter unit (Thermo) to remove dimers and other oligomers. The purified CsgA was passed through a pre-cooled desalting column (Zeba) to remove imidazole.

[0321] Alternatively, the synthetic hexapeptide of CsgA consisting of the following sequence, Nterm-QYGGNN-Cterm, is commercially available from Bio-synthesis, Inc.

[0322] Example 23 Another alternative is to utilize pre-formed CsgA amyloid species by preparing a Curli extract purified from biofilm, as described in Collinson et al. (1991). Journal of Bacteriology. 173(15). Wild-type E. coli are grown at room temperature for 3–7 days on YESCA medium with or without Congo red dye. This culture is scraped into 10–30 mL of 10 mM Tris (pH 8). Cells are lysed by sonication or freeze-thaw. The cell lysates are treated with 0.1 mg of RNase A, 0.1 mg of DNase I, and MgCl2 to 1 mM, and incubated at 37°C for 20–30 minutes. Lysozyme is added at 1 mg / mL and incubated further at 37°C for 20–40 minutes. SDS is added at 1% and incubated at 37°C for 20–40 minutes. Insoluble material is recovered by centrifugation at 12,000 × g for 15 minutes. The sample is resuspended in 1-10 mL of Tris buffer, boiled at 90°C for 15 minutes, and the above process is repeated (digestion by RNase, DNase, lysozyme, and SDS treatment). The sample is washed twice with Tris buffer, resuspended in Laemli buffer, boiled, and placed on an SDS-PAGE gel (4-20%). The sample is electrophoresed at 20 mA for 5 hours. Insoluble material remaining in the stacking gel is recovered, washed three times with water, washed twice with 95% ethanol, and dried. The sample is resuspended in 0.2 M glycine (pH 1.5) and boiled for 10-15 minutes. Insoluble material is recovered by centrifugation at 16 k × g for 10 minutes. The insoluble material is washed five times with water and resuspended in PBS. Finally, the sample is sonicated for 1 hour using an electrode or water bath, and the protein content is determined by BCA or absorbance at 280 nm.

[0323] Such changes may alter the dynamics of aggregation, the concentration of compounds required to inhibit aggregation, the ratio required to exhibit CsgA-mediated synuclein aggregation, or a combination of the above.

[0324] Example 24 In other iterations of the protein purification used in the assays of Examples 22 and 23, CsgA may be produced without a histidine tag or with another tag, and may include sequences that facilitate its efflux from cells. α-synuclein may be manipulated to include a histidine tag or other tags to facilitate purification by affinity for immobilized metals, such as nickel. CsgA and α-synuclein may be purified using alternative methods well known to those skilled in the art, such as ammonium sulfate precipitation with different concentrations of ammonium sulfate in a single step, or ammonium sulfate precipitation in multiple steps with progressively increasing ammonium sulfate concentrations, or ammonium sulfate precipitation may be omitted. As well known to those skilled in the art, other resins or materials may be used to separate CsgA or α-synuclein from other proteins based on protein affinity, cation exchange, anion exchange, hydrophobic interactions, or multiple or combined methods. Protein separation may be performed using batch purification, packed columns, gravity flow, low pressure, high pressure, and high-pressure liquid chromatography, using methods well known to those skilled in the art, and these methods may be used individually or in combination. CsgA or α-synuclein can be separated from other proteins based on size using methods well known to those skilled in the art, such as size exclusion chromatography or high-pressure liquid chromatography. CsgA and α-synuclein can be purified, in whole or in part, under denaturing conditions using guanidinium hydrochloride at different concentrations, or other denaturing agents known to those skilled in the art, such as urea. Alternatively, CsgA and α-synuclein can be purified under natural conditions well known to those skilled in the art, and CsgA can generally be rapidly purified under natural conditions or by using non-denaturing buffers to avoid aggregation during the purification process. His-tagged CsgA can be eluted from immobilized metal affinity materials such as Ni-NTA using alternative methods known to those skilled in the art, such as lowering the pH or adding a chelating agent such as ethylenediaminetetraacetic acid.In addition to, or instead of, immobilized metal affinity chromatography based on the affinity of protein histidine residues to immobilized nickel, other immobilized metal affinity chromatography or batch purification methods can be used, as is known to those skilled in the art, using materials having immobilized copper, immobilized zinc, immobilized cobalt, or immobilized nickel that interact with histidine or other amino acids of the protein (e.g., cysteine ​​or tryptophan). As is known to those skilled in the art, other buffers can be used with Ni-NTA agarose, for example, tris(hydroxymethyl)aminomethane ("Tris"), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid ("HEPES"), and 3-(N-morpholino)propanesulfonic acid ("MOPS"), optionally containing sodium chloride, potassium chloride, or other salts, and various surfactants and reducing agents in compositions and concentrations suitable for Ni-NTA agarose chromatography or batch purification.

[0325] In this assay, different concentrations of dimethyl sulfoxide may be used, but significantly higher or lower concentrations of dimethyl sulfoxide (less than 1%) may affect the aggregation kinetics of CsgA and α-synuclein. Different concentrations of thioflavin T may be used in the assay, which may affect the fluorescence signal and sensitivity of the assay. Different concentrations of CsgA and α-synuclein may be used, and such changes may affect the aggregation kinetics of α-synuclein and CsgA in the assay. Different concentrations of the compound may be tested in the assay to evaluate the dose-response. Further reagents, including surfactants such as sodium dodecyl sulfate, may be added to the assay, which may affect the aggregation kinetics of α-synuclein and CsgA depending on their concentrations. Shaking may be included in the assay at different intervals and may affect the aggregation kinetics of CsgA and α-synuclein. 2 mm glass beads may be omitted from assays containing α-synuclein, or included in assays containing CsgA, or beads of other sizes or compositions may be used; these changes may affect the aggregation kinetics of CsgA and α-synuclein. Other buffers, such as Tris, HEPES, or MOPS, and different buffer concentrations may be used in the assay; these may affect the aggregation kinetics of CsgA and α-synuclein. Any plate reader capable of fluorescence reading with a sufficiently narrow bandwidth, such as 10 nm, excited at 438 nM and emitting at 495 nm, can be used. Other microplates may be used in the assay, such as black microplates with a clear bottom. The plate may be sealed with another coating that does not absorb ThT fluorescence, or the coating may be removed before reading. Fluorescence may be read at a single endpoint or at multiple points over various time intervals; the time intervals for measuring fluorescence may be constant or may vary during the assay. The effects of this compound on α-synuclein and CsgA expression can be investigated using other metrics, such as examining the thioflavin T signal throughout the kinetic reading process to determine the thioflavin T fluorescence delay, the shape of the curve generated by the fluorescence signal, and the slope of that curve.

