Compositions and methods for inhibiting ALAS1 gene expression
ALAS1-specific iRNAs effectively inhibit ALAS1 gene expression, addressing the limitations of current treatments for acute porphyrias by providing a rapid and safer method to reduce porphyrin precursor levels.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- ALNYLAM PHARMACEUTICALS INC
- Filing Date
- 2023-10-27
- Publication Date
- 2026-04-17
AI Technical Summary
Current treatments for acute porphyrias, such as acute intermittent porphyria, are slow, require frequent intravenous infusions, and can cause iron overload and phlebitis, while orthotrophic liver transplantation is risky and limited by donor availability.
The use of ALAS1-specific iRNAs to inhibit ALAS1 gene expression, reducing the production of toxic porphyrin precursors through RNA-induced silencing complex-mediated cleavage, offering a subcutaneous delivery option.
Provides a more effective, rapid, and safer therapeutic approach by significantly reducing ALAS1 expression, thereby decreasing porphyrin precursor levels, potentially eliminating the need for intravenous treatments and minimizing side effects.
Smart Images

Figure 0007847571000111 
Figure 0007847571000112 
Figure 0007847571000113
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application is a continuation-in-part application of U.S. Patent Application No. 13 / 835,613, filed on 15 March 2013, and claims priority to U.S. Provisional Patent Application No. 61 / 622,288, filed on 10 April 2012. The contents of the aforementioned applications are incorporated herein by reference in their entirety.
[0002] This invention relates to the specific inhibition of ALAS1 gene expression. [Background technology]
[0003] Hereditary porphyrias, also referred to herein as the porphyrin pathway, are a group of disorders resulting from deficiencies in the activity of specific enzymes in the heme biosynthesis pathway. Deficiencies in porphyrin pathway enzymes lead to insufficient heme production and the accumulation of porphyrin precursors and porphyrins, which are toxic to tissues at high concentrations.
[0004] Among hereditary porphyrias, acute intermittent porphyria (e.g., AIP, such as autosomal dominant AIP), atypical porphyria (e.g., VP, such as autosomal dominant VP), hereditary coproporphyria (e.g., copropophyria or HCP, such as autosomal dominant HCP), and 5'-aminolevulinic acid (also known as δ-aminolevulinic acid or ALA) dehydratase deficiency porphyria (e.g., ADP, such as autosomal recessive ADP) are classified as acute hepatic porphyrias, manifesting as life-threatening acute neurological seizures. Acute seizures are characterized by autonomic, peripheral, and central nervous system symptoms, including severe abdominal pain, hypertension, tachycardia, constipation, motor paralysis, complete paralysis, and convulsions. If not treated appropriately, this can lead to quadriplegia, respiratory failure, and death. Various factors, including cytochrome P450 inducers, diets, and hormonal changes, can induce acute attacks by increasing the activity of hepatic 5'-aminolevulinic acid synthase 1 (ALAS1), the first and rate-limiting enzyme in the heme biosynthesis pathway. In acute porphyria, enzyme deficiencies, such as those of AIP, VP, HCP, and ADP, lead to the production and accumulation of one or more substances (e.g., porphyrins and / or porphyrin precursors, e.g., ALA and / or PBG) in the liver, which can be neurotoxic and lead to acute attacks. See, for example, Non-Patent Document 1.
[0005] The current treatment for acute porphyria is intravenous administration of hemin (Panhematin®, Lundbeck or Normosang®, Orphan Europe), which provides exogenous heme for negative feedback inhibition of ALAS1, thereby reducing the production of ALA and PBG. Hemin is used for the treatment of acute attacks and for the prevention of attacks, particularly in women with acute porphyria who experience frequent attacks due to hormonal changes in the menstrual cycle. While patients generally respond well, the effect is slow, and it typically takes 2-4 days or more to normalize urinary ALA and PBG concentrations toward normal levels. Because intravenous hemin is rapidly metabolized, usually 3-4 infusions are required to effectively treat or prevent acute attacks. Furthermore, repeated infusions can cause iron overload and phlebitis, which can impair marginal venous access. Orthotrophic liver transplantation is curative, but the procedure carries significant morbidity and mortality rates, and the availability of liver donors is limited. [Prior art documents] [Non-patent literature]
[0006] [Non-Patent Document 1] Balwani, M. and Desnick, R.J., Blood, 120:4496-4504, 2012 [Overview of the project] [Problems that the invention aims to solve]
[0007] Therefore, a more effective, rapid, and safe alternative therapeutic approach is needed. If such a drug could be delivered subcutaneously, it would be particularly advantageous as it would eliminate the need for intravenous fluids and prolonged hospitalization.
[0008] AIP, also known as porphobilinogen deaminase (PBGD) deficiency or hydroxymethylvilan synthase (HMBS) deficiency, is the most common type of acute hepatic porphyrias. It is an autosomal dominant disorder caused by mutations in the HMBS gene that reduce enzyme activity to, for example, half of normal. Previously, a mouse model of AIP with approximately 30% of wild-type HMBS activity was created by homologous recombination. Similar to human patients, in these mice, administration of porphyrin-producing drugs such as phenobarbital increases hepatic ALAS1 activity and leads to the accumulation of large amounts of plasma and urinary ALA and PBG. Therefore, these mice serve as an excellent model for evaluating the efficacy of novel therapeutic agents for acute hepatic porphyrias. [Means for solving the problem]
[0009] This invention describes methods and iRNA compositions for regulating the expression of the ALAS1 gene. In certain embodiments, ALAS1-specific iRNAs are used to reduce or inhibit the expression of the ALAS1 gene. Such inhibition may be useful in treating ALAS1 expression-related disorders such as porphyria.
[0010] Therefore, the compositions and methods described herein result in RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the ALAS1 gene in cells or in subjects (e.g., in mammals such as human subjects). Compositions and methods for treating ALAS1 gene expression-related disorders such as X-linked sideroblastic anemia (XLSA), ALA dehydratase deficiency porphyria (Doss porphyria or ADP), acute intermittent porphyria (AIP), congenital erythroblastic porphyria (CEP), late-onset cutaneous porphyria (prophyria cutanea tarda) (PCT), hereditary coproporphyria (coproporphyria or HCP), atypical porphyria (VP), erythroblastic protoporphyria (EPP), or transient infantile erythropoiesis-associated porphyria are also described. In some embodiments, the disease is an acute hepatic porphyria such as ALA dehydratase deficiency porphyria (ADP), AIP, HCP, or VP. In certain embodiments, the disease is ALA dehydratase deficiency porphyria (ADP) or AIP.
[0011] In embodiments, porphyria is hepatic porphyria, such as porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variant porphyria (VP), ALA dehydratase deficiency porphyria (ADP), and hepatomelaemic porphyria. In embodiments, porphyria is homozygous-dominant hepatic porphyria (e.g., homozygous-dominant AIP, HCP, or VP) or hepatomelaemic porphyria. In embodiments, porphyria is biporphyria.
[0012] In the use of this specification, the terms “iRNA,” “RNAi,” “iRNA agent,” or “RNAi agent” refer to agents containing RNA as defined herein that mediate targeted cleavage of RNA transcripts, for example, through the RNA-induced silencing complex (RISC) pathway. In one embodiment, the iRNA described herein results in inhibition of ALAS1 expression in cells or mammals.
[0013] The iRNAs contained in the compositions described herein include dsRNAs having an RNA chain (antisense strand) that is substantially complementary to at least a portion of the mRNA transcript of the ALAS1 gene (e.g., mouse or human ALAS1 gene), for example, having a region of 30 nucleotides or less in length and generally consisting of 19 to 24 nucleotides (also referred to herein as "ALAS1-specific iRNA"). Alternatively, or in combination, the iRNAs include dsRNAs having an RNA chain (antisense strand) that is substantially complementary to at least a portion of the mRNA transcript of the ALAS1 gene (e.g., human variant 1 or 2 of the ALAS1 gene), having a region of 30 nucleotides or less in length and generally consisting of 19 to 24 nucleotides (also referred to herein as "ALAS1-specific iRNA").
[0014] In the embodiments, the iRNA (e.g., dsRNA) described herein comprises an antisense strand having a region substantially complementary to the human ALAS1 region. In the embodiments, the human ALAS1 has the sequence NM_000688.4 (SEQ ID NO: 1) or NM_000688.5 (SEQ ID NO: 382).
[0015] In another embodiment, the iRNA comprises a dsRNA having an RNA strand (antisense strand) having a region substantially complementary to a portion of the ALAS1 mRNA described in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20. In one embodiment, the iRNA comprises a dsRNA having an RNA strand (antisense strand) having a region substantially complementary to a portion of the ALAS1 mRNA, such as human ALAS1 mRNA (e.g., human ALAS1 mRNA described in SEQ ID NO: 1 or SEQ ID NO: 382).
[0016] In one embodiment, an iRNA that inhibits the expression of the ALAS1 gene includes at least two complementary sequences. The iRNA includes a sense strand having a first sequence and an antisense strand having a second sequence. The antisense strand includes a nucleotide sequence substantially complementary to at least a portion of the mRNA encoding the ALAS1 transcript, and the complementary region is 30 nucleotides or less and at least 15 nucleotides long. Generally, iRNAs are 19 to 24 nucleotides long.
[0017] In some embodiments, the iRNA is 19-21 nucleotides long. In some embodiments, the iRNA is 19-21 nucleotides long and is in the form of a lipid formulation, such as a lipid nanoparticle (LNP) formulation (e.g., an LNP11 formulation).
[0018] In some embodiments, the iRNA is 21-23 nucleotides long. In some embodiments, the iRNA is 21-23 nucleotides long and exists in the form of a complex, conjugated to one or more GalNAc derivatives, such as those described herein.
[0019] In some embodiments, the iRNA is approximately 15 to 25 nucleotides long, and in other embodiments, the iRNA is approximately 25 to 30 nucleotides long. When assayed using the methods described herein, iRNAs targeting ALAS1 inhibit the expression of the ALAS1 gene by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% or more upon contact with cells expressing ALAS1. In one embodiment, the iRNAs targeting ALAS1 are formulated into stable nucleic acid lipid particles (SNALPs).
[0020] In one embodiment, the iRNA (e.g., dsRNA) described herein includes a first sequence of dsRNA selected from the group consisting of sense sequences in Tables 2, 3, 6, 7, 8, 9, 14, and 15, and a second sequence selected from the group consisting of corresponding antisense sequences in Tables 2, 3, 6, 7, 8, 9, 14, and 15.
[0021] In one embodiment, the iRNA (e.g., dsRNA) described herein comprises a first sequence of dsRNA selected from the group consisting of sense sequences in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20, and a second sequence selected from the group consisting of the corresponding antisense sequences in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20. In one embodiment, the iRNA (e.g., dsRNA) discussed herein has a sense and / or antisense sequence selected from AD-58882, AD-58878, AD-58886, AD-58877, AD-59115, AD-58856, AD-59129, AD-59124, AD-58874, AD-59125, AD-59105, AD-59120, AD-59122, AD-59106, AD-59126, and AD-59107 as disclosed in the examples herein. In an embodiment, the iRNA (e.g., dsRNA) has a sense and / or antisense sequence selected from AD-58882, AD-58878, AD-58886, AD-58877, AD-59115, AD-58856, and AD-59129.
[0022] The iRNA molecules discussed herein may contain native nucleotides, or may contain at least one modified nucleotide, including, but not limited to, 2'-O-methyl-modified nucleotides, nucleotides having a 5'-phosphorothioate group, and terminal nucleotides linked to cholesteryl derivatives. Alternatively, the modified nucleotide may be selected from the group of 2'-deoxy-2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, debasalized nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, and non-native base-containing nucleotides. Such a modified sequence may be based, for example, on a first sequence of the iRNA selected from the group consisting of sense sequences in Table 2, and a second sequence selected from the group consisting of antisense sequences in Table 2.
[0023] In one embodiment, the iRNA (e.g., dsRNA) discussed herein comprises a sense strand containing a sequence selected from the group consisting of SEQ ID NOs: 330, 334, 342, 344, 346, 356, 358, 362, 366, 376, and 380.
[0024] In one embodiment, the iRNA (e.g., dsRNA) described herein comprises an antisense strand containing a sequence selected from the group consisting of SEQ ID NOs: 331, 335, 343, 345, 347, 357, 359, 363, 367, 377, and 381.
[0025] In one embodiment, the iRNA (e.g., dsRNA) discussed herein comprises a sense strand containing a sequence selected from the group consisting of SEQ ID NOs: 140, 144, 152, 154, 156, 166, 168, 172, 176, 186, and 190. In another embodiment, the iRNA (e.g., dsRNA) discussed herein comprises an antisense strand containing a sequence selected from the group consisting of SEQ ID NOs: 141, 145, 153, 155, 157, 167, 169, 173, 177, 187, and 191.
[0026] In one embodiment, the iRNA described herein targets a wild-type ALAS1 RNA transcript variant, and in another embodiment, the iRNA targets a mutant transcript (e.g., ALAS1 RNA carrying an allele variant). For example, the iRNA discussed in this invention may target polymorphic variants of ALAS1, such as single nucleotide polymorphisms (SNPs). In yet another embodiment, the iRNA targets both wild-type and mutant ALAS1 transcripts. In yet another embodiment, the iRNA targets a specific transcription variant of ALAS1 (e.g., human ALAS1 variant 1). In yet another embodiment, the iRNA agent targets multiple transcript variants (e.g., both human ALAS1 variant 1 and variant 2).
[0027] In one embodiment, the iRNA addressed in this invention targets a non-coding region of the ALAS1 RNA transcript, such as the 5' or 3' untranslated region of the transcript.
[0028] In some embodiments, the iRNA described herein is in the form of a complex, such as a carbohydrate complex, which may play the role of a target moiety and / or ligand, as described herein. In one embodiment, the complex attaches to the 3' end of the sense strand of the dsRNA. In some embodiments, the complex attaches via a linker, such as a bivalent or trivalent branched linker.
[0029] In some embodiments, the complex comprises one or more N-acetylgalactosamine (GalNAc) derivatives. Such complexes are also referred to herein as GalNAc complexes. In some embodiments, the complex targets the RNAi agent to specific cells, such as hepatocytes, e.g., hepatocytes. The GalNAc derivatives may attach via linkers, e.g., divalent or trivalent branched linkers. In certain embodiments, the complex is [ka] That is the case.
[0030] In some embodiments, the RNAi agent attaches to the carbohydrate complex via a linker, such as the linker shown in the schematic diagram below, where X is O or S. [ka]
[0031] In some embodiments, X is O. In some embodiments, X is S.
[0032] In some embodiments, the RNAi agent is conjugated to L96, as defined in Table 1 and shown below. [ka]
[0033] In one embodiment, the herein provides a pharmaceutical composition for inhibiting ALAS1 gene expression in organisms, generally of human interest. The composition typically comprises one or more of the iRNAs described herein and a pharmaceutically acceptable carrier or delivery vehicle. In one embodiment, the composition is used to treat porphyria, such as AIP.
[0034] In one aspect, the iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of ALAS1, and the dsRNA comprises a sense strand and an antisense strand that are 15 to 30 base pairs in length, and the antisense strand is complementary to at least 15 consecutive nucleotides of SEQ ID NO: 1 or 382.
[0035] In a further aspect, the iRNA provided herein is a double-stranded RNAi (dsRNA) comprising a sense strand complementary to the antisense strand, the antisense strand comprising a region of complementarity with the ALAS1 RNA transcript, each strand having from about 14 to about 30 nucleotides, and the double-stranded RNAi agent Formula (III), Sense: 5’n -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3’ Antisense: 3’n p ’-N a ’-(X’X’X’) k -N b ’-Y’Y’Y’-N b ’-(Z’Z’Z’) l -N [[ID=3' represents an oligonucleotide sequence consisting of 0 to 10 nucleotides, which are independently modified, unmodified, or a combination thereof; each n p , n p ',n q , and n q ' independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications of three consecutive nucleotides; N b Unlike the modification above Y, the modification above N b (The above modifier is different from the above modifier of Y) It is represented by [this].
[0036] In this embodiment, the sense chain is conjugated with at least one ligand.
[0037] In this embodiment, i is 1; j is 1; or both i and j are 1.
[0038] In this embodiment, k is 1; l is 1; or both k and l are 1.
[0039] In this embodiment, XXX is complementary to X'X'X', YYY is complementary to Y'Y'Y', and ZZZ is complementary to Z'Z'Z'.
[0040] In this embodiment, the Y'Y'Y' motif is located at positions 11, 12, and 13 from the 5' end of the antisense chain.
