A vector having a promoter and enhancer combination for treating phenylketonuria.

JP7838779B2Active Publication Date: 2026-04-01AMERICAN GENE TECHNOLOGIES INTERNATIONAL INC
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2018-10-02
Publication Date
2026-04-01

Smart Images

  • Figure 0007838779000045
    Figure 0007838779000045
  • Figure 0007838779000046
    Figure 0007838779000046
  • Figure 0007838779000047
    Figure 0007838779000047
Patent Text Reader

Abstract

A lentiviral vector system for expressing lentiviral particles is disclosed. The lentiviral vector system includes a therapeutic vector. The lentiviral vector system produces lentiviral particles for upregulating PAH expression in cells of a subject suffering from phenylketonuria (PKU). In one aspect, a viral vector is provided that includes a therapeutic cargo portion, wherein the therapeutic cargo portion includes a PAH sequence or a variant thereof; a promoter; and a liver-specific enhancer, and the PAH sequence or a variant thereof is operatively regulated by both the promoter and the liver-specific enhancer.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 62 / 566,979, filed on 2 October 2017, entitled "VECTORS WITH PROMOTER AND ENHANCER COMBINATIONS FOR TREATING PHENYLKETONURIA," the entirety of which is incorporated herein by reference.

[0002] Aspects of this disclosure relate to gene therapies for treating phenylketonuria (PKU). More specifically, aspects of this disclosure relate to lentiviral vectors, including PAH-containing lentiviral vectors, whose expression is regulated by various promoter-enhancer combinations. [Background technology]

[0003] Phenylketonuria (PKU) represents a heterogeneous group of disorders that, if left untreated, can cause intellectual disability, seizures, behavioral problems, and growth and developmental delays in children. The mechanism by which hyperphenylalaninemia leads to intellectual disability reflects the remarkable toxicity of high doses of phenylalanine, accompanied by myelin dysplasia or demyelination of the nervous system tissue. PKU has an average incidence of 1 in 12,000 people in North America and affects both sexes equally. The disorder is most common among people of European or Native American descent and reaches much higher levels in the Eastern Mediterranean region.

[0004] Neurological changes in patients with PKU are observed within the first month of life, and magnetic resonance imaging (MRI) in adult PKU patients revealed white matter lesions in the brain. The size and number of these lesions are directly correlated with serum phenylalanine levels. Cognitive profiles of adolescents and adults with PKU, compared to control subjects, may include significantly reduced IQ, processing speed, motor control and inhibitory abilities, and impaired performance on attention tests.

[0005] The majority of PKUs are caused by a deficiency of hepatic phenylalanine hydroxylase (PAH). PAH is a multimeric hepatic enzyme that catalyzes the hydroxylation of phenylalanine (Phe) to tyrosine (Tyr) in the presence of molecular oxygen and catalytic amounts of tetrahydrobiopterin (BH4), a non-protein cofactor of PAH. In the absence of sufficient PAH expression, blood phenylalanine levels increase, leading to hyperphenylalaninemia and adverse side effects in PKU patients. Reduced or absent PAH activity can lead to deficiencies in tyrosine as well as its downstream products, such as catecholamine neurotransmitters like melanin, l-thyroxine, and dopamine.

[0006] PKU can be caused by mutations in PAH and / or defects in the synthesis or regeneration of PAH cofactors (i.e., BH4). Notably, some PAH mutations have been shown to affect protein folding in the endoplasmic reticulum, resulting in accelerated degradation and / or aggregation due to missense mutations (63%) and small deletions (13%) in the protein structure, which attenuate or greatly eliminate enzymatic catalytic activity.

[0007] Generally, three major phenotypic groups are used to classify PKU based on blood plasma Phe levels, dietary tolerance to Phe, and potential response to treatment. These groups include classical PKU (Phe > 1200 μM), atypical or mild PKU (Phe 600–1200 μM), and constitutive mild hyperphenylalaninemia (HPA, Phe 120–600 μM).

[0008] PKU detection relies on Universal Neonatal Screening (NBS). A single drop of blood collected from a heel puncture is tested for phenylalanine levels in a screening mandated in all 50 US states.

[0009] Currently, lifelong phenylketonuria dietary restriction and BH4 supplementation are the only two treatment options available for PKU, and early therapeutic intervention is critically important to ensure optimal clinical outcomes in affected infants. However, costly drug applications and specialized low-protein foods impose a significant burden on patients and can lead to malnutrition, psychosocial, or neurocognitive complications, especially if these products are not fully covered by private health insurance. Furthermore, BH4 treatment is primarily effective in treating mild hyperphenylalaninemia associated with defects in BH4 biosynthesis, with only 20-30% of patients with mild or classic PKU responding. Therefore, there is an urgent need for new treatment approaches for PKU as an alternative to the burdensome phenylketonuria diet. For this reason, it would be desirable to develop alternative methods for the treatment of phenylketonuria.

[0010] Gene therapies have the potential to effectively treat PKUs. Gene therapies may involve the delivery and expression of gene constructs aimed at treating or preventing diseases. The expression of gene constructs may be regulated by various promoters, enhancers, and / or combinations thereof. [Overview of the project] [Means for solving the problem]

[0011] In one aspect of the present disclosure, a viral vector comprises a therapeutic cargo portion comprising a PAH sequence or a variant thereof, a promoter, and a liver-specific enhancer, wherein the PAH sequence or a variant thereof is operatively modulated by both the promoter and the liver-specific enhancer.

[0012] In an embodiment, the liver-specific enhancer includes a prothrombin enhancer. In an embodiment, the promoter is a liver-specific promoter. In an embodiment, the liver-specific promoter includes the hAAT promoter. In an embodiment, the therapeutic cargo portion further includes a β-globin intron. In an embodiment, the therapeutic cargo portion further includes at least one hepatocyte nuclear factor binding site. In an embodiment, at least one hepatocyte nuclear factor binding site is located upstream of the prothrombin enhancer. In an embodiment, at least one hepatocyte nuclear factor binding site is located downstream of the prothrombin enhancer.

[0013] In an embodiment, the PAH sequence or its variant is terminally truncated. In an embodiment, the terminally truncated portion of the PAH sequence or its variant is the 3' untranslated region (UTR) of the PAH sequence or its variant.

[0014] In an embodiment, the PAH sequence or its variant is as follows:

Chemical formula

Chemical formula

Chemical formula

[0015] In an embodiment, the PAH sequence or its variant includes SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; or SEQ ID NO: 4.

[0016] In some embodiments, the prothrombin enhancer is as follows:

Chemical formula

[0017] In this embodiment, the sequence of the prothrombin enhancer includes SEQ ID NO: 5.

[0018] In the embodiment, the sequence of the hAAT promoter includes SEQ ID NO: 6. In the embodiment, the sequence of the β-globin intron includes one of SEQ ID NOs: 7 or 8. In the embodiment, the sequence of the hepatocyte nuclear factor binding site includes one of SEQ ID NOs: 9 to 12.

[0019] In embodiments, the therapeutic cargo portion further comprises at least one small RNA sequence capable of binding to at least one predetermined complementary mRNA sequence. In embodiments, the at least one small RNA sequence targets a complementary mRNA sequence containing a full-length UTR. In embodiments, the at least one predetermined complementary mRNA sequence is a PAH mRNA sequence. In embodiments, the at least one small RNA sequence inhibits the production of endogenous PAH. In embodiments, the at least one small RNA sequence comprises shRNA. In embodiments, the at least one small RNA sequence is under the regulation of a first promoter, and the PAH sequence or a variant thereof is under the regulation of a second promoter. In embodiments, the first promoter comprises an H1 promoter. In embodiments, the second promoter comprises a liver-specific promoter. In embodiments, the liver-specific promoter comprises an hAAT promoter. In embodiments, the at least one small RNA sequence is: [ka] It includes sequences having at least 80%, at least 85%, at least 90%, or at least 95% percent identity.

[0020] In this embodiment, at least one small RNA sequence includes SEQ ID NO: 13 or SEQ ID NO: 14.

[0021] In one embodiment, the viral vector is a lentiviral vector. In another embodiment, the viral vector is an AAV vector.

[0022] In one embodiment of the present disclosure, a lentiviral particle capable of infecting target cells comprises an envelope protein optimized for infecting target cells and a viral vector according to any embodiment of the present disclosure. In the embodiment, the target cells are hepatocytes, muscle cells, epithelial cells, endothelial cells, nerve cells, neuroendocrine cells, endocrine cells, lymphocytes, myeloid cells, cells present in parenchymal organs or hematopoietic lineage cells, hematopoietic stem cells or progenitor hematopoietic stem cells.

[0023] In aspects of this disclosure, a method for treating PKU in a subject is disclosed. The method comprises administering a therapeutically effective amount of the lentiviral particles described herein to the subject. In aspects of this disclosure, a method for preventing PKU in a subject comprises administering a therapeutically effective amount of the lentiviral particles described herein to the subject. In embodiments, the method further comprises diagnosing a PKU genotype in the subject that correlates with a PKU phenotype. In embodiments, the subject is in utero. In embodiments, the diagnosis is performed during prenatal screening of the subject. In embodiments, the diagnosis is performed in vitro. In embodiments, the therapeutically effective amount of lentiviral particles comprises a plurality of single-dose doses of lentiviral particles. In embodiments, the therapeutically effective amount of lentiviral particles comprises a single-dose dose of lentiviral particles. The present invention provides, for example, the following items: (Item 1) A viral vector including a therapeutic cargo portion, wherein the therapeutic cargo portion is PAH sequence or its variant; Promoter and; Liver-specific enhancers, Includes, The PAH sequence or its variant is operatively regulated by both the promoter and the liver-specific enhancer. Viral vector. (Item 2) The viral vector according to item 1, wherein the liver-specific enhancer comprises a prothrombin enhancer. (Item 3) The viral vector according to item 2, wherein the promoter includes a liver-specific promoter. (Item 4) The viral vector according to item 3, wherein the liver-specific promoter includes the hAAT promoter. (Item 5) The viral vector described in item 1, wherein the PAH sequence or a variant thereof is terminally cleaved. (Item 6) The viral vector according to item 5, wherein the terminally cleaved portion of the PAH sequence or its variant is the 3' untranslated region (UTR) of the PAH sequence or its variant. (Item 7) The viral vector according to item 1, wherein the therapeutic cargo portion further comprises a β-globin intron. (Item 8) The viral vector according to item 1, wherein the therapeutic cargo portion further comprises at least one hepatocyte nuclear factor binding site. (Item 9) The viral vector according to item 8, wherein the at least one hepatocyte nuclear factor binding site is located upstream of the prothrombin enhancer. (Item 10) The viral vector according to item 8, wherein the at least one hepatocyte nuclear factor binding site is located downstream of the prothrombin enhancer. (Item 11) The viral vector according to item 1, wherein the PAH sequence or a variant thereof comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% percent identity with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. (Item 12) The viral vector according to item 11, wherein the PAH sequence or a variant thereof comprises SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. (Item 13) The viral vector according to item 2, wherein the prothrombin enhancer comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% percent identity with SEQ ID NO: 5. (Item 14) The viral vector described in item 2, wherein the sequence of the prothrombin enhancer includes sequence number 5. (Item 15) The viral vector described in item 4, wherein the sequence of the hAAT promoter includes sequence number 6. (Item 16) A viral vector as described in item 5, wherein the sequence of the β-globin intron includes sequence number 7 or 8. (Item 17) A viral vector as described in item 6, wherein the sequence of the hepatocyte nuclear factor binding site contains one of sequence numbers 9 to 12. (Item 18) The viral vector according to item 1, wherein the therapeutic cargo portion further comprises at least one small RNA sequence capable of binding to at least one predetermined complementary mRNA sequence. (Item 19) The viral vector according to item 18, wherein at least one small RNA sequence targets a complementary mRNA sequence containing a full-length UTR. (Item 20) The viral vector according to item 18, wherein the at least one predetermined complementary mRNA sequence is a PAH mRNA sequence. (Item 21) The viral vector according to item 18, wherein at least one of the small RNA sequences comprises shRNA. (Item 22) The viral vector according to item 18, wherein at least one small RNA sequence is under the control of a first promoter, and the PAH sequence or a variant thereof is under the control of a second promoter. (Item 23) The viral vector according to item 20, wherein the first promoter comprises an H1 promoter. (Item 24) The viral vector according to item 20, wherein the second promoter comprises a liver-specific promoter. (Item 25) The viral vector according to item 24, wherein the liver-specific promoter includes the hAAT promoter. (Item 26) The viral vector according to item 18, wherein the at least one small RNA sequence comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% percent identity with SEQ ID NO: 13 or SEQ ID NO: 14. (Item 27) The viral vector according to item 21, wherein the at least one small RNA sequence comprises SEQ ID NO: 13 or SEQ ID NO: 14. (Item 28) The viral vector described in item 1 is a lentiviral vector. (Item 29) A lentiviral particle capable of infecting target cells, wherein the lentiviral particle is An envelope protein optimized for infecting the aforementioned target cells; The viral vector described in item 1; lentiviral particles, including those containing lentiviral particles. (Item 30) The lentiviral particle described in item 29, wherein the target cells are hepatocytes, muscle cells, epithelial cells, endothelial cells, nerve cells, neuroendocrine cells, endocrine cells, lymphocytes, myeloid cells, cells present in parenchymal organs or hematopoietic cells, hematopoietic stem cells or precursor hematopoietic stem cells. (Item 31) A method for treating PKU in a subject, comprising administering a therapeutically effective amount of lentiviral particles described in item 29 or 30 to the subject. (Item 32) A method for preventing PKU in a subject, comprising administering a therapeutically effective amount of lentiviral particles described in item 29 or 30 to the subject. (Item 33) The method according to item 31 or 32, further comprising diagnosing a PKU genotype in the subject that correlates with a PKU phenotype. (Item 34) The method according to item 31 or 32, wherein the subject is located in the uterus. (Item 35) The method according to item 33, wherein the diagnosis is made during the prenatal screening of the subject. (Item 36) The method described in item 33, wherein the aforementioned diagnosis is performed in vitro. (Item 37) The method according to item 31 or 32, wherein the therapeutically effective amount of lentiviral particles comprises a plurality of single-dose doses of lentiviral particles. (Item 38) The method according to item 31 or 32, wherein the therapeutically effective amount of lentiviral particles comprises a single dose of lentiviral particles. [Brief explanation of the drawing]

[0024] [Figure 1] Figure 1 illustrates an exemplary three-vector lentiviral vector system in a circularized form.

[0025] [Figure 2] Figure 2 illustrates an exemplary four-vector lentiviral vector system in a circularized form.

[0026] [Figure 3] Figure 3 illustrates a linear map of eight exemplary lentiviral vectors containing prothrombin enhancers and hAAT promoter modifications to control PAH expression.

[0027] [Figure 4] Figures 4A and 4B illustrate immunoblot data comparing PAH levels in (Figure 4A) Hepa1-6 and (Figure 4B) 293T cells with and without different enhancer elements and 3'UTR.

[0028] [Figure 5] Figures 5A–5C illustrate immunoblot data comparing PAH levels in Hepa1–6 cells with (Figure 5A) rabbit β-globin introns, (Figure 5B) codon-optimized PAH sequences, and (Figure 5C) prothrombin enhancers with or without HNF1 or HNF1 / 4 binding sites either upstream or downstream.

[0029] [Figure 6] Figure 6 illustrates PAH RNA expression in Hepa1-6 cells transduced with a lentiviral vector that expresses PAH via deformation in a prothrombin enhancer.