[0326] Example 25 To evaluate the effect of compounds on α-synuclein aggregation, cell-free assays were performed using purified α-synuclein and thioflavin T. In this assay, human α-synuclein was expressed in E. coli BL21(DE3) from plasmids derived from pT7 or pET11a, into which the full-length, untagged human α-synuclein gene was inserted. Cells were then subjected to OD containing 0.8mMIPTG. 600The culture was induced at 0.6°C for 4 hours, collected by centrifugation, and suspended in a lysis buffer equivalent to 1 / 10 of the culture volume (10 mM Tris (pH 8.0), 1 mM EDTA, and 1 mM PMSF), and dissolved by boiling for 20 minutes. The cell debris was pelletized by centrifugation, and the clarified lysate was treated with 136 μL / mL of 10% streptomycin sulfate, followed by 228 μL / mL of glacial acetic acid. The lysate was then centrifuged, the supernatant was transferred to a new tube, and the protein was precipitated by adding an equal volume of saturated (100%) ammonium sulfate. The mixture was incubated in an oscillating shaker at 4°C for 1 hour. The protein was pelletized by centrifugation, washed with 100 mM ammonium acetate in an equal volume of chilled ethanol, pelletized again by centrifugation, washed twice with chilled ethanol, dried overnight, resuspended in 50 mM potassium phosphate buffer (pH 7.3) or 10 mM Tris (pH 7.4), and passed through a 50 kDa cutoff column. Immediately before use, the purified α-synuclein was filtered through a 0.2 μm nylon filter. This assay was performed in a 96-well black microplate containing one 1-2 mm glass bead, 20-40 μM thioflavin T, 1% DMSO, 50 μM α-synuclein, and 20-100 μM of the compound in each well. The plate was sealed with sealing tape (ThermoFisher 232701) and incubated at 37°C in a Tecan Nano F200 plate reader. Excitation was performed at 438 nm using a 439 nm filter with an 8 nm bandwidth, and emission was performed at 495 nm using a 490 nm filter with a 10 nm bandwidth. During the assay, the plate was shaken continuously or shaken for 999 seconds every 18 minutes. Readings were taken hourly for up to 73 hours. The effect of the compound on α-synuclein aggregation in this assay was determined using data at 36, 47, 48, or 72 hours, or from the final time point of the assay before or near the time when ThT fluorescence became steady in the vehicle control well. The vehicle control contained all components of the assay except the compound and represented the level of α-synuclein aggregation in the absence of the inhibitor or accelerator.The fluorescence values ​​of each compound containing α-synuclein were first adjusted by subtracting the average fluorescence of the compound in the absence of α-synuclein. These adjusted values ​​were normalized by dividing them by the average fluorescence at the same time point in the vehicle control well, and the average normalized fluorescence of the compound was expressed as a percentage of the average fluorescence observed in the untreated control. The inhibition rate of α-synuclein aggregation by the compound was determined by subtracting the percentage of the average fluorescence of the compound relative to the average vehicle control from 100%. A higher positive inhibition rate reflects greater inhibition of α-synuclein aggregation, while a negative inhibition rate reflects increased α-synuclein aggregation.

[0327] In some embodiments, in other variations of protein purification used in the assay, α-synuclein can be purified by alternative methods well known to those skilled in the art, such as ammonium sulfate precipitation with different concentrations of ammonium sulfate in a single step, or ammonium sulfate may be omitted. In some embodiments, as well as well known to those skilled in the art, a different resin or apparatus (e.g., based on protein affinity, cation exchange, anion exchange, or hydrophobic interaction) can be used to separate α-synuclein from other proteins, and multiple modes or mixed modes can be used. In some embodiments, protein separation can be performed using batch purification, packed columns, gravity flow, low pressure, high pressure and high pressure liquid chromatography, using methods well known to those skilled in the art, and these methods can be used individually or in combination. α-synuclein can be separated from other proteins by size using methods well known to those skilled in the art, such as size exclusion chromatography or high pressure liquid chromatography. α-synuclein can be purified in whole or in part of the assay purification process under denaturing conditions with various concentrations of guanidinium hydrochloride or various concentrations of other denaturants known to those skilled in the art, such as urea. Alternatively, α-synuclein can be purified using affinity tags such as histidine tags, BAP tags, or GST tags, but not limited to these. As is known to those skilled in the art, several alternative buffers can be used, but not limited to tris(hydroxymethyl)aminomethane ("Tris"), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid ("HEPES"), 3-(N-morpholino)propanesulfonic acid ("MOPS"), or phosphate-buffered saline, which may optionally contain sodium chloride, potassium chloride or other salts, and various surfactants and reducing agents in compositions and concentrations suitable for protein purification.

[0328] In the assay described herein, different concentrations of dimethyl sulfoxide may be used, but significantly higher or lower concentrations of dimethyl sulfoxide (less than 1 percent) may affect the aggregation kinetics of α-synuclein. Different concentrations of thioflavin T may be used in the assay, which may affect the fluorescence signal and sensitivity of the assay. Different concentrations of α-synuclein may be used, and such changes may affect the aggregation kinetics of α-synuclein in the assay. Different concentrations of the compound may be tested in the assay to evaluate the dose-response. Further reagents may be added to the assay, including surfactants such as sodium dodecyl sulfate, sodium chloride, dithiothreitol, or bovine serum albumin, which may affect the aggregation kinetics of α-synuclein depending on its concentration. Shaking may be included in the assay at different intervals and may affect the aggregation kinetics of α-synuclein. Teflon beads of various sizes may be included in the assay, or beads of other compositions may be used, and these changes may affect the aggregation kinetics of α-synuclein. Other buffers such as Tris, phosphate-buffered saline, HEPES, or MOPS, and different buffer concentrations may be used in the assay, as they may affect the aggregation kinetics of α-synuclein. Any plate reader capable of fluorescence reading with a sufficiently narrow bandwidth, such as 10 nm, excited at 438 nM and emitting at 495 nm, can be used. Examples include, but are not limited to, the Spectra Max M5, Spectra Max M2, or Spectra Max® i3X (Molecular Devices, San Jose, California). Other microplates may be used in the assay, such as black microplates with a clear bottom, solid white microplates, or white microplates with a clear bottom. Different plate densities may also be used, such as 384-well or 1536-well formats. Plates may also be treated, but are not limited to, non-binding coatings or highly binding coatings, or they may not be treated at all. Plates may be sealed with another coating that does not absorb ThT fluorescence, or the coating may be removed before reading.Fluorescence may be read at a single endpoint or at multiple points over various time intervals, and the time intervals for measuring fluorescence may be constant or vary over the course of the assay. The results are shown in Tables 3 and 4. Higher positive inhibition rates reflect greater inhibition of α-synuclein aggregation, while negative inhibition rates reflect enhanced α-synuclein aggregation.