[0041] In this embodiment, Y' is 2'-O-methyl.
[0042] In this embodiment, the double-stranded region is 15 to 30 nucleotide pairs long.
[0043] In this embodiment, the double-stranded region is 17 to 23 nucleotide pairs long.
[0044] In this embodiment, the double-stranded region is 19 to 21 nucleotide pairs long.
[0045] In this embodiment, the double-stranded region is 21 to 23 nucleotide pairs long.
[0046] In the embodiment, the nucleotide modification is selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof.
[0047] In the embodiment, the modification on the nucleotide is 2'-O-methyl, 2'-fluoro, or both.
[0048] In this embodiment, the ligand comprises a carbohydrate.
[0049] In this embodiment, the ligand attaches via a linker.
[0050] In this embodiment, the linker is a divalent or trivalent branched linker.
[0051] In this embodiment, the ligand is [ka] That is the case.
[0052] In the embodiment, the ligand and linker are Formula XXIV, [ka] As shown.
[0053] In this embodiment, the ligand is attached to the 3' end of the sense chain.
[0054] In the embodiment, the dsRNA has a nucleotide sequence selected from the sequence group provided in Tables 2 and 3 (for example, comprising such a sequence). In the embodiment, the dsRNA has a nucleotide sequence selected from the sequence group provided in Tables 2, 3, 6, 7, 8, and 9. In the embodiment, the dsRNA has a nucleotide sequence selected from the sequence group provided in Tables 2, 3, 6, 7, 8, 9, 14, and 15. In the embodiment, the dsRNA has a nucleotide sequence selected from the sequence group provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20. In the embodiment, the dsRNA has a nucleotide sequence disclosed in Table 18. In the embodiment, the dsRNA has a nucleotide sequence selected from the sequence group provided in Tables 14 and 15.
[0055] In the embodiment, the dsRNA has a nucleotide sequence selected from the sequence group provided in Tables 3 and 8.
[0056] In a further embodiment, the iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting ALAS1 expression, wherein the dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a complementary region with an ALAS1 RNA transcript, and the antisense strand comprising at least 15 consecutive nucleotides that differ by 3 nucleotides or less from one of the antisense sequences listed in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20. In some such embodiments, the sense and antisense sequences are selected from the double-stranded AD-58882, AD-58878, AD-58886, AD-58877, AD-59115, AD-58856, AD-59129, AD-59124, AD-58874, AD-59125, AD-59105, AD-59120, AD-59122, AD-59106, AD-59126, and AD-59107 disclosed in the embodiments herein. In embodiments, the sense and antisense sequences are selected from the double-stranded AD-58882, AD-58878, AD-58886, AD-58877, AD-59115, AD-58856, and AD-59129. In embodiments, the sense and antisense sequences are double-stranded AD-58632. In embodiments, the sense and antisense sequences are selected from double-stranded AD-59453, AD-59395, AD-59477, and AD-59492. In embodiments, the sense and antisense sequences are double-stranded as disclosed herein that suppress ALAS1 mRNA expression by at least 50%, 60%, 70%, 80%, 85%, or 90% in evaluation using assays disclosed in the examples provided herein.
[0057] In some embodiments, the dsRNA comprises at least one modified nucleotide.
[0058] In some embodiments, at least one modified nucleotide is selected from the group consisting of 2'-O-methyl modified nucleotides, nucleotides comprising a 5'-phosphorothioate group, and terminal nucleotides linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.
[0059] In some embodiments, the modified nucleotide is selected from the group consisting of 2'-deoxy-2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, debasalized nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, and non-natural base-containing nucleotides.
[0060] In some embodiments, the complementary region is at least 17 nucleotides long.
[0061] In some embodiments, the complementary region is 19 to 21 nucleotides long.
[0062] In some embodiments, the complementary region is 19 nucleotides long.
[0063] In some embodiments, each chain is 30 nucleotides or less in length.
[0064] In some embodiments, at least one strand comprises a 3' overhang of at least one nucleotide.
[0065] In some embodiments, at least one strand comprises 3' overhangs of at least two nucleotides.
[0066] In some embodiments, the dsRNA described herein further comprises a ligand.
[0067] In some embodiments, the ligand is a GalNAc ligand.
[0068] In some embodiments, the ligand targets dsRNA to hepatocytes.
[0069] In some embodiments, the ligand is coupled to the 3' end of the sense strand of the dsRNA.
[0070] In some embodiments, the complementary region consists of antisense sequences selected from Table 2 or Table 3. In embodiments, the complementary region consists of antisense sequences selected from Tables 2, 3, 6, 7, 8, 9, 14, or 15. In embodiments, the complementary region consists of antisense sequences selected from Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20. In some embodiments, the complementary region consists of an antisense sequence selected from AD-58882, AD-58878, AD-58886, AD-58877, AD-59115, AD-58856, AD-59129, AD-59124, AD-58874, AD-59125, AD-59105, AD-59120, AD-59122, AD-59106, AD-59126, or AD-59107 disclosed in the embodiments herein. In some embodiments, the complementary region consists of the double-stranded antisense sequence AD-58632. In embodiments, the complementary region is selected from the antisense sequences consisting of AD-59453, AD-59395, AD-59477, and AD-59492. In embodiments, the complementary region comprises a double-stranded antisense sequence selected herein that suppresses ALAS1 mRNA expression by at least 50%, 60%, 70%, 80%, 85%, or 90% in evaluation using the assays disclosed herein.
[0071] In some embodiments, the dsRNA comprises a sense strand consisting of a sense strand sequence selected from Table 2 or Table 3, and an antisense strand consisting of an antisense sequence selected from Table 2 or Table 3.
[0072] In some embodiments, the dsRNA comprises a sense strand consisting of a sense strand sequence selected from Tables 2, 3, 6, 7, 8, 9, 14, or 15, and an antisense strand consisting of an antisense sequence selected from Tables 2, 3, 6, 7, 8, 9, 14, or 15. In embodiments, the dsRNA comprises a pair of corresponding sense and antisense sequences selected from the double-stranded sequences disclosed in Tables 2, 3, 6, 7, 8, 9, 14, and 15.
[0073] In some embodiments, the dsRNA comprises a sense strand consisting of a sense strand sequence selected from Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20, and an antisense strand consisting of an antisense sequence selected from Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20. In embodiments, the dsRNA comprises a pair of corresponding sense and antisense sequences selected from the double-stranded sequences disclosed in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20.
[0074] In one embodiment, the present invention provides cells containing at least one of the iRNAs (e.g., dsRNA) discussed herein. The cells are generally mammalian cells, such as human cells. In some embodiments, the cells are erythroid cells. In other embodiments, the cells are hepatocytes (e.g., hepatocytes).
[0075] In one embodiment, the herein provides a pharmaceutical composition for inhibiting the expression of the ALAS1 gene, the composition comprising an iRNA (e.g., dsRNA) as described herein.
[0076] In embodiments of the pharmaceutical compositions described herein, iRNA (e.g., dsRNA) is administered in a non-buffered solution. In embodiments, the non-buffered solution is physiological saline or water.
[0077] In embodiments of the pharmaceutical compositions described herein, iRNA (e.g., dsRNA) is administered in a non-buffered solution. In embodiments, the buffer solution comprises acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In embodiments, the buffer solution is phosphate-buffered saline (PBS).
[0078] In embodiments of the pharmaceutical compositions described herein, iRNA (e.g., dsRNA) is targeted to hepatocytes.
[0079] In the embodiments of the pharmaceutical compositions described herein, the compositions are administered intravenously.
[0080] In the embodiments of the pharmaceutical compositions described herein, the compositions are administered subcutaneously.
[0081] In the embodiments, the pharmaceutical composition comprises an iRNA (e.g., dsRNA) described herein, which includes a ligand (e.g., GalNAc ligand) that targets iRNA (e.g., dsRNA) to hepatocytes.
[0082] In the embodiment, the pharmaceutical composition comprises an iRNA (e.g., dsRNA) described herein, which comprises a ligand (e.g., GalNAc ligand), and the pharmaceutical composition is administered subcutaneously. In the embodiment, the ligand targets the iRNA (e.g., dsRNA) to hepatocytes.
[0083] In certain embodiments, the pharmaceutical composition, for example, the composition described herein, comprises a lipid formulation. In some embodiments, the RNAi agent is in an LNP formulation, for example, an MC3 formulation. In some embodiments, the LNP formulation targets the RNAi agent to specific cells, such as hepatocytes, for example, hepatocytes. In embodiments, the lipid formulation is an LNP11 formulation. In embodiments, the composition is administered intravenously.
[0084] In another embodiment, the pharmaceutical composition is formulated for administration according to a dosing schedule described herein, such as once every four weeks or less, once every three weeks or less, once every two weeks or less, or once every week or less. In another embodiment, administration of the pharmaceutical composition may continue for, for example, one, two, three or six months or more, or for one year or more.
[0085] In another embodiment, a composition containing the iRNA discussed in this invention, such as a dsRNA targeting ALAS1, is administered together with a non-iRNA therapeutic agent, such as a drug known to treat porphyria (e.g., AIP) or symptoms of porphyria (e.g., pain). In yet another embodiment, a composition containing the iRNA discussed in this invention, such as a dsRNA targeting AIP, is administered together with a non-iRNA drug administration regimen (e.g., glucose infusion (e.g., IV glucose)) such as hemin or glucose. For example, the iRNA discussed in this invention may be administered before, after, or concurrently with glucose, dextrose, or similar therapeutic agents that help restore energy balance (e.g., total parenteral nutrition). The iRNA discussed in this invention may also be administered before, after, or concurrently with heme products (e.g., hemin, heme alginate, or hemalbumin) and optionally combined with glucose (e.g., IV glucose).
[0086] Typically, glucose administered for the treatment of porphyria is given intravenously (IV). Intravenous administration of glucose is referred to herein as "IV glucose." However, alternative embodiments in which glucose is administered by other means are also included.
[0087] In one embodiment, ALAS1 iRNA is administered to the patient, followed by the administration of a non-iRNA drug or treatment plan (e.g., glucose and / or heme products) (or vice versa). In another embodiment, ALAS1 iRNA and a non-iRNA drug or treatment plan are administered simultaneously.
[0088] In one embodiment, the foregoing provides a method for inhibiting ALAS1 expression in cells, comprising the steps of (a) introducing an iRNA (e.g., dsRNA) described herein into cells, and (b) maintaining the cells from step (a) for a period of time sufficient to obtain degradation of the mRNA transcript of the ALAS1 gene, thereby inhibiting the expression of the ALAS1 gene in the cells.
[0089] In one embodiment, the foregoing provides a method for reducing or inhibiting the expression of the ALAS1 gene in cells (e.g., erythroid cells or hepatocytes such as hepatocytes). The method is: (a) The step of introducing double-stranded ribonucleic acid (dsRNA) containing at least two complementary sequences into a cell; (b) A step of maintaining the cells from step (a) for a sufficient time to obtain degradation of the mRNA transcript of the ALAS1 gene, thereby inhibiting the expression of the ALAS1 gene in the cells. The dsRNA comprises a sense strand having a first sequence and an antisense strand having a second sequence; the antisense strand has a complementary region substantially complementary to at least a portion of the mRNA encoding ALAS1, the complementary region being 30 nucleotides or less in length, i.e., 15-30 nucleotides, generally 19-24 nucleotides; and when the dsRNA comes into contact with a cell expressing ALAS1, it inhibits the expression of the ALAS1 gene by at least 10%, for example, at least 20%, at least 30%, at least 40% or more.
[0090] In the embodiments of the above-described method for inhibiting ALAS1 expression in cells, the cells are treated ex vivo, in vitro, or in vivo. In the embodiments, the cells are hepatocytes.
[0091] In this embodiment, the cells are present in subjects who require treatment, prevention, and / or management of ALAS1 expression-related diseases.
[0092] In the embodiment, the disease is porphyria. In the embodiment, the porphyria is acute intermittent porphyria or ALA dehydratase deficiency porphyria.
[0093] In embodiments, porphyria is hepatic porphyria, such as porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variant porphyria (VP), ALA dehydratase deficiency porphyria (ADP), and hepatomelaemic porphyria. In embodiments, porphyria is homozygous-dominant hepatic porphyria (e.g., homozygous-dominant AIP, HCP, or VP) or hepatomelaemic porphyria. In embodiments, porphyria is biporphyria.
[0094] In this embodiment, ALAS1 expression is inhibited by at least 30%.
[0095] In this embodiment, iRNA (e.g., dsRNA) has an IC in the range of 0.01 to 1 nM. 50 It holds.
[0096] In certain embodiments, the cells (e.g., hepatocytes) are mammalian cells (e.g., human, non-human primate, or rodent cells).
[0097] In one embodiment, the cells are treated in vitro, in vitro, or in vivo (for example, the cells are present in a subject (e.g., a patient requiring treatment, prevention, and / or management of ALAS1 expression-related disease)).
[0098] In one embodiment, the subject is a mammal (e.g., human) at risk of or diagnosed with porphyria, such as X-linked sideroblastic anemia (XLSA), ALA dehydratase deficiency porphyria (ADP or Doss porphyria), acute intermittent porphyria (AIP), congenital erythroblastic proliferative porphyria (CEP), sporphyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), atypical porphyria (VP), erythroblastic protoporphyria (EPP), or transient erythroblastic porphyria in infancy. In some embodiments, the disease is acute hepatic porphyria, such as ALA dehydratase deficiency porphyria (ADP), AIP, HCP, or VP. In certain embodiments, the disease is ALA dehydratase deficiency porphyria (ADP) or AIP.
[0099] In embodiments, porphyria is hepatic porphyria, such as porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variant porphyria (VP), ALA dehydratase deficiency porphyria (ADP), and hepatomelaemic porphyria. In embodiments, porphyria is homozygous-dominant hepatic porphyria (e.g., homozygous-dominant AIP, HCP, or VP) or hepatomelaemic porphyria. In embodiments, porphyria is biporphyria.
[0100] In one embodiment, the introduced dsRNA reduces or inhibits the expression of the ALAS1 gene in cells.
[0101] In one embodiment, the introduced dsRNA reduces or inhibits the expression of the ALAS1 gene, or the levels of one or more porphyrins or porphyrin precursors (e.g., δ-aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilan (HMB), uroporphyrinogen I or III, coproporphyrinogen I or III, protoporphrinogen IX, and protoporphyrin IX) or porphyrin products or metabolites by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% compared to a reference (e.g., untreated cells or cells treated with an untargeted control dsRNA). Without being constrained by theory, ALAS1 is the first enzyme in the porphyrin pathway. Therefore, reducing the expression of the ALAS1 gene appears to decrease the levels of one or more porphyrin precursors, porphyrins, or porphyrin products or metabolites.
[0102] In other embodiments, the present invention provides methods for treating, preventing, or managing pathological processes associated with ALAS1 expression (e.g., pathological processes associated with porphyrins, porphyrin precursors, or porphyrin pathway defects, such as porphyria). In one embodiment, the method includes administering an effective dose (e.g., a therapeutic or prophylactic effective dose) of one or more iRNAs discussed herein to a subject, for example, a patient in need of such treatment, prevention, or management.
[0103] In one embodiment, the foregoing provides a method for treating and / or preventing ALAS1 expression-related disease, comprising the step of administering to a subject in need of such treatment a therapeutically effective amount of an iRNA (e.g., dsRNA) described herein, or a therapeutically effective amount of a composition comprising an iRNA (e.g., dsRNA) described herein.
[0104] In one embodiment, the foregoing provides a method for treating and / or preventing porphyria, comprising the step of administering a double-stranded ribonucleic acid (dsRNA) to a subject in need of such treatment, wherein the dsRNA comprises a sense strand and an antisense strand of 15 to 30 base pairs in length, the antisense strand being complementary to at least 15 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 382.
[0105] In one embodiment, the subject (e.g., a patient) has porphyria. In another embodiment, the subject (e.g., a patient) is at risk of developing porphyria. In some embodiments, administration of an iRNA targeting ALAS1 alleviates or reduces the severity of at least one symptom of ALAS1-related disease in the patient.
[0106] In one embodiment, the subjects are mammals (e.g., humans) who are at risk of or have been diagnosed with ALAS1 expression-related diseases, such as X-linked sideroblastic anemia (XLSA), ALA dehydratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoiesis (CEP), sporphyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), atypical porphyria (VP), erythropoiesis protoporphyria (EPP), or transient erythropoiesis in infancy. In further embodiments, the porphyria is acute hepatic porphyria such as ALA dehydratase deficiency porphyria (ADP), AIP, HCP, or VP. In some such embodiments, the disease is ALA dehydratase deficiency porphyria (ADP) or AIP.