[0030] [Figure 7]Figure 7 illustrates immunoblot data comparing PAH expression levels in Hepa1-6 cells, regulated by either the anti-α1 trypsin (hAAT) or thyroxine-binding globulin (TBG) promoter.

[0031] [Figure 8] Figures 8A and 8B illustrate immunoblot data comparing PAH levels in rabbit or human β-globin introns, with or without, in Hepa1-6 cells (Figure 8A) or Hep3B cells (Figure 8B).

[0032] [Figure 9] Figure 9 illustrates immunoblot data of PAH expression in human primary hepatocytes using a lentiviral vector expressing PAH.

[0033] [Figure 10] Figures 10A-10C illustrate the PAH activity of Hepa1-6 cells transduced with a lentiviral vector expressing PAH and treated with sepiapterin, a BH4 cofactor precursor, as determined by detection of phenylalanine levels in cell medium (Figures 10A and 10C) or lysate (Figure 10B).

[0034] [Figure 11] Figure 11 illustrates the reduced levels of Phe in the blood of Pahenu2 mice after treatment with a lentiviral vector containing PAH.

[0035] [Figure 12] Figure 12 illustrates the suppression of phenylalanine in the blood by LV-Pro-hAAT-PAH.

[0036] [Figure 13-1]Figures 13A–13D show PAH protein expression (Figure 13A) and PAH RNA expression (Figure 13D) after AAV-delivered PAH expression in 293 cells using various DJ or AAV / 2 serotype vectors; the multiplicative changes in PAH protein expression were also analyzed after delivery of AAV / DJ vectors (Figure 13B) and AAV / 2 vectors (Figure 13C). [Figure 13-2] Figures 13A–13D show PAH protein expression (Figure 13A) and PAH RNA expression (Figure 13D) after AAV-delivered PAH expression in 293 cells using various DJ or AAV / 2 serotype vectors; the multiplicative changes in PAH protein expression were also analyzed after delivery of AAV / DJ vectors (Figure 13B) and AAV / 2 vectors (Figure 13C).

[0037] [Figure 14] Figure 14 illustrates the reduced levels of Phe in neonatal enu2 / enu2 mice treated with LV-Pro-hAAT-PAH lentiviral vector therapy for PKU.

[0038] [Figure 15] Figure 15 illustrates data obtained from Hep3B cells that exhibit PAH expression after treatment with lentiviral vectors encoding either prothrombin-hAAT-PAH-PAH shRNA sequence #1 (SEQ ID NO: 13) or prothrombin-hAAT-PAH-PAH shRNA sequence #2 (SEQ ID NO: 14), which target the 3'UTR of mRNA expressed by the endogenous Pah gene and inhibit PAH protein expression. [Modes for carrying out the invention]

[0039] Summary of this disclosure This disclosure relates to therapeutic vectors and the delivery of therapeutic vectors to cells. In embodiments, the therapeutic vector comprises a PAH sequence or a variant thereof and a liver-specific enhancer. In embodiments, the therapeutic vector also comprises a small RNA that regulates host (i.e., endogenous) PAH protein expression.

[0040] Definitions and interpretations Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure shall have the meanings generally understood by those skilled in the art. Furthermore, unless otherwise required by context, singular terms shall include plurals and plural terms shall include singulars. Generally, the nomenclature and techniques used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are well known and commonly used in the art. Unless otherwise stated, the methods and techniques described herein shall generally be carried out in accordance with commonly known and customary methods in the art, and as described in the various general and more specific references cited and discussed throughout this disclosure. For example, see Sambrook J. & Russell D. Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); Harlow and Lane Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); and Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003). Any enzymatic reactions or purification techniques shall be carried out according to the manufacturer's specifications, as is commonly achieved in this art, or as described herein.The nomenclature, laboratory procedures, and techniques used in relation to analytical chemistry, synthetic organic chemistry, and medical chemistry and medicinal chemistry described herein are well known and commonly used in the art.

[0041] Where used herein and in the appended claims, the singular forms “a,” “an,” and “the” are used interchangeably and are intended to include the plural forms, respectively, unless the context explicitly indicates the opposite meaning. Also, where used herein, “and / or” includes not only all possible combinations of one or more of the listed items, but also, where interpreted selectively (“or”), the absence of any combination.

[0042] All numerical notations, including ranges, such as pH, temperature, time, concentration, and molecular weight, are approximations that vary (+) or (-) by increments of 0.1. While not always explicitly stated, it should be understood that all numerical notations are preceded by the term "approximately." The term "approximately" includes both the exact value "X" and small increments of "X," such as "X + 0.1" or "X - 0.1." While not always explicitly stated, it should also be understood that the reagents described herein are merely illustrative, and that equivalent reagents are known in the art.

[0043] Where used herein, the term “about” may vary to some extent depending on the context in which it is used and to be understood by those skilled in the art. Where there is a use of the term that is not clear to those skilled in the art given the context in which it is used, “about” would mean up to plus or minus 10% of that term.

[0044] The terms “administering” or “giving” an active substance should be understood to mean giving an active substance to a subject in need of treatment in a form that can be introduced into the body of that individual in a therapeutically useful form and therapeutically effective amount.

[0045] As used herein, the term “including” is intended to mean that a composition and method includes the elements described, but does not exclude other elements. When used to define a composition and method, “essentially consisting of” means excluding other elements that have any essential importance to that composition or method. “Consists of” means excluding other components that are not in trace amounts to the claimed composition and substantial method steps. Embodiments defined by each of these transitional terms are within the scope of this disclosure. Thus, a method and composition may include (including) further steps and elements, or may include (essentially consisting of) non-essential steps and compositions, or intend (consist of) only the described method steps or compositions.

[0046] As used herein, “expression,” “expressed,” or “encode” refers to the process by which polynucleotides are transcribed into mRNA and / or the process by which transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Expression may include splicing of mRNA or other forms of post-transcriptional or post-translational modification in eukaryotic cells.

[0047] As used herein, the term “adeno-associated virus vector” refers to the carrier or transporter of the adeno-associated virus. In this specification, the term “adeno-associated virus vector” may also be referred to as “AAV vector.”

[0048] As used herein, the term “adeno-associated virus” refers to a small, non-pathogenic virus that can generate a mild immune response and be incorporated into the host cell genome.

[0049] As used herein, the term "AAV / DJ" (also referred to herein as "AAV-DJ") refers to a serotype of an AAV vector produced from a different AAV serotype that mediates higher transduction and infection rates than the wild-type AAV serotype.

[0050] As used herein, the term "AAV2" (also referred to herein as "AAV / 2" or "AAV-2") refers to a naturally occurring AAV serotype.

[0051] As used herein, the term "AAV-Pro-hAAT-PAH" refers to an AAV vector comprising a prothrombin enhancer, an hAAT promoter, and a PAH sequence.

[0052] The abbreviation "ApoE enhancer" used in this specification refers to apolipoprotein E enhancer.

[0053] As used herein, the terms “gene therapy” or “multiple gene therapy” generally refer to therapeutic drugs and therapeutic strategies that focus on gene targets to address clinical diseases or symptom manifestations. The term “gene therapy” includes gene therapy and the like.

[0054] The abbreviation "hAAT" used herein represents the hAAT promoter.

[0055] The term "hAAT-hPAH-3'UTR" as used herein 289 The term "U" is used herein. 289 It can also be called, or generally referred to as a terminally truncated hPAH3'UTR expressed by a transgene, or generally referred to as a terminally truncated 3'UTR.

[0056] As used herein, the term “hepatocyte nuclear factor” refers primarily to transcription factors expressed in the liver. Types of hepatocyte nuclear factors include, but are not limited to, hepatocyte nuclear factor 1, hepatocyte nuclear factor 2, hepatocyte nuclear factor 3, and hepatocyte nuclear factor 4.

[0057] As used herein, the abbreviation "HNF" represents hepatocyte nuclear factor. Therefore, HNF1 represents hepatocyte nuclear factor 1, HNF2 represents hepatocyte nuclear factor 2, HNF3 represents hepatocyte nuclear factor 3, and HNF4 represents hepatocyte nuclear factor 4.

[0058] As used herein, the term "HNF binding site" refers to a region of DNA to which an HNF transcription factor can bind. Therefore, an HNF1 binding site is a region of DNA to which HNF1 can bind, and an HNF4 binding site is a region of DNA to which HNF4 can bind.

[0059] As used herein, the terms “individual,” “subject,” and “patient” are used interchangeably to refer to any individual mammalian subject, such as a mouse, pig, cattle, dog, cat, horse, non-human primate, or human primate.

[0060] As used herein, the term "rabbit β-globin intron" refers to a nucleic acid segment within the rabbit β-globin gene that is removed by splicing during RNA maturation and does not encode a protein.

[0061] As used herein, the term "human β-globin intron" refers to a nucleic acid segment within the human β-globin gene that is removed by splicing during RNA maturation and does not encode a protein.

[0062] As used herein, the term "LV" generally refers to "lentivirus." As a non-limiting example, a reference to "LV-PAH" refers to a lentivirus that contains a PAH sequence and expresses PAH.

[0063] As used herein, the term "LV-Pro-hAAT-PAH" refers to a lentivirus containing a prothrombin enhancer, an hAAT promoter, and a PAH sequence. The LV-Pro-hAAT-PAH vector is also referred to as the AGT323 vector.

[0064] As used herein, the term "LV-HNF-Pro-hAAT-PAH" refers to a lentivirus comprising an HNF binding site, a prothrombin enhancer, an hAAT promoter, and a PAH sequence.

[0065] As used herein, the term "LV-Pro-intron-PAH" refers to a lentivirus comprising a prothrombin enhancer, an intron, and a PAH sequence, wherein the intron is a human β-globin intron.

[0066] As used herein, the term "LV-Pro-hAAT" refers to a lentivirus containing a prothrombin enhancer and an hAAT promoter.

[0067] As used herein, the term "LV-Pro-TBG-PAH" refers to a lentivirus comprising a prothrombin enhancer, thyroxine-binding globulin, and a PAH sequence.

[0068] As used herein, the term "LV-ApoE-hAAT-PAH-UTR" refers to a lentivirus comprising an apolipoprotein E enhancer, an hAAT promoter, a PAH sequence, and an untranslated region of a gene, wherein the untranslated region is the 3'UTR of the PAH gene.

[0069] As used herein, the term "LV-Pro-hAAT-PAH-shPAH" refers to a lentivirus comprising a prothrombin enhancer, an hAAT promoter, a PAH sequence, and a shPAH sequence.

[0070] As used herein, the term “packaging cell line” refers to any cell line that can be used to express lentiviral particles.

[0071] As used herein, the term “percent identity” in the context of two or more nucleic acid or polypeptide sequences means two or more sequences or subsequences that have a specified percentage of identical nucleotide or amino acid residues when compared and aligned for maximum match, either using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to those skilled in the art) or measured by visual inspection. Depending on the application, “percent identity” may exist across regions of the sequences being compared, for example, across functional domains, or across the entire length of the two sequences to be compared. For sequence comparison, typically one sequence serves as a reference sequence, and the test sequence is compared to it. When using a sequence comparison algorithm, the test and reference sequences are entered into a computer, and if necessary, subsequence coordinates and sequence algorithm program parameters are specified. The sequence comparison algorithm then calculates the percentage sequence identity of the test sequence compared to the reference sequence based on the specified program parameters.

[0072] As used herein, “pharmaceutically acceptable” means a compound, substance, composition and / or dosage form that is suitable for use in contact with human and animal tissues, organs and / or bodily fluids, within the bounds of sound medical judgment, without excessive toxicity, irritation, allergic response or other problems or complications, in proportion to a reasonable benefit-to-risk ratio.

[0073] As used herein, “pharmaceutically acceptable carrier” includes, and encompasses, all physiologically compatible solvents, dispersions, coatings, antimicrobial and antifungal agents, isotonic agents, and absorption retarders. The composition may contain pharmaceutically acceptable salts, such as acid addition salts or base addition salts (see, for example, Berge et al., (1977) J.Pharm.Sci. 66:1-19).

[0074] The term "phenylalanine hydroxylase" may also be expressed herein as PAH. The term phenylalanine hydroxylase includes all wild-type and variant PAH sequences, including both nucleotide and peptide sequences. Without limitation, the term phenylalanine hydroxylase includes references to SEQ ID NOs: 1-4 and further includes variants having at least about 80% identity with them. Human PAH may also be expressed herein as hPAH. Human PAH may also be expressed herein as hPAH.

[0075] The term “wild-type hPAH” as used herein may also be expressed herein as “endogenous PAH” or “full-length PAH.”

[0076] The term "phenylketonuria," also referred to herein as "PKU," as used herein, refers to chronic deficiency of phenylalanine hydroxylase and all associated conditions, including mild and classic forms of the disease. Treatment of "phenylketonuria" may therefore relate to treatment of all or some of the symptoms associated with PKU.

[0077] As used herein, the term “prothrombin enhancer” refers to a region on the prothrombin gene that can be bound by a protein, which results in the transcription of the prothrombin gene.

[0078] In this specification, the abbreviation "Pro" represents a prothrombin enhancer.

[0079] As used herein, “small RNA” refers to non-coding RNA that is generally about 200 nucleotides or less in length and has a silencing or interfering function. In other embodiments, small RNA may be about 175 nucleotides or less, about 150 nucleotides or less, about 125 nucleotides or less, about 100 nucleotides or less, or about 75 nucleotides or less in length. Such RNAs include microRNAs (miRNAs), small interfering RNAs (siRNAs), double-stranded RNAs (dsRNAs), and small hairpin RNAs (shRNAs). The “small RNAs” of this disclosure should generally be capable of inhibiting or knocking down the gene expression of a target gene through a pathway that results in the disruption of the target gene mRNA.

[0080] As used herein, the term "shPAH" refers to small hairpin RNA molecules that target PAHs.

[0081] The abbreviation "lncRNA" used herein represents long non-coding RNA.

[0082] As used herein, the term "SEQ ID NO." is synonymous with the term "Sequence ID No."

[0083] As used herein, the term "thyroxine-binding globulin" refers to a transport protein that carries thyroid hormones in the bloodstream. As used herein, the abbreviation "TBG" represents thyroxine-binding globulin.

[0084] As used herein, the term “therapeutic effective dose” refers to a sufficient amount of the active ingredient of this disclosure in a suitable composition and dosage form to treat or prevent the symptoms, progression, or onset of complications observed in a patient suffering from a given disease, injury, illness, or condition. The therapeutic effective dose will vary depending on the patient’s condition or the severity thereof, and the age, weight, etc., of the subject to be treated. The therapeutic effective dose may vary depending on any of a number of factors, including, for example, the route of administration, the subject’s condition, and other factors that will be understood by those skilled in the art.

[0085] As used herein, the term “therapeutic vector” includes, but is not limited to, references to lentiviral vectors or adeno-associated virus (AAV) vectors. Furthermore, as used herein in reference to lentiviral vector systems, the term “vector” is synonymous with the term “plasmid.” For example, 3-vector and 4-vector systems, including 2-vector and 3-vector packaging systems, can also be referred to as 3-plasmid and 4-plasmid systems.

[0086] As used herein, the terms “treatment” or “to treat” generally refer to an intervention aimed at altering the natural course of the treated subject, which may be carried out for preventive purposes or during the course of a clinicopathological condition. Desired effects include, but are not limited to, preventing the onset or recurrence of the disease, alleviating symptoms, suppressing, reducing or inhibiting any direct or indirect pathological consequences of the disease, improving or mitigating the condition, and causing remission or an improved prognosis.

[0087] A "treatment" is intended to target a disease condition and combat it, that is, to improve or prevent its progression. Therefore, the specific treatment will depend on the disease condition being targeted, as well as the current or future status of drug treatments and therapeutic approaches. Treatments may have associated toxicity.