[0329] Example 26 In vitro thioflavin T assay to investigate the effect of compounds on CsgA aggregation To evaluate the effect of compounds on the aggregation of E. coli CsgA, a cell-free assay was performed using purified CsgA and thioflavin T. In this assay, histidine-tagged CsgA was overexpressed in E. coli NEB3016slyD::kan cells harboring a pET11d vector containing a C-terminal 6×His tag. After growth in nutrient-rich medium, 0.5 mM IPTG (isopropyl beta-D-1-thiogalactopyranoside) was added, followed by incubation at 37°C for 1-4 hours with shaking at 200-250 rpm, resulting in an OD of approximately 1.0. 600CsgA production was induced. The bacteria were resuspended in 8M guanidine hydrochloride in 50mM potassium phosphate buffer (pH 7.3) and lysed by sonication three times at 20-second intervals on ice. The resulting lysate was incubated at room temperature for 1 hour on a platform locker. After centrifugation at 10,000×g for 20 minutes, the supernatant was further sonicated three times at 20-second intervals on ice, and then incubated with nickel-nitrilotriacetate resin (Sigma) in a 50 mL conical tube on a platform locker at room temperature for 1 hour. The resin was washed and pelleted five times with 45 mL of 8M guanidine in 50mM potassium phosphate buffer (pH 7.3). The resin was washed again and pelleted twice with 8M guanidine hydrochloride in 50mM potassium phosphate buffer pH 7.3 containing 12.5mM imidazole. The purified CsgA protein was eluted twice with 5 mL of 6-8 M guanidine hydrochloride in 50 mM potassium phosphate buffer (pH 7.3) containing 250 mM imidazole. The eluted protein was aliquoted at 150 μL per aliquot, rapidly frozen in liquid nitrogen, and stored at -80°C. To obtain monomeric CsgA, the purified CsgA protein was thawed and passed through two pre-cooled desalting columns (Zeba) to remove imidazole and guanidine. The buffer-exchanged protein was placed in a 30 kDa centrifugal filter unit (Amicon) and rotated at 7500 × g for 30 minutes to remove dimers and other oligomers. The protein concentration was evaluated by NanoDrop technique (Thermo Scientific), as is well known to those skilled in the art. The CsgA agglutination assay was performed in 96-well black unbound surface or white untreated microplates containing 20 μM–40 μM thioflavin T, 50 mM potassium phosphate buffer (pH 7.3), 1% DMSO, 2 μM–20 μM CsgA, and 3.125 μM–200 μM of the compound. The vehicle control well contained all components of the assay except the test compound and represented the level of CsgA agglutination in the absence of inhibitors or promoters.Plates were incubated at room temperature using a Tecan Nano F200 plate reader, excited at 438 nm using a 439 nm filter with an 8 nm bandwidth, and emitted at 495 nm using a 490 nm filter with a 10 nm bandwidth, or using a SpectraMax M5, SpectraMax M2, or SpectraMax® i3X (Molecular Devices, San Jose, California) spectrophotometer, excited at 438 nM and emitted at 495 nm. During the assay, plates were initially shaken for 5 seconds, followed by 3 seconds of shaking before fluorescence reading. Readings were taken every 15 minutes for a maximum of 1005 minutes. The effect of compounds on CsgA aggregation in the assay was investigated using data from 0 to 17 hours. The fluorescence values ​​of each CsgA-containing compound were first adjusted by subtracting the average fluorescence of the compound in the absence of CsgA, or the average fluorescence of the compound in the presence of both CsgA and the compound, at 0 or 15 minutes. Data were analyzed using several methods as described below.

[0330] 1. The adjusted ThT fluorescence values ​​were normalized by dividing them by the average fluorescence of the vehicle control well containing CsgA. The median normalized fluorescence from 6–6.5 hours or 8–9 hours using the compound was expressed as a percentage of the median fluorescence observed in the vehicle control over the same period. The inhibition rate of CsgA aggregation by the compound was determined by subtracting the percentage of the average fluorescence by the compound relative to the vehicle control from 100%. A higher positive inhibition rate reflects greater inhibition of CsgA aggregation, while a negative inhibition rate reflects increased CsgA aggregation.

[0331] 2. Using GraphPad Prism (GraphPad Software, San Diego, California), adjusted ThT fluorescence values ​​for each compound and vehicle control were plotted as progress curves over time. The area under the curve (AUC) for each compound at different time points (105 minutes, 255 minutes, 510 minutes, 750 minutes, 1005 minutes) was calculated for the vehicle control and each test concentration. The control AUC percentage was calculated by dividing the average AUC of each compound at each test concentration at a given time point by the average AUC of the vehicle control at the same time point. A lower control AUC percentage reflects greater inhibition of CsgA aggregation by the compound at a given concentration and time point, while a higher control AUC percentage reflects less inhibition of CsgA aggregation by the compound at a given concentration and time point.

[0332] 3. The adjusted ThT fluorescence values ​​for each compound concentration and vehicle control were plotted as progression curves using GraphPad Prism. The progression curves were plotted using the Hill slope (Y=B max *X^h / (T 1 / 2 The GraphPadPrism equation for specific binding using ^h + X^h) was fitted. The maximum binding value, i.e., B max This represents the maximum specific binding to ThT fluorescence. Time to maximum half-binding (T) 1 / 2 ) is semi-maximum B max This is the time required to achieve fluorescence, and higher T 1 / 2 This indicates that the compound delays CsgA aggregation in the assay or prolongs the delay period of CsgA aggregation in the assay. If a ThT molecule binds uncooperatively to one site on CsgA, the Hill slope (h) is equal to 1.0. If the Hill slope is greater than 1.0, CsgA has multiple binding sites for ThT with positive cooperativity. If there are multiple binding sites with different affinities to CsgA, or if there is negative cooperativity, the Hill slope is less than 0. For each test concentration of the compound, vehicle control B max % represents the average B of the compound. max The average B of the vehicle control maxIt was calculated by dividing by and multiplying by 100%. Vehicle control B with a lower percentage max This reflects greater inhibition of CsgA aggregation by the compound in the assay. The values ​​obtained for each parameter were replotted using the GraphPad Prism equation [inhibitor] vs. response-variable gradient (4 parameters), and the data were converted to IC 50 This was reported.

[0333] In other embodiments, the protein purification used in the CsgA assay can be performed without a histidine tag or with another tag, which may contain sequences that promote its efflux from cells. CsgA protein induction can be performed in cultures using different cell densities and varying concentrations of IPTG at different times and temperatures. CsgA can be purified using alternative methods well known to those skilled in the art, such as ammonium sulfate precipitation in a single step with different concentrations of ammonium sulfate, or ammonium sulfate precipitation in multiple steps with progressively increasing ammonium sulfate concentrations, and in some embodiments, ammonium sulfate precipitation may be omitted. In some embodiments, as well as well known to those skilled in the art, another resin or material may be used to separate CsgA from other proteins based on protein affinity, cation exchange, anion exchange, hydrophobic interactions, or multiple or combined methods. Protein separation can be performed using batch purification, packed columns, gravity flow, low pressure, high pressure, and high-pressure liquid chromatography, using methods well known to those skilled in the art, and these methods can be used individually or in combination. CsgA can be separated from other proteins by size using methods well known to those skilled in the art, such as size exclusion chromatography or high-pressure liquid chromatography. CsgA can be purified for all or part of the assay purification process under denaturing conditions using guanidinium hydrochloride at different concentrations, or other denaturing agents at various concentrations well known to those skilled in the art, such as urea. In some embodiments, CsgA is purified under natural conditions well known to those skilled in the art, and CsgA is generally purified rapidly under natural conditions or by a step using a non-denaturing buffer to avoid aggregation during the purification process. His-tagged CsgA can be eluted from immobilized metal affinity materials such as Ni-NTA using alternative methods known to those skilled in the art, such as lowering the pH or adding a chelating agent such as ethylenediaminetetraacetic acid.In addition to, or instead of, immobilized metal affinity chromatography based on the affinity of protein histidine residues to immobilized nickel, in some embodiments, as known to those skilled in the art, immobilized metal affinity chromatography or batch purification methods can be used that use immobilized copper, immobilized zinc, immobilized cobalt, or immobilized nickel as materials, for example, interacting with histidine or another amino acid of the protein (e.g., cysteine ​​or tryptophan). In some embodiments, a different buffer can be used with Ni-NTA agarose, for example, tris(hydroxymethyl)aminomethane ("Tris"), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid ("HEPES"), and 3-(N-morpholino)propanesulfonic acid ("MOPS"), optionally containing sodium chloride, potassium chloride, or other salts, and various surfactants and reducing agents in compositions and concentrations suitable for Ni-NTA agarose chromatography or batch purification. In this assay, different concentrations of dimethyl sulfoxide may be used, but significantly higher or lower concentrations of dimethyl sulfoxide (less than 1 percent) may affect the aggregation kinetics of CsgA. Different concentrations of thioflavin T may be used in the assay, which may affect the fluorescence signal and sensitivity of the assay. Different concentrations of CsgA may be used, and such changes may affect the aggregation kinetics of CsgA in the assay. Different concentrations of the compound may be tested in the assay to evaluate the dose-response. Further reagents, including surfactants such as sodium dodecyl sulfate, NaCl, dithiothreitol, or bovine serum albumin, may be added to the assay, which may affect the aggregation kinetics of CsgA depending on the concentration. Agitation by shaking may be included in the assay at different intervals and may affect the aggregation kinetics of CsgA. 2 mm glass beads or Teflon beads may be included in the assay containing CsgA, or beads of other sizes or compositions may be used, and these changes may affect the aggregation kinetics of CsgA.Other buffers, such as Tris, HEPES, or MOPS, and different buffer concentrations may be used in the assay, as they may affect the aggregation kinetics of CsgA. Any plate reader capable of fluorescence reading with a sufficiently narrow bandwidth, such as 10 nm, excited at 438 nM and emitting at 495 nm, may be used. Other microplates may be used in the assay, such as black microplates with a transparent bottom, solid white microplates, or white microplates with a transparent bottom. Different plate densities may also be used, such as 384-well or 1536-well formats. The plates may also be treated, but not limited to, unbound or highly bound coatings, or they may be untreated. The plates may be sealed with another coating that does not absorb ThT fluorescence, or the coating may be removed before reading. Fluorescence may be read at a single endpoint or at multiple points over various time intervals, and the time intervals for measuring fluorescence may be constant or vary over the course of the assay. The results are shown in Tables 3 and 4. Lower control B. max A percentage or lower control AUC percentage reflects greater inhibition of CsgA aggregation, while a higher control B max A percentage or higher control AUC percentage reflects less inhibition of CsgA aggregation.