[0107] In the embodiments, the subjects have or are at risk of developing porphyria. In the embodiments, the porphyria is hepatic porphyria, such as porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variant porphyria (VP), ALA dehydratase deficiency porphyria (ADP), and hepatomelaemic porphyria. In the embodiments, the porphyria is homozygous-dominant hepatic porphyria (e.g., homozygous-dominant AIP, HCP, or VP) or hepatomelaemic porphyria. In the embodiments, the porphyria is biporphyria.
[0108] In some embodiments, porphyria, symptoms of porphyria, prodromal symptoms, or porphyria attacks are induced by exposure to exacerbating factors described herein. In some embodiments, the exacerbating factor is exposure to a chemical substance. In some embodiments, the exacerbating factor is a drug, such as a prescription drug or an over-the-counter drug. In some embodiments, the exacerbating factor is the menstrual cycle, such as a specific time of the menstrual cycle, such as the luteal phase.
[0109] In the embodiment, iRNA (e.g., dsRNA) or a composition comprising iRNA is administered after an acute attack of porphyria.
[0110] In the embodiment, an iRNA (e.g., dsRNA) or a composition comprising iRNA is administered during an acute attack of porphyria.
[0111] In the embodiment, iRNA (e.g., dsRNA) or a composition comprising iRNA is administered prophylactically to prevent acute attacks of porphyria.
[0112] In this embodiment, iRNA (e.g., dsRNA) is formulated as an LNP preparation.
[0113] In these embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc complex.
[0114] In this embodiment, iRNA (e.g., dsRNA) is administered at a dose of 0.05 to 50 mg / kg.
[0115] In the embodiment, iRNA (e.g., dsRNA) is administered at a concentration of 0.01 mg / kg to 5 mg / kg per body weight of the subject.
[0116] In this embodiment, iRNA (e.g., dsRNA) is formulated as an LNP preparation and administered at a dose of 0.05 to 5 mg / kg.
[0117] In this embodiment, the iRNA (e.g., dsRNA) is in the form of a GalNAc complex and is administered at a dose of 0.5 to 50 mg / kg.
[0118] In one embodiment, the method reduces the level of porphyrin or porphyrin precursor in the subject.
[0119] In one embodiment, the level decreases by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In one embodiment, the level decreases by at least 30%.
[0120] In the embodiment, the porphyrin precursor is δ-aminolevulinic acid (ALA) or porphopilinogen (PBG).
[0121] In this embodiment, iRNA (e.g., dsRNA) has an IC in the range of 0.01 to 1 nM. 50 It holds.
[0122] In embodiments, the methods described herein are (i) To improve symptoms associated with ALAS1-related disorders (e.g., porphyria), (ii) Inhibit ALAS1 expression in the subjects, (iii) In the subjects, reduce the levels of rufirin precursors (e.g., ALA or PBG) or porphyrins, (iv) In the subjects, reduce the frequency of acute attacks of symptoms associated with porphyria, or (v) Reduce the incidence of acute attacks of porphyria-related symptoms in subjects when they are exposed to exacerbating factors (e.g., premenstrual or luteal phase).
[0123] In the embodiment, the method improves pain and / or progressive neuropathy.
[0124] In the embodiment, an iRNA (e.g., dsRNA) or a composition comprising iRNA is administered according to the administration plan.
[0125] In some embodiments, iRNA (e.g., dsRNA) or a composition comprising iRNA is administered before or during an acute attack of porphyria. In some embodiments, the iRNA is administered before an acute attack of porphyria.
[0126] In some embodiments, an iRNA (e.g., dsRNA) or a composition comprising an iRNA is administered during the prodromal symptoms. In embodiments, the prodromal symptoms are characterized by abdominal pain, nausea, psychological symptoms (e.g., anxiety), emotional instability, and / or insomnia.
[0127] In embodiments, iRNA (e.g., dsRNA) or a composition comprising iRNA is administered during a specific menstrual cycle, such as the luteal phase. In embodiments, the method improves or prevents periodic seizures of porphyria by, for example, reducing the severity, duration, or frequency of seizures. In embodiments, periodic seizures are associated with exacerbating factors. In embodiments, the exacerbating factor is a menstrual cycle, such as a specific time of the menstrual cycle, such as the luteal phase.
[0128] In embodiments, the subject has elevated ALA and / or PBG levels. In embodiments, the subject has or is at risk of developing a porphyria, such as hepatic porphyria. In embodiments, the subject is asymptomatic. In embodiments, the subject carries a genetic alteration (e.g., a gene mutation) associated with the porphyria described herein.
[0129] In one embodiment, the subject has or is at risk of developing porphyria and suffers from pain (e.g., chronic pain, e.g., chronic neuropathic pain) and / or neurological disorders (e.g., progressive neurological disorders). In another embodiment, the subject does not suffer from an acute attack but suffers from pain (e.g., chronic pain such as long-term neuropathic pain) and / or neurological disorders (e.g., progressive neurological disorders). In yet another embodiment, the pain is abdominal pain.
[0130] In the embodiment, the subject (a) has elevated ALA and / or PBG levels, and (b) suffers from pain (e.g., chronic pain such as long-term neuropathic pain) and / or neuropathy (e.g., progressive neuropathy). In the embodiment, the pain is abdominal pain.
[0131] In embodiments, the subject has elevated plasma and / or urinary levels of ALA and / or PBG. In embodiments, the elevated levels of ALA and / or PBG are accompanied by other symptoms, such as pain (e.g., chronic pain, e.g., long-term neuropathic pain) or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain. In embodiments, the subject is asymptomatic. In embodiments, the subject has a gene mutation associated with porphyria, such as the mutations described herein.
[0132] In the embodiments, the subjects have elevated levels of porphyrin precursors such as ALA and / or PBG (e.g., plasma levels or urine levels), such as levels exceeding or above a reference value. In the embodiments, the levels exceed a reference value. In the embodiments, the reference value is two standard deviations above the mean level in a healthy person sample. In the embodiments, the reference value is the upper limit of the reference value.
[0133] In embodiments, subjects have plasma and / or urinary levels of ALA and / or PBG that are two, three, four, or five times, or greater than, the upper limit of the reference range. As used herein, “upper limit of reference range” refers to the upper limit of the 95% confidence interval of a standard sample, such as a sample from a normal (e.g., wild-type) or healthy individual, such as an individual who does not carry a gene mutation associated with porphyria, and / or an individual who does not suffer from porphyria. In embodiments, subjects have urinary ALA and / or PBG levels that are two to four times, or greater than, the upper limit of the reference range. In embodiments, subjects have urinary ALA and / or PBG levels that are four times, or greater than, the upper limit of the reference range.
[0134] In the embodiment, the reference value for plasma PBG is 0.12 μmol / L. In the embodiment, the subject is human and has plasma PBG levels greater than or equal to 0.12 μmol / L, 0.24 μmol / L, 0.36 μmol / L, 0.48 μmol / L, or 0.60 μmol / L. In the embodiment, the subject is human and has plasma PBG levels greater than or equal to 0.48 μmol / L.
[0135] In one embodiment, the reference value for urinary PBG is 1.2 mmol / mol creatinine. In another embodiment, the subject is human and has a urinary PBG level greater than or equal to 1.2 mmol / mol creatinine, 2.4 mmol / mol creatinine, 3.6 mmol / mol creatinine, 4.8 mmol / mol creatinine, or 6.0 mmol / mol creatinine. In yet another embodiment, the subject is human and has a plasma PBG level greater than or equal to 4.8 mmol / mol.
[0136] In the embodiment, the reference value for plasma ALA is 0.12 μmol / L. In the embodiment, the subject is human and has plasma ALA levels greater than or equal to 0.12 μmol / L, 0.24 μmol / L, 0.36 μmol / L, 0.48 μmol / L, or 0.60 μmol / L. In the embodiment, the subject is human and has plasma ALA levels greater than or equal to 0.48 μmol / L.
[0137] In this embodiment, the reference value for urinary ALA is 3.1 mmol / mol creatinine. In this embodiment, the subject is a human having a urinary ALA level greater than or equal to 3.1 mmol / mol creatinine, 6.2 mmol / mol creatinine, 9.3 mmol / mol creatinine, 12.4 mmol / mol creatinine, or 15.5 mmol / mol creatinine.
[0138] In the embodiments, the subject is the method, which reduces elevated ALA and / or PBG levels. In the embodiments, the method reduces pain (e.g., chronic pain, e.g., chronic neuropathic pain) and / or neuropathy (e.g., progressive neuropathy). In the embodiments, the pain is abdominal pain. In the embodiments, the pain is neuropathic pain (e.g., pain associated with progressive neuropathy of acute porphyria). Pain reduction includes, for example, prevention of pain, delay of pain onset, reduction of pain frequency, and / or reduction of pain severity.
[0139] In the embodiment, the method improves or prevents acute seizures of porphyria, for example, by reducing the severity, duration, or frequency of seizures.
[0140] In embodiments, the method reduces or prevents nerve damage.
[0141] In embodiments, the method prevents deterioration (e.g., prevents the occurrence of abnormalities) or results in improvement of clinical measurements such as, for example, clinical measurements of muscle and / or clinical measurements of nerve function such as, for example, EMG and / or nerve conduction velocity.
[0142] In the embodiment, the method is effective in lowering ALA and / or PBG levels (e.g., ALA and / or PBG levels in plasma or urine). In the embodiment, the method is effective in bringing about a planned decrease in elevated ALA and / or PBG levels.
[0143] In some embodiments, the intended decrease is a decrease to a value below a reference value. In some embodiments, the reference value is the upper limit of the reference value. In some embodiments, the reference value is a value two standard deviations above the mean level of the standard sample.
[0144] In the embodiment, an iRNA (e.g., dsRNA) or a composition containing iRNA is administered repeatedly, for example, according to a dosing schedule.
[0145] In embodiments, an iRNA (e.g., dsRNA) or a composition comprising iRNA is administered prophylactically to subjects at risk of developing porphyria. In embodiments, an iRNA (e.g., dsRNA) or a composition comprising iRNA is administered prophylactically at the beginning of puberty. In embodiments, subjects possess a gene mutation associated with porphyria and / or elevated ALA and / or PBG levels (e.g., elevated plasma or urine ALA and / or PBG levels). In embodiments, the mutation makes the individual more susceptible to acute attacks (e.g., when exposed to aggravating factors such as drugs, diets, or other aggravating factors such as those disclosed herein). In embodiments, the mutation is associated with elevated levels of porphyrin or porphyrin precursors (e.g., ALA and / or PBG). In embodiments, the mutation is associated with chronic pain (e.g., chronic neuropathic pain) and / or neuropathy (e.g., progressive neuropathy).
[0146] In the embodiments, the mutation is a mutation in the ALAS1 gene. In the embodiments, the mutation is a mutation in the ALAS1 gene promoter, or a mutation in the upstream or downstream region of the ALAS1 gene. In the embodiments, the mutation is a mutation in a transcription factor or other gene that interacts with ALAS1. In the embodiments, the mutation is a mutation in a gene encoding an enzyme in the heme biosynthesis pathway.
[0147] In the embodiments, iRNA (e.g., dsRNA) or a composition containing iRNA is administered subcutaneously. In the embodiments, the iRNA is in the form of a GalNAc complex. In the embodiments, the iRNA (e.g., dsRNA) is administered at a dose of 0.5 to 50 mg / kg.
[0148] In one embodiment, the foregoing provides a method for treating a subject having elevated ALA and / or PBG levels, the method comprising the step of administering a double-stranded ribonucleic acid (dsRNA) to the subject, the dsRNA comprising a sense strand and an antisense strand of 15 to 30 base pairs in length, the antisense strand being complementary to at least 15 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 382.
[0149] In one embodiment, the foregoing provides a method for treating a subject having elevated ALA and / or PBG levels, the method comprising administering a therapeutically effective amount of dsRNA or a composition comprising dsRNA to the subject, as described herein.
[0150] In some embodiments, the methods described herein are effective in reducing ALA and / or PBG levels. In some embodiments, ALA and / or PBG levels are reduced to be below or below a reference value, such as an upper reference limit. In another embodiment, the present invention provides a method for reducing porphyrin or porphyrin precursor levels in cells (e.g., erythroid cells, or hepatocytes, such as hepatocytes). In one embodiment, the cells are treated in vitro, in vitro, or in vivo (e.g., the cells are present in a subject (e.g., a patient requiring treatment, prevention, and / or management of an ALAS1 expression-related disease)). The method comprises contacting cells with one or more effective amounts of ALAS1-targeting iRNAs, such as one or more of the iRNAs disclosed herein, thereby reducing porphyrin or porphyrin precursor levels in the cells compared to pre-contact levels; or reducing porphyrin or porphyrin precursor levels in other cells, tissues, or body fluids in a subject in which the cells are located. Using such methods, ALAS1 expression-related disorders such as porphyrias, including AIP or ALA dehydratase deficiency porphyria, can be treated (for example, by improving their severity).
[0151] In one embodiment, the contact step is carried out in vitro, in vitro, or in vivo. For example, cells may be present in a subject such as a mammal (e.g., human) that is at risk of porphyria or has been diagnosed with porphyria. In one embodiment, porphyria is acute hepatic porphyria. In an embodiment, porphyria is hepatic porphyria such as acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), atypical porphyria (VP), ALA dehydratase deficiency porphyria (ADP), and hepatomelaemic porphyria. In an embodiment, porphyria is homozygous-dominant hepatic porphyria (e.g., homozygous-dominant AIP, HCP, or VP) or hepatomelaemic porphyria. In an embodiment, porphyria is biporphyria.
[0152] In one embodiment, a method for reducing porphyrin or porphyrin precursor (e.g., ALA or PBG) levels in cells is provided herein, comprising the step of contacting cells with an iRNA (e.g., dsRNA) described herein in an amount effective to reduce the levels of porphyrin or porphyrin precursor in cells. In embodiments, the cells are hepatocytes. In embodiments, the porphyrin or porphyrin precursor is δ-aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilan (HMB), uroporphyrinogen I or III, coproporphyrinogen I or III, protoporphrinogen IX, or protoporphyrin IX. In embodiments, the porphyrin precursor is ALA or PBG.
[0153] In one embodiment, the cells are erythroid cells. In a further embodiment, the cells are hepatocytes (e.g., hepatocytes).
[0154] In one embodiment, the vector provided herein encodes at least one iRNA (e.g., adsRNA) strand, as described herein.
[0155] In one embodiment, the herein provides a vector encoding at least one dsRNA strand, wherein the dsRNA comprises a complementary region with at least a portion of the mRNA encoding ALAS1, the dsRNA is 30 base pairs or less in length, and the dsRNA targets the mRNA for cleavage.
[0156] In this embodiment, the complementary region is at least 15 nucleotides long.
[0157] In one embodiment, the complementary region is at least 19 to 21 nucleotides long. In one embodiment, the present invention provides a vector for inhibiting the expression of the ALAS1 gene in cells. In one embodiment, the vector comprises an iRNA as described herein. In one embodiment, the vector comprises at least one regulatory sequence operably linked to a nucleotide sequence encoding at least one strand of the iRNA as described herein. In one embodiment, the vector comprises at least one ALAS1 iRNA strand.
[0158] In one embodiment, the herein provides cells comprising the vector described herein. In another embodiment, the herein provides cells comprising a vector that inhibits ALAS1 gene expression in cells. The vector comprises a regulatory sequence operably linked to a nucleotide sequence encoding at least one strand of the iRNA described herein. In one embodiment, the cells are hepatocytes (e.g., hepatocytes). In another embodiment, the cells are erythroid cells.
[0159] All publications, patent applications, patents, and other references mentioned herein are incorporated solely by reference.
