Biosensor for glucose measurement
A novel FAD-binding glucose dehydrogenase enzyme, produced via recombinant technology, addresses the limitations of PQQ-based enzymes by enhancing glucose selectivity and stability, ensuring accurate and efficient glucose measurement in point-of-care testing devices.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- PHC CORP
- Filing Date
- 2025-02-04
- Publication Date
- 2026-04-10
AI Technical Summary
Conventional glucose dehydrogenases, particularly those using pyrroloquinoline quinone (PQQ) as a coenzyme, suffer from low stability, high reactivity with maltose, and low selectivity for glucose, leading to inaccurate blood glucose measurements and potential health risks in point-of-care testing devices.
Development of a novel FAD-binding glucose dehydrogenase enzyme, encoded by a specific polynucleotide sequence, which exhibits high selectivity for glucose, low reactivity with maltose, and improved thermal stability, produced through recombinant technology in transformed cells.
The novel enzyme allows for accurate and reliable glucose measurement with reduced interference from oxygen and other sugars, enabling high sensitivity and large-scale production suitable for point-of-care testing devices.
Smart Images

Figure 0007843452000009 
Figure 0007843452000010 
Figure 0007843452000011
Abstract
Description
Technical Field
[0001] The present invention relates to a novel gene (polynucleotide) encoding flavin adenine dinucleotide (FAD)-binding glucose dehydrogenase, a transformed cell recombined by the gene, a method for producing the enzyme using the transformed cell, recombinant FAD-binding glucose dehydrogenase, and a method for measuring glucose characterized by using the enzyme, a glucose measurement reagent composition, and a biosensor for glucose measurement, etc.
Background Art
[0002] The amount of blood glucose is an important marker for diabetes. Diabetes tests are carried out not only in clinical tests in hospital laboratories, etc., but also in simple measurements (Point-of-Care Testing: POCT) such as simple tests by medical staff, etc. and self-tests by patients themselves.
[0003] This simple measurement is carried out by measuring devices (POCT devices) such as glucose diagnostic kits and biosensors. Conventionally, glucose oxidase has been used in these POCT devices. However, since glucose oxidase is affected by the dissolved oxygen concentration and an error occurs in the measured value, the use of glucose dehydrogenase that is not affected by oxygen is recommended.
[0004] Glucose dehydrogenases include coenzyme non-binding glucose dehydrogenases that use nicotinamide adenine dinucleotide (NAD) or nicotinamide adenine dinucleotide phosphate (NADP) as coenzymes, and coenzyme-binding glucose dehydrogenases that use pyrroloquinoline quinone (PQQ), flavin adenine dinucleotide (FAD), etc. as coenzymes. Among them, Coenzyme-bound glucose dehydrogenase is more complex than coenzyme-unbound glucose dehydrogenase. It is less affected by the components, has high measurement sensitivity, and, in principle, makes POCT devices inexpensive. It has the advantage of being able to be manufactured.
[0005] However, conventional PQQ-bound glucose dehydrogenases have low stability and are also malformed. It has the drawback of reacting to toxin and galactose as well. Maltose is used in intravenous fluids. It is a sugar used, and when PQQ-linked glucose dehydrogenase reacts with maltose, blood glucose is produced. POCT devices display blood glucose levels higher than the actual values. Therefore, patients may experience unnecessary symptoms. As a result of administering the injection, hypoglycemia accidents such as loss of consciousness or coma can occur. This is a major problem.
[0006] In particular, the current applications of blood glucose POCT devices extend beyond simply measuring blood glucose levels to include more advanced uses. Its importance as a means of patient self-management and treatment is increasing, and it is used for that purpose. The adoption of self-monitoring of blood glucose (SMBG) devices in homes is expanding. Given that this trend continues, the demand for measurement accuracy is considered to be very high.
[0007] In fact, in February 2005, the Ministry of Health, Labour and Welfare in Japan approved maltose infusion and icodextrin. For patients receiving dialysis fluid containing string, enzymes that utilize PQQ as a coenzyme. A notice has been issued to warn about the use of blood glucose meters that utilize [a specific technology / method] (February 2005). (7th; Pharmaceutical and Food Safety Notification No. 0207005, etc.)
[0008] On the other hand, coenzyme-bound glucose catalyzes the dehydrogenation reaction of glucose and uses FAD as a coenzyme. As for dehydrogenases, there is one derived from Agrobacterium tumefaciens (J. Biol. Chem. (1967) 242: 3665-3672), derived from Cytophaga marinoflava (Appl. Biochem. Biotechnol. (1996) 56: 301) -310), derived from Halomonas sp. α-15 (Enzyme Microb. Technol. (1998) 22 : 269-274), Agar derived from icus bisporus (Arch. Microbiol. (1997) 167:119-125, Appl. Microbiol. Biotechnol . (1999)51:58-64) and derived from Macrolepiota rhacodes (Arch. Microbiol. (2001)176:178-186 Although enzymes have been reported for the hydroxyl group at the 2nd and / or 3rd positions of glucose, these enzymes target the hydroxyl group at the 2nd and / or 3rd positions of glucose. They oxidize maltose and both have high activity against glucose but low selectivity against glucose. Also, Burkholderia cepacia, which also has a high effect on maltose, Although coenzyme-bound glucose dehydrogenase derived from ia cepacia is also known, this is the original The natural enzyme is a heterooligomeric enzyme composed of three subunits: α, β, and γ, which binds to the membrane. It is known as a synthetic enzyme. Therefore, solubilization treatment was necessary to obtain the enzyme. Therefore, in order to express sufficient activity through cloning, the necessary subunits must be cloned simultaneously. There were challenges such as the need for training.
[0009] In contrast, the present inventors have developed a novel soluble enzyme that uses FAD as a coenzyme and is not membrane-bound. Coenzyme-bound glucose dehydrogenase is purified from Aspergillus teleus (special Patent Document 1). The coenzyme-bound glucose dehydrogenase of this Patent Document 1 oxidizes the hydroxyl group at the 1-position of glucose, has excellent substrate recognition for glucose, is not affected by dissolved oxygen, and has low reactivity with maltose (when the activity against glucose is 100%, the activity against maltose is 5% or less, and the activity against galactose is also 5% or less), which is an excellent property that has never existed before.
[0010] However, the coenzyme-bound glucose dehydrogenase of this Patent Document 1 is isolated and extracted from a liquid culture of wild microorganisms (such as microorganisms belonging to the genus Aspergillus), and there is a limit to its production amount. In addition, the amount of enzyme produced is extremely small, and a large amount of sugar binds to the enzyme, covering it with a different type of sugar from the N-type and O-type sugar chains that usually bind to enzymes, resulting in a form that can be called a "sugar-embedded enzyme", making it difficult to detect its activity ( low enzyme activity), inability to remove sugar chains enzymatically or chemically, and as a result, in electrophoresis, it is hardly stained by normal protein staining (such as by Coomassie Brilliant Blue G-250), and it is difficult to decode the amino-terminal and internal amino acid sequences of the enzyme, which are the information necessary for gene acquisition, from normal purified enzymes. There is no known case where the cloning of the enzyme gene was successful and the expression of this enzyme activity was confirmed.
[0011] On the other hand, regarding the coenzyme-bound glucose dehydrogenase derived from Aspergillus oryzae, its existence was suggested in 1967 (Non-Patent Document 1), but only partially enzymatic properties were clarified, and although the property of not acting on maltose was suggested, Subsequently, it was the coenzyme-bound glucose dehydrogenase derived from Aspergillus oryzae Regarding detailed reports on it, as well as coenzyme-bound glucose dehydrogenases derived from other microorganisms Regarding the enzyme that oxidizes the hydroxyl group at the 1-position of glucose, there has been no follow-up report, and there has been no report at all on the amino acid sequence and gene of coenzyme-bound glucose dehydrogenase.
[0012] Also, the idea of using glucose dehydrogenase EC 1.1.99.10 for glucose measurement was known (see Patent Document 2), but FAD-bound glucose dehydrogenase has never been produced at a practical level and has not been actually used in a sensor and commercialized. The reason is that the activity of this enzyme in the cells is weak, and even when secreted outside the cells, the amount is extremely small and is covered by a large amount of sugar, resulting in weak activity and difficulty in detection, so it is speculated that the gene could not be cloned.
[0013]
Patent Document 1
Patent Document 2
[0014]
Non-Patent Document 1
Summary of the Invention
Problems to be Solved by the Invention
[0015] Regarding genetic engineering methods for the modification of PQQ-bound glucose dehydrogenase, many techniques are already known. These prior techniques mainly focus on the low substrate specificity and stability of the enzyme A modified version to improve upon the shortcomings of conventional PQQ-bound glucose dehydrogenases, such as their low performance. PQQ-bound glucose dehydrogenase and modified genes for creating it through genetic engineering. We are supplying the materials.
[0016] However, modified PQQ-bound glucose desorbed cells created using modified gene material In the case of hydrogen enzymes, the malt enzyme is still considered to have 100% activity on glucose. The activity towards maltose is generally higher than 10%, or the reactivity to maltose is low. As a result, even the original reactivity to glucose (specific activity) decreases, and the substrate is not sufficient. When the activity is observed using electrochemical measurement methods under the given quantity conditions, its function as a glucose sensor is insufficient. In reality, it has not yet been used in POCT devices, etc. Furthermore, PQQ-bound gluco - The coenzyme PQQ, which is necessary for the expression of dehydrogenase activity, is widely used as a recombinant host. It is not produced in E. coli, and is limited to host microorganisms that produce PQQ (such as Pseudomonas). There was also the problem of having to create recombinant organisms.