[0088] As used herein, the term “terminated” may also be expressed herein as “shortened” or “without.”

[0089] As used herein, the term "UTR" refers to a region of a gene located at either the 5' or 3' end of the gene's coding region.

[0090] As used herein, the term "3'UTR" refers to the "UTR" located at 3' of the coding region of a gene.

[0091] As used herein, the term “modified” may also be expressed as “analog” or “transformation.” A modified version represents any substitution, deletion, or addition to a nucleotide sequence.

[0092] Where considered herein, the optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized execution of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (generally, see Ausubel et al. below).

[0093] One example of a suitable algorithm for determining percent sequence identity and sequence similarity is the BLAST algorithm described in Altschul et al., J.Mol.Biol.215:403-410 (1990). Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information website.

[0094] The nucleic acid and protein sequences of this disclosure can further be used as “query sequences” for performing searches against public databases, for example, to identify relevant sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al., (1990) J.Mol.Biol.215:403-10. A BLAST nucleotide search can be performed using the NBLAST program, score=100, word length=12 to obtain homologous nucleotide sequences for the nucleic acid molecules provided in this disclosure. A BLAST protein search can be performed using the XBLAST program, score=50, word length=3 to obtain homologous amino acid sequences for the protein molecules of this disclosure. To obtain gapped alignment for comparison purposes, Gapped BLAST can be used as described in Altschul et al., (1997) Nucleic Acids Res.25(17):3389-3402. When using BLAST and Gapped BLAST programs, you can use the initial setup parameters for each program (e.g., XBLAST and NBLAST). See http: / / www.ncbi.nlm.nih.gov for more information.

[0095] Description of the aspects and embodiments of this disclosure In one aspect of the present disclosure, a viral vector comprises a therapeutic cargo portion comprising a PAH sequence or a variant thereof, a promoter, and a liver-specific enhancer, wherein the PAH sequence or a variant thereof is operatively regulated by both the promoter and the liver-specific enhancer.

[0096] In an embodiment, the liver-specific enhancer comprises a prothrombin enhancer. In an embodiment, the promoter is a liver-specific promoter. In an embodiment, the liver-specific promoter comprises an hAAT promoter. In an embodiment, the therapeutic cargo portion further comprises a β-globin intron. In an embodiment, the therapeutic cargo portion further comprises at least one hepatocyte nuclear factor binding site. In an embodiment, the at least one hepatocyte nuclear factor binding site is located upstream of the prothrombin enhancer. In an embodiment, the at least one hepatocyte nuclear factor binding site is located downstream of the prothrombin enhancer.

[0097] In one embodiment, a lentiviral vector (LV-Pro-hAAT-PAH) is provided, comprising a prothrombin enhancer, an hAAT promoter, and a PAH sequence. In another embodiment, a lentiviral vector (LV-HNF-Pro-hAAT-PAH) is provided, comprising an HNF binding site, a prothrombin enhancer, an hAAT promoter, and a PAH sequence. In one embodiment, the HNF binding site is an HNF1 or HNF1 / 4 binding site. In another embodiment, a lentiviral vector (LV-Pro-intron-PAH) is provided, comprising a prothrombin enhancer, an hAAT promoter, an intron, and a PAH sequence. In one embodiment, the intron is a rabbit globin intron. In another embodiment, the intron is a human globin intron. In yet another embodiment, a lentiviral vector (LV-Pro-hAAT) is provided, comprising a prothrombin enhancer and an hAAT promoter. In one embodiment, a lentiviral vector (LV-Pro-TBG-PAH) is provided, comprising a prothrombin enhancer, thyroxine-binding globulin, and a PAH sequence. In another embodiment, a lentiviral vector (LV-ApoE-hAAT-PAH-UTR) is provided, comprising an ApoE enhancer, an hAAT promoter, a PAH sequence, and the 3'UTR of the PAH.

[0098] In one embodiment, the PAH sequence or its variant is terminally cleaved. In another embodiment, the terminally cleaved portion of the PAH sequence or its variant is the 3' untranslated region (UTR) of the PAH sequence or its variant.

[0099] In an embodiment, a PAH terminal cleavage at the 3'UTR prevents the binding of certain regulatory RNA to the 3'UTR. In an embodiment, the regulatory RNA is an lncRNA. In an embodiment, the regulatory RNA is a microRNA. In an embodiment, the regulatory RNA is a piRNA. In an embodiment, the regulatory RNA is an shRNA. In an embodiment, the regulatory RNA is an siRNA with a length of 19 to 25 nucleotides. In an embodiment, the regulatory RNA is a small RNA sequence containing a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or more percent identity with SEQ ID NO: 13 or 14.

[0100] In one embodiment, the PAH sequence includes SEQ ID NO: 1. In another embodiment, the PAH sequence includes a codon-optimized PAH sequence (SEQ ID NO: 2). In another embodiment, the PAH sequence or a variant thereof includes a cleaved 3'UTR (289 nucleotides) (SEQ ID NO: 4). In yet another embodiment, the PAH sequence or a variant thereof includes a 5'UTR (897 nucleotides) (SEQ ID NO: 3).

[0101] In one embodiment, the PAH sequence or a variant thereof includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or more percent identity with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

[0102] In the embodiment, the variant can be produced for any of the above sequences. In the embodiment, the PAH sequence or its variant includes SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

[0103] In one embodiment, the prothrombin enhancer comprises sequence number 5 and a sequence having at least 80%, or at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or more percent identity.

[0104] In the embodiment, the modified product can be prepared for the above sequence. In the embodiment, the prothrombin enhancer sequence includes sequence number 5.

[0105] In the embodiment, the sequence of the hAAT promoter includes SEQ ID NO: 6. In the embodiment, the sequence of the β-globin intron includes one of SEQ ID NOs: 7 or 8. In the embodiment, the sequence of the hepatocyte nuclear factor binding site includes one of SEQ ID NOs: 9 to 12.

[0106] In an embodiment, the therapeutic cargo portion further comprises at least one small RNA sequence capable of binding to at least one predetermined complementary mRNA sequence. In an embodiment, the at least one small RNA sequence targets a complementary mRNA sequence containing a full-length UTR. In an embodiment, the at least one predetermined complementary mRNA sequence is a PAH mRNA sequence. In an embodiment, the at least one small RNA sequence comprises shRNA. In an embodiment, the at least one small RNA sequence is under the regulation of a first promoter, and the PAH sequence or a variant thereof is under the regulation of a second promoter. In an embodiment, the first promoter comprises an H1 promoter. In an embodiment, the second promoter comprises a liver-specific promoter. In an embodiment, the liver-specific promoter comprises an hAAT promoter. In one embodiment, at least one small RNA sequence includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or more percent identity with SEQ ID NO: 13 or SEQ ID NO: 14.

[0107] In the embodiment, the modified product can be prepared for any of the above sequences. In the embodiment, at least one small RNA sequence includes SEQ ID NO: 13 or SEQ ID NO: 14.

[0108] In one embodiment, a lentiviral vector (LV-Pro-hAAT-PAH-shPAH) is provided, comprising a prothrombin enhancer, an hAAT promoter, a PAH sequence, and an shRNA targeting endogenous PAH. In one embodiment, the shRNA targets the 3'UTR of endogenous PAH. In one embodiment, the shPAH comprises SEQ ID NO: 13. In another embodiment, the shPAH comprises SEQ ID NO: 14.

[0109] In one aspect of this disclosure, a lentiviral particle capable of infecting target cells comprises an envelope protein optimized for infecting target cells and one of the viral vectors disclosed herein. In the embodiment, the target cells are hepatocytes, muscle cells, epithelial cells, endothelial cells, nerve cells, neuroendocrine cells, endocrine cells, lymphocytes, myeloid cells, cells present in parenchymal organs or hematopoietic cells, hematopoietic stem cells or progenitor hematopoietic stem cells.

[0110] In aspects of this disclosure, a method for treating PKU in a subject includes administering a therapeutically effective amount of any of the lentiviral particles disclosed herein to the subject. In aspects of this disclosure, a method for preventing PKU in a subject includes administering a therapeutically effective amount of any of the lentiviral particles disclosed herein to the subject. In another aspect of this disclosure, the use of any of the lentiviral particles disclosed herein for treating PKU in a subject is disclosed. In an embodiment, the method further includes diagnosing a PKU genotype in the subject that correlates with a PKU phenotype. In an embodiment, the subject is in utero. In an embodiment, the diagnosis is made during prenatal screening of the subject or after parental genetic screening. In an embodiment, the diagnosis is made in vitro. In an embodiment, a therapeutically effective amount of lentiviral particles comprises a plurality of single-dose doses of lentiviral particles. In an embodiment, a therapeutically effective amount of lentiviral particles comprises single-dose doses of lentiviral particles.

[0111] Another embodiment of this disclosure provides a method for treating a PKU in a subject, comprising treating the subject having a variant form of the PAH with a therapeutically effective amount of a lentiviral vector containing an exogenous PAH. In embodiments, the subject is a mammal. In embodiments, the mammal is a human. In embodiments, the mammal is a rodent. In embodiments, the rodent is a mouse or a rat. In embodiments, the mammal is a pig.

[0112] In embodiments, the subject is treated with a lentiviral vector. In embodiments, the lentiviral vector comprises a PAH sequence or a variant thereof. In embodiments, the PAH sequence is any of the PAH sequences or variants described herein.

[0113] In embodiments, the lentiviral vector is either a lentiviral vector containing a PAH or a modified version as described herein. In embodiments, the lentiviral vector containing a PAH is a lentiviral vector expressing a PAH, as illustrated in Figures 1 and 2. In embodiments, the lentiviral vector containing a PAH is a lentiviral vector expressing a PAH, as illustrated in Figure 3.

[0114] In embodiments, the viral vector comprises a prothrombin enhancer, an hAAT promoter, and a PAH sequence (also referred to herein as LV-Pro-hAAT-PAH or AGT323). In embodiments, the prothrombin enhancer sequence is any of the prothrombin sequences or variants described herein. In embodiments, the hAAT promoter is any of the hAAT promoter sequences or variants described herein. In embodiments, the PAH sequence is any of the PAH sequences or variants described herein.

[0115] In an embodiment, the lentiviral vector consists of an incorporated lentiviral vector. In an embodiment, the incorporated lentiviral vector is derived from a lentiviral vector system. In an embodiment, the lentiviral vector system includes separate plasmids encoding the rev gene and the env gene. In an embodiment, the incorporated lentiviral vector is derived from a 3-vector lentiviral system. In an embodiment, the 3-vector lentiviral system is illustrated in Figure 1. In an embodiment, the incorporated lentiviral vector is derived from a 4-vector lentiviral system. In an embodiment, the 4-vector lentiviral vector system is illustrated in Figure 2.

[0116] In embodiments, the subject is treated with an adeno-associated virus (AAV) vector. In embodiments, the AAV vector comprises any of the AAV vectors disclosed herein. In embodiments, the AAV vector comprises a PAH sequence or a variant thereof. In embodiments, the PAH sequence is any of the PAH sequences or variants described herein.

[0117] In an embodiment, the injection is an intradermal injection. In an embodiment, the injection is an intramuscular injection. In an embodiment, the injection is a subcutaneous injection. In an embodiment, the injection is an intravenous injection.

[0118] In embodiments, the methods described herein further include preparing an incorporated lentiviral vector of a specific titer before treating a subject with lentiviral particles. The specific titer is determined in a test system that uses cell-targeted and in vitro lentiviral vector transduction, followed by quantitative PCR analysis of chromosomal DNA from transduced cells to measure the frequency of transduced cells and the number of incorporated vector copies per cell. The titer is expressed as the number of incorporated copies that would have resulted from transduction of a suitable column of the lentiviral vector into a suitable number of cells. In embodiments, the titer is 1 × 10⁻⁶ 5~1×10 15 of integrated vector copies, e.g., 1×10 7 ~1×10 13 of integrated vector copies or 1×10 9 ~1×10 11 of integrated vector copies. In embodiments, the titer is 1×10 10 of integrated vector copies.

[0119] In embodiments, generating a lentiviral vector with a specific titer involves adding a vector system to one or more cells. In embodiments, the one or more cells are a cell line. In embodiments, the cell line is a 293T cell line. In embodiments, the cell line is a HeLa cell line. In embodiments, the cell line is a CHO cell line. In embodiments, the cell line is a Hep3B cell line. Those skilled in the art will understand that in other embodiments, the cell line can be any suitable cell line known in the art.

[0120] In embodiments, the method further includes measuring the level of Phe in the blood after injection of the lentiviral vector containing PAH.

[0121] In aspects of the present disclosure, human PAH is expressed in cells using an expression system delivered by AAV. In embodiments, AAV serotype 2 is used. In embodiments, AAV-DJ serotype is used. In embodiments, the AAV vector contains GFP. In embodiments, the AAV vector can present any serotype or can be generated by recombinant DNA or other synthetic approaches designed to improve transduction of human hepatocytes.

[0122] In one embodiment, a human PAH is introduced into the AAV vector. In another embodiment, a prothrombin enhancer is introduced into the AAV vector. In another embodiment, an hAAT promoter is introduced into the AAV vector. In another embodiment, a rabbit globin intron is introduced into the AAV vector. In another embodiment, one or more of the human PAH, prothrombin enhancer, hAAT promoter, and rabbit globin intron are introduced into the AAV vector. In another embodiment, the viral vector comprises a prothrombin enhancer, an hAAT promoter, and a PAH sequence (AAV-Pro-hAAT-PAH; AGT323).

[0123] In embodiments, the prothrombin enhancer sequence is one of the prothrombin sequences or variants disclosed herein. In embodiments, the PAH sequence is one of the PAH sequences or variants described herein. In embodiments, the hAAT sequence is one of the hAAT sequences or variants disclosed herein. In embodiments, the intron sequence is one of the intron sequences or variants disclosed herein.

[0124] In embodiments of this disclosure, lentiviral vector therapy is used in the treatment of subjects having a mutant PAH gene. In embodiments, the subject is human. In other embodiments, as experimentally demonstrated herein, the subject is a neonatal mouse derived from a Pah mutant mouse strain. In embodiments, the mutant mouse strain is Pah enu1 In the embodiment, the mutant mouse line is Pah enu2 In the embodiment, the mutant mouse line is Pah enu3 That is the case.

[0125] In embodiments, the PAH sequence in the lentiviral vector is either a PAH sequence or a variant thereof, including those described herein and listed in the PAHvdb, BIODEF, BIOPKU, JAKE, or PNDdb databases found at www.biopku.org.

[0126] In an embodiment, the lentiviral vector consists of an incorporated lentiviral vector. In an embodiment, the incorporated lentiviral vector is derived from a lentiviral vector system. In an embodiment, the lentiviral vector system includes separate plasmids encoding a rev gene and an envelope gene. In an embodiment, the incorporated lentiviral vector is derived from a 3-vector lentiviral system. In an embodiment, the 3-vector lentiviral system is illustrated in Figure 1. In an embodiment, the incorporated lentiviral vector is derived from a 4-vector lentiviral system. In an embodiment, the 4-vector lentiviral vector system is illustrated in Figure 2.

[0127] In an embodiment of this disclosure, lentiviral expression in cells containing shRNA and PAH suppresses the expression of endogenous PAH but does not suppress the expression of exogenous PAH expressed from a lentiviral vector.

[0128] In embodiments, the lentivirus containing shRNA and PAH is expressed in vivo in a subject as described herein. In embodiments, the subject is a mammal. In embodiments, the mammal is a human.