[0160] Details of various embodiments of the present invention are described below. Other characteristics, purposes, and advantages of the present invention will become apparent from the description and drawings and from the claims. [Brief explanation of the drawing]
[0161] [Figure 1] Figure 1 illustrates the heme biosynthesis pathway. [Figure 2A] Figure 2 summarizes certain porphyrias associated with genetic errors in heme metabolism. [Figure 2B] Figure 2 summarizes certain porphyrias associated with genetic errors in heme metabolism. [Figure 3A]Figure 3 depicts human ALAS1 mRNA sequence transcription variant 1 (reference sequence NM_000688.4 (GI:40316942, recorded November 19, 2011), sequence number 1). [Figure 3B] Figure 3 depicts human ALAS1 mRNA sequence transcription variant 1 (reference sequence NM_000688.4 (GI:40316942, recorded November 19, 2011), sequence number 1). [Figure 4A] Figure 4 depicts human ALAS1 mRNA sequence transcription variant 2 (reference sequence NM_000688.5 (GI:362999011, recorded April 1, 2012), SEQ ID NO: 382). [Figure 4B] Figure 4 depicts human ALAS1 mRNA sequence transcription variant 2 (reference sequence NM_000688.5 (GI:362999011, recorded April 1, 2012), SEQ ID NO: 382). [Figure 5] Figure 5 shows the dose-response of siRNA AD-53558 in the suppression of mouse ALAS1 (mALAS1) mRNA compared to a PBS control. Results for a luciferase (LUC) AD-1955 control are also shown. [Figure 6] Figure 6 shows the dose-response of siRNA AD-53558 in suppressing ALAS1 mRNA in rats compared to a PBS control. Results for a luciferase (LUC) AD-1955 control are also shown. [Figure 7] Figure 7 shows the persistence of mouse ALAS1 (mALAS1) mRNA suppression by siRNA AD-53558 compared to a PBS control. [Figure 8] Figure 8 shows the mean ± standard deviation of plasma ALA levels (in μM) at baseline and after phenobarbital treatment in the experimental group (ALAS1 siRNA) and the control group (LUC siRNA). [Figure 9] Figure 9 shows the baseline and post-phenobarbital plasma ALA levels (in μM) of individual animals treated with ALAS1 siRNA and a control (LUC siRNA). [Figure 10] Figure 10 shows the mean ± standard deviation of plasma ALA levels (in μM) at baseline and after phenobarbital treatment in animals treated with ALAS1 siRNA and control (LUC siRNA). [Figure 11] Figure 11 shows the plasma PBG levels (in μM) of individual animals at baseline and after phenobarbital treatment in animals treated with ALAS1 siRNA and control (LUC siRNA). [Figure 12] Figure 12 shows the relative mALAS1 mRNA levels in the liver at baseline and after phenobarbital treatment in selected representative experimental (ALAS1 siRNA) and control (PBS) animals. [Figure 13] Figure 13 shows the effects of three GalNAc-conjugated mALAS1 siRNAs on mALAS1 expression in mouse liver tissue (compared to PBS control). [Figure 14] Figure 14 shows plasma ALA and PBG levels over time after phenobarbital administration and ALAS1 siRNA treatment or control LUC siRNA treatment. [Figure 15] Figure 15 shows the effects of GalNAc-conjugated ALAS1 siRNA on plasma ALA and plasma PBG levels in the mouse AIP phenobarbital induction model.
Mode for Carrying Out the Invention
[0162] iRNAs induce sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). This specification describes iRNAs and methods for using them to inhibit the expression of the ALAS1 gene in cells or mammals, in which the iRNAs target the ALAS1 gene. Compositions and methods for ALAS1 expression-related disorders such as porphyria (e.g., ALA dehydratase deficiency porphyria (ADP or Doss porphyria), acute intermittent porphyria, congenital erythropoiesis, tardive cutaneous porphyria (prophyria cutanea tarda), hereditary coproporphyria (coproporphyria), atypical porphyria, erythropoiesis protoporphyria (EPP), X-linked sideroblastic anemia (XLSA), and transient erythropoiesis in infancy) are also provided.
[0163] Porphyria can be inherited or acquired disorders caused by decreased or increased activity of specific enzymes in the heme biosynthesis pathway, also referred to herein as the porphyrin pathway (see Figure 1). Porphyrins are major heme precursors. Examples of porphyrins and porphyrin precursors include δ-aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilan (HMB), uroporphyrinogen I or III, coproporphyrinogen I or III, protoporphrinogen IX, and protoporphyrin IX. Heme is an essential component of hemoglobin, myoglobin, catalase, peroxidase, and cytochromes, including respiratory and P450 hepatic cytochromes. Heme is synthesized in most or all human cells. Approximately 85% of heme is produced in erythroid cells, primarily for hemoglobin. Most of the remaining heme is produced in the liver, with 80% of it used for cytochrome synthesis. Deficiencies in specific enzymes in the porphyrin pathway result in insufficient heme production and also lead to the accumulation of porphyrins, precursors, and / or porphyrins, which can be toxic to cell or organ function at high concentrations.
[0164] Porphyria can manifest as neurological complications ("acute"), skin problems ("cutaneous"), or both. Porphyria may be classified according to the primary site of overproduction and accumulation of porphyrins or their precursors. In hepatic porphyria, porphyrins and porphyrin precursors are predominantly overproduced in the liver, while in erythroblastic porphyria, porphyrins are overproduced in erythroid cells within the bone. Acute or hepatic porphyria results in neurological dysfunction and the manifestation of neurological symptoms, which can affect both the central and limbic nervous systems, such as pain (e.g., abdominal pain and / or chronic neuropathic pain), vomiting, neuropathy (e.g., acute neuropathy, progressive neuropathy), muscle weakness, convulsions, psychiatric disorders (e.g., hallucinations, depression, anxiety, delusions), cardiac arrhythmias, tachycardia, constipation, and diarrhea. Cutaneous or erythroblastic porphyrias primarily affect the skin, causing symptoms such as painful photosensitivity, blistering, necrosis, itching, swelling, and increased hair growth in areas such as the forehead. Subsequent infection of skin lesions can lead to bone and tissue loss, as well as scarring, impaired aesthetics, and loss of fingers (e.g., fingers, toes). Most porphyrias are caused by mutations encoding enzymes in the heme biosynthesis pathway. An overview of porphyrias associated with genetic errors in heme metabolism is provided in Figure 2.
[0165] Not all porphyrias are genetic. For example, patients with liver disease may develop porphyria as a result of liver failure, and a transient form of erythroporphria in infancy (transient erythroporphria in infancy) has been described (see Crawford, RI et al., J Am Acad Dermatol. August 1995; 33(2 Pt 2):333-6). Patients with PCT may develop uroporphyrinogen decarboxylase (URO-D) deficiency due to the formation of ORO-D enzyme with lower activity than normal (see Phillips et al., Blood, 98:3179-3185, 2001).
[0166] Acute intermittent porphyria (AIP), also known as porphobilinogen (PBG) deaminase deficiency or hydroxymethylbilan synthase (HMBS) deficiency, is the most common type of acute hepatic porphyria. Other types of acute hepatic porphyria include hereditary coproporphyria (HCP), atypical porphyria (VP), and ALA dehydratase deficiency porphyria (ADP). Acute hepatic porphyria is described, for example, in Balwani, M. and Desnick, R.J., Blood, 120:4496-4504, 2012.
[0167] AIP is an autosomal dominant disorder typically characterized by a deficiency of the enzyme porphobilinogen deaminase (PBG deaminase); this enzyme is also known as hydroxymethylbilan synthase (HMB synthase or HMBS). PBG deaminase is the third enzyme in the heme biosynthesis pathway (see Figure 1) and catalyzes the head-to-tail condensation of the porphobilinogen molecule to hydroxymethylbilan (HMB), a linear tetrapyrrole. Transcript variants by alternative splices encoding different isoforms of PBG deaminase have been described. Mutations in the PBG deaminase gene have been associated with AIP. Such mutations can result in decreased PBG deaminase levels and / or decreased PBG deaminase activity (affected individuals typically have about a 50% decrease in PBG deaminase activity).
[0168] There are at least two distinct models of the pathophysiology of AIP and other acute hepatic porphyria (see, e.g., LinCS-Y et al., Clinical Neurophysiology, 2011;122:2336-44). According to one model, reduced heme production due to PBG deaminase deficiency leads to energy deficiency and axonal degeneration. According to another, currently more supported model, deposition of porphyrin precursors (e.g., ALA and PBG) results in neurotoxicity.
[0169] AIP is known to have a high prevalence of approximately 1 in 10,000 people in certain populations (see, e.g., Northern Sweden; Floderus Y et al., Clin Genet. 2002; 62:288-97). In the general populations of the United States and Europe, excluding the UK, the prevalence is estimated to be between 1 in 10,000 and 1 in 20,000. Clinical symptoms appear in only about 10–15% of individuals carrying the mutation known to be associated with AIP. However, penetrance is high, at around 40% of individuals with a specific mutation (e.g., the W198X mutation). AIP is typically latent before puberty. Symptoms are more common in females than in males. The prevalence of the disease is probably underestimated due to its incomplete penetrance and long latency period. In the United States, it is estimated that there are approximately 2,000 individuals who have experienced at least one seizure. In France, Sweden, the United Kingdom, and Poland, there are estimated to be approximately 150 active relapsing cases; the majority of these patients are young women, with a median age of 30 years. See, for example, Elder et al., J Inherit Metab Dis., published online on November 1, 2012.
[0170] AIP affects, for example, the visceral, peripheral, autonomic, and central nervous systems. AIP symptoms fluctuate and include gastrointestinal symptoms (e.g., severe, vaguely localized abdominal pain, nausea / vomiting, constipation, diarrhea, bowel obstruction), urinary symptoms (dysuria, urinary retention / incontinence, or dark urine), neurological symptoms (e.g., sensory neuropathy, motor neuropathy (e.g., affecting cranial nerves and / or causing weakness in the arms or legs), convulsions, neuropathic pain (e.g., pain associated with progressive neuropathy such as chronic neuropathic pain), neuropsychiatric symptoms (e.g., confusion, anxiety, agitation, hallucinations, hysteria, delirium, emotional blunting, depression, phobias, psychosis, insomnia, somnolence, coma), autonomic nervous system disorders (e.g., cardiovascular symptoms such as tachycardia, hypertension, and / or arrhythmias, as well as circulating catecholamine levels, sweating, emotional dysregulation, etc.), Symptoms include dehydration and electrolyte imbalances (leading to other symptoms such as increased tremors and / or quiescence). The most common symptoms are abdominal pain and tachycardia. Patients also frequently develop progressive neuropathy with chronic neuropathic pain. Patients with recurrent attacks often have prodromal symptoms. Permanent paralysis may occur after a severe attack. Recovery from a severe attack that is not treated immediately may take weeks or months. Acute attacks can be fatal, for example, due to respiratory muscle paralysis or cardiovascular damage from electrolyte imbalance (see, for example, Thunell S. Hydroxymethylbilan synthase deficiency, refer to the entire content by reference). Synthase Deficiency) September 27, 2005 [Updated September 1, 2011]. In: Pagon (RA), Bird (TD), Dolan (CR), et al., editors, GeneReviews(registered trademark) [Internet]. Seattle, Washington: University of Washington, Seattle; 1993- (See Thunell (1993) below). Before hemin therapy became available, up to 20% of patients with AIP disease died from the disease.
[0171] Individuals carrying the AIP gene have an increased risk of hepatocellular carcinoma. In individuals with recurrent attacks, the risk of hepatocellular carcinoma is particularly severe, and after age 50, the risk is more than 100 times higher than in the general population.
[0172] Acute porphyria attacks can be triggered by endogenous or exogenous factors. Mechanisms by which such factors trigger attacks include, for example, increased demand for hepatic P450 enzymes and / or induction of hepatic ALAS1 activity. Increased demand for hepatic P450 enzymes leads to a decrease in hepatic free heme, which in turn induces hepatic ALAS1 synthesis.
[0173] Aggravating factors include fasting (or other forms of reduced or insufficient calorie intake resulting from crush diets or long-distance running), metabolic stress (e.g., infections, surgery, international air travel, and psychological stress), endogenous hormones (e.g., progesterone), smoking, lipid-soluble exogenous chemicals (e.g., tobacco smoke, certain prescription drugs, organic solvents, biocides, and chemicals present in alcoholic beverages), and endocrine factors (e.g., reproductive hormones (women may experience exacerbations during the premenstrual period), synthetic estrogens, progesterone, ovulation inducers, and hormone replacement therapies). See, for example, Thunell (1993).
[0174] In acute hepatic porphyria (e.g., AIP, HCP, ADP, and VP), more than 1,000 drugs are contraindicated, including, for example, alcohol, barbiturates, carbamazepine, carisoprodol, clonazepam (high dose), danazol, diclofenac and possibly other NSAIDs, ergot, estrogen, ethoclorvynol, glutetimide, griseofulvin, mephenytoin, meprobamate (also mebutamate and tybutamate), metiprilone, metoclopramide, phenytoin, primidone, progesterone and synthetic progestins, pyrazinamide, pyrazolone (aminopyrine and antipyrine), rifampin, succinimide (ethosuccimide and methosuccimide), sulfonamide antibiotics, and valproic acid.
[0175] Objective signs of AIP include discoloration of the urine during acute attacks (the urine may appear red or reddish-brown), and increased urinary concentrations of PBG and ALA during acute attacks. Molecular genetic testing identifies mutations in the PBG deaminase (also known as HMBS) gene in over 98% of affected individuals. Thunell (1993).
[0176] Differential diagnosis of porphyria may involve determining the type of porphyria by measuring individual levels of porphyrins or porphyrin precursors (e.g., ALA, PBG) in urine, feces, and / or plasma during an attack (e.g., by chromatography and fluorescence). Diagnosis of AIP may be confirmed by establishing that erythrocyte PBG deaminase activity is less than 50% of normal levels. DNA testing for mutations may be performed in the patient and at-risk relatives. Diagnosis of AIP is typically confirmed by DNA testing to identify a specific causative gene mutation (e.g., HMBS mutation).
[0177] Treatment of acute seizures typically requires hospitalization to manage and treat acute symptoms, such as abdominal pain, convulsions, dehydration / hyponatremia, nausea / vomiting, tachycardia / hypertension, and urinary retention / intestinal obstruction. For example, abdominal pain may be treated with narcotic analgesics, convulsions with seizure prophylaxis and, in some cases, with medication (although many anticonvulsants are contraindicated), nausea / vomiting may be treated with phenothiazines, for example, and tachycardia / hypertension may be treated with beta-blockers, for example. Treatment includes discontinuing unsafe medications and monitoring respiratory function, muscle strength, and neurological condition. Mild seizures (e.g., without paresis or hyponatremia) may be treated with at least 300 g of intravenous 10% glucose per day, but hemin is increasingly being administered immediately. Severe seizures should be treated as quickly as possible with intravenous hemin (3-4 mg / kg daily for 4-14 days), and treated with IV glucose while waiting for the effects of IV hemin to appear. Typically, seizures are treated with IV hemin for 4 days, and then with IV glucose while waiting for IV hemin administration.
[0178] Hemin (Panhematin® or Hemin for Injection, formerly known as Hematin) is the only heme product approved for use in the United States and the first drug approved under the Orphan Medicines Act. Panhematin® is a hemin derived from processed red blood cells (PRBCs) and is a protoporphyrin IX containing a chloride ligand-supported ferric ion (heme B). Heme acts to restrict hepatic and / or bone marrow synthesis of porphyrins. The exact mechanism by which hemin produces symptom relief in patients with acute onset of hepatic porphyria is not fully understood; however, its action is thought to be due to the (feedback) inhibition of δ-aminolevulinic acid (ALA) synthase, an enzyme that limits the rate of porphyrin / heme biosynthesis. See the Panhematin® product label, October 2010, Lundbeck, Inc. Inhibition of ALA synthase should result in reduced production of ALA and PBG, as well as porphyrins and porphyrin intermediates.
[0179] Disadvantages of hemin include its delayed effect on clinical symptoms and its inability to prevent seizure relapses. Adverse reactions associated with hemin administration include thrombophlebitis, anticoagulant effects, thrombocytopenia, renal arrest, or iron overload, which are particularly likely to occur in patients requiring multiple courses of hemin treatment due to recurrent seizures. To prevent phlebitis, indwelling intravenous catheters are necessary for access in patients with recurrent seizures. Rarely reported side effects include fever, pain, malaise, hemolysis, anaphylaxis, and circulatory collapse. See Anderson, KE, Approaches to Treatment and Prevention of Human Porphyrias, The Porphyrin Handbook: Medical Aspects of Porphyrins, edited by Karl M. Kadish, Kevin M. Smith, and Roger Guilard (2003) (hereinafter, Anderson).