[0017] Therefore, the present invention solves the above problems and improves reactivity to glucose, thermal stability, and substrate recognition. FAD bonds possess excellent recognition properties and low activity on maltose, making them superior in their characteristics. A novel gene (polynucleotide) encoding a type glucose dehydrogenase, and said gene A method for producing the enzyme using recombinant transformed cells, and a method for using the obtained enzyme. A method for measuring glucose, a glucose measuring reagent composition, and glucose The objective is to provide biosensors and the like for measuring [unclear]. [Means for solving the problem]
[0018] The inventors of this invention have diligently researched and found that Aspergillus oryzae (Asperg In the *Illus oryzae* strain, for FAD-binding glucose dehydrogenase to be significantly expressed, The polypeptide encoded by that gene must contain the amino acid sequence (AGVPWV). It was found to be essential, and furthermore, if at least one of these amino acids is missing, it becomes active. Having confirmed that the properties are substantially lost, the present invention was completed. That is, the present invention is in the following embodiments. It is related to this.
[0019] [Aspect 1] Amino acid sequence: X1-X2-X3-X4-X5-X6 (X1 and X2 are aliphatic amino acids, X3 and X6 are branched amino acids, and X4 and X5 FAD-linked polypeptides containing heterocyclic amino acids or aromatic amino acids A polynucleotide that codes for glucose dehydrogenase. [Aspect 2] Polynucleotides encoding the polypeptides (a), (b), or (c) below D: (a) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 1, (b) In the amino acid sequence of (a), one to several amino acids are substituted or deleted. Alternatively, it consists of an added amino acid sequence and has FAD-binding glucose dehydrogenase activity. Lipeptide, or (c) Consists of an amino acid sequence having 70% or more homology to amino acid sequence (a), Polypeptides possessing FAD-bound glucose dehydrogenase activity. [Aspect 3] The following polynucleotides (d), (e), or (f): (d) Polynucleotides containing the base sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3, (e) Polynucleotides consisting of a base sequence (d) and polynucleotides consisting of a complementary base sequence It hybridizes with ocides under stringent conditions, and also removes FAD-bound glucose. Polynucleotides encoding polypeptides having hydrogenase activity, or (f) A base sequence having 70% or more homology to a polynucleotide consisting of the base sequence (d) Encoding a polypeptide that contains and has FAD-bound glucose dehydrogenase activity. Polynucleotide. [Aspect 4] Amino acid sequence: A sense primer consisting of a nucleotide sequence encoding AGVPWV and FAD-bound glucose dehydrogenase derived from Aspergillus oryzae A reverse primer consisting of the 3' terminal base sequence of the encoding polynucleotide, or , amino acid sequence: antisense primers and as for the base sequence encoding AGVPWV FAD-bound glucose dehydrogenase derived from Aspergillus oryzae A combination of forward primers consisting of the 5' terminal base sequence of the polynucleotide to be routed. FAD-bound glucose detachment having DNA fragments that can be amplified by PCR using combination A polynucleotide encoding a polypeptide with hydrogenase activity. [Aspect 5] Amino acid sequence: A probe and stringer consisting of a base sequence encoding AGVPWV It hybridizes under optimal conditions and possesses FAD-bound glucose dehydrogenase activity. A polynucleotide that codes for a polypeptide. [Aspect 6] When the enzyme activity value for D-glucose is set to 100%, the enzyme activity value for maltose The enzyme activity value for D-galactose must be 10% or less, and the enzyme activity value for D-galactose must be 5% or less. A FAD-binding glucose derived from Aspergillus oryzae, characterized by the following features. A polynucleotide that codes for coarse dehydrogenase. [Aspect 7] Aspergillus, characterized by having an enzyme activity of 300 U / mg or more. Polyenzyme encoding FAD-binding glucose dehydrogenase derived from Aspergillus oryzae nucleotide. [Aspect 8] A recombinant vector having the above-mentioned polynucleotide. [Aspect 9] Transformed cells created using the recombinant vector described above. [Aspect 10] The transformed cells described above are cultured, and glucose is dehydrogenated from the culture obtained. This method involves collecting FAD-bound glucose dehydrogenase that has the effect of [doing something]. A method for producing lucose dehydrogenase. [Aspect 11] Recombinant FAD-conjugated glyconucleotide encoded by the polynucleotide described above Dehydrogenase. [Aspect 12] A feature characterized by using the above-mentioned FAD-bound glucose dehydrogenase. Measurement method. [Aspect 13] A gluco characterized by containing the above-mentioned FAD-bound glucose dehydrogenase. - Measuring reagent composition. [Aspect 14] A glucose dehydrogenase characterized by using the above-mentioned FAD-bound glucose dehydrogenase. A biosensor for measuring [condition]. [Effects of the Invention]
[0020] By utilizing the polynucleotide of the present invention, excellent substrate recognition for glucose is achieved. Furthermore, FAD-bound gluco has the excellent characteristic of having low activity against maltose. - Dehydrogenase can be produced homogeneously and in large quantities, for example, by genetic engineering. It becomes Noh. Furthermore, the enzyme produced in this way is problematic in FAD-bound glucose dehydrogenase. Because the amount of sugar can be controlled according to the purpose, enzymes with reduced sugar content can be prepared. Therefore, in blood glucose measurement and other applications, it is possible to change the action on sugars (such as glucose) in the sample. It is also possible. [Brief explanation of the drawing]
[0021] [Figure 1] A calibration curve for glucose concentration using enzyme-immobilized electrodes is shown. [Figure 2] The results of detecting the target gene by PCR are shown. The symbols in the figure are as follows: M: 200bp DNA ladder marker (Takara Bio Inc.) 1: Aspergillus oryzae NBRC4268 2: Aspergillus oryzae NBRC5375 3: Aspergillus oryzae NBRC6215 4: Aspergillus oryzae NBRC4181 5: Aspergillus oryzae NBRC4220 6: Aspergillus oryzae NBRC100959 [Figure 3] The results of detecting the target gene by Southern hybridization are shown. The symbols in the figure are the same as in Figure 2. [Modes for carrying out the invention]
[0022] In the FAD-bound glucose dehydrogenase of the present invention, the amino acid sequence is: X1-X2-X3-X4-X5-X6 (X1 and X2 are the same or different aliphatic amino acids, X3 and X6 are the same or different) Different branched amino acids, and X4 and X5 are the same or different heterocyclic amino acids. (where indicates aromatic amino acids), that is, a polypeptide consisting of 6 amino acids. This is one of the technically important points, and for this reason, the enzyme is significantly expressed within the bacterial cell. Furthermore, the expressed enzyme does not necessarily need to be secreted outside the bacterial cell; it may remain inside the cell. In contrast, as specifically shown in the examples herein, the homology of the entire amino acid sequence Even if the gene codes for an enzyme that is thought to be FAD-binding glucose dehydrogenase, Genes that do not encode polypeptides consisting of the amino acid sequence are FAD-conjugated glyco It does not express proteins that possess dehydrogenase activity.
[0023] The above six amino acid sequences are preferably poly(FAD-bound glucose dehydrogenase). The peptide is located at positions 202-207, or at least one of X1-X6 is such that X1 is Ranine (A), X2 is glycine (G), X3 is valine (V), X4 is proline (P), and X5 is trypto Fan (W) or X6 is valine (V). For example, a preferred example is the amino acid sequence AGVPWV (sequence code 4) can be cited.
[0024] In this invention, "FAD-bound glucose dehydrogenase" refers to a enzyme that, in the presence of an electron acceptor, It catalyzes the dehydrogenation (oxidation) of the hydroxyl group at position 1 of glucose, and its action on glucose is controlled by... This refers to a soluble protein whose activity on maltose is 10% or less, and the enzyme is as follows: It is characterized by its properties. 1) Using flavin adenine dinucleotide (FAD) as a coenzyme, 2) Not using oxygen as an electron acceptor, 3) Its activity on maltose is 10% or less compared to its activity on glucose.
[0025] Among the FAD-bound glucose dehydrogenases of the present invention, those having the amino acid sequence: AGVPWV In particular, those derived from Aspergillus oryzae are preferred. Representative strains include NBRC5375 and NBRC, as shown in Table 1 below. 4079 shares, NBRC4203 shares, NBRC4214 shares, NBRC4268 shares, NBRC 5238 shares, NBRC6215 shares, NBRC30104 shares, and NBRC30113 shares Examples include: Amino acid sequence: AGVPWV is an amino acid sequence of the enzyme, The 202nd to 207th amino acids (NBRC5) when the starting amino acid M of the Gunal sequence is considered as the 1st amino acid. (In the vicinity of strain 375) (or in the location corresponding to the enzyme source from other strains) It is included.
[0026] For example, the Aspergillus oryzae strain NBRC5375 expresses The amino acid sequence of FAD-binding glucose dehydrogenase is sequence number 1 (which contains the signal peptide). (m), the base sequence of the chromosomal DNA that codes for it is shown in SEQ ID NO: 2, and also in SEQ ID NO: 1. The cDNA corresponding to each amino acid is shown in SEQ ID NO: 3. The amino acid sequence: The base sequence encoding AGVPWV is GCTGGTGTTCCATGGGTT (SEQ ID NO: 5) That is the case.