[0334] Example 26A In vitro thioflavin T assay to investigate the effect of compounds on CsgA-seeded α-synuclein aggregation: To evaluate the effect of compounds on the aggregation of CsgA-seeded α-synuclein in E. coli, a cell-free assay was performed using purified α-synuclein, purified CsgA, and thioflavin T. In this assay, histidine-tagged CsgA was overexpressed in E. coli NEB3016slyD::kan cells containing a pET11d vector with csgA having a sequence of six histidine residues added to the C-terminus and lacking the Sec signal (amino acid 1-22) sequence. To induce CsgA overexpression, optical density (OD) at 600 nm was measured. 600CsgA was purified by batch purification using nickel-NTA agarose and by immobilized metal affinity chromatography using a combination of low pressure and gravity flow through a disposable polypropylene column, which included washing with 50 mM potassium phosphate buffer (pH 7.3) under low pressure manually applied by applying a syringe plunger to the column, followed by washing with 12.5 mM imidazole in 50 mM potassium phosphate buffer (pH 7.3), and elution with 125 mM imidazole in 50 mM potassium phosphate buffer (pH 7.3). A buffer containing imidazole was freshly prepared before protein purification. Purified CsgA was passed through a 30 kDa molecular weight cutoff filter and then through a desalting column. All steps of CsgA purification in the absence of guanidine hydrochloride were performed rapidly and continuously with as little delay as possible. CsgA was quantified using a BCA assay or absorbance at 280 nm using a nanodrop spectrophotometer. Human α-synuclein was expressed in E. coli BL21(DE3) from plasmids derived from pT7 or pET11a with the full-length, untagged human α-synuclein gene inserted. Cells were osmotically treated with 0.8 mM IPTG. 600The cells were induced at 0.6 for 4 hours. The cells were lysed by boiling for 20 minutes, the cell debris was pelleted by centrifugation, and the clarified lysate was treated with 136 μL / mL of 10% streptomycin sulfate, followed by 228 μL / mL of glacial acetic acid. The lysate was centrifuged, the supernatant was transferred to a new tube, and the protein was precipitated by adding an equal volume of saturated (100%) ammonium sulfate. The ammonium sulfate pellet was washed with 100 mM ammonium acetate in an equal volume of ethanol, pelleted by centrifugation, washed twice with ethanol, dried overnight, resuspended in 10 mM Tris (pH 7.4), and passed through a 50 kDa cutoff column. Immediately before use, the purified α-synuclein was filtered through a 0.2 μm nylon filter. The assay was performed in a 96-well black microplate containing one glass bead (1–2 mm) per well, 20–40 μM thioflavin T, 1% DMSO, 2 μM CsgA, 50–60 μM α-synuclein, 100 mM sodium chloride, 9.3 mM potassium phosphate (pH 7.3), and 50 μM of the compound. The compound was tested in triplicates. The plate was sealed with sealing tape (ThermoFisher 232701) and incubated in a Tecan Nano F200 plate reader with continuous shaking at 37°C, excited at 438 nm using a 439 nm filter with an 8 nm bandwidth and emitted at 495 nm using a 490 nm filter with a 10 nm bandwidth, or excited at 438 nM and emitted at 495 nm in a SpectraMax M5 or SpectraMax® i3X. Readouts were taken hourly for up to 73 hours. The effect of compounds on CsgA-seeded α-synuclein aggregation in this assay was investigated using data from 16 to 52 hours into the assay. The fluorescence values ​​of each compound containing CsgA and α-synuclein were first adjusted by subtracting the average fluorescence of the compound in the absence of CsgA and α-synuclein. These adjusted values ​​were normalized by dividing them by the average fluorescence at the same time point in the vehicle control well containing all assay components except the compound. The average or centrally normalized fluorescence of the compound was then expressed as a percentage of the average or central fluorescence observed in the vehicle control at the same time point.The inhibition rate of CsgA-seeded α-synuclein aggregation by each compound was determined by subtracting the average percentage or central fluorescence at 100% of the compound. A higher positive inhibition rate reflects greater inhibition of CsgA-seeded α-synuclein aggregation, while a negative inhibition rate reflects increased CsgA-seeded α-synuclein aggregation.

[0335] [Table 3] TIFF0007836089000062.tif246170TIFF0007836089000063.tif254170TIFF0007836089000064.tif254170TIFF0007836089000065.tif254170

[0336] The effect of compounds on CsgA aggregation, CsgA expression, and α-Syn aggregation, i.e., the mean maximum CsgA aggregation (B) as a percentage of DMSO control in a ThT assay using 2 μM CsgA, 100 μM, and 25 μM of the compound in a white plate. max ), median Abs IC in CsgA reporter assay 50 We investigated the mean inhibition rate of αSyn aggregation in ThT assays using 50 μM αSyn and 100 μM of the compound, compared to a DMSO control.

[0337] [Table 4] TIFF0007836089000067.tif254170TIFF0007836089000068.tif254170TIFF0007836089000069.tif25417 0TIFF0007836089000070.tif254170TIFF0007836089000071.tif229170TIFF0007836089000072.tif81170

[0338] The range of inhibition percentages presented is defined as follows: (--) represents less than -10, (-) represents -10 to 10, (+) represents 11 to 30, (++) represents 31 to 60, and (+++) represents greater than 60.

[0339] Shown is contrast B max The ranges for % and control AUC% are defined as follows: (++++) represents 10 or less, (+++) represents 11 to 30, (++) represents 31 to 60, and (+) represents greater than 60.

[0340] Presented reporter assay IC 50 The range of (μM) is defined as follows: (****) represents less than 1.3, (***) represents 1.3 to 4.5, (**) represents 4.6 to 10, and (*) represents greater than 10.