[0129] In embodiments, the lentivirus containing shRNA and PAH is expressed in vitro or ex vivo. In embodiments, the lentivirus is expressed in vitro, for example, in a cell line. In embodiments, the cell line is either a cell line described herein or a cell line known to those skilled in the art. In embodiments, the cell line is a Hep3B cell line.

[0130] In one embodiment, a lentiviral vector is provided comprising a prothrombin enhancer, an hAAT promoter, a PAH sequence, and an shRNA targeting endogenous PAH (referred to herein, if necessary, as LV-Pro-hAAT-PAH-shPAH). In this embodiment, the shRNA targets the 3'UTR of endogenous PAH.

[0131] In embodiments, the prothrombin enhancer sequence includes either the prothrombin sequence or a variant disclosed herein. In embodiments, the hAAT promoter includes either the hAAT promoter sequence or a variant disclosed herein. In embodiments, the PAH sequence includes either the PAH sequence or a variant described herein. In embodiments, the shRNA sequence in the lentiviral vector includes SEQ ID NO: 13. In embodiments, the shRNA sequence in the lentiviral vector includes SEQ ID NO: 14.

[0132] Other aspects and advantages of the present invention described herein will become apparent from the following detailed description illustrating aspects of the invention, in conjunction with the accompanying drawings.

[0133] Phenylketonuria PKU is thought to be caused by mutations in PAH and / or defects in the synthesis or regeneration of PAH cofactors (i.e., BH4). Notably, some PAH mutations have been shown to affect protein folding in the endoplasmic reticulum, resulting in accelerated degradation and / or aggregation due to missense mutations (63%) and small deletions (13%) in the protein structure, which attenuate or greatly eliminate enzymatic catalytic activity. Given the numerous mutations that can affect the functionality of PAH, effective therapeutic approaches to treat PKU will need to address the manner in which abnormal PAH and surrogate PAH may be administered.

[0134] Generally, based on phenotypic leukemia levels measured at diagnosis, dietary tolerance to phenotyemia, and potential response to treatment, PKU is classified into three major phenotypic groups. These groups include classical PKU (phenotyemia > 1200 μM), atypical or mild PKU (phenotyemia 600–1200 μM), and chronic mild hyperphenylalaninemia (HPA, phenotyemia 120–600 μM).

[0135] PKU detection relies on Universal Neonatal Screening (NBS). Mandated in all 50 US states and routinely used in many developed countries, this screening test tests a single drop of blood collected from a heel puncture for phenylalanine levels.

[0136] Genetic medicine The term "genetic medicine" includes references to viral vectors used to deliver gene constructs to host cells for the purpose of treating or preventing disease.

[0137] Gene constructs may include, but are not limited to, functional genes or gene portions that correct or complement existing defects, DNA sequences encoding regulatory proteins, DNA sequences encoding regulatory RNA molecules including antisense, small hairpin RNA, small homology RNA, long non-coding RNA, small interfering RNA, or others, and decoy sequences encoding either RNA or protein designed to compete for critical cellular factors to alter disease status. Gene therapies involve delivering these therapeutic gene constructs to target cells to treat or alleviate a particular disease.

[0138] By delivering a functional PAH gene to the liver in vivo, PAH activity should be reconstituted, resulting in normal clearance of Phe in the blood and thus eliminating the need for dietary restrictions or frequent enzyme replacement therapy. The effectiveness of this therapeutic approach should be enhanced by targeting shRNA against endogenous PAH. In embodiments of this disclosure, if a fetus is identified as being at risk for the PKU genotype, the functional PAH gene or a variant thereof can also be delivered intrauterine. In embodiments, a diagnostic step can be performed to determine whether the fetus is at risk for the PKU phenotype. If the diagnostic step determines that the fetus is at risk for the PKU phenotype, the fetus can then be treated with a gene medicine as detailed herein. Treatment may be performed intrauterine or in vitro.

[0139] Therapeutic vectors Lentiviral virions (particles) according to various aspects and embodiments of this specification are expressed by a vector system encoding viral proteins necessary for producing virions (viral particles). In various embodiments, a single vector containing a nucleic acid sequence encoding the lentiviral Pol protein is operably ligated to a promoter and provided for reverse transcription and incorporation. In another embodiment, the Pol protein is expressed by multiple vectors. In yet another embodiment, a vector is provided containing a nucleic acid sequence encoding the lentiviral Gag protein for forming a viral capsid, operably ligated to a promoter. In an embodiment, this gag nucleic acid sequence is on a vector separate from at least some of the pol nucleic acid sequences.

[0140] Numerous modifications can be made to the vectors described herein and used to produce particles that further minimize the chance of obtaining wild-type revertant mutants. These include, but are not limited to, deletions of the U3 region of the LTR, tat deletions, and matrix (MA) deletions. In embodiments, the gag, pol, and env vectors do not contain nucleotides derived from the lentiviral genome that package lentiviral RNA, referred to as lentiviral packaging sequences.

[0141] The particle-forming vector preferably does not contain a nucleic acid sequence derived from the lentiviral genome that expresses the envelope protein. Preferably, a separate vector containing a nucleic acid sequence encoding the envelope protein, operably linked to a promoter, is used. This env vector also does not contain the lentiviral packaging sequence. In one embodiment, the env nucleic acid sequence encodes the lentiviral envelope protein.

[0142] In another embodiment, the envelope protein is derived from a different virus, not a lentivirus. The resulting particles are referred to as pseudotype particles. With appropriate selection of the envelope protein, virtually any cell can be infected. For example, env genes encoding envelope proteins that target intracellular compartments can be used, such as the envelope protein of influenza virus, human and non-human rhabdovirus isolates, alphaviruses (Semliki Forest Virus, Sindbis virus), arenaviruses (lymphocytic choriomeningitis virus), flaviviruses (tick-borne encephalitis virus, dengue virus, hepatitis C virus, GB virus), rhabdoviruses (bullous stomatitis virus, rabies virus), paramyxoviruses (mumps or measles), and VSV-G or similar envelope proteins derived from orthomyxoviruses (influenza virus). Other envelope proteins that can be preferably used include envelope proteins from feline leukemia virus and feline endogenous retroviruses, Moloney's leukemia viruses such as MLV-E and MLV-A, gibbon leukemia virus GALV, and baboon endogenous retroviruses. These latter envelope proteins are particularly preferred when the host cell is a primary cell. Other envelope proteins can be selected depending on the desired host cell.

[0143] The lentiviral vector systems provided herein typically include at least one helper plasmid containing at least one of the gag, pol, or rev genes. Each of the gag, pol, and rev genes may be supplied on a separate plasmid, or one or more genes may be supplied together on the same plasmid. In one embodiment, the gag, pol, and rev genes are supplied on the same plasmid (e.g., Figure 1). In another embodiment, the gag and pol genes are supplied on a first plasmid, and the rev gene is supplied on a second plasmid (e.g., Figure 2). Thus, both 3-vector and 4-vector systems can be used to produce lentiviruses as described herein. In embodiments, the therapeutic vector, at least one envelope plasmid, and at least one helper plasmid are transfected into packaging cells, e.g., a packaging cell line. An unspecified example of a packaging cell line is the 293T / 17HEK cell line. Once the therapeutic vector, envelope plasmid, and at least one helper plasmid are transfected into the packaging cell line, lentiviral particles are ultimately produced.

[0144] In another embodiment, a lentiviral vector system for expressing lentiviral particles is disclosed. This system comprises a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infecting cells; and at least one helper plasmid for expressing gag, pol, and rev genes. When the lentiviral vector, envelope plasmid, and at least one helper plasmid are transfected into a packaging cell line, lentiviral particles are produced by the packaging cell line, and the lentiviral particles can inhibit PAH production and / or inhibit the expression of endogenous PAHs.

[0145] In another embodiment, the lentiviral vector, also referred to herein as a therapeutic vector, comprises the following elements: hybrid 5' terminal repeat sequence (long terminal repeat) (RSV / 5'LTR) (SEQ ID NOs. 15-16), Psi sequence (RNA packaging site) (SEQ ID NOs. 17), RRE (Rev response element) (SEQ ID NOs. 18), cPPT (polypurine tract) (SEQ ID NOs. 19), anti-α-trypsin promoter (hAAT) (SEQ ID NOs. 6), phenylalanine hydroxylase (PAH) (SEQ ID NOs. 1-4), woodchuck post-transcriptional regulatory element (WPRE) (SEQ ID NOs. 20), and ΔU3 It includes a 3'LTR (SEQ ID NO: 21). In embodiments, the lentiviral vector, also referred to herein as a therapeutic vector, includes the following elements: hybrid 5' terminal repeat sequence (RSV / 5'LTR) (SEQ ID NOs: 15-16), Psi sequence (RNA packaging site) (SEQ ID NO: 17), RRE (Rev response element) (SEQ ID NO: 18), cPPT (polyprint lact) (SEQ ID NO: 19), H1 promoter (SEQ ID NO: 22), PAH shRNA (SEQ ID NOs: 1-4), anti-α-trypsin promoter (hAAT) (SEQ ID NO: 6), PAHshRNA (SEQ ID NOs: 1-4), woodchuck post-transcriptional regulatory element (WPRE) (SEQ ID NO: 20), and ΔU3 3'LTR (SEQ ID NO: 21). In embodiments, sequence modifications by substitution, deletion, addition or mutation may be used to modify the sequences cited herein.

[0146] In another embodiment, the helper plasmid comprises the following elements: CMV enhancer / chicken β-actin enhancer (SEQ ID NO: 23); HIV component gag (SEQ ID NO: 24); HIV component pol (SEQ ID NO: 25); HIV Int (SEQ ID NO: 26); HIV RRE (SEQ ID NO: 27); and HIV Rev (SEQ ID NO: 28). In another embodiment, the helper plasmid may be modified to include a first helper plasmid for expressing the gag and pol genes, and a second, separate plasmid for expressing the rev gene. In embodiments, sequence modifications by substitution, deletion, addition or mutation may be used to modify the sequences cited herein.

[0147] In another embodiment, the envelope plasmid comprises the following elements: RNA polymerase II promoter (CMV) (SEQ ID NO: 29) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 30). In embodiments, sequence modifications by substitution, deletion, addition or mutation may be used to modify the sequences cited herein.

[0148] In various embodiments, plasmids used for lentiviral packaging can be modified by substitution, addition, removal, or mutation of various elements without loss of vector function. For example, without limit, the following elements can replace similar elements in plasmids constituting the packaging system: Elongation factor-1 (EF-1), phosphoglycerate kinase (PGK), and ubiquitin C (UbC) promoters can replace CMV or CAG promoters; SV40 polyA and bGH polyA can replace rabbit β-globin polyA; and HIV sequences in helper plasmids can be constructed from different HIV strains or lineages. The VSV-G glycoprotein can be replaced with membrane glycoproteins derived from human endogenous retroviruses including HERV-W, baboon endogenous retrovirus BaEV, feline endogenous virus (RD114), gibbon leukemia virus (GALV), rabies (FUG), lymphocytic choriomeningitis virus (LCMV), influenza A tripest virus (FPV), Ross River alphavirus (RRV), mouse leukemia virus 10A1 (MLV), or Ebola virus (EboV).

[0149] Various lentiviral packaging systems are commercially available (e.g., Lenti-vpak packaging kits from OriGene Technologies, Inc., Rockville, MD) and can also be designed as described herein. Furthermore, replacing or modifying embodiments of lentiviral packaging systems to improve any number of relevant factors, including the production efficiency of lentiviral particles, is within the scope of the skills of those skilled in the art.

[0150] In another embodiment, an adeno-associated virus (AAV) vector may also be used. In one embodiment, the AAV vector is the AAV-DJ serotype. In one embodiment, the AAV vector is one of serotypes 1 to 11. In one embodiment, the AAV serotype is AAV-2. In one embodiment, the AAV vector is a non-natural type created for optimal transduction of human hepatocytes.

[0151] AAV Vector Construction In an embodiment of this disclosure, a prothrombin enhancer (SEQ ID NO: 5) together with PAH coding sequences (SEQ ID NOs: 1-4) and an hAAT promoter (SEQ ID NO: 6) is inserted into a pAAV plasmid (Cell Biolabs, San Diego, CA). PAH coding sequences with adjacent EcoRI and SalI restriction sites are synthesized by Eurofins Genomics (Louisville, Kentucky). The pAAV plasmid and PAH sequences are digested using EcoRI and SalI enzymes and ligated together. Insertion of PAH sequences is confirmed by sequencing. Next, the prothrombin enhancer and hAAT promoter, together with adjacent MluI and EcoRI restriction sites, are synthesized by Eurofins Genomics (Louisville, Kentucky). The pAAV plasmid containing the PAH coding sequences and prothrombin enhancer / hAAT promoter sequences is digested using MluI and EcoRI enzymes and ligated together. The insertion of the prothrombin enhancer / hAAT promoter is confirmed by sequencing.

[0152] Furthermore, representative AAV plasmid systems for PAH expression may include AAV helper plasmids, AAV plasmids, and AAV Rev / Cap plasmids. The AAV helper plasmid may contain a left-side ITR (SEQ ID NO: 31), a prothrombin enhancer (SEQ ID NO: 5), a human anti-α-trypsin promoter (SEQ ID NO: 6), PAH elements (SEQ ID NOs: 1-4), a poly-A element (SEQ ID NO: 32), and a right-side ITR (SEQ ID NO: 33). The AAV plasmid may contain a suitable promoter element (SEQ ID NO: 23 or 29), an E2A element (SEQ ID NO: 34), an E4 element (SEQ ID NO: 35), a VA RNA element (SEQ ID NO: 36), and a poly-A element (SEQ ID NO: 32). The AAV Rep / Cap plasmid may contain a suitable promoter element, a Rep element (SEQ ID NO: 37), a Cap element (SEQ ID NO: 38), and a poly-A element (SEQ ID NO: 32).

[0153] In one embodiment, an AAV / DJ plasmid (AAV / DJ-Pro-PAH) containing a prothrombin enhancer and a PAH sequence is provided. In another embodiment, an AAV / DJ plasmid (AAV / DJ-Pro-intron-PAH) containing a prothrombin enhancer, an intron, and a PAH sequence is provided. In one embodiment, the intron is a human β-globin intron. In another embodiment, the intron is a rabbit β-globin intron. In another embodiment, an AAV / DJ plasmid (AAV / DJ-GFP) containing GFP is provided.

[0154] In one embodiment, an AAV2 plasmid (AAV2-Pro-PAH) containing a prothrombin enhancer and a PAH sequence is provided. In another embodiment, an AAV2 plasmid (AAV2-Pro-intron-PAH) containing a prothrombin enhancer, an intron, and a PAH sequence is provided. In one embodiment, the intron is a human β-globin intron. In another embodiment, the intron is a rabbit β-globin intron. In another embodiment, an AAV2 plasmid (AAV2-GFP) containing GFP is provided.

[0155] In embodiments, any of the AAV vectors disclosed herein may contain a sequence expressing regulatory RNA. In embodiments, the regulatory RNA is lncRNA. In embodiments, the regulatory RNA is microRNA. In embodiments, the regulatory RNA is piRNA. In embodiments, the regulatory RNA is shRNA. In embodiments, the regulatory RNA is a small RNA sequence containing a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or more percent identity with SEQ ID NO: 13 or 14.