[0027] Therefore, the polynucleotide of the present invention is Aspergillus oryzae In addition to the above derived from the strain of ) the following polypeptides (a), (b), or (c) Polynucleotides that encode: (a) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 1, (b) In the amino acid sequence (a), one to several amino acids are substituted, deleted, or added. A polypeptide consisting of an amino acid sequence and possessing FAD-bound glucose dehydrogenase activity, teeth (c) Consists of an amino acid sequence having 70% or more homology to amino acid sequence (a), This includes polypeptides that possess FAD-bound glucose dehydrogenase activity.
[0028] Furthermore, the polynucleotide of the present invention contains the following polynucleotides: (d), (e), or (f) Ochido: (d) Polynucleotides containing the base sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3, (e) Polynucleotides consisting of a base sequence (d) and polynucleotides consisting of a complementary base sequence It hybridizes under oxygen and stringent conditions, and also dehydrates FAD-bound glucose. Polynucleotides encoding polypeptides having enzymatic activity, or (f) A base sequence having 70% or more homology to a polynucleotide consisting of the base sequence (d) Encoding a polypeptide that contains and has FAD-bound glucose dehydrogenase activity. It contains polynucleotides.
[0029] In particular, the polypeptide of (b) or (c) above has the above amino acid sequence: X1-X2-X3-X4-X5-X Those containing 6, or the polynucleotide of (e) or (f) encoding the amino acid sequence It is preferable that the base sequence contains the following. Furthermore, it is preferable that the amino acid sequence is AGVPWV. stomach.
[0030] In this specification, an amino acid sequence or base sequence having 70% or more homology means, respectively It exhibits at least 70% identity across the entire length of the reference sequence being compared, preferably 75% or more, more preferably 80% or more, even more preferably 90% or more, particularly preferred This refers to sequences that have 95% or more identity. The identity percentage of such sequences This refers to publicly available or commercially available software that has an algorithm for comparing a reference sequence with a query sequence. It can be calculated using software. For example, BLAST, FASTA, or G You can use ENETYX (manufactured by Software Development Co., Ltd.), and these are the default. It can be used with the `Lute` parameter.
[0031] Furthermore, the polynucleotide of the present invention is derived from the base sequence encoding the amino acid sequence: AGVPWV A sense primer and FAD derived from Aspergillus oryzae. From the 3' end of the polynucleotide encoding combined glucose dehydrogenase A reverse primer, or an amino acid sequence: an amino acid sequence corresponding to the base sequence encoding AGVPWV Chisen primer and FAD binding derived from Aspergillus oryzae. It is derived from the 5' terminal base sequence of the polynucleotide that codes for type glucose dehydrogenase. DNA fragments that can be amplified by PCR using a combination of forward primers Polynucleate encoding polypeptides that possess FAD-binding glucose dehydrogenase activity. Contains leotide.
[0032] Alternatively, the polynucleotide of the present invention is a base sequence that encodes the amino acid sequence: AGVPWV The probe is hybridized under stringent conditions, and the FAD-bound group is formed. It contains a polynucleotide encoding a polypeptide having coarse dehydrogenase activity.
[0033] Preferably, the base sequence encoding the amino acid sequence:AGVPWV is (GCTGGTGTTCCATGGGTT) Yes. Also, various methods regarding the above PCR and hybridization under stringent conditions. The conditions can be appropriately selected by those skilled in the art in accordance with the descriptions of the examples herein.
[0034] Furthermore, the polynucleotide of the present invention has an enzymatic activity value of 100% for D-glucose. In this case, the enzyme activity value for maltose should be 10% or less, preferably 5% or less, more preferably The enzyme activity value for D-galactose is 3% or less, and preferably 5% or less. FAD-bound glucoglyceride, which is 3% or less, more preferably 2% or less, and even more preferably 1% or less. - A polynucleotide encoding a dehydrogenase, or a protein with a specific activity of 300 U / mg or higher, preferably 500 U / mg or higher, more preferably 1,000 U / mg or higher It contains a polynucleotide encoding a FAD-bound glucose dehydrogenase with the enzymatic activity of the following: It is possible. Furthermore, "specific activity per protein" here refers, for example, to Example 7 of this specification. As described above, the culture supernatant was concentrated and confirmed as a single band by SDS-PAGE. It was measured at [location / location].
[0035] Furthermore, in this invention, "polynucleotide" refers to a purine or pyrimidine that has β-N- Glycosidic nucleoside phosphate ester (ATP (adenosine triphosphate), G TP (Guanosine Triphosphate), CTP (Cytidine Triphosphate), UTP (Uridine Triphosphate) ); or dATP (deoxyadenosine triphosphate), dGTP (deoxyguanosine triphosphate) dCTP (deoxycytidine triphosphate), dTTP (deoxythymidine triphosphate) This refers to a molecule in which 100 or more )) are linked, specifically FAD-bound glucose dehydrogenase. Encoding chromosomal DNA, mRNA transcribed from chromosomal DNA, and synthesized from mRNA It contains cDNA and polynucleotides amplified by PCR using them as templates. A "nucleotide" is a molecule consisting of 2 to 99 nucleotides linked together. " is a group of 30 molecules linked to each other by amide bonds (peptide bonds) or non-natural residue linkages. This refers to molecules composed of one or more amino acid residues, and furthermore, molecules to which sugar chains are attached. This includes natural materials and those that have been artificially chemically modified.
[0036] The most specific embodiment of the polynucleotide (gene) of the present invention is Sequence ID No. 2 or Sequence ID No. It is a polynucleotide containing the sequence of 3 bases. It is chromosomal DNA, exemplified by Sequence ID No. 2. Polynucleotides are, for example, derived from the chromosome of Aspergillus oryzae NBRC5375 strain. Prepare a DNA library and obtain FAD derived from Aspergillus teleus as described in Patent Document 1. The amino acids of the N-terminus and internal sequence of conjugated glucose dehydrogenase are determined by methods such as the Edman method. The amino acid sequence obtained by this process, and the "Genome Analysis Project for Aspergillus oryzae" As a result of this project, DOGAN (Database of the Genomes Analyzed at NITE) was launched in January 2006. Aspergillus (published on the website http: / / www.bio.nite.go.jp / dogan / Top) Multiple oligonucleotides created based on the genome sequence information of Oryzae (NBRC100959 strain) The above chromosomal DNA library is obtained by a method known to those skilled in the art using a creotide probe. It can be obtained by screening.
[0037] The probe may be labeled by any method known to those skilled in the art, for example, by radioisotopes (RI). This can be done by radioisotope or non-RI method, but the non-RI method is preferred. Methods include fluorescent labeling, biotin labeling, and chemiluminescence, but fluorescent labeling is... It is preferable to use a fluorescent substance that can bind to the base portion of the oligonucleotide. While various materials can be selected and used as appropriate, cyanine dyes (e.g., Cy Dye™) are also available. Series Cy3, Cy5, etc., Rhodamine 6G reagent, N-acetoxy-N2-acetyl Minofluorene (AAF), AAIF (an iodine derivative of AAF), etc. can be used. Cut.
[0038] Alternatively, polynucleotides, such as cDNA represented by Sequence ID No. 3, are, for example, as described in this specification. As specifically described in the examples in the book, using a cDNA library as a template, Using the prepared set of oligonucleotide primers (probes), each known to those skilled in the art Extracted by seed PCR or from Aspergillus oryzae strain NBRC5375 It can also be obtained by RT-PCR using total RNA or mRNA as a template. When designing primers, the size (number of base pairs) of the primer should be considered in relation to the template DNA. Considering the need to satisfy specific annealing, 15-40 bases, preferably 15-30 It is a base. However, when performing LA (long and accurate) PCR At least 30 bases is efficient. Sense strand (5' end) and antisense strand (3' end). A pair of primers (two of them) consisting of the end surfaces will not anneal to each other. Avoid complementary sequences between primers. Furthermore, ensure stable binding to the template DNA. To maintain this, the GC content is set to approximately 50%, and within the primer, GC-rich or AT- Ensure that the richness is not unevenly distributed. The annealing temperature is Tm (melting temperature). Because they are dependent, to obtain highly specific PCR products, the Tm values are approximated at 55-65°C. Select the appropriate primer. Also, the final concentration of the primer used in PCR should be approximately 0.1 It is also necessary to take care to adjust the concentration to approximately 1 μM. Commercially available software for this purpose, such as Oligo™ [National Bioscience Inc. (USA)] Software such as [manufactured by] GENETYX (manufactured by Software Development Co., Ltd.) can also be used.
[0039] Furthermore, these oligonucleotide probes and oligonucleotide primer sets are For example, the cDNA, which is a polynucleotide of the present invention, is prepared by cutting it with an appropriate restriction enzyme. It is also possible.
[0040] Furthermore, the polynucleotide of the present invention is, for example, the Aspergillus oryzae NBRC5 mentioned above. FAD-binding glucose dehydrogenase cDNA derived from strain 375 was used in a known mutation It can be created by modifying it using methods such as the introduction method or the mutation introduction PCR method. Furthermore, NBRC53 Chromosomal DNA or cDNA library of Aspergillus oryzae strains other than the 75 strains. Then, use an oligonucleotide created based on the nucleotide sequence information of Sequence ID No. 1. It can be obtained by probe hybridization. During the process, by varying the stringing conditions, the above polynucleotide can be produced. Otid can be obtained. The stringent conditions are hybridization and Depending on the salt concentration, organic solvent (formaldehyde, etc.) concentration, temperature conditions, etc. during the washing process As defined and disclosed, for example, in U.S. Patent No. 6,100,037, etc., by those skilled in the art Various well-known conditions can be adopted.