[0180] Heme is difficult to prepare in a stable form for intravenous administration. It is insoluble at neutral pH but can be prepared as heme hydroxide at pH 8 or above. Anderson. Panhematin is a lyophilized hemin preparation. When lyophilized hemin is solubilized for intravenous administration, degradation products are rapidly formed; these degradation products are the cause of a transient anticoagulant effect at the infusion site and phlebitis. Anderson. Heme albumin and heme arginate (Normosang, the European version of hemin) are more stable and potentially cause less phlebitis. However, heme arginate is not approved for use in the United States. Panhemin may be stabilized for infusion by solubilizing it in 30% human albumin rather than sterile water; albumin has a volume-expanding effect in the vascular space and is isolated from human blood, increasing the treatment cost as well as the pathogen risk. See, for example, Anderson.
[0181] Successful treatment of an acute episode does not prevent or delay relapse. There is a question as to whether hemin itself can cause recurrent episodes due to induction of heme oxygenase. Nevertheless, in some regions (particularly France), young women with multiple recurrent episodes are being treated with weekly administration of hemin for the purpose of achieving prophylaxis.
[0182] Limited experience with liver transplantation suggests that it is an effective treatment for AIP if successful. Approximately 12 transplants have been performed in human patients in Europe, and the effects have been curative or variable. Liver transplantation can restore normal excretion of ALA and PBG and prevent acute episodes. See, for example, Dar, F.S. et al., Hepatobiliary Pancreat. Dis. Int., 9(1):93-96 (2010). Furthermore, when the liver of an AIP patient is transplanted into another patient ("domino transplantation"), the recipient patient may develop AIP.
[0183] Long-term clinical effects of acute porphyria include chronic neuropathic pain, which may result from progressive neuropathy due to neurotoxic effects such as elevated porphyrin precursors (e.g., ALA and / or PBG). Patients may suffer from neuropathic pain prior to or during acute attacks. Elderly patients may experience increased neuropathic pain with age, for which various anesthetics are typically prescribed. Electromyographic abnormalities and decreased conduction time have been demonstrated in patients with acute hepatic porphyria. Notably, untreated, uninducible mice with AIP (PBG deaminase deficiency) develop progressive motor neuropathy, which has been shown to cause progressive quadriceps nerve axonal degeneration and loss, likely due to constitutively elevated porphyrin precursor (ALA & PBG) levels, porphyrin and / or heme deficiency (Lindberg et al., J. Clin. Invest., 103(8):1127-1134, 1999). In patients with acute porphyria (e.g., ADP, AIP, HCP, or VP), porphyrin precursor (ALA and PBG) levels are often elevated in asymptomatic patients and in symptomatic patients between attacks. Therefore, reducing porphyrin precursors and restoring normal heme biosynthesis by decreasing ALAS1 expression and / or activity levels is expected to prevent and / or minimize the development of chronic and progressive neurological disorders. Treatment, such as long-term treatment (e.g., cyclical treatment with iRNA as described herein, treatment according to the dosing schedule as described herein, e.g., weekly or bi-weekly treatment), can continuously reduce ALAS1 expression in patients with acute porphyria who have elevated levels of porphyrin precursors, porphyrins, porphyrin products, or their metabolites. Such treatment may be provided as needed to prevent, reduce the frequency or severity of, individual patient symptoms (e.g., pain and / or neurological disorders), and / or reduce levels of porphyrin precursors, porphyrins, porphyrin products, or metabolites.
[0184] There is a need to identify novel therapeutic agents that can be used for the treatment of porphyria. As discussed above, existing therapeutic agents such as hemin have numerous drawbacks. For example, the effects of hemin on clinical symptoms are delayed, expensive, and may have side effects (e.g., thrombophlebitis, anticoagulant, thrombocytopenia, iron overload, renal arrest). Novel therapeutic agents, such as those described herein, may address these drawbacks and unmet patient needs by, for example, acting more rapidly, not inducing phlebitis, offering the convenience of subcutaneous administration, successfully preventing recurrent attacks, preventing or improving pain (e.g., chronic neuropathic pain) and / or progressive neuropathy, and / or not causing certain adverse effects associated with hemin (e.g., iron overload, increased risk of hepatocellular carcinoma).
[0185] This disclosure provides methods and iRNA compositions for regulating the expression of the ALAS1 gene. In certain embodiments, ALAS1-specific iRNAs are used to reduce or inhibit ALAS1 expression, resulting in decreased ALAS1 gene expression. Decreased ALAS1 gene expression may also reduce the levels of one or more porphyrin precursors, porphyrins, or porphyrin products or metabolites. Decreased ALAS1 gene expression, along with associated decreases in the levels of one or more porphyrin precursors and / or porphyrins, may be useful in treating ALAS1 expression-related disorders, such as porphyria.
[0186] The iRNAs of the compositions discussed herein include RNA strands (antisense strands) having a region of 30 nucleotides or less in length, i.e., 15 to 30 nucleotides, generally 19 to 24 nucleotides, which are substantially complementary to at least a portion of the mRNA transcript of the ALAS1 gene (also referred to herein as "ALAS1-specific iRNA"). The use of such iRNAs enables mRNA-targeted degradation of genes associated with ALAS1 expression in mammals, such as porphyrias like ALA dehydratase deficiency porphyria (Doss porphyria) or acute intermittent porphyria. Very low doses of ALAS1-specific iRNAs can specifically and efficiently mediate RNAi to induce significant inhibition of ALAS1 gene expression. IRNAs targeting ALAS1 can specifically and efficiently mediate RNAi to induce significant inhibition of ALAS1 gene expression, for example, in cell-based assays. Therefore, these iRNAs and other methods and compositions are useful for treating ALAS1 expression-related pathological processes such as porphyria (e.g., X-linked sideroblastic anemia (XLSA), ALA dehydratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythroblastic proliferative porphyria, late-onset cutaneous porphyria (prophyria cutanea tarda), hereditary coproporphyria (coproporphyria), atypical porphyria, erythroblastic protoporphyria (EPP), and transient erythropoiesis in infancy).
[0187] The following description discloses how to prepare and use iRNA-containing compositions for inhibiting the expression of the ALAS1 gene, as well as compositions and methods for treating diseases and disorders caused or regulated by the expression of this gene. Embodiments of the pharmaceutical compositions covered by the present invention include an iRNA having an antisense strand comprising a region of 30 nucleotides or less in length, generally 19 to 24 nucleotides in length, together with a pharmaceutically acceptable carrier, the region being substantially complementary to at least a portion of the RNA transcript of the ALAS1 gene. Embodiments of the compositions covered by the present invention also include an iRNA having an antisense strand having a complementary region of 30 nucleotides or less in length, generally 19 to 24 nucleotides in length, which is substantially complementary to at least a portion of the RNA transcript of the ALAS1 gene.
[0188] Accordingly, in some embodiments, the present invention addresses pharmaceutical compositions containing ALAS1 iRNA and a pharmaceutically acceptable carrier, methods for inhibiting ALAS1 gene expression using the composition, and methods for treating ALAS1 expression-related disorders using the pharmaceutical composition.
[0189] I. Definition For convenience, the meanings of certain terms and phrases used in the specification, examples, and appended claims are provided below. In the event of any apparent conflict between their usage in other parts of this specification and the definitions provided in this section, the definitions in this section shall prevail.
[0190] "G," "C," "A," "T," and "U" typically represent nucleotides containing guanine, cytosine, adenine, thymidine, and uracil as bases, respectively. However, the terms "ribonucleotide" or "nucleotide" are also understood to refer to modified nucleotides or alternative substitutions, as will be further detailed below. Those skilled in the art are well aware that guanine, cytosine, adenine, and uracil may be replaced by other parts without substantially altering the base-pairing properties of oligonucleotides containing such substitutions. As an example not intended to be limiting, a nucleotide containing inosine as a base may base-pair with a nucleotide containing adenine, cytosine, or uracil. Thus, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the dsRNAs discussed in this invention with, for example, nucleotides containing inosine. In another embodiment, adenine and cytosine may be substituted with guanine and uracil, respectively, anywhere in the oligonucleotide to form GU fluctuation base pairs with the target mRNA. Sequences containing such substitutions are suitable for the compositions and methods addressed in the present invention.
[0191] In the context of this specification, "ALAS1" (ALAS-1; δ-aminolevulinic acid synthase 1; δ-ALA synthase 1; 5'-aminolevulinic acid synthase 1; ALAS-H; ALASH; ALAS-N; ALAS3; EC2.3.1.37; nonspecific mitochondrial 5-aminolevulinic acid synthase; ALAS; MIG4; OTTHUMP00000212619; OTTHUMP00000212620; OTTHUMP00000212621; OTTHUMP00000212622; transfer-inducing protein 4; also known as EC2.3.1) refers to the nucleus-encoded mitochondrial enzyme, which is the first enzyme in the mammalian heme biosynthesis pathway and is typically the rate-limiting enzyme. ALAS1 catalyzes the condensation of glycine with succinyl-CoA to produce δ-aminolevulinic acid (ALA). The human ALAS1 gene is widely expressed, located on chromosome 3p21.1, and typically encodes a sequence of 640 amino acids. In contrast, the ALAS-2 gene, which encodes an isoenzyme, is expressed only in red blood cells, located on chromosome Xp11.21 (chromoxome), and typically encodes a sequence of 550 amino acids. As used herein, “ALAS1 protein” means any protein variant of ALAS1 from any species (e.g., human, mouse, non-human primates), as well as any variants and fragments thereof that retain ALAS1 activity. Similarly, “ALAS1 transcript” means any transcriptional variant of ALAS1 from any species (e.g., human, mouse, non-human primates). The sequence of the human ALAS1 variant 1 mRNA transcript is found at NM_000688.4 (Figure 3; SEQ ID NO: 1). The sequence of another version of the human ALAS1 variant 2 mRNA transcript is found at NM_000688.5 (Figure 4; SEQ ID NO: 382). The levels of the encoded mature ALAS1 protein are regulated by heme, with high levels of heme downregulating maturation enzymes in mitochondria, while low levels of heme upregulating them. Multiple variants of the same protein, resulting from alternative splicing, have been identified.
[0192] In the context of this specification, the terms “iRNA,” “RNAi,” “iRNA agent,” or “RNAi agent” refer to an agent containing RNA as defined herein that mediates targeted cleavage of RNA transcripts, for example, through the RNA-induced silencing complex (RISC) pathway. In one embodiment, the iRNA described herein results in inhibition of ALAS1 expression. Inhibition of ALAS1 expression may be assessed based on a decrease in ALAS1 mRNA levels or a decrease in ALAS1 protein levels. In the context of this specification, “target sequence” refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the ALAS1 gene, including mRNA, which is the RNA processing product of the primary transcript. The target portion of the sequence is at least long enough to serve as a substrate for iRNA-directed cleavage, either in that portion or in its vicinity. For example, the target sequence is generally 9 to 36 nucleotides long, such as 15 to 30 nucleotides, and includes all partial ranges within that range. As a non-limiting example, target sequences include 15-30 nucleotides, 15-26 nucleotides, 15-23 nucleotides, 15-22 nucleotides, 15-21 nucleotides, 15-20 nucleotides, 15-19 nucleotides, 15-18 nucleotides, 15-17 nucleotides, 18-30 nucleotides, 18-26 nucleotides, 18-23 nucleotides, 18-22 nucleotides, 18-21 nucleotides, 18-20 nucleotides, 19-30 nucleotides, and 19-26 nucleotides. Otide may consist of 19-23 nucleotides, 19-22 nucleotides, 19-21 nucleotides, 19-20 nucleotides, 20-30 nucleotides, 20-26 nucleotides, 20-25 nucleotides, 20-24 nucleotides, 20-23 nucleotides, 20-22 nucleotides, 20-21 nucleotides, 21-30 nucleotides, 21-26 nucleotides, 21-25 nucleotides, 21-24 nucleotides, 21-23 nucleotides, or 21-22 nucleotides.
[0193] In the use of this specification, the term “sequence-containing chain” refers to an oligonucleotide chain containing a sequence described by a sequence referred to using standard nucleotide nomenclature.
[0194] In the use herein, unless otherwise specified, the term “complementary” means, as will be understood by those skilled in the art, the ability of an oligonucleotide or polynucleotide comprising a first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide comprising a second nucleotide sequence under specific conditions to form a double-stranded structure, when used to describe a first nucleotide sequence in relation to a second nucleotide sequence. Such conditions may be stringent conditions, for example, 400 mM NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA, 50°C or 70°C for 12–16 hours, followed by washing. Other conditions, such as physiologically reasonable conditions that may be encountered in living organisms, may also be applied. Those skilled in the art can determine the optimal set of conditions for the complementarity test of the two sequences according to the end use of the hybridized nucleotides.
[0195] For example, complementary sequences within iRNA, such as those within dsRNA, as described herein include base pairings of an oligonucleotide or polynucleotide comprising a first nucleotide sequence with an oligonucleotide or polynucleotide comprising a second nucleotide sequence, spanning the entire length of one or both nucleotide sequences. Such sequences may be referred to herein as "fully complementary." However, where herein the first sequence is referred to as "substantially complementary" to the second sequence, the two sequences may be fully complementary, or they may form one or more, but generally five, four, three, or two or fewer, mismatched base pairs during double-stranded hybridization of up to 30 base pairs, while retaining the ability to hybridize under conditions most appropriate for their ultimate use, such as gene expression inhibition via the RISC pathway. However, if the two oligonucleotides are designed to form one or more single-stranded overhangs during hybridization, such overhangs shall not be considered mismatches for the purpose of determining complementarity. For example, a dsRNA comprising one oligonucleotide of 21 nucleotides in length and another oligonucleotide of 23 nucleotides in length, wherein the longer oligonucleotide comprises a 21-nucleotide sequence that is perfectly complementary to the shorter oligonucleotide, may still be referred to as “perfectly complementary” for the purposes described herein.
[0196] In the usage herein, “complementary” sequences also include, or may be entirely formed from, non-Watson-Crick base pairs and / or base pairs generated from non-natural and modified nucleotides, provided that the above requirements regarding their hybridizing ability are met. Such non-Watson-Crick base pairs include, but are not limited to, G:U fluctuation base pairs or Hoogsteen-type base pairs.
[0197] The terms “complementary,” “fully complementary,” and “substantially complementary” may be used herein to describe matching bases between the sense and antisense strands of a dsRNA, or between the antisense strand and target sequence of an iRNA agent, as will be understood from their context of use.
[0198] As used herein, a polynucleotide "substantially complementary to at least a portion" of messenger RNA (mRNA) means a polynucleotide substantially complementary to the continuous portion of the mRNA in question (e.g., the mRNA encoding the ALAS1 protein). For example, a polynucleotide is complementary to at least a portion of ALAS1 mRNA if its sequence is substantially complementary to the uninterrupted portion of the mRNA encoding ALAS1. For example, a polynucleotide is complementary to at least a portion of ALAS1 mRNA if its sequence is substantially complementary to the uninterrupted portion of the mRNA encoding ALAS1.
[0199] The term “double-stranded RNA” or “dsRNA” as used herein refers to an iRNA containing an RNA molecule or molecular complex having a hybridized double-stranded region comprising two antiparallel and substantially complementary nucleic acid strands that are said to have “sense” and “antisense” orientations with respect to the target RNA. The double-stranded region can be of any length that allows for the specific degradation of the desired target RNA, for example, via the RISC pathway, but is typically in the range of 9 to 36 base pairs in length, such as 15 to 30 base pairs. Considering double helix strands between 9 and 36 base pairs, the double helix strands can be any length within this range, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36, and 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 1 These ranges include, but are not limited to, any partial range between 8–22 base pairs, 18–21 base pairs, 18–20 base pairs, 19–30 base pairs, 19–26 base pairs, 19–23 base pairs, 19–22 base pairs, 19–21 base pairs, 19–20 base pairs, 20–30 base pairs, 20–26 base pairs, 20–25 base pairs, 20–24 base pairs, 20–23 base pairs, 20–22 base pairs, 20–21 base pairs, 21–30 base pairs, 21–26 base pairs, 21–25 base pairs, 21–24 base pairs, 21–23 base pairs, or 21–22 base pairs. dsRNAs produced in cells by processing with dicers and similar enzymes are generally in the 19–22 base pair range. One strand of the double-stranded region of dsDNA contains a sequence substantially complementary to the region of the target RNA. The two strands forming the double-stranded structure may originate from a single RNA molecule having at least one self-complementary region, or they may be generated from two or more distinct RNA molecules.If the double-stranded region is generated from two strands of a single molecule, the molecule may have a double-stranded region separated by a single strand of nucleotides (referred to herein as a “hairpin loop”) between the 3’ end of one strand forming the double-stranded structure and the 5’ end of the other strand. The hairpin loop may consist of at least one unpaired nucleotide; in some embodiments, the hairpin loop may consist of at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, and at least 23 or more unpaired nucleotides. If the two substantially complementary strands of a dsRNA are composed of another RNA molecule, these molecules may be covalently linked, although this is not necessarily required. If the two strands are covalently linked by means other than a hairpin loop, the linking structure is referred to as a “linker”. The term “siRNA” is also used herein to refer to dsRNA as described above.