[0341] The effects of compounds on CsgA aggregation, CsgA expression, and α-Syn aggregation, specifically, the mean AUC as a percentage of the DMSO control in ThT assays using 10 μM CsgA, 100 μM, and 25 μM of the compound in a black plate, and the median Abs IC in a CsgA reporter assay. 50 We investigated the mean inhibition rate of αSyn aggregation in ThT assays using 50 μM αSyn and 100 μM of the compound, compared to a DMSO control.

[0342] Results of thioflavin T assays on the effects of compounds on aggregation. The activity ranges of the compounds are defined in Tables 3 and 4. The tested compounds showed a variety of effects in thioflavin T assays on α-synuclein and CsgA aggregation. The compounds showed a variety of activity ranges. The inhibition of various types of aggregation described in Tables 3 and 4 suggests that the compounds of the present invention (e.g., the compounds shown in Table 1) may be useful in preventing α-synuclein aggregation, the seeding of α-synuclein aggregation by CsgA or other microbial amyloids, and the formation of microbial amyloids that can seed α-synuclein aggregation in vivo, thereby suggesting that these compounds may be useful in preventing or treating Parkinson's disease and other α-synucleinopathy. By oral administration of these compounds, relatively high concentrations can be achieved in the gastrointestinal tract, which may be rich in amyloid-producing microorganisms, and the compounds may inhibit their seeding of α-synuclein aggregation. The inhibition of α-synuclein aggregation by these compounds may be beneficial on its own, or it may have a synergistic effect with the inhibition of microbial amyloid-seeded α-synuclein aggregation. In line with Braak's hypothesis of prion-like transmission of α-synuclein from the enteric nervous system to the central nervous system (e.g., Rietdijk et al., “Exploring Braak's Hypothesis of Parkinson's Disease,” Front. Neurol., 13 February 2017), these inhibitory effects may be beneficial in preventing the transmission of α-synuclein aggregates in both the enteric and central nervous systems. Furthermore, if orally administered compounds mitigate the continuous dissemination of α-synuclein aggregates by microbial amyloid or the independent formation of α-synuclein aggregates, the process by which the target can remove α-synuclein aggregates may have a greater net effect (i.e., the process may not lag behind aggregate formation), thereby potentially making these compounds effective in preventing or treating Parkinson's disease and other microbial amyloid-dissemination α-synucleinopathy.While not limited by theory, oral administration may offer a specific benefit in the gastrointestinal tract, potentially restoring gastrointestinal function in patients with impaired gastrointestinal function, or preventing or delaying further loss of gastrointestinal function, and / or providing a specific benefit in improving one or more of the following symptoms in patients with alpha-synuclein pathology or those at risk of developing alpha-synuclein pathology: dysphagia, decreased bowel motility, gastrointestinal paresis, constipation (including chronic and chronic idiopathic constipation), small intestinal bacterial overgrowth (SIBO), diarrhea, abdominal pain and / or cramps, bloating, flatulence, nausea, or any other symptom of irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, increased intestinal permeability, or any combination thereof.

[0343] As shown in Tables 3 and 4, some compounds inhibited only one or two types of aggregation in the assay, while others were inactive or appeared to enhance one or more types of aggregation. Some compounds may also inhibit CsgA-seeded alpha-Syn aggregation.

[0344] Example 27 In vitro live-cell fluorescence reporter assay to investigate the effects of compounds on CsgA transcription. To evaluate the effects of compounds on CsgA gene expression, a live-cell assay was performed using an engineered strain of Escherichia coli UTI89 with a fluorescent CsgA gene expression reporter driven by a csgBAC promoter. As described in Cegelski et al., "Small-molecule inhibitors target Escherichia coli amyloid biogenesis and biofilm formation," Nat. Chem. Bio., 25 Oct 2009, in the reporter strain, the gene encoding green fluorescent protein (GFP) was inserted as a single copy into the E. coli UTI89 chromosome, positioned immediately downstream of the complete intergenetic region between csgDEF and csgBAC, which contains the csgBAC promoter and other transcriptional regulatory elements. In this construct, GFP expression in the reporter strain was under the same regulation as CsgA expression. Reporter strains were isolated on YESCA agar plates (1 g / L yeast extract, 10 g / L casu amino acids, 20 g / L Bacto Agar) and grown at approximately 27°C for 2 days, or until single colonies were large enough to be picked. Single colonies of the reporter strain were inoculated into 5 mL of YESCA medium (1 g / L yeast extract, 10 g / L casu amino acids) and grown overnight at approximately 27°C. The inoculum was diluted 1:10 with YESCA medium and measured at 600 nm optical density (OD) using a SpectraMax M2 or M5e spectrophotometer (Molecular Devices, San Jose, California) in a cuvette. 600 The OD was then measured. The culture was then further diluted to obtain a final OD of 0.003. 600 Achieved this, and this is OD 600This was confirmed by measurement. The compounds were diluted with dimethyl sulfoxide (DMSO) to a final test concentration of 0.14–100 μM and plated in 96-well plates treated with tissue culture using 1.5 μL / well black clear bottom. All assay wells, including vehicle controls and positive controls for inhibition, contained 1% DMSO in the final stage. Vehicle control wells consisted of DMSO and the reporter strain to evaluate the expression of the reporter strain in the assay in the absence of any compound. Positive controls for inhibition included a well containing compound 020, which had been previously observed to inhibit CsgA expression in WT E. coli by qRT-PCR, and a well containing a 10 g / L salt final stage that largely or completely inhibited CsgA expression in vitro. OD in YESCA medium 600 148.5 μL of culture with a concentration of 0.003 was added to each well to a final volume of 150 μL. The plate was incubated at 27°C for 20 hours, and then the GFP fluorescence signal in each well was read using a Spectramax M2 or M5e plate reader with excitation at 485 nm, emission at 525 nm, and cutoff at 515 nm. The OD of each well was read. 600 The values ​​were measured using a Spectramax M2 or M5e plate reader. Since 10 g / L NaCl completely inhibited CsgA expression under these growth conditions, background fluorescence was calculated by averaging the values ​​from wells containing bacteria in YESCA containing 10 g / L NaCl. After subtracting the background fluorescence from all wells, the fluorescence signal of each well was normalized relative to the mean of the vehicle control well. The normalized dose-response curves were plotted for each compound, and the compound inhibition of CsgA transcription was analyzed using GraphPad Prism software version 8.1.1 (GraphPad Software, San Diego, California), with curve-fitted IC2. 50The bottom, top, span (top-bottom), and hill slope were investigated by evaluating them. An additional metric used to evaluate the compounds was the concentration at which the curve reached 50% of the vehicle control expression level. This was described as a custom analysis in GraphPad Prism according to the compound concentration at which the fluorescence of the reporter strain reached 50% of the vehicle control fluorescence, i.e., the X value at which equation X

[50] , or Y=50. Apart from the fluorescence data, OD 600 The values ​​were normalized to the mean of the vehicle control well, and dose-response curves were plotted for each compound. OD > 10% 600 The decrease indicated that the compound had some toxicity or adverse effect on bacterial growth.