[0041] Furthermore, see the literature (e.g., Carruthers (1982) Cold Spring Harbor Symp. Quant. Biol. 47:411) -418;Adams(1983)J. Am. Chem. Soc. 105:661;Belousov(1997)Nucleic Acid Res. 25:34 40-3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994) Biochemist ry 33:7886-7896; Narang(1979)Meth. Enzymol. 68:90;Brown(1979)Meth. Enzymol. 68:1 09; Beaucage (1981) Tetra. Lett. 22:1859; U.S. Patent No. 4,458,066) The polynucleotides of the present invention are synthesized in vitro using well-known chemical synthesis techniques. It is possible.
[0042] The recombinant vector of the present invention is a cloning vector or an expression vector, and insert The appropriate type of polynucleotide should be used depending on the type of polynucleotide and its intended use. For example, using cDNA or its ORF region as an insert in FAD-bound glucose dehydrogenation When producing the element, an expression vector for in vitro transcription is used, as well as cells such as E. coli and Bacillus subtilis. In each of the following types of cells: prokaryotic cells, filamentous fungi such as yeast and mold, insect cells, mammalian cells, etc. A suitable expression vector can also be used.
[0043] Examples of transformed cells in this invention include prokaryotic cells such as Escherichia coli and Bacillus subtilis, as well as yeast and fungi. Eukaryotic cells such as insect cells and mammalian cells can be used. Cells are identified using methods such as electroporation, calcium phosphate spectroscopy, liposome spectroscopy, and DEAE dextran spectroscopy. It can be prepared by introducing recombinant vectors into cells using the appropriate methods. As specific examples of recombinant vectors and transformed cells, the recombinant vectors shown in the following examples and Examples include transformed E. coli and transformed fungi using this vector.
[0044] The FAD-bound glucose dehydrogenase of the present invention is expressed in DNA in microorganisms such as E. coli. For production, the origin, promoter, and ribosome binding site must be replicable within the microorganism. An expression vector having a position, DNA cloning site, terminator sequence, etc. contains the aforementioned poly Create an expression vector with recombinant nucleotides and transform host cells with this expression vector. Afterward, culturing the resulting transformants will allow the microorganism to produce FAD-bound glucose dehydrogenase. This allows for mass production. In this process, start codons and stop codons are placed before and after any translation region. By adding and expressing the molecule, a FAD-bound glucose dehydrogenase fragment containing any desired region can be obtained. It is also possible to express it as a fusion protein with other proteins. The fusion protein can also be cleaved with a suitable protease to obtain the desired FAD-bound glucose. Coarse dehydrogenase can be obtained. For expression vectors for E. coli, the pUC system is available. pBluescriptII, pET expression system, pGEX expression system, pCold Expression systems can be used as examples.
[0045] Alternatively, if you express and produce FAD-binding glucose dehydrogenase in eukaryotic cells... The polynucleotide is used as a promoter, splice region, poly(A) addition site, etc. A recombinant vector is created by inserting it into an expression vector for eukaryotic cells and introducing it into eukaryotic cells. This allows eukaryotic cells to produce FAD-bound glucose dehydrogenase. It can be maintained within the cell in a state like this, or it can be maintained by incorporating it into the chromosome. It is also possible to express pKA1, pCDM8, pSVK3, pSVL, p Examples include BK-CMV, pBK-RSV, EBV vectors, pRS, and pYE82. Also, pIND / V5-His, pFLAG-CMV-2, pEGFP-N1, pEGFP- If you use an expression vector such as C1, various tags such as His tag, FLAG tag, and GFP can be expressed. A fusion protein with the addition of 'g' expresses a FAD-bound glucose dehydrogenase polypeptide. It is also possible to do so. Examples of eukaryotic cells include monkey kidney cells (COS-7) and Chinese hamster cells. Mammalian cultured cells such as ovarian cells (CHO), budding yeast, fission yeast, fungi, silkworm cells, Af While Clawed frog egg cells are commonly used, they produce FAD-bound glucose dehydrogenase. Any eukaryotic cell will do, as long as it can express the gene. The expression vector is introduced into the eukaryotic cell. These include electroporation, calcium phosphate lithography, liposome lithography, DEAE dextran lithography, and public Methods of knowledge can be used.
[0046] In particular, the FAD-conjugated gluten of the present invention derived from Aspergillus oryzae A recombinant vector containing a polynucleotide encoding cosal dehydrogenase, Self-cloning of the Spergillus oryzae strain is preferred for transformation.
[0047] After expressing FAD-bound glucose dehydrogenase in prokaryotic or eukaryotic cells, the culture (bacterial cells) The target protein is isolated from a culture medium, culture medium composition, etc., containing enzymes secreted outside the bacterial cell. Purification can be carried out by combining known separation operations. For example, urea. Treatment with denaturants or surfactants, heat treatment, pH treatment, ultrasonic treatment, enzymatic digestion, salting out or dissolution Precipitation method, dialysis, centrifugation, ultrafiltration, gel filtration, SDS-PAGE, isoelectric focusing, Ion exchange chromatography, hydrophobic chromatography, reversed-phase chromatography, Affinity chromatography (methods utilizing tag sequences and FAD coenzyme-bound glucose) This also includes methods using polyclonal and monoclonal antibodies specific to coarse dehydrogenase. Examples include (m), etc.
[0048] Furthermore, the FAD-bound glucose dehydrogenase of the present invention is a polynucleotide (cDNA or It can be obtained by recombinant DNA technology using that translation region. RNA is prepared from a vector containing tides by in vitro transcription, and this is used as a template. By performing in vitro translation, FAD-bound glucose dehydration can be achieved in vitro. It is possible to create elementary enzymes. Furthermore, polynucleotides can be expressed using known methods to achieve appropriate expression levels. If recombined into a chromosome, it can be used to recompose prokaryotic cells such as E. coli and Bacillus subtilis, as well as yeast, fungi, insect cells, and mammals. In eukaryotic cells such as cellular cells, polynucleotide-encoded FAD-bound glucose dehydrogenase It can express a large amount of the element. Also, in response to the host, although the amino acid sequence is the same, You may also introduce polynucleotides optimized for Don You Sage. Furthermore, the essential and unnecessary glycans... Depending on the need for other peptide modifications, the host can be selected as appropriate.
[0049] When producing FAD-bound glucose dehydrogenase by in vitro expression, The polynucleotides described above are used in a vector having a promoter to which RNA polymerase can bind. - Insert into the RNA corresponding to the promoter to create a recombinant vector, and this vector is then used with the RNA. In vitro translation of polymerase-containing rabbit reticulocyte lysates and wheat germ extracts When added to the translation system, it is possible to produce FAD-bound glucose dehydrogenase in vitro. Yes, it is possible. Promoters that RNA polymerase can bind to include T3, T7, and SP6. Examples include pKA1 and pCDM8, which contain these promoters. Examples include pT3 / T718, pT7 / 319, and pBluescriptII.
[0050] The recombinant FAD-bound glucose dehydrogenase of the present invention is produced by the method described above. This can be done. Such FAD-bound glucose dehydrogenases can produce glucose in the presence of an electron acceptor. Since it is an enzyme that catalyzes the dehydrogenation reaction of -, there are applications where the changes resulting from this reaction can be utilized. If so, there are no particular restrictions. For example, the measurement and measurement of glucose in a sample containing biological material. It can be used in medical and clinical fields, such as in fixed reagents and elimination reagents, and fermentation It can also be used in the production of substances using elementary-bonded glucose dehydrogenase.
[0051] The glucose measurement reagent composition of the present invention may be mixed together to form a single reagent, and may also be used in conjunction with other reagents. If there are components that interfere with each other, the components may be divided into appropriate combinations. Furthermore, these may be prepared as solution or powder reagents, and these may also be used It is contained in a suitable support such as filter paper or film and used as test paper or analytical film. It may also be prepared by using a standard containing a protein remover such as perchloric acid or a glucose quantifier. Reagents may be provided. The amount of enzyme in this composition is approximately 0.1 to 50 units per sample. Preferred. Samples for quantifying glucose include, for example, plasma, serum, cerebrospinal fluid, saliva, urine, etc. These are some examples.
[0052] The biosensor of the present invention contains the FAD-bound glucose dehydrogenase of the present invention as an enzyme. This is a glucose sensor used in the reaction layer to measure the glucose concentration in the sample solution. Using methods such as screen printing on an insulating substrate, the working electrode, its counter electrode, and the reference electrode are formed from An electrode system is formed, and a hydrophilic polymer, an oxidoreductase, and an electron acceptor are placed in contact with this electrode system. It is produced by forming an enzyme reaction layer containing on this biosensor. When a sample solution containing the substrate is dropped onto it, the enzyme reaction layer dissolves and the enzyme and substrate react, and The electron acceptor is then reduced. After the enzymatic reaction is complete, the reduced electron acceptor is electrochemically reduced. The sample is oxidized, and at this time, the biosensor determines the substrate concentration in the sample solution from the obtained oxidation current value. It is possible to measure this. In addition, it is possible to detect other things such as color intensity or pH changes. A biosensor using this method can also be constructed.
[0053] As electron acceptors for biosensors, chemical substances with excellent electron transfer capabilities can be used. Chemical substances with excellent electron transfer capabilities are generally called "electron carriers" or "mediators." Alternatively, these are chemical substances called "oxidation-reduction mediators," and these are chemical substances that fall under this category. For example, electron carriers and oxidation-reduction mediators listed in Japanese Patent Publication No. 2002-526759. You may use the following: Specifically, osmium compounds, quinone compounds, and ferricyanine compounds. These are some examples.