[0156] Preparation of AAV particles. The AAV-PAH plasmid is combined with plasmids pAAV-RC2 (Cell Biolabs) and pHelper (Cell Biolabs). The pAAV-RC2 plasmid contains the Rep and AAV-2 capsid genes, and pHelper contains the adenovirus E2A, E4, and VA genes. The AAV capsid can also consist of the AAV-8 (SEQ ID NO: 39) or AAV-DJ (SEQ ID NO: 40) sequence. To prepare AAV particles, these plasmids are transfected into 293T cells in a ratio of 1:1:1 (pAAV-PAH:pAAV-RC2:pHelper). For cell transfection in a 150 mm dish (BD Falcon), 10 μg of each plasmid is added together to 1 mL of DMEM. In a separate tube, 60 μL of transfection reagent PEI (1 μg / mL) (Polysciences) is added to 1 mL of DMEM. Mix the two tubes together and incubate for 15 minutes. Then, add the transfection mixture to the cells and collect the cells after 3 days. Lyse the cells by freeze / thaw cycle in dry ice / isopropanol. Add benzonase nuclease (Sigma) to the cell lysate at 37°C for 30 minutes. Then, pellet the cell debris by centrifugation at 12,000 rpm at 4°C for 15 minutes. Collect the supernatant and then add it to the target cells.

[0157] Dosage and dosage form The disclosed vector compositions enable short-term, medium-term, or long-term expression of the gene or sequence of interest and maintenance of the disclosed vector as an episome. Therefore, the dosing regimen may vary depending on the condition being treated and the method of administration.

[0158] In embodiments, the vector composition may be administered to the required subjects in varying doses. Specifically, the subjects receive approximately 10 doses. 6 The subjects are administered an amount greater than the infectious dose (on average, one dose is required to transduce one target cell). More specifically, the subjects are given approximately 10 units per kg of body weight. 7 More than an infectious dose, about 108 More than an infectious dose, about 10 9 More than an infectious dose, about 10 10 More than an infectious dose, about 10 11 More than the infectious dose or approximately 10 12 Any number of doses above or between the infectious dose will be administered. The upper limit of the medication will be determined for each symptom of the disease and will depend on the toxicity / safety profile for each individual product or product lot.

[0159] Furthermore, the vector compositions of this disclosure may be administered regularly, such as once or twice a day, or at any other appropriate interval. For example, the vector compositions may be administered to the subject requiring them once a week, once every two weeks, once every three weeks, once a month, once every two months, once every three months, once every six months, once every nine months, once a year, once every 18 months, once every two years, once every 30 months, or once every three years.

[0160] In embodiments, the disclosed vector composition is administered as a pharmaceutical composition. In embodiments, the pharmaceutical composition can be formulated in a variety of dosage forms for clinical application, including but not limited to nasal, pulmonary, oral, topical, or parenteral dosage forms. Each dosage form may contain a variety of diluents or other pharmaceutically acceptable excipients, such as solubilizers, disintegrants, surfactants, fillers, thickeners, binders, wetting agents, etc. The pharmaceutical composition can also be formulated for injection, gas infusion, infusion, or intradermal exposure. For example, an injectable formulation may contain the disclosed vector in an aqueous or non-aqueous solution at appropriate pH and tonicity.

[0161] The disclosed vector compositions may be administered to a subject by direct injection into the liver using guided injection. In some embodiments, the vector may be administered systemically via arterial or venous circulation. In some embodiments, the vector composition may be administered by guided cannula insertion into tissue directly surrounding the liver, including the spleen or pancreas. In some embodiments, the vector composition may be delivered by injection into the portal vein or portal sinus, or by injection into the umbilical vein.

[0162] The disclosed vector composition can be administered by any pharmaceutically acceptable method, including intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenous, intradermal, intramuscular, subcutaneous, intraperitoneal), lung, vaginal, locally administered, topically administered, post-stinging local administration, mucosal administration, via aerosol, in a semi-solid medium such as agarose or gelatin, or via buccal or nasal spray formulations.

[0163] Furthermore, the disclosed vector compositions can be formulated into any pharmaceutically acceptable dosage form, such as solid dosage forms, tablets, pills, lozenges, capsules, liquid dispersions, gels, aerosols, pulmonary aerosols, nasal aerosols, ointments, creams, semi-solid dosage forms, solutions, emulsions, and suspensions. Furthermore, the pharmaceutical compositions may be controlled-release formulations, sustained-release formulations, immediate-release formulations, or any combination thereof. Additionally, the pharmaceutical compositions may be transdermal delivery systems.

[0164] In embodiments, the pharmaceutical composition may be formulated in solid dosage forms for oral administration, which may be powders, granules, capsules, tablets, or pills. In embodiments, the solid dosage form may contain one or more excipients, such as calcium carbonate, starch, sucrose, lactose, microcrystalline cellulose, or gelatin. Furthermore, in addition to the excipients, the solid dosage form may contain lubricants, such as talc or magnesium stearate. In some embodiments, the oral dosage form may be immediate-release or modified-release form. Modified-release forms include controlled-release or sustained-release, enteric-release, and the like. Excipients used in modified-release forms are generally known to those skilled in the art.

[0165] In embodiments, pharmaceutical compositions may be formulated as sublingual or buccal dosage forms. Such dosage forms include sublingual tablets or solution compositions administered under the tongue and buccal tablets placed between the cheek and gum.

[0166] In embodiments, pharmaceutical compositions may be formulated as nasal formulations. Such formulations of the present disclosure include solutions, suspensions, and gel compositions for nasal delivery.

[0167] In embodiments, the pharmaceutical composition may be formulated in an orally administered liquid dosage form such as a suspension, emulsion, or syrup. In embodiments, the liquid dosage form may include various excipients such as humectants, sweeteners, aromatics, or preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. In embodiments, the composition may be formulated to be suitable for administration to pediatric patients.

[0168] In embodiments, the pharmaceutical composition may be formulated in parenteral dosage forms such as sterile aqueous solutions, suspensions, emulsions, non-aqueous solutions, or suppositories. In embodiments, the solution or suspension may contain propylene glycol, polyethylene glycol, vegetable oils such as olive oil, or injectable esters such as ethyl oleate.

[0169] The dosage of the pharmaceutical composition may vary depending on the patient's weight, age, sex, administration time and method, excretion rate, and severity of the disease.

[0170] In embodiments, PKU treatment is achieved by guided direct injection of the disclosed vector construct into the liver using needle or intravascular cannula insertion. In embodiments, the vector composition is administered into the cerebrospinal fluid, blood, or lymphatic circulation by intravenous or arterial cannula insertion or injection, intradermal delivery, intramuscular delivery, or injection into a draining organ near the liver.

[0171] The following embodiments are provided to illustrate aspects of the present invention. However, it should be understood that the present invention is not limited to the specific conditions or details described in these embodiments. All publications cited herein are expressly incorporated by reference. [Examples]

[0172] [Example 1] Development of a lentiviral vector system

[0173] As summarized in Figure 1, a lentiviral vector system was developed (circularized form). Following transfection with therapeutic vectors, envelope plasmids, and helper plasmids, lentiviral particles were produced in 293T / 17HEK cells (purchased from American Type Culture Collection, Manassas, Virginia). Transfection of 293T / 17HEK cells producing functional viral particles utilized the reagent poly(ethyleneimine) (PEI) to increase the efficiency of plasmid DNA uptake. First, plasmids and DNA were added separately to serum-free culture medium in a 3:1 ratio (mass ratio of PEI to DNA). After 2-3 days, the cell medium was collected, and lentiviral particles were purified by anion exchange chromatography following high-speed centrifugation and / or filtration. The concentration of lentiviral particles can be expressed in units of transduction units / ml (TU / ml). The determination of TU was achieved by measuring HIV p24 levels in the culture medium (the p24 protein is incorporated into lentiviral particles), by quantitative PCR, by measuring the number of viral DNA copies per transduced cell, or by infecting cells and using light (if the vector encodes luciferase or a fluorescent protein marker).

[0174] As described above, a 3-vector system (i.e., including a 2-vector lentiviral packaging system) was designed for the production of lentiviral particles. A schematic diagram of the 3-vector system is shown in Figure 1. Briefly, referring to Figure 1, the top vector is a helper plasmid, which in this case contains Rev. The vector appearing in the middle of Figure 1 is an envelope plasmid. The bottom vector is a therapeutic vector, as described herein.

[0175] Referring to Figure 1, the helper+Rev plasmid contains CMV enhancer with chicken β-actin promoter (SEQ ID NO: 23); chicken β-actin intron (SEQ ID NO: 41); HIV Gag (SEQ ID NO: 24); HIV Pol (SEQ ID NO: 25); HIV integrase (SEQ ID NO: 26); HIV RRE (SEQ ID NO: 27); HIV Rev (SEQ ID NO: 28); and rabbit β-globin polyA (SEQ ID NO: 42).

[0176] The envelope plasmid contains the CMV promoter (SEQ ID NO: 29); β-globin intron (SEQ ID NO: 7 or 8); VSV-G envelope glycoprotein (SEQ ID NO: 30); and rabbit β-globin polyA (SEQ ID NO: 42).

[0177] The synthesis of a 3-vector system, including a 2-vector lentiviral packaging system consisting of a helper (+Rev) and envelope plasmid, is disclosed.

[0178] material and method:

[0179] Helper plasmid construction: A helper plasmid was constructed by initial PCR amplification of a DNA fragment from the pNL4-3 HIV plasmid (NIH Aids Reagent Program) containing Gag, Pol, and integrase genes. Primers were designed to amplify the fragment containing EcoRI and NotI restriction sites, which can be used for insertion into the same sites in the pCDNA3 plasmid (Invitrogen). The forward primer was (5'-TAAGCAGAATTCATGAATTTGCCAGGAAGAT-3') (SEQ ID NO: 43), and the reverse primer was (5'-CCATACAATGAATGGACACTAGGCGGCCGCACGAAT-3') (SEQ ID NO: 44).

[0180] The sequences for Gag, Pol, and the integrase fragment were as follows:

[0181] [ka] [ka] [ka]

[0182] Next, a DNA fragment containing RRE, Rev, and a rabbit β-globin polyA sequence, with XbaI and XmaI flanking restriction sites, was synthesized by Eurofins Genomics. This DNA fragment was then inserted into a plasmid at the XbaI and XmaI restriction sites. The DNA sequence was as follows:

[0183] [ka] [ka]

[0184] Finally, the CMV promoter of pCDNA3.1 was replaced with a CAG promoter (CMV enhancer, chicken β-actin promoter, and chicken β-actin intron sequence). A DNA fragment containing the CAG enhancer / promoter / intron sequence with MluI and EcoRI flanking restriction sites was synthesized by Eurofins Genomics. This DNA fragment was then inserted into the plasmid at the MluI and EcoRI restriction sites. The DNA sequence was as follows:

[0185] [ka] [ka]

[0186] Construction of VSV-G envelope plasmid:

[0187] The bullous stomatitis Indiana virus glycoprotein (VSV-G) sequence, along with the adjacent EcoRI restriction site, was synthesized by Eurofins Genomics. This DNA fragment was then inserted into the pCDNA3.1 plasmid (Invitrogen) at the EcoRI restriction site, and its correct orientation was determined by sequencing using CMV-specific primers.

[0188] The DNA sequence was as follows:

[0189] [ka] [ka]

[0190] A 4-vector system, including a 3-vector lentiviral packaging system, was also designed and prepared using the methods and materials described herein. A schematic diagram of the 4-vector system is shown in Figure 2. Briefly, referring to Figure 2, the top vector is a helper plasmid and, in this case, does not contain Rev. The second vector is a separate Rev plasmid. The third vector is an envelope plasmid. The bottom vector is a therapeutic vector as described herein.

[0191] Referring to Figure 2, the helper plasmid contains CMV enhancer and chicken β-actin promoter (SEQ ID NO: 23); chicken β-actin intron (SEQ ID NO: 41); HIV Gag (SEQ ID NO: 24); HIV Pol (SEQ ID NO: 25); HIV integrase (SEQ ID NO: 26); HIV RRE (SEQ ID NO: 27); and rabbit β-globin polyA (SEQ ID NO: 42).

[0192] The Rev plasmid contains the RSV promoter and HIV Rev (SEQ ID NO: 48); and rabbit β-globin polyA (SEQ ID NO: 42).

[0193] The envelope plasmid contains the CMV promoter (SEQ ID NO: 29); the β-globin intron (SEQ ID NO: 7 or 8); the VSV-G envelope glycoprotein (SEQ ID NO: 30); and the rabbit β-globin polyA (SEQ ID NO: 42).

[0194] In one aspect, the therapeutic lentiviral vector expressing PAH contains all of the elements shown in vector A of FIG. 3. In another aspect, the therapeutic lentiviral vector expressing PAH contains all of the elements shown in vector B of FIG. 3. In another aspect, the therapeutic lentiviral vector expressing PAH contains all of the elements shown in vector C of FIG. 3. In another aspect, the therapeutic lentiviral vector expressing PAH contains all of the elements shown in vector D of FIG. 3. In another aspect, the therapeutic lentiviral vector expressing PAH contains all of the elements shown in vector E of FIG. 3. In another aspect, the therapeutic lentiviral vector expressing PAH contains all of the elements shown in vector F of FIG. 3. In another aspect, the therapeutic lentiviral vector expressing PAH contains all of the elements shown in vector G of FIG. 3. In another aspect, the therapeutic lentiviral vector expressing PAH contains all of the elements shown in vector H of FIG. 3.

[0195] Disclosed is a 4-vector system synthesis comprising a 3-vector lentiviral packaging system consisting of a helper, Rev, and an envelope plasmid.

[0196] Materials and Methods:

[0197] Construction of a helper plasmid without Rev:

[0198] A helper plasmid without Rev was constructed by inserting a DNA fragment containing the RRE and the rabbit β-globin polyA sequence. This sequence was synthesized by Eurofins Genomics, together with the adjacent XbaI and XmaI restriction sites. Subsequently, the RRE / rabbit polyA β-globin sequence was inserted into the helper plasmid at the XbaI and XmaI restriction sites.

[0199] The DNA sequence is as follows.

[0200] [Chemical formula]

[0201] Construction of the Rev plasmid:

[0202] The RSV promoter and the HIV Rev sequence were synthesized by Eurofins Genomics as a single DNA fragment, together with the adjacent MfeI and XbaI restriction sites. Subsequently, this DNA fragment was inserted into the pCDNA3.1 plasmid (Invitrogen) in which the CMV promoter had been replaced by the RSV promoter, at the MfeI and XbaI restriction sites. The DNA sequence was as follows.

[0203] [Chemical formula]

[0204] The plasmids used in the packaging system can be modified using similar elements, and the intron sequences can potentially be removed without loss of vector function. For example, the following elements can replace similar elements in the packaging system.

[0205] Promoter: Elongation factor-1 (EF-1) (SEQ ID NO: 49), phosphoglycerate kinase (PGK) (SEQ ID NO: 50), and ubiquitin C (UbC) (SEQ ID NO: 51) can replace CMV (SEQ ID NO: 29) or the CMV enhancer / chicken β-actin promoter (SEQ ID NO: 23). These sequences can also be further modified by addition, substitution, deletion, or mutation.

[0206] PolyA sequences: SV40 polyA (sequence number 52) and bGH polyA (sequence number 53) can replace rabbit β-globin polyA (sequence number 42). These sequences can also be further modified by addition, substitution, deletion, or mutation.

[0207] HIV Gag, Pol, and Integrase Sequences: The HIV sequences in the helper plasmid can be constructed from different HIV strains or lineages. For example, HIV Gag (SEQ ID NO: 24); HIV Pol (SEQ ID NO: 25); and HIV Int (SEQ ID NO: 26) from the Bal strain can replace the gag, pol, and int sequences contained in the helper / helper+Rev plasmid as outlined herein. These sequences can also be further modified by addition, substitution, deletion, or mutation.