[0345] In some embodiments, other versions of the live-cell reporter assay for CsgA expression can use a plasmid-encoded reporter construct. The same reporter, consisting of the GFP gene immediately following the E. coli intergeneric region containing the csgBAC promoter and all transcriptional regulatory elements, may be encoded on a plasmid along with a select marker, such as antibiotic resistance, driven by a constitutive promoter. The plasmid may be low, medium, or high copy number. The plasmid-mediated reporter can be transformed into other E. coli strains, certain other compatible strains, and additional microbial strains, including engineered or selected mutants such as csgB knockout. In some embodiments, other reporters can be used, including other fluorophores such as mCherry, chemiluminescent reporters such as luciferase, and colorimetric reporters such as LacZ. Amyloid-binding dyes can also be used separately or in combination with the reporter to directly quantify Curli production. Other modifications to the reporter assay may include changing the assay format to 6-well, 12-well, 24-well, 48-well, or 384-well plates, culture tubes, microcentrifuge tubes, or other culture vessels. Spectrophotometric readings can be performed with various assay plate types (clear, black, white, solid bottom plate, or clear bottom plate with lid or plate seal) or cuvettes. In some embodiments, the assay volume may range from about 30 μL to several mL. Growth conditions for both the starter culture and plated bacteria can be modified, for example, incubation temperature of about 20–37°C, growth on solid agar instead of medium, growth in different media types such as salt-free Luria-Bertani medium (LB), and different initial ODs. 600Modifications such as dilution of the starter culture and growth with shaking can be made. The assay can be extended up to 72 hours. The compound may be administered to bacteria approximately 12–16 hours after plating so that they grow and reach a plateau phase before exposure to the compound, or the compound may be washed off approximately 12–16 hours later to assess recovery from the effect of the compound. The assay window and possibly sensitivity can be altered by significantly decreasing or increasing the final DMSO concentration from 1%. In some embodiments, the assay may also be performed using kinetic readings instead of endpoints to confirm the effect of the compound on CsgA expression over time. The results are shown in Tables 3 and 4 below.

[0346] Example 27A A monocolonized mouse model was developed. To evaluate the effect of compounds on CsgA expression in vivo, sterile female C57 BL / 6NTac mice were randomized into groups of approximately 5–10 mice each and housed in isolators using appropriate methods to maintain the symbiotic state of the mice throughout the experiment. Mice were monocolonized with E. coli MC4100 at 5–8 weeks of age. At least 6 days after colonization, monocolonized mice were treated daily with either a vehicle or a compound by oral forced nutrition for 9–14 days. Fecal pellets were collected from individual mice, rapidly frozen on dry ice within 60 minutes of defecation, and stored at -80°C. Fecal pellets were evaluated by culture, qPCR, and / or 16s rRNA gene sequencing to confirm sterility or monocolony status and determine the level of colonization.

[0347] CsgA expression relative to the expression of housekeeping genes recA, cysG, hcaT, and / or idnT was evaluated by qRT-PCR. All reagents and materials used for RNA isolation, reverse transcription, and qPCR were proven to be RNase-free. Controls included cultures of WT E. coli and CsgA deletion mutants. RNA was isolated from 1 to 3 fecal pellets per mouse using the ZymoBIOMICS RNA Miniprep kit, catalog number R2001, protocol version 1.1.0 (Zymo Research, Irvine, California). For each sample, 1 to 3 fecal pellets were added to a ZR BashingBead Lysis Tube, 750 μL of DNA / RNA Shield was added to the tube, and the tube was immobilized on a Bead Ruptor Elite bead mill homogenizer (Omni International, Kennesaw, Georgia). The samples were processed in a bead mill homogenizer at 3.25 m / s for four cycles of 2 minutes on and 2 minutes off, for a total processing time of 16 minutes. BashingBead Lysis Tubes were centrifuged at 16,000 × g for 1 minute, and 300 μL of supernatant was transferred to a new RNase-free tube. Nucleic acids were extracted from the supernatant according to the ZymoBIOMICS RNA Miniprep kit, catalog number R2001, protocol version 1.1.0, omitting the DNase treatment step specified in the kit protocol. After nucleic acid isolation, DNA was removed from the nucleic acids using the Invitrogen TURBO DNA-free® Kit, catalog number AM1907, according to the Invitrogen TURBO DNA-free® Kit User Guide Publication Number 1907M Revision H (ThermoFisher Scientific Baltics, Vilnius, Lithuania). The absorbance at 260 nm, 280 nm, and 230 nm was measured using a NanoDrop2000 spectrophotometer (Thermo Scientific, Wilmington, Delaware), and for each sample, A 260 / A 280 Ratio and A 230 / A280 The concentration and quality of RNA were evaluated by calculating the ratio.

[0348] Reverse transcription was performed in a 20 μL reaction mixture containing 2.5 ng / μL of RNA final product, 0.2 ng / μL of SuperScript Vilo IV Master Mix final product (catalog number 11756500, Life Technologies, Carlsbad, California), and nuclease-free water. The reaction mixture was incubated at 25°C for 10 minutes, 50°C for 10 minutes, and 85°C for 5 minutes. The reaction was set up and run in parallel without reverse transcriptase to monitor for DNA contamination.

[0349] qPCR was performed using primers for detecting csgA (forward primer: TCT GGC AGG TGT TGT TCC TC, reverse primer: CCG CCG CCA TGC TGG GTA AT), primers for detecting the housekeeping gene recA (forward primer: CTGTTCGTCTCGACATCCGT, reverse primer: TCGCCGTAGAGGATCTGGAA), primers for detecting hcaT (forward primer: TTCTGGCCTGCGTTTGTTTAT, reverse primer: AGATCAACAGCATATCGCGTG), primers for detecting cysG (forward primer: AACAACGATCAGAAAGCCATT, reverse primer: TATCGTCAGAAACCAGACGGT), and / or primers for detecting idnT (forward primer: ACTCGCTTTGAGAAAGCACCA, reverse primer: GGTTACCGACAAATTCAAAGA). The qPCR reaction product contained 50 nM forward primer final product, 50 nM reverse primer final product, 10 μL of Applied Biosystems PowerUp® SYBR Green master mix (Thermo Fisher Scientific, Austin, Texas), approximately 5 ng of cDNA, and RNase / DNase-free water in a final reaction volume of 20 μL. The qPCR reaction was performed in a 384-well plate of an Applied Biosystems QuantStudio5 real-time PCR system (Thermo Fisher Scientific, Waltham, Massachusetts) for 40 cycles consisting of 2 minutes at 50°C, 10 minutes at 95°C, and 15 seconds at 95°C and 1 minute at 60°C. All reactions were performed in triplicate, and controls included a reaction without a template, a reverse transcriptase-negative control, and reactions with products from WT E. coli and CsgA-deficient mutants. Before including the data in subsequent analysis, the melting temperature was examined to ensure that the cycle threshold (CT) value corresponded to the specified target.To determine the effects of different treatments on csgA expression, the CT values ​​obtained from reactions with csgA primers were normalized to the CT values ​​obtained from reactions with housekeeping gene primers, and the percentage change in expression compared to the vehicle control group was calculated. See Figures 29A and 29B.

[0350] In other embodiments of the assay described herein, germ-free mice may be monocolonized with amyloid-producing bacteria other than Escherichia coli MC4100, and the mice may be colonized by alternative methods, such as administering viable bacterial cells onto bedding, in food, or in drinking water, or by exposure to monocolonized mice or the bedding or feces of monocolonized mice. Mice of strains other than C57 BL / 6NTac mice and male mice may be used. The compound and vehicle may be administered via drinking water, in food, or through other routes such as intranasal passages. The compound may be administered for less than 9 days or longer than 14 days. The fecal pellets may be added to an RNA protective agent such as RNA Later instead of, or in addition to, rapid freezing.