[0054] In measuring the activity of FAD-bound glucose dehydrogenase, the enzyme is preferably measured at the final concentration. Dilute as appropriate to achieve a concentration of 0.1 to 1.0 units / mL before use. Note that the enzyme activity of the enzyme... The enzyme unit is the enzyme activity that oxidizes 1 μmol of glucose per minute. The enzyme activity of the FAD-bound glucose dehydrogenase can be measured by the following method.
[0055] [Method for measuring enzyme activity] 1.0 mL of 0.1 M potassium phosphate buffer (pH 7.0), 1.0 M D-glucose 1.0 mL, 3 mM 2,6-dichlorophenolindophenol (hereinafter referred to as DCIP) (u) 0.14 mL, 3 mM 1-Methoxy-5-methylphenadium methylsulfate Add 0.2 mL of the solution and 0.61 mL of water to a 3 mL quartz cell (optical path length 1 cm) and heat in a constant temperature cell holder. After setting in a spectrophotometer with a dash and incubating at 37°C for 5 minutes, the enzyme solution 0.05 ml After adding L, measure the absorbance change (ΔABS / min) of DCIP at 600 nm. The molar extinction coefficient of DCIP at pH 7.0 is 16.3 × 10⁻⁶. 3 cm -1 M -1 And, 1 minute The enzyme activity required to reduce 1 μmol of DCIP in between is substantially equivalent to 1 unit of that enzyme activity. Therefore, the enzyme activity was determined from the change in absorbance according to the following formula.
[0056]
number
[0057] In measuring the protein concentration of this enzyme, the enzyme is preferably measured at a final concentration of 0.2 to 0.9 Dilute as appropriate to achieve a concentration of mg / mL before use. The protein concentration in this invention is determined by Japan Ba Bio-Rad Pr, a protein concentration measurement kit available from Io-Rad Co., Ltd. Using the otein assay, follow the instructions for use and add bovine serum albumin (BSA, Wako). The result is obtained by converting from a calibration curve created using a standard substance (manufactured by Junyaku Kogyo Co., Ltd., for biochemical use). It is possible.
[0058] Furthermore, the various techniques used to implement this invention are, in particular, techniques whose sources are clearly indicated, except for those mentioned above. Therefore, it can be easily and reliably implemented by a person skilled in the art based on publicly available literature, etc. For example Genetic engineering and molecular biological techniques are used by Sambrook and Maniatis, in Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989; Ausubel, FM et al., Current Protocols in Molecular Biology, John Wiley & Sons, New Yo The methods described in rk, NY, 1995, etc., or the methods described in the cited literature, or therein It can be implemented based on substantially similar methods or modifications. Furthermore, the terminology used in this invention is Basically, it is based on the IUPAC-IUB Commission on Biochemical Nomenclature, and This is based on the meaning of terms commonly used in that field.
[0059] The present invention will be described in more detail below with reference to examples. The technical scope of the present invention is limited to these. This is not limited in any way by the statements made herein. Furthermore, the statements made in the references cited herein The content described herein constitutes part of the disclosures herein. [Examples]
[0060] (Presumed to be FAD-bound glucose dehydrogenase derived from Aspergillus oryzae strain NBRC5375) Cloning of genes into E. coli) (1) Bacterial cell culture Glucose (manufactured by Nakalai) 1% (W / V), Defatted soybeans (manufactured by Showa Sangyo Co., Ltd.) 2% (W / V) ), Corn steep liquor (manufactured by Sanei Sugar Refining Co., Ltd.) 0.5% (W / V), Magnesium sulfate Prepare a liquid culture medium consisting of 0.1% (W / V) of 700-700 hydrate (manufactured by Nakarai) and water, and adjust the pH to 6.0. Prepare the solution, transfer 100 mL to a 500 mL Sakaguchi flask, and autocrate at 121°C for 20 minutes. I added Aspergillus oryzae to this cooled liquid culture medium. After inoculating with the NBRC5375 strain and incubating with shaking at 28°C for 48 hours, the results were obtained using a centrifuge. 15.5g of wet bacterial cells were recovered. (2) Activation of FAD-bound glucose dehydrogenase in Aspergillus oryzae strain NBRC5375 gender confirmation (1) The bacterial cells obtained in (1) are suspended in 50 mM potassium phosphate buffer (pH 7.5) and sea sand After grinding the bacterial cells using B (manufactured by Nakarai), the supernatant was collected by centrifugation to obtain a cell-free extract. . According to the enzyme activity measurement method described above, the FAD-bound glucose dehydrogenase activity of the cell-free extract was measured. Upon examination, it was found that the cell-free extract contained 0.0043 U / mL of FAD-bound glucose desorption. Hydrogen enzyme activity was confirmed. (3) Isolation of total RNA (1) Of the bacterial cells obtained, 0.31 g of wet bacterial cells were frozen with liquid nitrogen and then crushed. Total RNA was extracted using ISOGEN (manufactured by Nippon Gene Co., Ltd.). (4) RT-PCR Using the TaKaRa RNA LA PCR Kit (AMV) Ver.1.1 (manufactured by Takara Bio), RT was performed under the following conditions. -PCR was performed to identify a gene presumed to be FAD-bound glucose dehydrogenase, approximately 1.8 kbp in length. A PCR product containing [the specified substance] was obtained. Template: (3) Total RNA extracted Primer: Primer 1: 5'-tgggatcctatgctcttctcactggcat-3' (SEQ ID NO: 6) Primer 2: 5'-gccaagcttctaagcactcttcgcatcctccttaatcaagtc-3' (SEQ ID NO: 7) Furthermore, primers 1 and 2 are from the above-mentioned DOGAN (Database of the Genomes Analyzed at NIT E) Asperger's (available on the website http: / / www.bio.nite.go.jp / dogan / Top) Genetic analysis results of Russ oryzae strain NBRC100959: AO090005000449 It was synthesized based on the base sequence of (presumably "choline dehydrogenase"). The reason is the FAD-binding type of Aspergillus teleus discovered by the inventors. Based on the base sequence information of the cos dehydrogenase gene, the above AO090005000449 is cos It's not the phosphate dehydrogenase gene, but rather the FAD-bound glucose dehydrogenase gene of Aspergillus oryzae. This was because it was suspected to be an enzyme gene. Reaction conditions: Reverse transcription reaction at 42°C for 30 minutes (1 cycle) Denaturation at 99°C for 5 minutes (1 cycle) Cooling to 5°C for 5 minutes (1 cycle) Denaturation at 94°C for 2 minutes (1 cycle) Denaturation 94°C, 30 seconds; Annealing 45°C, 30 seconds; Extension reaction 72°C, 1 minute 30 seconds (25 cycle) Extension reaction: 72°C, 5 minutes (1 cycle) (5) Preparation of a plasmid containing a gene presumed to be FAD-binding glucose dehydrogenase (4) The PCR amplification fragment obtained in the previous step was cleaved with restriction enzymes BamHI and HindIII, and the same process Enzyme-treated pUC18 vector (Takara Bio Inc.) Ligation was performed using (Takara Bio Co., Ltd.) and the FAD-bound glucose dehydrogenase was then evaluated. Plasmids containing the target gene were prepared. (6) Preparation of transformed organisms (5) Plasmid obtained in E. coli JM109 Competent Cell The transformation was performed by introducing it into L (manufactured by Takara Bio Inc.). Ampicillin sodium (Wako Pure Chemical Industries, Ltd.) After culturing overnight at 37°C on an LB plate containing (manufactured by) the cells were grown by direct PCR. Each colony contained a plasmin that was presumed to be a gene for FAD-bound glucose dehydrogenase. After confirming that the drug has been introduced, the phenotype was converted using an LB plate containing ampicillin sodium. The replacement was obtained. [Examples]
[0061] (Presumed to be FAD-bound glucose dehydrogenase derived from Aspergillus oryzae strain NBRC5375) Cloning of genes into Aspergillus oryzae) (1) Extraction of chromosomal DNA 0.25 g of the wet bacterial cells obtained in Example 1 (1) was frozen with liquid nitrogen, and then powder The material was crushed, and chromosomal DNA was extracted using conventional methods. (2) Cloning of a gene presumed to be FAD-binding glucose dehydrogenase Aspergillus oryzae NS4 strain was used as the host organism. This strain is publicly known. As stated in Reference 1 (Biosci. Biotech. Biochem., 61(8), 1367-1369, 1997), It was bred at the Brewing Experiment Station in 1999 and is used for the analysis of transcription factors and the breeding of high-production strains of various enzymes. These properties are available for sale. For this strain, see the publicly available reference 2 (Heterogeneic gene expression systems of the genus Aspergillus, Toshiki Minetoki, Chemistry and Biology). Amylase derived from Aspergillus oryzae, as described in (Item, 38, 12, pp. 831-838, 2000). Using the improved promoter of the system, and downstream of it, the chromosomal DNA obtained in (1) is used as a template. DOGAN (Database of the Genomes Analyzed at NITE) (website) AO090005000449 (available at http: / / www.bio.nite.go.jp / dogan / Top) The following primers were synthesized based on the base sequence: 1. gene1F: 5'-(acgcgtcgac) tgaccaattccgcagctcgtcaaa atgctcttctcactggcattcctga-3'(Sequence ID 8) ) 2. gene1R: 5'-(gtg)ctaagca ctcttcgcat cctccttaat caagtcgg-3'(Sequence ID 9) (F is the 5' side, R is the 3' side, in parentheses: restriction enzyme cleavage site, underlined part: enoA 5'-UTR, others: ORF) ) This involves using the gene that is presumed to be FAD-binding glucose dehydrogenase to be linked to the amplified gene. Therefore, a vector capable of expressing this gene was prepared. Transformation is basically based on publicly available documents 2 and 3 (Genetic engineering techniques for koji mold used in sake production, 5 Transformed organisms were obtained by following the method described in (Ajikatsuya, Brewing Association, P494-502, 2000). Comparison example