[0200] In another embodiment, the iRNA agent may be a "single-stranded siRNA" introduced into a cell or organism to inhibit a target mRNA. The single-stranded RNA iRNA ligates to the RISC endonuclease algonaut 2, which then cleaves the target mRNA. Single-stranded siRNAs typically consist of 15 to 30 nucleotides and are chemically modified. Designs and tests of single-stranded siRNAs are described in U.S. Patent No. 8,101,348, and Lima et al., (2012) Cell 150:883-894, the entirety of which is incorporated herein by reference. Any of the antisense nucleotide sequences described herein (e.g., the sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20) may be used as single-stranded siRNA as described herein, or may be used after being chemically modified by the method described in Lima et al., (2012) Cell 150;:883-894.
[0201] In another embodiment, RNA agents are "single-stranded antisense RNA molecules." These molecules are complementary to the sequence within the target mRNA. Single-stranded antisense RNA molecules can inhibit translation in a stoichiometric manner by physically interfering with the translation mechanism by forming base pairs with the mRNA. (See Dias, N. et al., (2002) Mol Cancer Ther 1:347-355.) Alternatively, single-stranded antisense molecules inhibit the target mRNA by hybridizing with the target (hydridizing) and cleaving the target through an RNaseH cleavage event. Single-stranded antisense RNA molecules may be approximately 10 to 30 nucleotides long and have a sequence complementary to the target sequence. For example, a single-stranded antisense RNA molecule may include a sequence that is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides from any one of the antisense nucleotide sequences described herein, such as the sequences provided in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20.
[0202] Those skilled in the art will recognize that the terms “RNA molecule” or “ribonucleic acid molecule” encompass not only naturally expressed or found RNA molecules, but also RNA analogs and derivatives comprising one or more ribonucleotide / ribonucleoside analogs or derivatives described herein or known in the art. Strictly speaking, “ribonucleoside” comprises a nucleoside base and a ribose sugar, and “ribonucleotide” is a ribonucleoside having one, two, or three phosphate moieties. However, the terms “ribonucleoside” and “ribonucleotide” may be considered equivalent in the use herein. RNA may be modified in its nucleic acid base structure or in its ribose phosphate backbone structure, for example, as described below herein. However, molecules comprising ribonucleoside analogs or derivatives must retain the ability to form double helixes. As a non-limiting example, an RNA molecule may also contain at least one modified ribonucleoside, including but not limited to 2'-O-methyl-modified nucleosides, nucleosides containing a 5'-phosphorothioate group, terminal nucleosides linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, locked nucleosides, debased nucleosides, 2'-deoxy-2'-fluoro-modified nucleosides, 2'-amino-modified nucleosides, 2'-alkyl-modified nucleosides, morpholino-nucleosides, phosphoramidates or non-natural base-containing nucleosides, or any combination thereof. Alternatively, an RNA molecule may contain at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, and at least 20 or more modified ribonucleosides totaling the full length of the dsRNA molecule. The modifications do not have to be the same for each of the multiple such modified ribonucleosides in the RNA molecule. In one embodiment, the modified RNA considered for use in the methods and compositions described herein is a peptide nucleic acid (PNA) which has the ability to form the required double-stranded structure, enabling or mediating the specific degradation of target RNA, for example, through the RISC pathway.
[0203] In one embodiment, the modified ribonucleoside includes a deoxyribonucleoside. In such cases, the iRNA agent may include one or more deoxynucleosides, such as a deoxynucleoside overhang or one or more deoxynucleosides within the double-stranded portion of dsRNA. However, it is self-evident that under no circumstances is a double-stranded DNA molecule included in the term "iRNA".
[0204] In one embodiment, RNA interference agents include single-stranded RNA that interacts with a target RNA sequence to induce cleavage of the target RNA. Although we do not wish to be constrained by theory, long double-stranded RNA introduced into cells is degraded into siRNA by a type III endonuclease known as Dicer (Sharp et al., Genes Dev., 2001, Vol. 15, p. 485). Dicer, a ribonuclease-III-like enzyme, processes dsRNA into short interference RNAs of 19-23 base pairs with a characteristic 2-base 3' overhang (Bernstein et al., 2001, Nature, Vol. 409, p. 363). Next, the siRNA is incorporated into an RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA double strand, allowing the complementary antisense strand to induce target recognition (Nykanen et al., 2001, Cell, Vol. 107, p. 309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target, inducing silencing (Elbashir et al., 2001, Genes Dev., Vol. 15, p. 188). Thus, in one embodiment, the present invention relates to single-stranded RNA that facilitates RISC complex formation, resulting in the silencing of a target gene.
[0205] As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the double-stranded structure of an iRNA, such as dsRNA. For example, a nucleotide overhang exists when the 3' end of one strand of dsRNA extends over the 5' end of the other strand, or vice versa. A dsRNA may consist of an overhang of at least one nucleotide; alternatively, the overhang may consist of at least two nucleotides, at least three nucleotides, at least four nucleotides, or at least five or more nucleotides. A nucleotide overhang may consist of or comprise nucleotide / nucleoside analogs, including deoxyribonucleotides / nucleosides. The overhang may be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleotides of the overhang may be located on the 5' end, the 3' end, or both ends of either the antisense or sense strand of the dsRNA.
[0206] In one embodiment, the antisense strand of the dsRNA has 1 to 10 nucleotide overhangs at its 3' and / or 5' ends. In another embodiment, one or more nucleotides in the overhangs are substituted with thiophosphate nucleosides.
[0207] As used herein with respect to dsRNA, the terms “blunted” or “blunt-terminated” mean that a given end of the dsRNA has no unpaired nucleotides or nucleotide analogs, i.e., no nucleotide overhangs. One or both ends of a dsRNA can be blunted. If both ends of a dsRNA are blunted, the dsRNA is said to be blunt-terminated. For clarity, a “blunt-terminated” dsRNA is a dsRNA where both ends are blunted, i.e., there are no nucleotide overhangs at either end of the molecule. In most cases, such a molecule is double-stranded along its entire length.
[0208] The terms “antisense strand” or “guide strand” refer to an iRNA strand, such as a dsRNA, that contains a region substantially complementary to the target sequence. As used herein, the term “regional complementarity” refers to a region on the antisense strand that is substantially complementary to a sequence, such as the target sequence as defined herein. If the complementary region is not perfectly complementary to the target sequence, there may be mismatches in the internal or terminal regions of the molecule. Generally, the most tolerable mismatches are in terminal regions, such as within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.
[0209] The terms “sense strand” or “passenger strand” as used herein refer to an iRNA strand containing a substantially complementary region to the antisense strand region as defined herein.
[0210] In the use of this specification, in one embodiment, the term “SNALP” refers to a stable nucleic acid-lipid particle. SNALP means a lipid vesicle lining the interior of a reducing aqueous solution containing a nucleic acid such as iRNA or a plasmid from which iRNA is transcribed. SNALP is described, for example, in U.S. Patent Publication No. 20060240093, U.S. Patent Publication No. 20070135372, and International Publication No. 2009082817. These applications are incorporated by reference in their entirety.
[0211] "To introduce into cells," in the case of iRNA, means to facilitate or result in its uptake or absorption into cells, as will be understood by those skilled in the art. The absorption or uptake of iRNA may occur through unassisted diffusive or active cellular processes, or by aids or devices. The meaning of this term is not limited to extracellular cells; iRNA may also be "introduced into cells" when the cells are part of a living organism. In such cases, introduction into cells includes delivery to the organism. For example, for intra vivo delivery, iRNA may be injected into a tissue site or administered systemically. In vivo delivery may also be by β-glucan delivery systems, such as those described in U.S. Patent No. 5,032,401 and U.S. Patent No. 5,607,677, and U.S. Patent Publication No. 2005 / 0281781, whose entire contents are incorporated herein by reference. Extracellular introduction into cells includes methods known in the art, such as electroporation and lipofection. Further approaches are described below herein or are known in the art.
[0212] In the use of this specification, the term "modulate expression" means at least partial "inhibition" or partial "activation" of ALAS1 gene expression in cells treated with the iRNA compositions described herein, compared to ALAS1 expression in control cells. Control cells include untreated cells or cells treated with untargeted control iRNAs.
[0213] Terms such as “activate,” “enhance,” “upregulate expression,” and “increase expression” refer, insofar as they refer to the ALAS1 gene, to the extent that they refer to the ALAS1 gene, in this specification to at least partial activation of ALAS1 gene expression, which manifests as an increase in the amount of ALAS1 mRNA isolated from or detected in a first cell or cell group in which the ALAS1 gene is transcribed, where the first cell or cell group is substantially identical to the first cell or cell group but has been treated to increase ALAS1 gene expression compared to a second cell or cell group (control cell) that has not been treated in the same manner.
[0214] In one embodiment, ALAS1 gene expression is activated by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% upon administration of the iRNA described herein. In some embodiments, ALAS1 gene is activated by at least about 60%, 70%, or 80% upon administration of the iRNA discussed herein. In some embodiments, ALAS1 gene expression is activated by at least about 85%, 90%, or 95% or more upon administration of the iRNA described herein. In some embodiments, ALAS1 gene expression is increased by at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 500-fold, or at least 1000-fold in cells treated with the iRNA described herein compared to expression in untreated cells. Activation of expression by small dsRNAs is described, for example, in Li et al., 2006, Proceedings of the National Academy of Sciences (Proc. Natl. Acad. Sci. USA). 103:17337-42, and U.S. Patent No. 20070111963 and U.S. Patent No. 2005226848, respectively, which are each incorporated herein by reference.
[0215] Terms such as “arrest expression,” “inhibit expression,” “downregulate expression,” and “suppress expression” refer, insofar as they refer to the ALAS1 gene, in this specification to at least partial suppression of ALAS1 gene expression, for example, by evaluation based on ALAS1 mRNA expression, ALAS1 protein expression, or another parameter functionally linked to ALAS1 gene expression (e.g., ALA or PBG concentration in plasma or urine). For example, inhibition of ALAS1 expression may manifest as a decrease in the amount of ALAS1 mRNA, which may be isolated from or detected in a first cell or cell population in which the ALAS1 gene is transcribed and treated to inhibit ALAS1 gene expression compared to a control. The control may be a second cell or cell population (control cells) that is substantially identical to the first cell or cell population but has not been treated in the same way. The degree of inhibition is usually, for example,
number
[0216] Alternatively, the degree of inhibition may be expressed in terms of a decrease in parameters functionally linked to ALAS1 gene expression, such as the amount of protein encoded by the ALAS1 gene or the level of one or more porphyrins. The decrease in parameters functionally linked to ALAS1 gene expression may also be expressed as a percentage of the control level. In principle, ALAS1 gene silencing may be determined by any suitable assay in any cell expressing ALAS1, either constitutively or by genomic engineering. However, if a reference is needed to determine whether a given iRNA inhibits ALAS1 gene expression to a particular degree, and therefore whether it is included in the present invention, the assays provided in the examples below would serve as such references.
[0217] For example, in some cases, the expression of the ALAS1 gene is suppressed by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of the iRNA discussed in this invention. In some embodiments, the ALAS1 gene is suppressed by at least about 60%, 65%, 70%, 75%, or 80% by administration of the iRNA discussed in this invention. In some embodiments, the expression of the ALAS1 gene is suppressed by at least about 85%, 90%, 95%, 98%, or 99% or more by administration of the iRNA described herein.
[0218] In the context of ALAS1 expression, terms such as “treat,” “treating,” and “treatment” refer to the reduction or mitigation of pathological processes associated with ALAS1 expression (e.g., pathological processes associated with porphyrins or porphyrin pathway defects, such as porphyria). In the context of the present invention, to the extent that it relates to any of the other medical conditions listed below (other than pathological processes associated with ALAS1 expression), terms such as “treat,” “treatment,” and “treatment” mean to prevent, reduce or mitigate at least one symptom associated with such medical condition, or to delay or reverse the progression or expected progression of such medical condition. For example, the methods described herein, when used to treat porphyria, may help alleviate or prevent one or more symptoms associated with porphyria (e.g., pain), reduce the severity or frequency of porphyria attacks, reduce the likelihood of an attack of one or more symptoms associated with porphyria upon exposure to aggravating conditions, shorten porphyria attacks, and / or reduce the risk of developing porphyria-related conditions (e.g., hepatocellular carcinoma or neuropathy (e.g., progressive neuropathy)). Therefore, unless otherwise clearly stated in the context, terms such as “treat” and “cure” are intended to include preventive measures, such as the prevention of ALAS1 expression-related disorders and / or disorder symptoms.
[0219] "To reduce" in the context of a disease marker or symptom means a statistically or clinically significant decrease in such a level. The reduction could be, for example, at least 10%, at least 20%, at least 30%, or at least 40% or more, and typically falls to a level that is generally recognized as being within the normal range for individuals without such disease.
[0220] In the use of this specification, the terms “therapeutic effective dose” and “preventive effective dose” refer to the amount that provides a therapeutic effect in the treatment, prevention, or management of a pathological process related to ALAS1 expression. The specific therapeutically effective dose can be readily determined by a typical practitioner and may vary depending on factors known in the art, such as the type of pathological process, the patient’s medical history and age, the stage of the pathological process, and the administration of other drugs.
[0221] In the use of this specification, “pharmaceutical composition” comprises a pharmacologically effective amount of iRNA and a pharmaceutically acceptable carrier. In the use of this specification, “pharmacologically effective amount,” “therapeutic effective amount,” or simply “effective amount” means the amount of iRNA that is effective in producing the intended pharmacological, therapeutic, or prophylactic effect. For example, in a method for treating ALAS1 expression-related disease (for example, in a method for treating porphyria), the effective amount could be an amount effective in reducing one or more symptoms associated with porphyria, an amount effective in reducing the frequency of seizures, an amount effective in reducing the likelihood of seizures of one or more symptoms associated with porphyria in response to exposure to an exacerbating factor, or an amount effective in reducing the risk of developing a condition associated with porphyria (e.g., neurological disorders (e.g., progressive neuropathy), hepatocellular carcinoma). For example, if a given clinical treatment is considered effective if there is at least a 10% reduction in a measurable parameter associated with a disease or disorder, the therapeutic effective amount of the drug for that disease or disorder is the amount required to produce at least a 10% reduction in the parameter. For example, a therapeutically effective dose of iRNA targeting ALAS1 can reduce ALAS1 protein levels to any measurable amount, such as at least 10%, 20%, 30%, 40%, or 50%.
[0222] The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to, physiological saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term explicitly excludes cell culture media. For orally administered drugs, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients such as inactive diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorings, and preservatives. Suitable inactive diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrants. Binders include starch and gelatin, while lubricants, if present, are generally magnesium stearate, stearic acid, or talc. If necessary, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. The active ingredients contained in the formulations are described in further detail below.
[0223] When referring to a number or range of numbers, the term "approximately" means that the number or range referred to is an approximation within experimental variation (or within statistical experimental error), and therefore the number or range may vary by, for example, 1% to 15% from the number or range described.
[0224] II. Double-stranded ribonucleic acid (dsRNA) This specification describes iRNA agents that inhibit the expression of the ALAS1 gene. In one embodiment, the iRNA agent comprises a double-stranded ribonucleic acid (dsRNA) molecule for inhibiting ALAS1 gene expression in cells or subjects (e.g., in mammals such as humans with porphyria), wherein the dsRNA comprises an antisense strand having a complementary region complementary to at least a portion of the mRNA formed in ALAS1 gene expression, the complementary region being 30 nucleotides or less in length, generally 19 to 24 nucleotides, and the dsRNA inhibits ALAS1 gene expression by at least 10% in contact with cells expressing the ALAS1 gene, for example by PCR or branched DNA (bDNA) based methods, or by protein-based assays such as Western blotting. In one embodiment, the iRNA agent activates ALAS1 gene expression in cells or mammals. The expression of the ALAS1 gene in cell cultures such as COS cells, HeLa cells, primary cultured hepatocytes, HepG2 cells, and primary cultured cells, or in biological samples from the subject, can be assayed by measuring ALAS1 mRNA levels using bDNA or TaqMan assays, or by measuring protein levels using immunofluorescence analysis, for example, with Western blotting or flow cytometry techniques.