[0208] Envelope: The VSV-G glycoprotein can be substituted with membrane glycoproteins derived from feline endogenous virus (RD114) (SEQ ID NO: 54), gibbon leukemia virus (GALV) (SEQ ID NO: 55), rabies (FUG) (SEQ ID NO: 56), lymphocytic choriomeningitis virus (LCMV) (SEQ ID NO: 57), influenza A tripest virus (FPV) (SEQ ID NO: 58), Ross River alphavirus (RRV) (SEQ ID NO: 59), mouse leukemia virus 10A1 (MLV) (SEQ ID NO: 60), or Ebola virus (EboV) (SEQ ID NO: 61). The sequences for these envelopes are identified in the sequence portions herein. Furthermore, these sequences can be further modified by addition, substitution, deletion, or mutation.

[0209] In summary, 3-vector and 4-vector systems can be compared and contrasted as follows: 3-vector lentiviral vector systems contain: 1. Helper plasmids: HIV Gag, Pol, integrase, RRE, and Rev; 2. Envelope plasmid: VSV-G envelope; and 3. Therapeutic vector: RSV, 5'LTR, Psi packaging signal, RRE, cPPT, prothrombin enhancer, α1 antitrypsin promoter, phenylalanine hydroxylase, WPRE, and 3'ΔLTR. 4-vector lentiviral vector systems contain: 1. Helper plasmids: HIV Gag, Pol, integrase, and RRE; 2. Rev plasmid: Rev; 3. Envelope plasmid: VSV-G envelope; and 4. Therapeutic vector: RSV, 5'LTR, Psi packaging signal, RRE, cPPT, prothrombin enhancer, α1 antitrypsin promoter, phenylalanine hydroxylase, WPRE, and 3'ΔLTR. Sequences matching the above elements are identified in the sequence listing section of this specification.

[0210] [Example 2] Therapeutic vector

[0211] For example, as shown in Figure 3, we designed and developed an exemplary therapeutic vector.

[0212] First, referring to vector A in Figure 3, from left to right, the main genetic elements are as follows: a hybrid 5' terminal repeat sequence (RSV / LTR), a Psi sequence (RNA packaging site), an RRE (Rev response element), a cPPT (polyprint lacte), a prothrombin enhancer, an hAAT promoter, a PAH sequence including the PAH sequence and its variants, a Woodchuck post-transcriptional regulatory element (WPRE), and an LTR with a deletion in the U3 region, as detailed herein.

[0213] Next, referring to vector B in Figure 3, from left to right, the main genetic elements are as follows: a hybrid 5' terminal repeat sequence (RSV / LTR), a Psi sequence (RNA packaging site), an RRE (Rev response element), a cPPT (polyprint lacte), an HNF1 (hepatocyte nuclear factor) binding site upstream of the prothrombin enhancer, an hAAT promoter, a PAH sequence including the PAH sequence and its variants, a Woodchuck post-transcriptional regulatory element (WPRE), and an LTR with a deletion in the U3 region, as detailed herein.

[0214] Next, referring to vector C in Figure 3, from left to right, the main genetic elements are as follows: hybrid 5' terminal repeat sequence (RSV / LTR), Psi sequence (RNA packaging site), RRE (Rev response element), cPPT (polyprint lacte), HNF1 / 4 (hepatocyte nuclear factor) binding site upstream of the prothrombin enhancer, hAAT promoter, PAH sequence including PAH sequence and its variants, Woodchuck post-transcriptional regulatory element (WPRE), and LTR with deletion in the U3 region, as detailed herein.

[0215] Next, referring to vector D in Figure 3, from left to right, the main genetic elements are as follows: hybrid 5' terminal repeat sequence (RSV / LTR), Psi sequence (RNA packaging site), RRE (Rev response element), cPPT (polyprint lacte), prothrombin enhancer, HNF1 (hepatocyte nuclear factor), hAAT promoter, PAH sequence including PAH sequence and its variants, Woodchuck post-transcriptional regulatory element (WPRE), and LTR with deletion in the U3 region, as detailed herein.

[0216] Next, referring to vector E in Figure 3 from left to right, the major genetic elements are as follows: Hybrid 5' terminal repeat sequence (RSV / LTR) as detailed herein, Psi sequence (RNA packaging site), RRE (Rev response element), cPPT (polypurine tract), prothrombin enhancer, HNF1 / 4 (hepatocyte nuclear factor), hAAT promoter, PAH sequence and its variants including the PAH sequence, woodchuck post-transcriptional regulatory element (WPRE), and LTR having a deletion in the U3 region.

[0217] Next, referring to vector F in Figure 3 from left to right, the major genetic elements are as follows: Hybrid 5' terminal repeat sequence (RSV / LTR) as detailed herein, Psi sequence (RNA packaging site), RRE (Rev response element), cPPT (polypurine tract), five HNF1 (hepatocyte nuclear factor) binding sites upstream of the prothrombin enhancer, hAAT promoter, PAH sequence and its variants including the PAH sequence, woodchuck post-transcriptional regulatory element (WPRE), and LTR having a deletion in the U3 region.

[0218] Next, referring to vector G in Figure 3 from left to right, the major genetic elements are as follows: Hybrid 5' terminal repeat sequence (RSV / LTR) as detailed herein, Psi sequence (RNA packaging site), RRE (Rev response element), cPPT (polypurine tract), three HNF1 / HNF4 (hepatocyte nuclear factor) binding sites upstream of the prothrombin enhancer, hAAT promoter, PAH sequence and its variants including the PAH sequence, woodchuck post-transcriptional regulatory element (WPRE), and LTR having a deletion in the U3 region.

[0219] First, referring to vector H in Figure 3, from left to right, the main genetic elements are as follows: hybrid 5' terminal repeat sequence (RSV / LTR), Psi sequence (RNA packaging site), RRE (Rev response element), cPPT (polyprint lact), prothrombin enhancer, hAAT promoter, rabbit β-globin intron, PAH sequence including PAH sequence and its variants, woodchuck post-transcriptional regulatory element (WPRE), and LTR with deletion in the U3 region, as detailed herein.

[0220] To prepare the vectors generally outlined in Figure 3, the methods and materials described herein, as well as others understood by those skilled in the art, were used.

[0221] Inhibitory RNA Design: To search for potential shRNA candidates for knocking down PAH levels in human cells, the sequence of Homo sapiens phenylalanine hydroxylase (PAH) (NM_000277.1) mRNA was used. Potential RNA-shRNA sequences were selected from candidates chosen by siRNA or shRNA design programs such as the GPP Web Portal hosted by the Broad Institute (portals.broadinstitute.org / gpp / public / ) or the BLOCK-iT RNAi Designer from Thermo Scientific (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ). To control shRNA expression, the selected individual shRNA sequences were inserted into lentiviral vectors immediately 3' of the RNA polymerase III promoter H1 (SEQ ID NO: 22). These lentiviral shRNA constructs were used to transduce cells and measure changes in specific mRNA levels.

[0222] Vector Construction: For PAH shRNA, oligonucleotide sequences containing BamHI and EcoRI restriction sites were synthesized using Eurofins MWG Operon. The overlapping sense and antisense oligonucleotide sequences were mixed and annealed while cooling from 70°C to room temperature. The lentiviral vector was digested for 1 hour at 37°C using the restriction enzymes BamHI and EcoRI. The digested lentiviral vector was purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit from Thermo Scientific. DNA concentration was measured, and the vector to oligo (3:1 ratio) was mixed, annealed, and ligated. The ligation reaction was performed using T4 DNA ligase for 30 minutes at room temperature. 2.5 μL of the ligated mixture was added to 25 μL of STBL3 transformation-receptive bacterial cells. Transformation was achieved after heat shock at 42°C. Bacterial cells were spread on agar plates containing ampicillin, and drug-resistant colonies (indicating the presence of ampicillin-resistant plasmids) were collected and grown in LB broth. To confirm the insertion of oligo sequences, plasmid DNA was extracted from the collected bacterial cultures using the Thermo Scientific DNA MiniPrep Kit. The insertion of shRNA sequences in the lentiviral vector was confirmed by DNA sequencing using specific primers for the promoter used to control shRNA expression. Exemplary shRNA sequences were determined to knock down PAH using the following target sequences.

[0223] PAH shRNA sequence #1: TCGCATTTCATCAAGATTAATCTCGAGATTAATCTTGATGAAATGCGATTTTT(Sequence No. 13)

[0224] PAH shRNA sequence #2: ACTCATAAAGGAGCATATAAGCTCGAGCTTATATGCTCCTTTATGAGTTTTTT(Sequence No. 14)

[0225] [Example 3] Liver-specific prothrombin enhancer / hAAT promoter

[0226] Hepa1-6 mouse hepatome cells were transduced using a lentiviral vector containing a liver-specific prothrombin enhancer (SEQ ID NO: 5) and a human α-1 antitrypsin promoter (SEQ ID NO: 6). The resulting DNA sequences are as follows: [ka] The results for these infections are described in detail in further examples herein.

[0227] [Example 4] hAAT promoter with prothrombin enhancer and hepatocyte nuclear factor (HFN) binding site

[0228] Hepa1-6 mouse hepatome cells were transduced with a lentiviral vector containing a liver-specific prothrombin enhancer (SEQ ID NO: 5), a human α-1 antitrypsin promoter (SEQ ID NO: 6), and one or more hepatocyte nuclear factor (HNF) binding sites. The resulting DNA sequences containing five HNF1 binding sites (shown in underlined font) were as follows: [ka] The obtained DNA sequence containing the three HNF1 / HNF4 binding sites (HNF1 is shown in underlined font, and HNF4 is shown in bold font) is as follows: [ka] The expression of PAH from these vectors is described in detail in further examples herein.

[0229] [Example 5] Materials and methods for PAH

[0230] The sequence of Homo sapiens phenylalanine hydroxylase (hPAH) mRNA (Gen Bank: NM_000277.1), along with the EcoRI and SalI restriction enzyme sites located at the distal and proximal ends of this gene, was chemically synthesized by Eurofins Genomics (Louisville, Kentucky). Under the control of a hybrid promoter containing either ApoE (NM_000001.11, U35114.1) or a portion of the prothrombin (AF478696.1) and hAAT (HG98385.1) locus regulatory regions, hPAHs treated with EcoRI and SalI restriction enzymes were ligated into a pCDH lentiviral plasmid (System Biosciences, Palo Alto, CA). Furthermore, human PAHs were synthesized to include 289 nucleotides of the 3' untranslated region (UTR).

[0231] Lentiviral vectors and hPAH sequences were digested for 2 hours at 37°C using restriction enzymes BamHI and EcoRI (NEB, Ipswich, MA). The digested lentiviral vectors were purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit obtained from ThermoFisher (Waltham, MA). The DNA concentration was measured and then mixed with the PAH sequence (hPAH) using an insert-to-vector ratio of 3:1. The mixtures were ligated using T4 DNA ligase (NEB) at room temperature for 30 minutes. 2.5 μL of the ligated mixture was added to 25 μL of STBL3 transformation-receptive bacterial cells (ThermoFisher). Transformation was performed by heat shock at 42°C. Bacterial cells were streaked onto agar plates containing ampicillin, and the colonies were then grown in LB broth. To confirm the insertion of the PAH sequence, plasmid DNA was extracted from collected bacterial cultures using a ThermoFisher DNA miniprep kit. The insertion of the PAH sequence in the lentiviral vector (LV) was confirmed by DNA sequencing. Next, ApoE enhancer / hAAT promoter or prothrombin enhancer / hAAT promoter sequence with ClaI and EcoRI restriction sites was synthesized by Eurofins Genomics. Lentiviral vectors containing the PAH coding sequence and hybrid promoter were digested with ClaI and EcoRI enzymes and ligated together. Plasmids containing the hybrid promoter were confirmed by DNA sequencing. Then, lentiviral vectors containing hPAH and hybrid promoter sequences were used to test their ability to package lentiviral particles and express PAH in transduced cells. Mammalian cells were transduced with lentiviral particles. Cells were collected after 3 days, and proteins were analyzed by immunoblotting for PAH expression.

[0232] Modification of the hPAH sequence:

[0233] To improve the cellular expression levels controlled by the ApoE enhancer / hAAT promoter, several modifications to the hPAH sequence were incorporated. First, 289 nucleotides were inserted into the hPAH 3' untranslated region (UTR) after the PAH coding region and before the mRNA end. This created LV-ApoE / hAAT-hPAH-UTR.

[0234] Next, the liver-specific ApoE enhancer was replaced with a liver-specific prothrombin enhancer. PAH expression was analyzed using either the ApoE or prothrombin enhancer / hAAT promoter combination containing the hPAH coding sequence and the 289 nucleotide UTR. Then, PAH expression was evaluated using the prothrombin enhancer / hAAT promoter and hPAH coding sequence, which lacked the UTR region. The prothrombin enhancer / hAAT promoter combination eliminated the need for the UTR region required by the ApoE enhancer / hAAT promoter combination. Therefore, the prothrombin enhancer / hAAT promoter combination can control high levels of PAH expression in a liver-specific manner without the need for the UTR region. This significant advance in understanding the liver-specific regulatory elements for controlling the hPAH gene enables the creation of constructs for specific expression in liver tissue while still achieving high levels of hPAH production. Limiting transgene expression to hepatocytes is an important consideration for vector safety and target specificity in gene therapies for phenylketonuria.

[0235] [Example 6] Lentivirally delivered expression of hPAHs having a modified prothrombin enhancer and having or not having a 3'UTR in Hepa1-6 cells and 293T cells.

[0236] This embodiment demonstrates that, as shown in Figures 4A and 4B respectively, the use of a lentiviral vector containing an hAAT promoter in combination with a prothrombin enhancer increases human PAH expression in Hepa1-6 carcinoma cells and 293T human embryonic kidney cells compared to an ApoE enhancer. When the prothrombin enhancer is combined with the hAAT promoter, the 3'UTR is not required for hPAH expression. The 3'UTR actually reduces PAH expression in prothrombin-containing vectors, as shown in Figures 4A and 4B respectively. This embodiment also demonstrates that a lentiviral vector expressing hepatocyte nuclear factor 1 and 4 (HNF1 / 4) binding sites combined with a prothrombin enhancer increases PAH protein levels in Hepa1-6 cells and 293T cells, as shown in Figures 4A and 4B respectively.

[0237] Human PAH, prothrombin and ApoE enhancers, and the hAAT promoter were synthesized by Eurofins Genomics (Louisville, Kentucky) and inserted into lentiviral vectors. The insertion of these sequences was confirmed by DNA sequencing. Lentiviral vectors containing the confirmed hPAH sequences were then used to transduce Hepa1-6 mouse liver cancer cells or 293T human embryonic kidney cells (American Type Culture Collection, Manassas, Virginia). The lentiviral vectors incorporated human PAH genes with or without their 3'UTR. Furthermore, hPAH expression in these constructs was driven by an hAAT promoter containing either liver-specific prothrombin or an ApoE enhancer. Cells were transduced with lentiviral particles, and after 3 days, protein analysis for hPAH expression was performed by immunoblotting. Relative expression of human PAH was detected by immunoblotting using anti-PAH antibodies (Abcam, Cambridge, MA), with anti-β-actin antibodies (SigmaMillipore, Billerica, MA) used as a loading control.