[0062] (Presumed to be FAD-bound glucose dehydrogenase derived from Aspergillus oryzae strain NBRC100959) Cloning of the gene (AO090005000449) into Aspergillus oryzae. (1) Bacterial cell culture Glucose 1% (W / V), Defatted Soybeans 2% (W / V), Corn Stir Liquor 0.5 A liquid culture medium consisting of %(W / V), 0.1%(W / V) magnesium sulfate heptahydrate, and water. Adjust the pH to 6.0, transfer 100 mL to a 500 mL Sakaguchi flask, and heat at 121°C for 20 minutes. Autoclaved for 1 minute. In this cooled liquid medium, Aspergillus oryzae NBRC After inoculating with strain 100959 and culturing with shaking at 28°C for 48 hours, the bacteria were removed using a centrifuge. A sample of 10.5g of the body was recovered. (2) Extraction of chromosomal DNA (1) Of the bacterial cells obtained, 0.31 g of wet bacterial cells were frozen with liquid nitrogen and then crushed. Chromosomal DNA was extracted using a standard method. (3) Gene presumed to be FAD-bound glucose dehydrogenase (AO09000500044) Cloning of 9 genes Aspergillus oryzae NS4 strain was used as the host organism. This strain is publicly known. As shown in Reference 1, it was bred at the Brewing Experiment Station in 1997 (Heisei 9), and the transcription factors were analyzed, and various It is used for breeding high-enzyme-producing strains and is available for distribution. For this bacterial strain, the amylase derived from Aspergillus oryzae, as described in publicly available document 2, was used. Using the improved promoter of the system, the chromosomal DNA obtained in (2) is used as a template at the bottom. The FAD nucleotides amplified using the primers (SEQ ID NOs. 8 and 9) used in Example 2 were The gene presumed to be the combined glucose dehydrogenase (AO090005000449 gene) By binding the gene, a vector capable of expressing this gene was prepared. The transformation should be carried out in accordance with the methods described in prior art documents 2 and 3. Then, I obtained the transformed organism. [Examples]
[0063] (Confirmation of gene sequence) (1) FAD-conjugated glucose derived from Aspergillus oryzae strain NBRC5375 in recombinant Escherichia coli. Sequence of the gene presumed to be coarse dehydrogenase Aspergillus oryzae NBRC5375 strain obtained from recombinant Escherichia coli in Example 1 The sequence of the gene presumed to be FAD-binding glucose dehydrogenase was performed, and the sequence number The sequence of Sequence ID No. 3 and the FAD-bound glucose dehydrogenase in the comparative example are shown in No. 3. cD of the base sequence of the defined gene (AO090005000449) with introns removed. When comparing the NA sequences, with the starting base A of AO090005000449 as the first base... The sequence ATG from position 604 to 606 is Aspergillus oryzae NBRC The gene presumed to be FAD-binding glucose dehydrogenase from strain 5375 is shown in Sequence ID No. 5. The sequence was GCTGGTGTTCCATGGGTT, and the other sequences were a perfect match. Furthermore, the translated amino acid sequence is shown in Sequence ID No. 1, and when compared in the same way, AO0900 When the starting amino acid M of 05000449 is considered as the 1st amino acid, the 202nd M is aspergill A gene presumed to be FAD-binding glucose dehydrogenase from the NBRC5375 strain of Su-orize. The amino acid sequence encoded by is the sequence AGVPWV shown in Sequence ID No. 4, and other sequences The columns matched perfectly. (2) FAD-conjugated glucoglycerides derived from Aspergillus oryzae strain NBRC5375 in recombinant mold - Sequence of genes presumed to be dehydrogenases F derived from Aspergillus oryzae NBRC5375 strain in recombinant mold obtained in Example 2 Sequence ID No. 2 shows the results of sequencing the gene presumed to be AD-binding glucose dehydrogenase. The sequence of Sequence ID No. 2 and the presumed FAD-bound glucose dehydrogenase in the comparative example are shown below. When comparing the base sequences of the gene (AO090005000449), AO09000 When the starting base A of 5000449 is considered as the 1st base, the ATG positions from the 656th to the 658th bases are... The sequence is from Aspergillus oryzae NBRC5375 strain FAD-bound glucose dehydrogenase. The gene that is presumed to be the source of this gene had the sequence GCTGGTGTTCCATGGGTT, as shown in Sequence ID No. 5. Furthermore, the translated amino acid sequence is shown in Sequence ID No. 1, and when compared in the same way, AO0900 When the starting amino acid M of 05000449 (presumably choline dehydrogenase) is taken as the 1st position, 20 The second M is FAD-bound glucose detachment from Aspergillus oryzae strain NBRC5375. The amino acid sequence encoded by the gene presumed to be a hydrogen enzyme is AGVPWV, as shown in Sequence ID No. 4. The sequence was as described above, and the other sequences matched.
[0064] (Comparison of gene sequences) Based on the above results, the bacterial strains of Examples 1 and 2 and the comparative example showed FAD-bound glucose dehydrogenation. In the gene presumed to be the enzyme, it has a similar gene sequence, but in Examples 1 and 2, The gene sequence derived from the Spergillus oryzae NBRC5375 strain is similar to that of the comparative example strain. Compared with the gene sequence of AO090005000449, from position 656 to 658 The sequence ATG is the sequence GCTGGTGTTCCATGGGTT shown in sequence number 5. Furthermore, upon comparison of the amino acid sequences, amino acid M around position 202 is found to be AGVPWV as shown in Sequence ID No. 4. It was discovered that this is the case. [Examples]
[0065] (Comparison with analysis at the gene level) (1) Confirmation by Southern blotting DNA was extracted from the wet bacterial cells cultured using the strains obtained in Example 2 and the Comparative Example, by a standard method. Using a portion of the gene that is presumed to be the FAD-binding glucose dehydrogenase as a probe, Detection was performed using Zumblotting. As a result, in all strains, the amylase system derived from Aspergillus oryzae was modified. DNA containing a gene presumed to be FAD-binding glucose dehydrogenase bound to a good promoter. It was found that each fragment contained approximately the same number of copies. In other words, the strains obtained in Example 2 and the Comparative Example were transformed to the same extent It was discovered that it contains the copy number gene. (2) Confirmation by Northern blotting RNA was extracted from wet bacterial cells cultured using the strains obtained in Example 2 and the Comparative Example, by a standard method. Then, using a portion of the gene that is presumed to be the FAD-binding glucose dehydrogenase as a probe, Detection was performed using blotting. As a result, in all strains, the transformed strains showed similar levels of activity. FAD-conjugated glycerides conjugated with an improved promoter of the amylase system derived from Aspergillus oryzae An mRNA fragment presumed to belong to the lucose dehydrogenase gene was detected. The strains obtained in 2 and the comparative example are thought to be genetically linked to this FAD-bound glucose dehydrogenase. It was determined that the offspring were transcribing into RNA to a similar extent. [Examples]
[0066] (Confirmation of FAD-binding glucose dehydrogenase activity in transformed bacterial strains) The bacterial cells in Example 1 were treated with 50 μg / mL ampicillin sodium and 0.1 mM I Sopropyl-β-D-1-thiogalactopyranoside (manufactured by Sigma-Aldrich Japan) In LB liquid medium containing [the substance], the cells were cultured with shaking at 37°C for 17 hours. After the culture was complete, the cells were collected and mixed with 50 mM liquid medium. The bacterial cells were suspended in potassium nitrate buffer (pH 7.0), then disrupted using an ultrasonic disruptor, and then dispersed. Care was taken to collect the supernatant and obtain a cell-free extract. When the cell-free extract was subjected to SDS-PAGE, an enzyme protein with a molecular weight of approximately 63 kDa was confirmed. It was confirmed that the cell-free extract contained 0.014 U / mL of active FAD-bound glucose dehydrogenase. Sex was confirmed. Furthermore, no such activity was observed in the host, E. coli. The bacterial cells in Example 2 and the Comparative Example contained 1% peptone, 2% sucrose, and dipotassium hydrogen phosphate. Culture in a culture medium containing 0.5% um and 0.05% magnesium sulfate at 28°C for 3 days with shaking. After completion, the cells and culture supernatant are collected by centrifugation, and the cells are sterilized in 50 mM potassium phosphate buffer (pH 7.0) The cells are suspended in the solution, then crushed using a tip-type ultrasonic disruptor, and the supernatant is collected after centrifugation. The cell-free extract was then prepared. When the culture supernatant and cell-free extract were subjected to SDS-PAGE, the bacterial cells in Example 2 had an odor. In the culture supernatant, an enzyme protein with a molecular weight of approximately 86 kDa was confirmed, but in the bacterial cells of the comparative example... It could not be detected in the culture supernatant or cell-free extract. Furthermore, according to the enzyme activity measurement method described above, the FAD-conjugated glucose of the culture supernatant and cell-free extract was measured. Upon checking the dehydrogenase activity, the bacterial cells in Example 2 showed 53 U / m³ in the culture supernatant. The FAD-bound glucose dehydrogenase activity of L was confirmed, but in the bacterial cells of the comparative example, No activity was detected in the supernatant or cell-free extract. (summary) In summary, the findings from Examples 3-5 indicate that Example 2 and the comparative example show that the transformed gene... The copy number and the amount of transcription are equivalent, but the transformed FAD-conjugated glucose The sequence of the gene for s-dehydrogenase is slightly different from the sequence of the gene, and this difference in gene sequence is We can conclude that this has a significant impact on the expression of enzyme activity. [Examples]
[0067] (Comparison with other strains of Aspergillus oryzae) For several other strains of Aspergillus oryzae, similar to Examples 1-(2), FAD-bound glucose dehydrogenase activity in culture supernatant and cell-free extract (CFE) of et al. This was confirmed. Furthermore, chromosomal DNA was extracted from these bacterial strains in the same manner as in Example 2-(1). Then, the sequence of the approximately 1.9 kbp fragment amplified using the primers described in Sequence IDs 6 and 7 was obtained. Determined, the sequence described in Sequence ID No. 2, and the chromosomal DNA distribution of AO090005000449 The sequence was compared with the sequence described in Sequence ID No. 1, as well as AO09. The amino acid sequence was compared with that of 0005000449. These results were compared with those of Examples 1 to 3 and The results of the comparative examples are shown in Table 1 below. Regarding the sequences, in particular, the AG described in Example 3-(1) is shown. Table 1 shows the presence or absence of the amino acid sequence VPWV.