[0351] In other embodiments of the qRT-PCR assay described in Example X for evaluating the effect of a compound on CsgA expression, different primers may be designed and implemented to evaluate the expression levels of csgA, recA, cysG, hcaT, and idnT using methods well known to those skilled in the art. The qRT-PCR values ​​for csgA may be normalized using other housekeeping genes such as rrsA, fliC, pbpC, uxuB, ugpQ, uxuR, and ispA. Instead of, or in addition to, the expression of csgB and / or csgC, ​​which are in the same operon as csgA, may be evaluated, and the expression of regulators of csgA expression, such as CsgD, may be monitored. Instead of, or in addition to, evaluating the mRNA level of csgA in feces, the mRNA level of csgA in gastrointestinal contents, gastrointestinal sections, or the entire gastrointestinal tract may be evaluated. RNA may be isolated from the sample and DNA removed from the RNA sample using different methods and materials. cDNA may be generated using a different reverse transcriptase method, a different enzyme, a different oligomer, such as a target-specific oligomer, a higher or lower reverse transcriptase concentration, a higher or lower oligomer concentration, a higher or lower RNA concentration, and different temperature and time cycling parameters. Other chemicals, such as a Taqman probe or another SYBR Green formulation, may be used in qPCR, and a different qPCR instrument may be used with compatible qPCR reagents. As is well known to those skilled in the art, higher or lower cDNA concentrations, higher or lower primer concentrations, and different cycling parameters may be applied to qPCR. A single-step qRT-PCR may be performed instead of separate reverse transcription and qPCR reactions, and mRNA levels may be measured by a method other than qRT-PCR, for example, by fluorescence in situ hybridization.

[0352] In some embodiments, to evaluate the effect of a compound on mouse CsgA, instead of, or in addition to, evaluating the mRNA level of csgA, the actual CsgA protein level may be evaluated. In some embodiments, CsgA protein levels in feces, gastrointestinal contents, or gastrointestinal sections may be monitored by various methods such as Western blotting, ELISA, and mass spectrometry.

[0353] Example 27B 96-well Congo Red Assay. To evaluate the effect of compounds on Curli production in viable bacterial cells, an in vitro assay was performed using YESCA agar (10 g / L casu amino acids, 1 g / L yeast extract, and 20 g / L agar) containing E. coli MC4100 or UTI89ΔbcsA and Congo Red, a dye that binds to Curli. For the assay, a single colony of E. coli MC4100 or UTI89ΔbcsA was inoculated into 5 mL of L medium, incubated at 37°C for 18 hours with shaking, and the culture was incubated overnight in YESCA medium (10 g / L casu amino acids and 1 g / L yeast extract). 600The compound was prepared by dilution to 0.05. This assay was performed on a 96-well clear polystyrene Denville cell culture plate, product number T1096, manufactured by Thomas Scientific (Suidesboro, New Jersey). The compound was tested at two-fold dilutions in the range of final concentrations from 100 μM to 1.25 μM. Since the salt inhibits Curli expression, 25 g / L sodium chloride was included as a positive control for Curli inhibition. Assay plates were first prepared by spotting 1.5 μl of DMSO, DMSO containing sodium chloride, or the compound into the appropriate wells. 150 μl of molten YESCA agar containing Congo Red at a final concentration of 5 μg / mL was added to all wells of the assay plate. The mixture was pipetted up and down five times to ensure thorough mixing of the compound and agar. After plate preparation, 5 μl of inoculum was spotted onto the agar in the appropriate wells of the 96-well plate. Three wells were spotted with YESCA medium free of bacteria to serve as blank wells for normalizing the data. After adding the medium or bacteria, the plates were dried in a biological safety cabinet. The dried assay plates were incubated at 26°C for 24–72 hours in a standing incubator with a water jacket. The binding of Congo red to Curli on the bacterial surface was measured by fluorescence reading using a SpectraMax M2 or M5 spectrophotometric plate reader (Molecular Devices, San Jose, California) with excitation set to 497 nm and emission set to 614 nm. OD of each well 600 Bacterial growth was confirmed by measuring Congo red fluorescence and OD using a SpectraMax M2 or M5 plate reader. 600Both readings were taken at 20–25°C. The Congo Red fluorescence value of bacteria in each well was calculated by subtracting the average fluorescence reading of blank wells (containing DMSO and Congo Red YESCA agar but no bacteria) from the untreated fluorescence reading of wells containing bacteria. The fluorescence value from wells containing compounds was divided by the average fluorescence reading of DMSO control wells containing bacteria and DMSO. The percentage of DMSO control at each compound concentration was calculated, with lower percentages of DMSO control indicating a potent compound. Furthermore, IC 50 This was calculated using GraphPad Prism software version 8.0.1 from GraphPad Software Inc. (San Diego, California), employing a nonlinear regression and inhibitor-versus-response (four-parameter) equation.

[0354] In some embodiments, the above 96-well Congo Red assay may be carried out using different or alternative amyloid-binding dyes such as (E,E)-1-fluoro-2,5-bis(3-hydroxycarbonyl-4-hydroxy)styrylbenzene (FSB) or turmeric, which are thought to bind specifically to curli, whereas Congo Red binds to both cellulose and curli (Reichhardt and Cegelski, PLoS One, 2018 and McCrate et al., Chem Communication, 2013). In some embodiments, amyloid-producing microbial strains other than Escherichia coli MC4100 or UTI89ΔbcsA, such as citrobacter, salmonella, enterobacter, staphylococcus, bacillus, or pseudomonas strains, may be included in the assay. In some embodiments, the DMSO concentration used in the assay may be increased, decreased, or eliminated. In the case of E. coli, increasing DMSO has been reported to upregulate the level of Curli production until it reaches a concentration harmful to the bacteria, while decreasing it reduces the level of Curli production (Lim et al., Appl Environ Micorbiol, 2012). Similarly, the concentration of the compound being tested can be increased or decreased. In some embodiments, the concentration of Congo Red dye, or another dye used, can be increased or decreased, and by varying the dye concentration, the best signal window between the background fluorescence from the dye of the agar itself and the fluorescence of the dye that binds to Curli can be identified. The culture may be incubated overnight in YESCA medium or another salt-free medium, which may affect the time required for assay readout after plating the bacteria, as the salts present in the L medium inhibit curli expression. In contrast, another nutrient-rich medium other than LB may be used for the starter culture to continue restricting curli production until the bacteria are seeded. The number of bacteria at the start of the assay can be increased or decreased, and this increase or decrease in the initial number of cells in the assay can be achieved by changing the amount of inoculum spotted on the assay plate or by changing the OD of the bacteria being plated. 600This can be carried out by modifying the following: The incubation temperature of the plate can be increased or decreased in the assay, and this change in temperature may affect the signal window and / or duration of the assay. Depending on the stability of the compound being tested, the timing of the assay can be modified to allow for extended bacterial growth on the plate. Since optimal expression of the Curli protein is thought to occur during the quiescent phase, extending the incubation may highlight the difference in potent production of Curli in the DMSO control compared to the reduced Curli expression resulting from a potent and stable inhibitor. In some embodiments, the assay can be carried out in liquid medium by co-incubating the compound with bacteria under conditions that allow amyloid expression, then adding the amyloid-binding dye to the liquid culture in the assay plate, incubating to bind the dye to bacterial amyloid, pelleting the bacteria to remove the unbound dye, and measuring the fluorescence after resuspending the pellet in fresh medium. Specific types of assay plates used to perform the assay can be modified to reduce the number of wells and increase the size of the bacterial flora spotted on the agar. In some embodiments, the assay can be carried out in 96-well, 48-well, 24-well, 12-well, or 6-well assay plates or Petri dishes, and the assay volume can be increased or decreased. In some embodiments, the assay can be carried out in polystyrene plates, polypropylene plates, white plates, black plates, clear-bottom plates, untreated plates, unbound plates, or highly bound plates. In some embodiments, darker red growth indicates increased binding of CongoRed to amyloid in the assay, so the amount of amyloid production by the compound and the inhibition of amyloid production in the assay can be visually assessed, for example, by creating a color scale from 0 to 5, where 0 is assigned to a light color indicating minimal curli expression and 5 indicates robust expression of curli, indicated by strong binding of the dye.