[0225] A dsRNA consists of two RNA strands that are sufficiently complementary and, under the conditions in which the dsRNA is used, hybridize to form a double-stranded structure. One strand of the dsRNA (the antisense strand) contains a complementary region that is substantially complementary to the target sequence, and generally perfectly complementary. The target sequence may originate from the mRNA sequence formed during the expression of the ALAS1 gene. The other strand (the sense strand) contains a region complementary to the antisense strand so that, when combined under appropriate conditions, the two strands hybridize to form a double-stranded structure. Generally, the double-stranded structure is 15–30, more commonly 18–25, even more commonly 19–24, and most commonly 19–21 base pairs long. Similarly, the complementary region with the target sequence is 15–30, more commonly 18–25, even more commonly 19–24, and most commonly 19–21 nucleotides long. In some embodiments, the dsRNA is 15–20 nucleotides long, and in other embodiments, the dsRNA is 25–30 nucleotides long. As those skilled in the art will recognize, the target region of the RNA to be cleaved is in most cases part of a larger RNA molecule, which is often an mRNA molecule. Where applicable, the “part” of the mRNA target is a continuous sequence of mRNA target that is long enough to serve as a substrate for RNAi-directed cleavage (i.e., cleavage via the RISC pathway). Short double-stranded dsRNAs of about 9 base pairs can, in some circumstances, mediate RNAi-directed RNA cleavage. In most cases, the target is at least 15 nucleotides long, e.g., 15–30 nucleotides long.
[0226] Those skilled in the art will also recognize that the double-stranded region is the main functional portion of a dsRNA, such as a double-stranded region of 9 to 36 base pairs, for example, 15 to 30 base pairs. Thus, in one embodiment, an RNA molecule or RNA molecule complex having a double-stranded region of more than 30 base pairs is a dsRNA, insofar as it is processed to become a functional double-stranded region of 15 to 30 base pairs, for example, that cleaves a desired RNA. Thus, those skilled in the art will also recognize in one embodiment that a miRNA is a dsRNA. In another embodiment, a dsRNA is not a native miRNA. In another embodiment, an iRNA agent useful for targeting ALAS1 expression is not generated in the target cell by cleaving a larger dsRNA.
[0227] The dsRNAs described herein may further comprise one or more single-stranded nucleotide overhangs. The dsRNAs may be synthesized by standard methods known in the art, as further discussed below, using an automated DNA synthesizer, such as one commercially available from Biosearch, Applied Biosystems, Inc. In one embodiment, the ALAS1 gene is the human ALAS1 gene. In another embodiment, the ALAS1 gene is the mouse or rat ALAS1 gene. In certain embodiments, the first sequence is the sense strand of the dsRNA, including a sense sequence from Table 2 or Table 3, and the second sequence is the antisense strand of the dsRNA, including an antisense sequence from Table 2 or Table 3. In embodiments, the first sequence is the sense strand of the dsRNA, including a sense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15, and the second sequence is the antisense strand of the dsRNA, including an antisense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15. In the embodiments, the first sequence is a sense strand of dsRNA, including a sense sequence from Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20, and the second sequence is an antisense strand of dsRNA, including an antisense sequence from Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20. Alternative dsRNA agents targeting sequences other than those disclosed herein (e.g., in Tables 2 or 3) can be readily determined using the target sequence and the ALAS1 sequence located laterally.
[0228] In one embodiment, the dsRNA comprises at least sense and antisense nucleotide sequences, and the sense strand is selected from the sequence group provided in Tables 2 and 3, corresponding to the antisense strand of the sense strand selected from Tables 2 and 3. In a further embodiment, the dsRNA comprises at least sense and antisense nucleotide sequences, and the sense strand is selected from the sequence group provided in Tables 2, 3, 6, 7, 8, 9, 14, and 15, corresponding to the antisense strand of the sense strand selected from Tables 2, 3, 6, 7, 8, 9, 14, and 15. In a further embodiment, the dsRNA comprises at least sense and antisense nucleotide sequences, and the sense strand is selected from the sequence group provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20, corresponding to the antisense strand of the sense strand selected from Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20. In these embodiments, one of the two sequences is complementary to the other, and one of the sequences is substantially complementary to the mRNA sequence resulting from the expression of the ALAS1 gene. Thus, the dsRNA comprises two oligonucleotides, the first of which is described as the sense strand in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20, and the second of which is described as the antisense strand corresponding to the sense strand from 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20. As described elsewhere in this specification and as known in the art, the complementary sequence of the dsRNA may also be contained as a self-complementary region of a single nucleic acid molecule, as opposed to that on a separate oligonucleotide.
[0229] Those skilled in the art are well aware that dsRNAs having double-stranded structures of 20–23 base pairs, particularly 21 base pairs, are supported as being especially effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877–6888). However, other those skilled in the art have found that shorter or longer RNA double-stranded structures may be equally effective. In the embodiments described above, due to the nature of the oligonucleotide sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20, the dsRNAs described herein may comprise at least one strand of a minimum length of 21 nucleotides. It can be reasonably foreseen that shorter double-stranded structures having one of the sequences in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20, with only a few nucleotides missing from one or both ends, may be equally effective compared to the dsRNAs described above. Therefore, the present invention intends dsRNAs having partial sequences of at least 15, 16, 17, 18, 19, or 20 consecutive nucleotides from one of the sequences in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20, and which differ in their ability to inhibit ALAS1 gene expression, not exceeding 5, 10, 15, 20, 25, or 30% inhibition of the dsRNA comprising the full-length sequence.
[0230] Furthermore, the RNAs provided in Tables 2 and 3, as well as those provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20, identify sites in the ALAS1 transcript that are highly sensitive to RISC-mediated cleavage. Thus, the present invention further features iRNAs that target within one of such sequences. As used herein, an iRNA is said to target within that specific site of the RNA transcript if it promotes cleavage of the transcript somewhere within a particular site. Such iRNAs generally consist of at least 15 consecutive nucleotides from one of the sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20, which ligate with an additional nucleotide sequence from a region adjacent to a selected sequence in the ALAS1 gene.
[0231] Target sequences are generally 15–30 nucleotides long, but there is a wide range of variation in the suitability of specific sequences within this range to induce cleavage of any given target RNA. The various software packages and guidelines presented herein provide guidance for identifying the optimal target sequence for any given gene target, but an empirical approach can also be taken to identify sequences within a size range that may act as the target sequence by actually or figuratively (including, for example, by computer simulation) placing a “window” or “mask” of a given size (21 nucleotides as an unrestricted example) on the target RNA sequence. By successively moving the sequence “window” one nucleotide upstream or downstream of the initial target sequence position, subsequent potential target sequences can be identified until a complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis of the identified sequences and testing to identify optimally functioning sequences (using assays described herein or known in the art), can identify the RNA sequence that best mediates the inhibition of target gene expression when targeted with an iRNA agent. Therefore, while the sequences identified in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20, for example, represent effective target sequences, it is possible to further optimize inhibition efficiency by identifying sequences with equivalent or better inhibitory properties by sequentially "walking a window" one nucleotide upstream or downstream of a given sequence.
[0232] Furthermore, it is explored that further optimization of any sequence identified in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20 may be achieved by systematically adding or removing nucleotides to create longer or shorter sequences, and then testing these and created sequences by walking a window of size longer or shorter than the target RNA from that position. Again, combining this approach to creating new target candidates with testing the efficacy of iRNAs based on these target sequences in inhibitory assays known in the art or described herein may lead to further improvements in inhibitory efficiency. Moreover, such optimized sequences may be modulated by further optimizing the molecule as an expression inhibitor (e.g., increased serum stability or circulating half-life, increased thermal stability, enhanced transmembrane delivery, targeting of specific sites or cell types, increased interaction with silencing pathway enzymes, increased release from endosomes, etc.) by introducing modified nucleotides described herein or known in the art, adding or changing overhangs, or other modifications known in the art and / or considered herein.
[0233] The iRNAs described herein may contain one or more mismatches with the target sequence. In one embodiment, the iRNAs described herein contain three or fewer mismatches. When the antisense strand of the iRNA contains a mismatch with the target sequence, it is preferable that the mismatch is not located in the center of the complementary region. When the antisense strand of the iRNA contains a mismatch with the target sequence, it is preferable that the mismatch is limited to the last five nucleotides from either the 5' or 3' end of the complementary region. For example, in a 23-nucleotide iRNA agent RNA strand complementary to the ALAS1 gene region, the RNA strand generally does not contain any mismatches within the central 13 nucleotides. Using the methods described herein or methods known in the art, it may be determined whether an iRNA containing a mismatch with the target sequence is effective in inhibiting the expression of the ALAS1 gene. Examining the effectiveness of mismatched iRNAs in inhibiting ALAS1 gene expression is important, especially when a particular complementary region of the ALAS1 gene is known to have polymorphic sequence variations within the population.
[0234] In one embodiment, at least one end of the dsRNA has a single-stranded nucleotide overhang of 1 to 4 nucleotides, generally 1 or 2 nucleotides. dsRNAs having at least one nucleotide overhang exhibit surprisingly superior inhibitory properties compared to their blunt-end counterparts. In yet another embodiment, the RNA of an iRNA, such as dsRNA, is chemically modified to enhance stability or other beneficial properties. The nucleic acids discussed herein may be synthesized and / or modified by methods established in the art, such as those described in "Current protocols in nucleic acid chemistry," edited by Beaucage, S.L. et al., John Wiley & Sons, Inc., New York, New York, USA, etc., which are incorporated herein by reference. Modifications include, for example, (a) terminal modifications such as 5'-end modifications (phosphorylation, conjugation, inversion) and 3'-end modifications (conjugation, DNA nucleotides, inversion, etc.); (b) base modifications such as substitution, base removal (debasing nucleotide), or conjugated bases, for example, at stabilizing bases, at destabilizing bases, or at bases that form base pairs with the repertoire of expanding partners; (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions; and (d) main chain modifications, including modifications or substitutions of phosphate diester bonds. Specific examples of RNA compounds useful in the present invention include, but are not limited to, RNA containing a modified main chain or RNA without natural internucleoside bonds. RNA having a modified main chain is particularly notable for not having a phosphorus atom in the main chain. For the purposes of this specification, and as sometimes referred to in the art, modified RNAs not having a phosphorus atom in their internucleoside main chains are also considered oligonucleosides. In certain embodiments, the modified RNA has a phosphorus atom in its internucleoside backbone.
[0235] Examples of modified RNA backbone include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkylphosphonates including 3'-alkylenephosphonates and chiralphosphonates, phosphinates, phosphoramidates including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages and their 2'-5' linked analogues, and boranophosphates with reverse polarity where adjacent nucleoside unit pairs are linked from 3'-5' to 5'-3' or from 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included.
[0236] Representative U.S. patents teaching the preparation of the phosphorus-containing bond described above are, respectively, U.S. Patent No. 3,687,808; U.S. Patent No. 4,469,863; U.S. Patent No. 4,476,301; U.S. Patent No. 5,023,243; U.S. Patent No. 5,177,195; U.S. Patent No. 5,188,897; U.S. Patent No. 5,264,423; U.S. Patent No. 5,276,019; U.S. Patent No. 5,278,302; and U.S. Patent No. 5,286,717, each of which is incorporated herein by reference. U.S. Patent No. 5,321,131; U.S. Patent No. 5,399,676; U.S. Patent No. 5,405,939; U.S. Patent No. 5,453,496; U.S. Patent No. 5,455,233; U.S. Patent No. 5,466,677; U.S. Patent No. 5,476,925; U.S. Patent No. 5,519,126; U.S. Patent No. 5,536,821; U.S. Patent No. 5,541,316; U.S. Patent No. 5,550,111; U.S. Patent No. 5,563,253; U.S. Patent No. 5,571,79 U.S. Patent No. 9; U.S. Patent No. 5,587,361; U.S. Patent No. 5,625,050; U.S. Patent No. 6,028,188; U.S. Patent No. 6,124,445; U.S. Patent No. 6,160,109; U.S. Patent No. 6,169,170; U.S. Patent No. 6,172,209; U.S. Patent No. 6,239,265; U.S. Patent No. 6,277,603; U.S. Patent No. 6,326,199; U.S. Patent No. 6,346,614; U.S. Patent No. 6,444,423; U.S. Patent No. 6 Examples include, but are not limited to, U.S. Patent No. 31,590; U.S. Patent No. 6,534,639; U.S. Patent No. 6,608,035; U.S. Patent No. 6,683,167; U.S. Patent No. 6,858,715; U.S. Patent No. 6,867,294; U.S. Patent No. 6,878,805; U.S. Patent No. 7,015,315; U.S. Patent No. 7,041,816; U.S. Patent No. 7,273,933; U.S. Patent No. 7,321,029; and U.S. Patent No. RE39464.
[0237] Modified RNA backchains that do not contain a phosphorus atom have backchains formed by short alkyl or cycloalkyl nucleoside bonds, mixed heteroatoms and alkyl or cycloalkyl nucleoside bonds, or one or more short heteroatoms or heterocyclic nucleoside bonds. These include morpholino bonds (partially formed from the sugar portion of nucleosides); siloxane backchains; sulfide, sulfoxide, and sulfone backchains; formacetyl and thioformacetyl backchains; methyleneformacetyl and thioformacetyl backchains; alkene-containing backchains; sulfamate backchains; methyleneimino and methylenehydrazino backchains; sulfonate and sulfonamide backchains; those having amide backchains; and others having mixed N, O, S, and CH2 components.
[0238] Representative U.S. patents teaching the preparation of the above-mentioned oligonucleotides are, respectively, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; and 5,470,967, each of which is incorporated herein by reference. U.S. Patent No. 5,489,677; U.S. Patent No. 5,541,307; U.S. Patent No. 5,561,225; U.S. Patent No. 5,596,086; U.S. Patent No. 5,602,240; U.S. Patent No. 5,608,046; U.S. Patent No. 5,610,289; U.S. Patent No. 5,618,704; U.S. Patent No. 5,623,070; U.S. Patent No. 5,663,312; U.S. Patent No. 5,633,360; U.S. Patent No. 5,677,437; and U.S. Patent No. 5,677,439, among others.
[0239] In other RNA mimetic compounds suitable or considered for use in iRNA, both the sugar and nucleoside linkages of the nucleotide unit backbone are replaced with novel groups. The base unit is maintained for hybridization with a suitable nucleic acid target compound. Such an oligomeric RNA mimetic compound that has been shown to have excellent hybridization properties is called a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleic acid bases are retained and bind directly or indirectly to the aza nitrogen atom of the amide portion of the backbone. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Patent No. 5,539,082; U.S. Patent No. 5,714,331; and U.S. Patent No. 5,719,262, each of which is incorporated herein by reference. Further teachings on PNA compounds can be found in Nielsen et al., Science, 1991, Vol. 254, pp. 1497-1500.
[0240] Some embodiments of the present invention include RNA having a phosphorothioate backbone, and oligonucleosides having a heteroatom backbone which is -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [known as methylene(methylimino) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2-CH2- [natural phosphate diester backbone is represented as -OPO-CH2-] as described in the aforementioned U.S. Patent No. 5,489,677, and an amide backbone as described in the aforementioned U.S. Patent No. 5,602,240. In some embodiments, the RNA described herein has a morpholino backbone structure as described in the aforementioned U.S. Patent No. 5,034,506.
[0241] Modified RNA may also contain one or more substituted sugar moieties. For example, iRNAs such as the dsRNA discussed herein may contain at the 2' position one of OH;F;O-, S-, or N-alkyl;O-, S-, or N-alkenyl;O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl may be substituted or unsubstituted C1-C 10 Alkyl, or C2-C 10 They may also be alkenyls and alkynyls. Exemplary appropriate modifications include O[(CH2) n O] m CH3, O(CH2). n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n One example is CH3)2 (wherein n and m are 1 to approximately 10). In another embodiment, the dsRNA contains one of the following at the 2' position: C1~C 10Lower alkyl groups, substituted lower alkyl groups, alkaryl groups, aralkyl groups, O-alkaryl or O-aralkyl groups, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl groups, heterocycloalkaaryl groups, aminoalkylamino groups, polyalkylamino groups, substituted silyl groups, RNA cleavage groups, reporter groups, interveners, groups that improve the pharmacokinetic properties of iRNA, or groups that improve the pharmacodynamic properties of iRNA, and other substituents having similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helvetica Chim. Acta, 1995, Vol. 78, pp. 486-504), i.e., alkoxy-alkoxy groups. Other exemplary modifications include 2'-dimethylaminooxyethoxy, i.e., the O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described below in the examples herein, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2, as also described below in the examples herein.