[0068] [Table 1]
[0069] Aspergillus oryzae NBRC4079, 4214, 4268, 5238, 621 The chromosomal DNA sequences from 5 and 30113 both completely match the sequence of Sequence ID No. 2. He was. The chromosomal DNA sequence from Aspergillus oryzae NBRC4203 is sequence number 2. The sequence and four base pairs (135C→A, 437G→A, 532G→A, 1263C→T) were different. Furthermore, As Amino acid sequence translated from the chromosomal DNA sequence of Perugillus oryzae NBRC4203 The sequence of sequence number 1 differed from that of sequence number 1 by two amino acids (129V→I, 386A→V). Furthermore, the chromosomal DNA sequence derived from Aspergillus oryzae NBRC30104 is sequence number The sequence of sample 2 differed from that of sample 2 by four base pairs (135C→A, 413C→A, 437G→A, 532G→A). Furthermore, Amino acids translated from the chromosomal DNA sequence of Aspergillus oryzae NBRC30104 The sequence differed from sequence number 1 by two amino acids (121R→S, 129V→I). Differences in amino acid sequences do not directly affect the expression of FAD-binding glucose dehydrogenase. It was presumed that... Furthermore, the chromosomal DNA sequences of Aspergillus oryzae NBRC4181 and 4220 are All of them were a perfect match for the chromosomal DNA sequence of AO090005000449.
[0070] Based on the results of Examples 1-5 and the Comparative Example, the Aspergillus oryzae strain NBRC5375 is derived from The gene presumed to be FAD-bound glucose dehydrogenase is the active form of FAD-bound glucose It was concluded that it was a gene encoding a dehydrogenase, and also Aspergillus oryzae NB Gene presumed to be FAD-binding glucose dehydrogenase from strain RC100959 (AO0900) The gene 05000449 encodes an active form of FAD-binding glucose dehydrogenase. It was not a genetic gene. The AO090005000449 gene is derived from the FA strain NBRC5375. It encodes an amino acid sequence very similar to that of D-linked glucose dehydrogenase. Therefore, considering the common technical knowledge in the relevant field, it is assumed that they have similar enzyme activity. It is conceivable. However, unexpectedly, the inventors have actually shown the comparative example shown. For example, the AO090005000449 gene, the NBRC4181 gene, and the 4220 gene It was discovered for the first time that the enzyme is not expressed in the sequence. Using a similar expression system, the above Since the presence or absence of FAD-binding glucose dehydrogenase expression is determined solely by differences in the sequence, However, although this is merely a hypothesis, the FAD-binding type of Aspergillus oryzae NBRC5375 strain, etc. Amino acid sequence of glucose dehydrogenase: AGVPWV is FAD-bound glucose dehydrogenase This sequence appears to be important for obtaining the basic higher-order structure, and if AGVPWV is missing, endoplasmic reticulum stress, etc. It is suspected that this triggers the degradation and / or suppression of the expressed protein. The amino acid sequence AGVPWV exists around position 202 when amino acid M is considered as position 1. It is important for functional expression. However, it is currently unknown which amino acids in this sequence are essential for activity expression. Although still under investigation, some degree of activity can be maintained even if certain amino acids are deleted, substituted, or added. There is a possibility. Also, in parts other than the amino acid sequence: AGVPWV, Aspergillus oryzae NBRC4203, and several amino acid substitutions identified from the gene analysis of Aspergillus oryzae NBRC 30104 did not affect the expression of FAD - bound glucose dehydrogenase.
Example
[0071] (Property test of FAD - bound glucose dehydrogenase) The culture supernatant of the cells of Example 2 obtained in Example 5 was concentrated with Vivace 2 (manufactured by Vivace Science Co., Ltd.) with a molecular weight cut - off of 10,000, and then replaced with distilled water to obtain a purified enzyme with a specific activity of 323 U / mg per protein. In addition, enzymes derived from other strains showing FAD - bound glucose dehydrogenase activity could also be purified in the same way. When these purified enzymes were subjected to SDS - PAGE, a single band of about 86 kDa was confirmed. For this enzyme, its functionality, substrate specificity and coenzyme were examined. The enzyme activity was measured according to the enzyme activity measurement method described above. 1) Functionality The purified enzyme was reacted with 500 mM D - glucose in the presence of 8.66 mM DCIP, and the reaction product was quantified with a D - gluconic acid / D - glucono - δ - lactone quantification kit. As a result, the production of D - gluconic acid was confirmed, and it was revealed that the FAD - bound glucose dehydrogenase of the present invention is an enzyme that catalyzes the reaction of oxidizing the hydroxyl group at the 1 - position of D - glucose. 1) Functionality The purified enzyme was reacted with 500 mM D - glucose in the presence of 8.66 mM DCIP, and [[ID=3When the activity value of the enzyme for D-glucose is taken as 100%, the activity value for maltose is... The enzyme activity value was 2.1%, and the enzyme activity value against D-galactose was 0.99%. Ta. 3) Coenzymes When D-glucose was added to the purified enzyme and absorbance analysis was performed, absorption was observed at 385 nm and 465 nm. The absorption maximum observed at nm disappeared upon addition, indicating that the coenzyme is FAD. It became clear. [Examples]
[0072] (Measurement of glucose using enzyme-immobilized electrodes) Using the purified enzyme described in Example 7, D-glucose was measured using an enzyme-immobilized electrode. Using a glassy carbon (GC) electrode immobilized with 1.5U of this enzyme, glucose The response current value to the concentration was measured. In the electrolytic cell, 50 mM potassium phosphate buffer ( 1.8 ml of pH 6.0 potassium hexacyanoferrate(III) (ferricyanide) 0.2 ml of potassium hydroxide aqueous solution was added. The GC electrode was connected to a potentiostat BAS100. Connect to a B / W (BAS), stir the solution at 37°C, and adjust the temperature to +50°C relative to the silver-silver chloride reference electrode. A voltage of 0 mV was applied. In these systems, 1 M D-glucose solutions were added to final concentrations of 5, 10, and 20. The current was added to achieve concentrations of 30, 40, and 50 mM, and the steady-state current value was measured after each addition. Current values are applied to known glucose concentrations (5, 10, 20, 30, 40, 50 mM). As a result, a calibration curve was created (Figure 1). From this, the FAD-bound glucose of the present invention was used. It was demonstrated that glucose can be quantified using an enzyme-immobilized electrode with a dehydrogenase. [Examples]
[0073] (Confirmation of the FAD-bound glucose dehydrogenase gene by PCR) (1) Bacterial cell culture Glucose (manufactured by Nakalai) 1% (W / V), Defatted soybeans (manufactured by Showa Sangyo Co., Ltd.) 2% (W / V) ), Corn steep liquor (manufactured by Sanei Sugar Refining Co., Ltd.) 0.5% (W / V), Magnesium sulfate Prepare a liquid culture medium consisting of 0.1% (W / V) of 700-700 hydrate (manufactured by Nakarai) and water, and adjust the pH to 6.0. Prepared, 10 mL was placed in a large test tube and autoclaved at 121°C for 20 minutes. Cooled. In this liquid medium, glucose dehydrogenase activity is added to the culture medium as shown in Example 4. Aspergillus oryzae strains NBRC4268, NBRC5375, and NBRC6215 have been confirmed to possess this strain. The strains, and Aspergillus oryzae strains NBRC4181 and NBRC42, in which this enzyme activity was not observed in the culture medium. 20 strains and NBRC100959 strain were inoculated into separate test tubes, incubated with shaking at 30°C for 43 hours, and then centrifuged. Wet bacterial cells were collected using a decoupling device.
[0074] (2) Extraction of chromosomal DNA (1) The wet bacterial cells obtained in this step were frozen with liquid nitrogen, then crushed, and chromosomal DNA was extracted by conventional methods. I took it out.