[0355] Example 28 2-Methyl-8-(naphthalene-1-ylmethyl)-6-oxo-9-(3-(trifluoromethyl)phenyl)-3,4-dihydro-2H,6H-pyrido[1,2-e][1,2,5]thiadiazine-4-carboxylic acid 1,1-dioxide. Synthesis of compound 008 (racemic mixture), compound 008a and compound 008b. [ka]

[0356] Step 1: Preparation of ethyl 2-(3-(trifluoromethyl)phenyl)acetylamide

[0357] 2-(3-(trifluoromethyl)phenyl)acetonitrile (50.0 g, 270.0 mmol) was dissolved in ethanol (80 mL) and cooled to 0°C. The reaction mixture was purged with HCl gas for 4 hours. The reaction mixture was stirred at room temperature for 16 hours. The reaction mixture was then evaporated to obtain ethyl 2-(3-(trifluoromethyl)phenyl)acetylide as a white solid (...

Claims

【Request Item 1】 【Chemistry 11】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 and compounds selected from these pharmaceutically acceptable salts.

2. A pharmaceutical composition comprising the compound described in claim 1 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

3. The pharmaceutical composition according to claim 2, wherein the compound or the pharmaceutical composition is formulated for oral administration.

4. The pharmaceutical composition according to claim 2, formulated for controlled release within the lower intestinal tract or colon of the target area.

5. A pharmaceutical composition according to any one of claims 2 to 4 for inhibiting amyloid formation in a target.

6. A pharmaceutical composition according to any one of claims 2 to 4 for preventing or treating amyloid disorders in a target area.

7. The pharmaceutical composition according to claim 6, wherein the amyloid disorder is a neurological disorder.

8. The pharmaceutical composition according to claim 6, wherein the amyloid disorder is Parkinson's disease (PD), Lewy body dementia, multiple system atrophy, multiple sclerosis (MS), frontotemporal dementia (FTD), REM sleep behavior disorder (RBD), alpha-synucleinopathy, PD-related constipation, PD-related hypotension, Huntington's disease, Alexander disease, amyotrophic lateral sclerosis (ALS), or Alzheimer's disease.

9. The pharmaceutical composition according to claim 6, wherein the amyloid disorder is intestinal dysbiosis, increased intestinal hyperpermeability, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), ulcerative colitis, or Crohn's disease.

10. The pharmaceutical composition according to claim 6, wherein the subject suffers from one or more gastrointestinal symptoms, including dysphagia, decreased bowel motility, gastroparesis, constipation, small intestinal bacterial overgrowth (SIBO), diarrhea, abdominal pain and / or cramps, bloating, flatulence, increased salivation (excessive salivation), anorectal dysfunction, defecation coordination disorder, and nausea.

11. The pharmaceutical composition according to claim 10, wherein the gastrointestinal symptoms are related to alpha-synucleinopathy, Parkinson's disease, or parkinsonism.

12. A method for interfering with and / or inhibiting the formation of amyloid protein aggregates in vitro, comprising contacting amyloid or an amyloid precursor with the compound described in claim 1 or a pharmaceutically acceptable salt thereof.

13. A pharmaceutical composition according to any one of claims 2 to 4 for inhibiting the formation of amyloid protein aggregates in a target.

14. The pharmaceutical composition according to claim 13, wherein the amyloid protein comprises one or more mammalian proteins.

15. The pharmaceutical composition according to claim 13, wherein the mammalian protein is selected from the group consisting of α-synuclein, tau, beta-amyloid derived from amyloid precursor protein, mezin, apolipoprotein AI, atrial natriuretic factor, beta-amyloid, cystatin, IAPP (amylin), beta-2 microglobulin, transthyretin, PrP, gelzolin, lysozyme, huntingtin, keratoepicelin, calcitonin, prolactin, serum amyloid A, SOD1, and immunoglobulin light chain AL.

16. The pharmaceutical composition according to any one of claims 13 to 15, wherein the amyloid protein comprises one or more bacterial proteins or fungal proteins.

17. The pharmaceutical composition according to claim 16, wherein the bacterial protein is CsgA or a CsgA homolog.

18. The pharmaceutical composition according to claim 17, wherein the CsgA homolog is produced by one or more organisms selected from the group consisting of Cytrobacter farmeri, Salmonella enterica, Enterobacter cloacae, Bacillus velezensis, Pseudomonas stutzeri, Burkholderia cepacia, Hafnia alvei, and Pseudomonas reinekei.

19. The pharmaceutical composition according to any one of claims 13 to 18, wherein the amyloid protein is present in the gastrointestinal tract, dural venous sinus, oral cavity, or nasal cavity.

20. The pharmaceutical composition according to any one of claims 13 to 19, wherein the amyloid protein is present in the enteric nerve tissue or the olfactory bulb.

21. A pharmaceutical composition according to any one of claims 13 to 20, which causes a measurable change in the nervous system of the subject.

22. A pharmaceutical composition according to any one of claims 13 to 21, which causes a measurable change in the gastrointestinal system of the subject.

23. The pharmaceutical composition according to claim 21, wherein the changes in the nervous system include one or more of the following: anosmia, olfactory dysfunction, bradykinesia, ataxia, tremor, muscle rigidity, postural and balance disorders, loss of automatic movement, dysarthria or other speech changes, changes in handwriting, orthostatic hypotension, memory impairment, dysphagia, incontinence, sleep disorders, cardiac arrhythmias, visual impairment, psychiatric problems including depression and hallucinations of sight, hearing, smell or touch, dizziness, cognitive impairment, changes in dopamine levels, changes in serotonin levels, changes in kynurenine levels, and / or any combination thereof.

24. The pharmaceutical composition according to any one of claims 13 to 23, wherein the subject is identified or selected as a subject that is at risk of developing or already has Parkinson's disease.

25. The pharmaceutical composition according to any one of claims 13 to 24, wherein the subject is identified or selected as having or already having a risk of developing Lewy body dementia, associated Lewy body disease, Lewy body variant of Alzheimer's disease, multiple system atrophy, pure autonomic dysregulation, or any combination thereof.

26. A pharmaceutical composition according to any one of claims 2 to 4 for preventing or treating inflammatory disorders in a target area where it is needed.

27. The pharmaceutical composition according to claim 26, wherein the inflammatory disorder is selected from the group consisting of bacterial sepsis, autoimmune diseases, lupus erythematosus, ischemia-reperfusion injury, stroke, metabolic diseases, obesity-related metabolic inflammation, gout, and cancer.

Citation Information

Patent Citations

  • Electrophotographic photoreceptor

    JP2009025682A