[0238] As shown in Figures 4A and 4B, the following six groups are compared: a control containing only Hepa1-6 cells or 293T cells (lane 1), a lentiviral vector expressing the coding region of hPAH via a prothrombin enhancer / hAAT promoter (lane 2), a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter containing a 5×HNF1 binding site upstream of the prothrombin enhancer (lane 3), a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter containing 3×HNF1 and 3×HNF4 binding sites upstream of the prothrombin enhancer (lane 4), a lentiviral vector expressing hPAH with a 3'UTR via a prothrombin enhancer / hAAT promoter (lane 5), and a lentiviral vector expressing hPAH with a 3'UTR via an ApoE enhancer / hAAT promoter (lane 6). Figures 4A and 4B demonstrate that, compared to the ApoE enhancer, the combination of the prothrombin enhancer with the hAAT promoter increases PAH expression in both Hepa1-6 carcinoma cells and 293T cells. Furthermore, when the prothrombin enhancer is included in the vector, the PAH3'UTR is not required for hPAH expression.

[0239] [Example 7] Lentivirally delivered expression of hPAH having an intron sequence, a codon-optimized PAH sequence, and a prothrombin enhancer containing an HNF-1 or HNF1 / 4 binding site in Hepa1-6 cells.

[0240] This embodiment demonstrates that, as shown in Figure 5A, a lentiviral vector containing an hAAT promoter combined with a prothrombin enhancer and a rabbit β-globin intron sequence increases the expression of human PAH in Hepa1-6 carcinoma cells. When the intron sequence is inserted in the reverse direction, hPAH is not expressed. In Figure 5B, this shows that a codon-optimized version of the hPAH coding sequence is expressed less than an unoptimized hPAH coding region sequence. This embodiment also demonstrates that, as shown in Figure 5C, a lentiviral vector expressing hepatocyte nuclear factor-1 and -4 (HNF1 and HNF1 / 4) binding sites combined with a prothrombin enhancer increases the level of hPAH protein in Hepa1-6 cells.

[0241] Human PAH (optimized and unoptimized), prothrombin enhancers, hAAT promoters, and rabbit β-globin sequences were synthesized by Eurofins Genomics (Louisville, Kentucky) and inserted into lentiviral vectors. The insertion of these sequences was confirmed by DNA sequencing. Lentiviral vectors containing the confirmed hPAH sequences were then used to transduce Hepa1-6 mouse liver cancer cells (American Type Culture Collection, Manassas, Virginia). The lentiviral vectors incorporated human PAH genes with or without rabbit β-globin introns. Furthermore, hPAH expression in these constructs was driven by an hAAT promoter containing a liver-specific prothrombin enhancer with an HNF1 or HNF1 / 4 binding site, either upstream or downstream of the prothrombin enhancer. Cells were transduced with lentiviral particles, and after 3 days, protein analysis for PAH expression was performed by immunoblotting. Relative expression of human PAH was detected by immunoblotting using anti-PAH antibodies (Abcam, Cambridge, MA), with anti-β-actin antibodies (SigmaMillipore, Billerica, MA) used as a loading control.

[0242] As shown in Figure 5A, the following four groups are compared: a control containing only Hepa1-6 cells (lane 1), a lentiviral vector expressing the coding region of hPAH via a prothrombin enhancer / hAAT promoter (lane 2), a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and containing rabbit β-globin introns in the forward direction (lane 3), and a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and containing rabbit β-globin introns in the reverse direction (lane 4). As shown in Figure 5B, three groups are compared: a control containing only Hepa1-6 cells (lane 1), a lentiviral vector expressing only the coding region of hPAH via a prothrombin enhancer / hAAT promoter (lanes 2 and 3), and a lentiviral vector expressing a codon-optimized sequence of hPAH via a prothrombin enhancer / hAAT promoter (lane 4). As shown in Figure 5C, the following six groups are compared: a control containing only Hepa1-6 cells (lane 1), lentiviral vectors expressing only the coding region of hPAH via a prothrombin enhancer / hAAT promoter (lanes 2 and 3), a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and containing rabbit β-globin introns (lane 4), and a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and an HNF1 binding site upstream of the prothrombin enhancer. (Lane 5), a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and an HNF1 binding site downstream of the prothrombin enhancer (Lane 6), a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and an HNF1 / 4 binding site upstream of the prothrombin enhancer (Lane 7), and a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and an HNF1 / 4 binding site downstream of the prothrombin enhancer (Lane 8).Figures 5A–5C demonstrate that adding rabbit β-globin intron sequences upstream of the hPAH coding sequence increases hPAH expression in Hepa1–6 carcinoma cells. Furthermore, codon-optimized hPAH coding sequences are expressed less than unoptimized sequences. Finally, adding an HNF1 or HNF1 / 4 binding site upstream of a prothrombin enhancer increases hPAH expression compared to lentiviral vectors containing only the prothrombin enhancer / hAAT promoter, but adding it downstream does not.

[0243] [Example 8] Expression of hPAH RNA having an hAAT promoter and a prothrombin enhancer containing HNF-1 and HNF-1 / 4 binding sites, delivered by lentivirus in Hepa1-6 cells.

[0244] As shown in Figure 6, this embodiment demonstrates that human PAH RNA expression is increased in Hepa1-6 carcinoma cells transduced with a lentiviral vector containing a prothrombin enhancer and an hAAT promoter combined with binding sites for HNF1 and HNF1 / 4, at infection efficiencies (MOI) of 1 and 5.

[0245] Human PAH, a prothrombin enhancer, and an hAAT promoter were synthesized by Eurofins Genomics (Louisville, Kentucky) and inserted into lentiviral vectors. The insertion of these sequences was confirmed by DNA sequencing. Lentiviral vectors containing the confirmed hPAH sequences were then used to transduce Hepa1-6 mouse liver cancer cells (American Type Culture Collection, Manassas, Virginia). The lentiviral vectors incorporated the human PAH gene. Furthermore, hPAH expression in these constructs was driven by an hAAT promoter containing a liver-specific prothrombin enhancer with an upstream HNF1 or HNF1 / 4 binding site. Cells were transduced with lentiviral particles, and 3 days later, RNA was extracted using the RNeasy kit (Qiagen, Germantown, MD) and analyzed by qPCR using the TaqMan probe (5'-TCGTGAAAGCTCATGGACAGTGGC-3') (SEQ ID NO: 66) and a primer set for hPAH: forward: 5'-AGATCTTGAGGCATGACATTGG-3' (SEQ ID NO: 67) and reverse: 5'-GTCCAGCTCTTGAATGGTTCTT-3' (SEQ ID NO: 68). Total RNA (100 ng) was normalized using the actin probe (5'-AGCGGGAAATCGTGCGTGAC-3') (SEQ ID NO: 69) and a primer set (forward: 5'-GGACCTGACTGACTACCTCAT-3' (SEQ ID NO: 70) and reverse: 5'-CGTAGCACAGCTTCTCCTTAAT-3') (SEQ ID NO: 71).

[0246] As shown in Figure 6, the following four groups are compared: a control containing only Hepa1-6 cells (Bar 1), a lentiviral vector expressing the hPAH coding region via the prothrombin enhancer / hAAT promoter at 1 MOI (Bar 2) and 5 MOI (Bar 5), a lentiviral vector expressing hPAH via the prothrombin enhancer / hAAT promoter and an HNF1 binding site upstream of the prothrombin enhancer at 1 MOI (Bar 3) and 5 MOI (Bar 6), and a lentiviral vector expressing hPAH via the prothrombin enhancer / hAAT promoter and an HNF1 / 4 binding site upstream of the prothrombin enhancer at 1 MOI (Bar 4) and 5 MOI (Bar 7). Figure 6 demonstrates that PAH RNA expression increases from 1 to 4.7 pg (1-5 MOI) when using a vector expressing hPAH via the prothrombin enhancer / hAAT promoter. When the HNF1 binding site is included upstream of the prothrombin enhancer, the dose increases from 2.3 to 10.7 pg (1-5 MOI), and when the HNF1 / 4 binding site is inserted upstream of the prothrombin enhancer, the dose increases from 3 to 17.8 pg (1-5 MOI).

[0247] [Example 9] Lentiviral-delivered expression of hPAH having either a prothrombin enhancer and either an hAAT or thyroxine-binding globulin (TBG) promoter in Hepa1-6 cells

[0248] This embodiment demonstrates that, as shown in Figure 7, a lentiviral vector containing a prothrombin enhancer combined with the hAAT promoter increases human PAH expression in Hepa1-6 carcinoma cells compared to the TBG promoter (SEQ ID NO: 62).

[0249] Human PAH, a prothrombin enhancer, and the hAAT and TBG promoters were synthesized by Eurofins Genomics (Louisville, Kentucky) and inserted into lentiviral vectors. The insertion of these sequences was confirmed by DNA sequencing. Lentiviral vectors containing the confirmed hPAH sequences were then used to transduce Hepa1-6 mouse liver cancer cells (American Type Culture Collection, Manassas, Virginia). The lentiviral vectors incorporated the human PAH gene. Furthermore, hPAH expression in these constructs was driven by either the liver-specific hAAT or TBG promoter. Cells were transduced with lentiviral particles, and after 3 days, protein analysis was performed by immunoblotting for PAH expression. Relative expression of human PAH was detected by immunoblotting using an anti-PAH antibody (Abcam, Cambridge, MA), with an anti-β-actin antibody (SigmaMillipore, Billerica, MA) used as a loading control.

[0250] As shown in Figure 7, the following four groups are compared: a lentiviral vector expressing the coding region of hPAH via a prothrombin enhancer / hAAT promoter (lane 1), a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and containing rabbit β-globin introns (lane 2), a control using a lentiviral vector containing only a prothrombin enhancer / hAAT promoter (lane 3), and a lentiviral vector expressing hPAH via a prothrombin enhancer / TBG promoter (lane 4). Figure 7 demonstrates that when the prothrombin enhancer is combined with the hAAT promoter, PAH expression is significantly increased in Hepa1-6 carcinoma cells compared to when the TBG promoter is used.

[0251] [Example 10] Lentiviral-delivered expression of hPAH having either rabbit or human β-globin intron sequences upstream of the PAH gene in Hepa1-6 cells or Hep3B cells.

[0252] This embodiment demonstrates that human PAH expression in Hepa1-6 and Hep3B carcinoma cells is not increased by human β-globin introns, using a lentiviral vector containing an hAAT promoter and a prothrombin enhancer combined with either rabbit or human β-globin introns, as shown in Figures 8A and 8B.

[0253] Human PAH, prothrombin enhancer, hAAT promoter, and rabbit or human β-globin introns were synthesized by Eurofins Genomics (Louisville, Kentucky) and inserted into lentiviral vectors. The insertion of these sequences was confirmed by DNA sequencing. Lentiviral vectors containing the confirmed hPAH sequences were then used to transduce Hepa1-6 mouse liver cancer cells or Hep3B human hepatocellular carcinoma cells (American Type Culture Collection, Manassas, Virginia). The lentiviral vectors incorporated the human PAH gene. Furthermore, hPAH expression in these constructs was driven by either a liver-specific hAAT promoter and either rabbit or human β-globin introns. Cells were transduced with lentiviral particles, and after 3 days, protein analysis for PAH expression was performed by immunoblotting. Relative expression of human PAH was detected by immunoblotting using anti-PAH antibodies (Abcam, Cambridge, MA), with anti-β-actin antibodies (SigmaMillipore, Billerica, MA) used as a loading control.

[0254] As shown in Figures 8A and 8B, the following four groups are compared: no lentivirus (lane 1), a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter (lane 2), a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and rabbit β-globin intron sequence (lane 3), and a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and human β-globin intron (lane 4). Figures 8A and 8B demonstrate increased PAH expression in Hepa1-6 and Hep3B carcinoma cells with prothrombin enhancer and hAAT promoter. Addition of rabbit β-globin introns improves expression in Hepa1-6 cells but not in Hep3B cells. Human β-globin introns do not improve expression in either Hepa1-6 or Hep3B cells.

[0255] [Example 11] Expression of hPAH having a prothrombin enhancer / hAAT promoter delivered by lentivirus in primary human hepatocytes

[0256] This embodiment demonstrates that, as shown in Figure 9, the expression of human PAH is significantly increased in primary human hepatocytes using a lentiviral vector containing a prothrombin enhancer combined with an hAAT promoter.

[0257] Human PAH, prothrombin and ApoE enhancer, and hAAT promoter were synthesized by Eurofins Genomics (Louisville, Kentucky) and inserted into lentiviral vectors. The insertion of these sequences was confirmed by DNA sequencing. Lentiviral vectors containing the confirmed hPAH sequences were then used to transduce primary human hepatocytes (Triangle Research Labs, North Carolina). The lentiviral vectors incorporated either the coding sequence of human PAH or the coding sequence and 3'UTR. Furthermore, hPAH expression in these constructs was driven by liver-specific prothrombin or ApoE enhancer and hAAT promoter. Cells were transduced with lentiviral particles, and after 4 days, protein analysis was performed by immunoblotting for PAH expression. Relative expression of human PAH was detected by immunoblotting using an anti-PAH antibody (Abcam, Cambridge, MA), with an anti-β-actin antibody (SigmaMillipore, Billerica, MA) used as a loading control.

[0258] As shown in Figure 9, the following five groups are compared: a control using a lentiviral vector containing only a prothrombin enhancer / hAAT promoter (lane 1), a lentiviral vector expressing the hPAH coding region via a prothrombin enhancer / hAAT promoter (lane 2), a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and a 5×HNF1 binding site upstream of the prothrombin enhancer (lane 3), a lentiviral vector expressing hPAH via a prothrombin enhancer / hAAT promoter and containing rabbit β-globin introns (lane 4), and a lentiviral vector having a 3'UTR and expressing hPAH via an ApoE / hAAT promoter (lane 5). Figure 9 demonstrates that when a prothrombin enhancer is combined with an hAAT promoter, PAH expression is increased in primary human hepatocytes compared to when an ApoE enhancer is used. Furthermore, including rabbit β-globin intron sequences upstream of the hPAH coding sequence enhances hPAH expression.

[0259] [Example 12] Enzymatic activity of lentivirus-delivered hPAH in Hepa1-6 cells

[0260] This example demonstrates that when hPAH is expressed in Hepa1-6 cells, as shown in Figures 10A, 10C, and 10B, the lentivirally delivered human PAH is enzymatically active, as indicated by a decrease in phenylalanine (Phe) levels in the cell culture medium and cell lysate. The cofactor BH4 precursor, sepiapterin, was required for PAH activity in Hepa1-6 cells.

[0261] Human PAH, prothrombin enhancer and ApoE enhancer, hAAT promoter, and rabbit β-globin intron were synthesized and inserted into lentiviral vectors. The insertion of these sequences was confirmed by DNA sequencing. Lentiviral vectors containing the confirmed hPAH sequences were then used to transduce Hepa1-6 mouse liver cancer cells (American Type Culture Collection, Manassas, Virginia). The lentiviral vectors incorporated the coding sequence of human PAH. Furthermore, hPAH expression in these constructs was driven by a liver-specific prothrombin enhancer / hAAT promoter and included the rabbit β-globin intron sequence. Cells were transduced with lentiviral particles, and after 4 days, phenylalanine levels were measured from either cell culture or cell lysate using a Phenylalanine Assay Kit (SigmaMillipore, Billerica, MA).