[0075] (3) Amplification of the full-length FAD-binding glucose dehydrogenase gene (2) Using each DNA extracted in step (2) as a template, a primer was synthesized based on the sequence of sequence number 2. Using 3 and 4, PCR was performed under the following conditions to obtain approximately 1.9 kbp of FAD-bound glucose dehydrogenase. We obtained a PCR product containing genes. Template: DNA extracted in (2) Primer: Primer 3: 5'-ttatgctcttctcactggcattcctgagtgccctgt-3' (SEQ ID NO: 10) Primer 4: 5'-gctaagcactcttcgcatcctccttaatcaagtcgg-3' (SEQ ID NO: 11) Reaction conditions: Denaturation at 94°C for 1 minute (1 cycle) Denaturation at 94°C for 30 seconds, annealing at 45°C for 30 seconds, extension reaction at 72°C for 1 minute 30 seconds (30 cycles) Extension reaction at 72°C for 10 minutes (1 cycle)
[0076] (4) Amplification of the FAD-binding glucose dehydrogenase gene that expresses activity Using each PCR product obtained in (1) as a template, PCR was performed under the following conditions using Primer 3 and Primer 5 synthesized based on the amino acid sequence: AGVPWV Template: The PCR product obtained in (3) Primers: Primer 3: 5'-ttatgctcttctcactggcattcctgagtgccctgt- 3' (SEQ ID NO: 10) Primer 5: 5'-aacccatggaacaccagc-3' (SEQ ID NO: 12) Reaction conditions: Denaturation at 94°C for 1 minute (1 cycle) Denaturation at 94°C for 30 seconds, annealing at 65°C for 30 seconds, extension reaction at 72°C for 1 minute (30 cycles) Extension reaction at 72°C for 5 minutes (1 cycle). The detection results of the target gene by PCR are shown in Figure 2. Only the polynucleotide encoding the FAD-binding glucose dehydrogenase derived from Aspergillus oryzae having glucose dehydrogenase
[0077] activity in the culture broth was confirmed to have amplification of the predicted size by PCR. Also, even when PCR was performed using the DNA obtained in (2) directly as a template, similarly, the FAD-binding glucose dehydrogenase derived from Aspergillus oryzae having glucose dehydrogenase activity in the culture broth was confirmed to have amplification of the predicted size by PCR. Also, even when PCR was performed using the DNA obtained in (2) directly as a template, similarly, the FAD-binding glucose dehydrogenase derived from Aspergillus oryzae having glucose dehydrogenase activity in the culture broth was confirmed to have amplification of the predicted size by PCR. Also, even when PCR was performed using the DNA obtained in (2) directly as a template, similarly, the FAD-binding glucose dehydrogenase derived from Aspergillus oryzae having glucose dehydrogenase Only the polynucleotide encoding the specified element showed amplification to the expected size by PCR. [Examples]
[0078] (Confirmation of FAD-binding glucose dehydrogenase gene by Southern hybridization) After agarose gel electrophoresis of 100 ng of each PCR product obtained in Example 9 (1), nylon mesh The sample was blotted onto a blotting pad (Hybond-N+, manufactured by GE Healthcare) and fixed at 80°C for 71 hours. After pre-hybridization, the 5' end is treated with fluorescein isothiocyanate (FI A probe synthesized from the amino acid sequence:AGVPWV, fluorescently labeled with TC, was added and incubated at 37°C for 24 hours. The membrane was incubated at 4°C, 6×SSC, and 50°C, with tetramethylammonium chloride. After washing with a ammonium solution, the SDS derived from tetramethylammonium chloride solution was washed with 25 mM TBS. Fluorescence detection was performed using an image analyzer (Typhoon 9400, manufactured by GE Healthcare). The composition of the buffer used and the probe sequence are described below. Hybridization buffer: 6×SSC 5x Denhardt solution 0.5% Skim Milk 20×SSC: 3M Sodium Chloride 0.3M Trisodium Citrate Tetramethylammonium chloride solution: 3M Tetramethylammonium Chloride 50 mM Tris-HCl (pH 8.0) 2mM EDTA 0.1% SDS Probe: 5'(FITC)-gctggtgttccatgggtt-3'(Sequence ID 5).
[0079] Figure 3 shows the results of detecting the target gene by Southern hybridization. FAD-bound glucose dehydrogenase derived from Aspergillus oryzae, which contains glucose dehydrogenase. Only the polynucleotides encoding hydrogenases were detected by Southern hybridization. This can be seen. Furthermore, confirmation by Southern hybridization is shown in Example 9 (3). The obtained PCR product was immobilized on a nylon membrane (Hybond-N+, manufactured by GE Healthcare). You can get the same results by doing so. [Examples]
[0080] (Cloning of genes identified as FAD-bound glucose dehydrogenase genes, and cloning (Secretion production in the controlled strain) Glucose dehydrogenase is secreted into the culture medium by the method shown in Example 9 and / or Example 10. The product encodes FAD-binding glucose dehydrogenase derived from Aspergillus oryzae. Regarding the gene that was confirmed to be a renucleotide, the vector was created according to the method described in Example 2. When the linked and cloned bacterial strains were cultured, they secreted and produced large amounts of active enzymes in the culture supernatant. I was able to make it happen. [Examples]
[0081] (Affects the activity expression of FAD-bound glucose dehydrogenase derived from Aspergillus oryzae) (Confirmation of the amino acids being used) Six amino acids of FAD-bound glucose dehydrogenase derived from Aspergillus oryzae strain NBRC5375 ( Several variants of AGVPWV (amino acids 202-207) with one amino acid deleted. A different enzyme gene, a mutant enzyme gene in which all six amino acids are deleted, and those six A mutant enzyme gene was created that has a base encoding Met instead of an amino acid, and Aspergillus The mutation was introduced into the Russ oryzae NS4 strain, and its effect on activity expression was confirmed. Note that the creation of the mutant gene was done by S Using TRATAGEN's Quik Change Site Directed Muntagenesis Kits, we studied Aspergillus. Gene introduction into Oryzae was carried out according to the method described in Example 2. Each mutation was introduced and recombined. The results of calculating the average activity value per culture medium (3 strains) for each organism (presumably a single copy) were obtained. These results are shown in Table 2. For the basic activity to be expressed, these six amino acids, especially amino acids 205-207, are important. This is strongly suggested.
[0082] [Table 2] [Industrial applicability]
[0083] The polynucleotide encoded by the present invention is FAD-bound glucose dehydrogenase, which is used to process blood glucose. Because it does not substantially affect maltose in measurement, it allows for more accurate self-monitoring of blood glucose (S It can also be used in MBG (Metabolic Gastric Glucose) devices, greatly contributing to self-management and treatment of diabetic patients.
[0084] JPEG0007843452000004.jpg242162JPEG0007843452000005.jpg242154JPEG00078434520 00006.jpg242152JPEG0007843452000007.jpg242153JPEG0007843452000008.jpg100153
Claims
1. A biosensor for glucose measurement, The system comprises an electrode system and an enzyme reaction layer disposed on the electrode system. The enzyme reaction layer comprises FAD-bound glucose dehydrogenase and an electron acceptor. The FAD-bound glucose dehydrogenase is a protein derived from Aspergillus oryzae strain, having a specific activity of 300 U / mg or more per unit of protein, and an enzyme whose enzymatic activity value for galactose is 5% or less when the enzymatic activity for D-glucose is taken as 100%. The FAD-bound glucose dehydrogenase is a polypeptide comprising the amino acid sequence AGVPWV, and is a polypeptide of the following (a) or (b): (a) A polypeptide having FAD-bound glucose dehydrogenase activity, consisting of an amino acid sequence in which one to several amino acids are substituted, deleted, or added in the amino acid sequence shown in Sequence ID No. 1; or (b) A polypeptide comprising an amino acid sequence having 90% or more identity with the amino acid sequence shown in Sequence ID No. 1, and having FAD-bound glucose dehydrogenase activity; a biosensor.
2. The biosensor according to claim 1, wherein the polypeptide of (b) consists of an amino acid sequence having 95% or more identity with the amino acid sequence shown in Sequence ID No. 1, and is a polypeptide having FAD-bound glucose dehydrogenase activity.
3. The biosensor according to claim 1, wherein the polypeptide of (a) or (b) comprises the substitution of valine (V) to isoleucine (I) corresponding to position 129 of SEQ ID NO: 1, and the substitution of alanine (A) to valine (V) corresponding to position 386 of SEQ ID NO:
1.
4. The biosensor according to claim 1, wherein the polypeptide of (a) or (b) comprises the substitution of arginine (R) corresponding to position 121 of SEQ ID NO: 1 with serine (S), and the substitution of valine (V) corresponding to position 129 of SEQ ID NO: 1 with isoleucine (I).
5. The biosensor according to claim 1, wherein the polypeptide of (a) or (b) contains the amino acid sequence AGVPWV at positions 202 to 207 of SEQ ID NO:
1.
6. The biosensor according to any one of claims 1 to 5, wherein the enzyme reaction layer contains 0.1 to 50 units of FAD-bound glucose dehydrogenase.
7. The biosensor according to any one of claims 1 to 6, wherein the enzyme reaction layer further comprises a hydrophilic polymer.
8. The biosensor according to any one of claims 1 to 7, wherein the electron acceptor is a compound selected from the group consisting of osmium compounds, quinone compounds, and ferricyanine compounds.
Citation Information
Patent Citations
Glucose sensor
JP1988139243A
Glucose sensor
JP1988139244A
Glucose sensor
JP1988317757A
Glucose biosensor
JP1992215055A
Manufacture of glucose sensor
JP1993196595A