[0262] As shown in Figures 10A and 10B, four groups are compared from cell culture in Figure 10A or from cell lysates in Figure 10B: a control using a lentiviral vector containing only the prothrombin enhancer / hAAT promoter, either without sepiapterin (Bar 1) or with sepiapterin (Bar 3); and a lentiviral vector expressing the hPAH coding region via the prothrombin enhancer / hAAT promoter and containing a rabbit β-globin intron sequence, either without sepiapterin (Bar 2) or with sepiapterin (Bar 4). As shown in Figure 10C, ten groups are compared from cell culture. A control using a lentiviral vector containing only the prothrombin enhancer / hAAT promoter, either without sepiapterin (Bar 1) or with sepiapterin (Bar 6); a lentiviral vector expressing the hPAH coding region by the prothrombin enhancer / hAAT promoter, either without sepiapterin (Bar 2) or with sepiapterin (Bar 7); and a lentiviral vector containing the prothrombin enhancer / hAAT promoter and the upstream of the prothrombin enhancer, either without sepiapterin (Bar 3) or with sepiapterin (Bar 8). Lentiviral vectors expressing the hPAH coding region via a 5×HNF1 binding site; lentiviral vectors expressing the hPAH coding region via a prothrombin enhancer / hAAT promoter containing a rabbit β-globin intron sequence, with or without sepiapterin (Bar 4) or with sepiapterin (Bar 9); lentiviral vectors expressing the hPAH coding region including the 3'UTR via an ApoE enhancer / hAAT promoter, with or without sepiapterin (Bar 5) or with sepiapterin (Bar 10). Figures 10A and 10B show that hPAH is enzymatically active in Hepa1-6 cells in the presence of sepiapterin. As shown in Figure 10A, a 38% decrease in phenylalanine levels in cell culture medium was observed in Hepa1-6 cells transduced with the hPAH-expressing lentiviral vector.In cell lysates, as shown in Figure 10B, Hepa1-6 cells transduced with a lentiviral vector expressing hPAH showed an 88% decrease in phenylalanine levels. Figure 10C shows that hPAH is enzymatically active in vectors containing different liver-specific promoter elements. A 41% decrease in Phe levels was observed with vectors containing the prothrombin enhancer / hAAT promoter and hPAH, a 43% decrease with vectors containing a 5×HNF1 binding site upstream of the prothrombin enhancer / hAAT promoter and hPAH, a 48% decrease with vectors containing the prothrombin enhancer / hAAT promoter and hPAH including rabbit β-globin introns, and a 36% decrease with vectors containing the ApoE enhancer / hAAT promoter and hPAH including the 3'UTR.

[0263] [Example 13] PAH delivered by lentivirus reduces blood phenylalanine levels in the blood of PAH mutant mice.

[0264] In this example, PAH delivered by a lentivirus is Pah enu2 This explains the reduction in phenylalanine levels in the blood of mutant mice. enu2 The mutant mouse was described and characterized by Shedlovsky et al. (Mouse Models of Human Phenylketonuria, Genetics 134:1205-1210 (August, 1993)), and the entire description is incorporated herein by reference. enu2 Mutant mice (n=4) were injected with 150 μL of LV-Pro-hAAT-PAH(AGT323) vector via the tail vein. Treated control animals were injected with saline solution without lentiviral vector via the tail vein. The titer of LV-Pro-hAAT-PAH(AGT323) was measured by qPCR detection of integrated vector copies in transduced 293T cells, resulting in a titer of 1 × 10⁻⁶. 10At the time of injection, the mice were 6-8 weeks old. Blood was collected before vector injection (T=0) and 1 and 2 weeks after injection.

[0265] To measure phenylalanine levels, blood was collected via facial vein. A lancet was used to puncture the cheek, and 400 μL of whole blood was collected in a serum tube. The blood was allowed to stand for 1 hour, and then the tube was centrifuged. Plasma / serum separated onto the upper layer and collected. The plasma was then frozen until analysis on a clinical amino acid analyzer.

[0266] Introduction of the LV-Pro-hAAT-PAH(AGT323) vector resulted in a decrease in serum phenylalanine levels at both 1 and 2 weeks post-injection. As shown in Table 1 and Figure 11, the mean μM serum phenylalanine levels at 1 and 2 weeks were 1674.7 and 1890, respectively. This is compared to the mean μM serum phenylalanine levels of control-treated mice, which ranged from approximately 2400 to 2500 (Table 1 and Figure 11).

[0267] Furthermore, the introduction of the LV-Pro-hAAT-PAH(AGT323) vector resulted in genetic modification of hepatocytes. Studies of vector copy numbers in livers collected during autopsy showed that the lentiviral vector copy number was approximately 0.2 / cell in these studies. As shown in Figure 12, there is a roughly linear relationship between the increasing vector copy number in the liver and the decreasing levels of phenylalanine (Pearson product correlation coefficient = -0.326).

[0268] A reduction of 20% or more in serum phenylalanine levels may provide therapeutic benefits to human patients with phenylketonuria and may shift the patient's diagnosis from classic PKU to mild phenylketonuria. [Table 1]

[0269] [Example 14] Expression of hPAH using either DJ or AAV2 serotype delivered by AAV in HEK293T cells

[0270] This example demonstrates that human PAH is expressed in HEK293T cells using an AAV vector containing a prothrombin enhancer combined with an hAAT promoter, with or without rabbit β-globin introns.

[0271] Human PAH, prothrombin enhancer, hAAT promoter, and rabbit β-globin intron were synthesized by Eurofins Genomics (Louisville, Kentucky) and inserted into AAV vectors. The insertion of these sequences was confirmed by DNA sequencing. Subsequently, AAV vectors containing the confirmed hPAH sequences were used to transduce HEK293T cells (American Type Culture Collection, Manassas, Virginia). The AAV vectors incorporated the human PAH gene as disclosed herein. Furthermore, hPAH expression in these constructs was driven by a liver-specific hAAT promoter and rabbit β-globin introns. Cells were transduced with AAV particles, and after 3 days, protein or RNA was analyzed for PAH expression by immunoblotting or qPCR. Human PAH protein expression was detected by immunoblotting using an anti-PAH antibody (Abcam, Cambridge, MA), with an anti-β-actin antibody (MilliporeSigma, Billerica, MA) used as a loading control. PAH RNA expression was detected by qPCR using a TaqMan Fam-labeled probe (SEQ ID NO: 66) and PAH primers (forward: SEQ ID NO: 67; reverse: SEQ ID NO: 68).

[0272] Figure 13A shows a comparison of the following six groups: AAV / DJ-GFP vector (lane 1), AAV / DJ vector expressing hPAH via prothrombin enhancer / hAAT promoter (lane 2), AAV / DJ vector expressing hPAH via prothrombin enhancer / hAAT promoter and rabbit β-globin intron sequence (lane 3), AAV2-GFP vector (lane 4), AAV2 vector expressing hPAH via prothrombin enhancer / hAAT promoter (lane 5), and AAV2 vector expressing hPAH via prothrombin enhancer / hAAT promoter and rabbit β-globin intron sequence (lane 6).

[0273] Figures 13B and 13C show blots after exposure with increased PAH banding, as shown in Figure 13A. Exposure was increased so that the band density fell within the range to be analyzed by quantitative imaging. The original band intensity was much lower on the blots treated with the AAV / 2 serotype vector compared to the blots treated with the AAV / DJ serotype vector. Consequently, longer exposure times were required on the AAV / 2 serotype blots compared to the AAV / DJ serotype blots to achieve quantitative measurement of PAH protein.

[0274] Quantitative imaging results showed that PAH protein expression was doubled when using either an AAV / DJ vector containing rabbit β-globin introns or an AAV / DJ vector lacking rabbit β-globin introns (Figure 13B; numbers below the bands indicate relative multipliers). The use of an AAV / 2 vector containing rabbit β-globin introns suppressed PAH expression, while the use of an AAV2 vector lacking rabbit β-globin introns resulted in a 50-fold increase in PAH (Figure 13C; numbers below the bands indicate relative multipliers). Comparison of PAH expression across AAV serotypes revealed that the use of AAV / DJ PAH vectors resulted in higher PAH protein expression compared to the use of AAV2 PAH vectors.

[0275] Figure 13D demonstrates that PAH RNA expression is higher with the AAV / DJ PAH vector compared to the AAV2 PAH vector, and that similar expression exists in rabbit β-globin with and without introns.

[0276] [Example 15] Lentiviral vector therapy for PKU in neonatal enu2 / enu2 mice

[0277] Newborn enu2 / enu2 mice (3 days old) were treated with 10 μL of vector stock LV-Pro-hAAT-PAH via direct intrahepatic injection. Untreated animals received physiological saline without vector (Siamese control). Approximately 5 × 10⁻⁶ 6 Transduction unit / mouse (approx. 10 9 For the final dose of transduction units / kg, the vector stock was approximately 5 × 10⁶ in sterile saline (measured in HEK293 cells). 8 The transduction unit was per mL.

[0278] As shown in Table 2 and Figure 14, blood phenylalanine levels (μM concentration) were significantly lower in LV-Pro-hAAT-PAH-treated enu2 / enu2 mice (1390+ / -127) compared to untreated enu2 / enu2 mice (2063+ / -185). [Table 2]

[0279] [Example 16] Expression of shPAH targeting the 3'UTR of the PAH gene does not suppress PAH expression by LV-H1-shPAH-prothrombin-hAAT-hPAH in Hep3B cells.

[0280] This example demonstrates that shPAH does not suppress PAH expression from the lentiviral vector LV-Pro-hAAT-PAH-shPAH sequence #1 (SEQ ID NO: 13) or the lentiviral vector LV-Pro-hAAT-PAH-shPAH sequence #2 (SEQ ID NO: 14) in Hep3B cells.

[0281] Human PAH as disclosed herein was synthesized and inserted into a lentiviral vector containing either PAH shRNA sequence #1 (SEQ ID NO: 13) or PAH shRNA sequence #2 (SEQ ID NO: 14). The insertion of these sequences was confirmed by DNA sequencing. Human Hep3B cells (purchased from the American Type Culture Collection, Manassas, Virginia) were then transduced using lentiviral vectors containing either PAH alone or PAH shRNA sequence #1 (SEQ ID NO: 13) or PAH shRNA sequence #2 (SEQ ID NO: 14) in combination. Cells were transduced with lentiviral particles, and after 3 days, protein analysis for PAH expression was performed by Western blotting. Relative expression of human PAH was detected by immunoblotting using an anti-PAH antibody (Abcam) and loading control β-actin. hPAH expression was driven by a prothrombin enhancer and an hAAT promoter. In various cases, lentiviral vectors incorporated the human PAH gene and either PAH shRNA sequence #1 (SEQ ID NO: 13) or PAH shRNA sequence #2 (SEQ ID NO: 14). The insertion of the shRNA sequence in the lentiviral vector (LV) was confirmed by DNA sequencing using primers complementary to the promoter used to control shPAH-2 expression. In this case, the H1 promoter was used to control PAH shRNA expression. The target sequence for shPAH—(PAH shRNA sequence #1 (SEQ ID NO: 13) or PAH shRNA sequence #2 (SEQ ID NO: 14))—is located in the PAH 3'UTR, which is not present in the LV-PAH vector.

[0282] As shown in Figure 15, lentivirus-derived PAH expression is not suppressed by either PAH shRNA sequence #1 (SEQ ID NO: 13) or PAH shRNA sequence #2 (SEQ ID NO: 14).

[0283] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8] [Table 3-9] [Table 3-10] [Table 3-11] [Table 3-12] [Table 3-13] [Table 3-14] [Table 3-15] Table 3-16 Table 3-17 Table 3-18 Table 3-19 Table 3-20 Table 3-21 Table 3-22 Table 3-23

Claims

1. A viral vector including a therapeutic cargo portion, wherein the therapeutic cargo portion is (a) or (b) below: (a) A polynucleotide encoding human phenylalanine hydroxylase (hPAH), wherein the sequence encoding the 3'UTR of the hPAH is either the sequence of the nucleotide sequence of Sequence ID No. 4 or is absent; HAAT promoter and; Prothrombin enhancer, Here, the polynucleotide encoding the hPAH is operatively regulated by both the haAAT promoter and the prothrombin enhancer. (b) The first polynucleotide encoding human phenylalanine hydroxylase (hPAH); A second polynucleotide encoding the 3'UTR of a shortened PAH, which is a sequence consisting of the nucleotide sequence of SEQ ID NO: 4; HAAT promoter and; ApoE enhancer, Here, the polynucleotide encoding the hPAH is operatively regulated by both the hAAT promoter and the ApoE enhancer. It includes one of the above, and the hPAH has PAH activity, Viral vector.

2. The viral vector according to claim 1, wherein the therapeutic cargo portion further comprises a β-globin intron.

3. The viral vector according to claim 1, wherein the therapeutic cargo portion further comprises at least one hepatocyte nuclear factor binding site.

4. The viral vector according to claim 3, wherein the at least one hepatocyte nuclear factor binding site is located upstream of the prothrombin enhancer.

5. The viral vector according to claim 3, wherein the at least one hepatocyte nuclear factor binding site is located downstream of the prothrombin enhancer.

6. The viral vector according to claim 1, wherein the polynucleotide encoding the hPAH includes a sequence that is at least 90% or at least 95% identical to SEQ ID NO: 1 or SEQ ID NO:

2.

7. The viral vector according to claim 6, wherein the polynucleotide encoding the hPAH includes SEQ ID NO: 1 or SEQ ID NO:

2.

8. The viral vector according to claim 1, wherein the prothrombin enhancer comprises a polynucleotide that is at least 90% or at least 95% identical to SEQ ID NO:

5.

9. The viral vector according to claim 1, wherein the polynucleotide of the prothrombin enhancer contains SEQ ID NO:

5.

10. The viral vector according to claim 1, wherein the polynucleotide of the hAAT promoter includes SEQ ID NO:

6.

11. The viral vector according to claim 2, wherein the polynucleotide of the β-globin intron comprises SEQ ID NO: 7 or 8.

12. The viral vector according to claim 3, wherein the polynucleotide of the hepatocyte nuclear factor binding site includes one of sequence numbers 9 to 12.

13. The viral vector according to claim 1, wherein the viral vector is a lentiviral vector or an AAV vector.

14. A lentiviral particle capable of infecting target cells, wherein the lentiviral particle is An envelope protein optimized for infecting the aforementioned target cells; The lentiviral vector according to claim 13; lentiviral particles, including those containing lentiviral particles.

15. The lentiviral particle according to claim 14, wherein the target cell is a hepatocyte, muscle cell, epithelial cell, endothelial cell, nerve cell, neuroendocrine cell, endocrine cell, lymphocyte, myeloid cell, cell present in a parenchymal organ or hematopoietic cell, hematopoietic stem cell or precursor hematopoietic stem cell.

16. A composition comprising lentiviral particles according to claim 14 or 15 for treating phenylketonuria (PKU) in a subject, characterized in that a therapeutically effective amount of the lentiviral particles is administered to the subject.

17. A composition comprising lentiviral particles according to claim 14 or 15 for preventing PKU in a subject, characterized in that a therapeutically effective amount of the lentiviral particles is administered to the subject.

18. The composition according to claim 16 or 17, characterized in that a PKU genotype in the subject that correlates with the PKU phenotype is diagnosed.

19. The composition according to claim 16 or 17, wherein the subject is present in the uterus.

20. The composition according to claim 18, wherein the diagnosis is performed during the prenatal screening of the subject.

21. The composition according to claim 18, wherein the diagnosis is performed in vitro.

22. The composition according to claim 16 or 17, wherein the therapeutically effective amount of lentiviral particles comprises a plurality of single-dose doses of lentiviral particles.

23. The composition according to claim 16 or 17, wherein the therapeutically effective amount of lentiviral particles comprises a single dose of lentiviral particles.

Citation Information

Patent Citations

  • CLAMP DEVICE FOR MINIMALLY INVASIVE PROCEDURES AND THEIR USE

    JP2016531670A

  • Spherical microcapsules comprising GLP-1 peptides, their production and use

    US20140105991A1

  • Vectors and transgenies with regulatory elements for gene delivery to the liver

    WO2001036620A2