[0242] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), and 2'-fluoro (2'-F). Similar modifications can also occur at other positions on the iRNA, specifically at the 3' position of the sugar on the 3' terminal nucleotide, or in the 2'-5' linked dsRNA, and at the 5' position of the 5' terminal nucleotide. The iRNA may also have sugar mimetic molecules such as cyclobutyl moieties instead of pentofuranosyl sugars. Representative U.S. patents teaching the preparation of the above-mentioned modified sugar structures are incorporated herein by reference, and certain of which are owned in the same place as this application: U.S. Patent No. 4,981,957; U.S. Patent No. 5,118,800; U.S. Patent No. 5,319,080; U.S. Patent No. 5,359,044; U.S. Patent No. 5,393,878; U.S. Patent No. 5,446,137; U.S. Patent No. 5,466,786; U.S. Patent No. 5,514,785; U.S. Patent No. 5,519,134. Examples of U.S. patents include, but are not limited to, U.S. Patent Nos. 5,567,811, 5,576,427, 5,591,722, 5,597,909, 5,610,300, 5,627,053, 5,639,873, 5,646,265, 5,658,873, 5,670,633, and 5,700,920.
[0243] iRNAs may also include modifications or substitutions of nucleic acid bases (often simply referred to as “bases” in the art). In the use of this specification, “unmodified” or “natural” nucleic acid bases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleic acid bases include 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2-thiocytosine; 5-halouracil and cytosine; 5-propynyluracil and cytosine; 6-azouracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thio Examples include uracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines; 5-halo, specifically 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and 7-daazaadenine; and other synthetic and natural nucleic acid bases such as 3-deazaguanine and 3-deazaadenine.Furthermore, nucleic acid bases are disclosed in U.S. Patent No. 3,687,808, "Modified Nucleosides in Biochemistry, Biotechnology and Medicine," edited by Herdewijn, P., Wiley-VCH, 2008; "The Concise Encyclopedia of Polymer Science and Engineering," pp. 858-859, edited by Kroschwitz, JL, John Wiley & Sons, 1990; disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, Vol. 30, p. 613; and Sanghvi, Y. This is disclosed in S., Chapter 15, “dsRNA Research and Applications,” pp. 289-302, edited by Crooke, ST. and Lebleu, B., CRC Press, 1993. Some of these nucleic acid bases are particularly useful for increasing the binding affinity of the oligomeric compounds discussed in this invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine.5-methylcytosine substitution has been shown to increase nucleic acid double-strand stability by 0.6–1.2°C (Sanghvi, Y.S., Crooke, ST., and Lebleu, B., eds., "dsRNA Research and Applications," CRC Press, Boca Raton, 1993, pp. 276–278), making it an exemplary base substitution, and even more so when combined with 2'-O-methoxyethyl sugar modification.
[0244] Representative U.S. patents teaching the preparation of the specific modified nucleic acid bases and other modified nucleic acid bases mentioned above include U.S. Patent No. 3,687,808, and, as each of them is incorporated herein by reference, U.S. Patents No. 4,845,205; U.S. Patent No. 5,130,30; U.S. Patent No. 5,134,066; U.S. Patent No. 5,175,273; U.S. Patent No. 5,367,066; U.S. Patent No. 5,432,272; U.S. Patent No. 5,457,187; U.S. Patent No. 5,459,255; U.S. Patent No. 5,484,908; U.S. Patent No. 5,502,177; U.S. Patent No. 5,525,711; U.S. Patent No. 5,552,540; U.S. Patent No. 5,587,469; U.S. Patent No. 5,594 U.S. Patent Nos. 121, 5,596,091; U.S. Patent Nos. 5,614,617; U.S. Patent Nos. 5,681,941; U.S. Patent Nos. 6,015,886; U.S. Patent Nos. 6,147,200; U.S. Patent Nos. 6,166,197; U.S. Patent Nos. 6,222,025; U.S. Patent Nos. 6,235,887; U.S. Patent Nos. 6,380,368; U.S. Patent Nos. 6,528,640; U.S. Patent Nos. 6,639,062; U.S. Patent Nos. 6,617,438; U.S. Patent Nos. 7,045,610; U.S. Patent Nos. 7,427,672; and U.S. Patent Nos. 7,495,088, and U.S. Patent No. 5,750,692, which is also incorporated herein by reference.
[0245] The RNA of iRNA can also be modified to include one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety, in which the ribose moiety includes additional crosslinks connecting the 2' and 4' carbon atoms. This structure effectively "locks" the ribose within the 3'-end conformation. The addition of locked nucleic acids to siRNA has been shown to increase siRNA stability in serum and reduce nonspecific effects (Elmen, J. et al., 2005, Nucleic Acids Research, Vol. 33, No. 1, pp. 439-447; Mook, O. et al., 2007, Molecular Cancer Therapeutics, Vol. 6, No. 3, pp. 833-843; Grunweller, A. et al., 2003, Nucleic Acids Research, Vol. 31, No. 12, pp. 3185-3193).
[0246] Representative U.S. patents teaching the preparation of locked nucleic acid nucleotides include, but are not limited to, U.S. Patent No. 6,268,490; U.S. Patent No. 6,670,461; U.S. Patent No. 6,794,499; U.S. Patent No. 6,998,484; U.S. Patent No. 7,053,207; U.S. Patent No. 7,084,125; and U.S. Patent No. 7,399,845, each of which is incorporated herein by reference in its entirety.
[0247] Potential stabilization modifications to the ends of RNA molecules include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyluridine-3''-phosphate, and the reversed base dT (idT). These modifications are disclosed in International Publication No. 2011 / 005861.
[0248] iRNA motif In one embodiment, the sense strand sequence is: Equation (I), 5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' (I) (In the formula, i and j are independently either 0 or 1; p and q are independently between 0 and 6; each N a Each represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, where each sequence contains at least two different modified nucleotides; each N b This independently represents an oligonucleotide sequence containing 0 to 10 modified nucleotides; each N p and N q This independently represents an overhanging nucleotide; Nb and Y do not have the same modifications; XXX, YYY, and ZZZ may each be represented independently by (representing one motif of three identical modifications of three consecutive nucleotides). Preferably, all YYY are 2'-F modified nucleotides.
[0249] In one embodiment, N a and / or N b It consists of alternating pattern modifications.
[0250] In one embodiment, the YYY motif occurs at or near the sense strand cleavage site. For example, if the RNAi agent has a double-stranded region of 17-23 nucleotides in length, the YYY motif may occur at or near the sense strand cleavage site (for example, starting from the first nucleotide at the 5' end, or optionally starting from the first paired nucleotide at the 5' end within the double-stranded region, it may occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12; or 11, 12, 13).
[0251] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. Therefore, the sense chain is formula, 5'n p -N a -YYY-N b -ZZZ-N a -n q 3'(Ib); 5'n p -N a -XXX-N b -YYY-N a -n q 3'(Ic); or 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3'(Id) It can be represented by:
[0252] If the sense chain is represented by formula (Ib), then N b This represents an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. aThis can independently represent an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0253] If the sense chain is represented by formula (Ic), then N b This represents an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. a This can independently represent an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0254] If the sense chain is represented by formula (Id), then N b This independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. Preferably, N b is 0, 1, 2, 3, 4, 5, or 6. a This can independently represent an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0255] Each of X, Y, and Z may be the same as or different from one another.
[0256] In another embodiment, i is 0 and j is 0, and the sense chain is formula, 5'N p -N a -YYY-N a -N q 3' (Ia) It may also be represented by [this].
[0257] If the sense chain is represented by equation (Ia), then each N a This can independently represent an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0258] In one embodiment, the sequence of the RNAi antisense strand is: Formula (II), 5’n q ’-N a ’-(Z’Z’Z’) k -N b ’-Y’Y’Y’-N b ’-(X’X’X’) l -N’ a -n p ’3’ (II) (wherein, k and l are each independently 0 or 1; p’ and q’ are each independently 0 to 6; each N a ’ represents an oligonucleotide sequence comprising 0 to 25 modified nucleotides, and each sequence comprises at least two different modified nucleotides; each N b ’ represents an oligonucleotide sequence comprising 0 to 10 modified nucleotides; each N p ’ and N q ’ each independently represent overhang nucleotides; N b ’ and Y’ do not have the same modification; X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications of three consecutive nucleotides) may be represented by.
[0259] In one embodiment, N a ’ and / or N b ’ comprises a modification in an alternating pattern.
[0260] The Y’Y’Y’ motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a double-stranded region 17 to 23 nucleotides in length, the Y’Y’Y’ motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14 counting from the first nucleotide at the 5’ end, or optionally, counting from the first paired nucleotide at the 5’ end within the double-stranded region, or at positions 13, 14, 15 of the antisense strand. Preferably, the Y’Y’Y’ motif occurs at positions 11, 12, 13.
[0261] In one embodiment, the Y’Y’Y’ motif consists of nucleotides that are all 2’-OMe modified.
[0262] In one embodiment, k is 1 and l is zero, or k is zero and l is 1; or both k and l are 1.
[0263] Thus, the antisense strand can be of the formula 5’n q ’-N a ’-Z’Z’Z’-N b ’-Y’Y’Y’-N a ’-n p ’3’ (IIb); 5’n q ’-N a ’-Y’Y’Y’-N b ’-X’X’X’-n p ’3’ (IIc); or 5’n q ’-N a ’-Z’Z’Z’-N b ’-Y’Y’Y’-N b ’-X’X’X’-N a ’-n p ’3’ (IId) and can be represented by
[0264] When the antisense strand is represented by formula (IIb), N b' represents an oligonucleotide sequence consisting of 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. a ' independently represents an oligonucleotide sequence consisting of 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0265] If the antisense chain is represented by equation (IIc), then N b ' represents an oligonucleotide sequence consisting of 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. a ' independently represents an oligonucleotide sequence consisting of 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0266] If the antisense chain is represented by equation (IId), then N b ' independently represents an oligonucleotide sequence consisting of 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. a ' independently represents an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. Preferably, N b It is 0, 1, 2, 3, 4, 5, or 6.
[0267] In another embodiment, k is 0 and l is 0, and the antisense chain is formula, 5'n p '-N a '-Y'Y'Y'-N a '-n q '3' (Ia) It may also be represented by [this].
[0268] If the antisense chain is represented by equation (IIa), then each N a ' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0269] Each of X', Y', and Z' may be identical to or different from one another.
[0270] Each nucleotide in the sense and antisense strands may be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, or 2'-fluoro. For example, each nucleotide in the sense and antisense strands may be independently modified with 2'-O-methyl or 2'-fluoro. Each X, Y, Z, X', Y', and Z' may, in particular, represent a 2'-O-methyl modification or a 2'-fluoro modification.
[0271] In one embodiment, the sense strand of the RNAi agent may contain YYY motifs occurring at positions 9, 10, and 11 of the strand, starting from the first nucleotide at the 5' end, or optionally, starting from the first paired nucleotide at the 5' end within the double-stranded region, if the double-stranded region is 21nt; Y represents a 2'-F modification. The sense strand may further contain an XXX motif or a ZZZ motif as a wing-like modification at the opposite end of the double-stranded region. XXX and ZZZ independently represent a 2'-OMe modification or a 2'-F modification, respectively.
[0272] In one embodiment, the antisense strand may contain a Y'Y'Y' motif occurring at positions 11, 12, and 13 of the strand, counting from the first nucleotide at the 5' end, or optionally from the first paired nucleotide at the 5' end of the double-stranded region; where Y' represents a 2'-O-methyl modification. The antisense strand may further contain an X'X'X' motif or a Z'Z'Z' motif as a wing-like modification at the opposite end of the double-stranded region; and X'X'X' and Z'Z'Z' independently represent a 2'-OMe modification or a 2'-F modification.
[0273] A sense strand represented by any one of the above equations (Ia), (Ib), (Ic), and (ID) forms a double helix with an antisense strand represented by any one of the above equations (IIa), (IIb), (IIc), and (IId).
[0274] Therefore, the RNAi agent used in the method of the present invention may include a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, and the RNAi double strand is Formula (III), Sense: 5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5' (III) (In the formula, i, j, k, and l are each independently either 0 or 1; p, p', q, and q' are each independently between 0 and 6; each N a and N a ' independently represents an oligonucleotide sequence comprising 0 to 25 modified nucleotides, where each sequence comprises at least two different modified nucleotides; each N b and N b ' independently represents an oligonucleotide sequence containing 0 to 10 modified nucleotides; Each of them may or may not exist, for each n p ',n p , n q ', and n qThis independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent a single motif of three identical modifications of three consecutive nucleotides. It is represented by [this].
[0275] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 1 and j is 0; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or both k and l are 0; or both k and l are 1.
[0276] The following formula is an example of a sense strand and antisense strand combination that forms an RNAi double helix. 5'n p -N a -YYY-N a -n q 3' 3'n p '-N a '-Y'Y'Y'-N a 'n q '5' (IIIa) 5'n p -N a -YYY-N b -ZZZ-N a -n q 3' 3'n p '-N a '-Y'Y'Y'-N b '-Z'Z'Z'-N a 'n q '5' (IIIb) 5'n p -N a -XXX-N b -YYY-N a -n q 3' 3'n p '-N a '-X'X'X'-Nb '-Y'Y'Y'-N a '-n q '5' (IIIc) 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' 3'n p '-N a '-X'X'X'-N b '-Y'Y'Y'-N b '-Z'Z'Z'-N a -n q '5' (IIId)
[0277] When an RNAi agent is represented by formula (IIIa), each N a This independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0278] When an RNAi agent is represented by formula (IIIb), each N b Each N independently represents an oligonucleotide sequence containing 1-10, 1-7, 1-5, or 1-4 modified nucleotides. a This independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0279] When an RNAi agent is represented by formula (IIIc), each N b , N b ' independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. a This independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0280] When an RNAi agent is represented by formula (IIId), each N b , N b' independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. a , N a ' independently represents an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides. a , N a ', N b andN b Each of these consists of an alternating pattern of modifications, independently.
[0281] In equations (III), (IIIa), (IIIb), (IIIc), and (IIId), X, Y, and Z may be identical or different from each other.
[0282] If the RNAi agent is represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId), then at least one Y nucleotide may base-pair with one of the Y' nucleotides. Alternatively, at least two Y nucleotides may base-pair with the corresponding Y' nucleotides; or all three Y nucleotides may base-pair with the corresponding Y' nucleotides.
[0283] If the RNAi agent is represented by formula (IIIb) or (IIId), then at least one Z nucleotide may base-pair with one of the Z' nucleotides. Alternatively, at least two Z nucleotides may base-pair with the corresponding Z' nucleotides; or all three Z nucleotides may base-pair with the corresponding Z' nucleotides.
[0284] If the RNAi agent is represented by formula (IIIc) or (IIId), then at least one of the X nucleotides may form a base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides may form base pairs with the corresponding X' nucleotides; or all three of the X nucleotides may form base pairs with the corresponding X' nucleotides.
[0285] In one embodiment, modifications on the Y nucleotide differ from modifications on the Y' nucleotide, modifications on the Z nucleotide differ from modifications on the Z' nucleotide, and / or modifications on the X nucleotide differ from modifications on the X' nucleotide.
[0286] In one embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is a 2'-O-methyl or 2'-fluoro modification. In another embodiment, if the RNAi agent is represented by formula (IIId), then N a The modifications are 2'-O-methyl or 2'-fluoro modifications, N p '>0 and at least one n p ' is linked to an adjacent nucleotide by a phosphorothioate bond. In yet another embodiment, if the RNAi agent is represented by formula (IIId), N a The modifications are 2'-O-methyl or 2'-fluoro modifications, n p '>0 and at least one n p ' is conjugated to one or more GalNAc derivatives, which are linked to adjacent nucleotides by phosphorothioate bonds, and the sense strand is attached via a divalent or trivalent branched linker. In yet another embodiment, if the RNAi agent is represented by formula (IIId), N a The modifications are 2'-O-methyl or 2'-fluoro modifications, n p '>0 and at least one n p ' is linked to an adjacent nucleotide by a phosphorothioate bond, and the sense strand comprises at least one phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker.
[0287] In one embodiment, when the RNAi agent is represented by formula (IIIa), N a The modifications are 2'-O-methyl or 2'-fluoro modifications, n p '>0 and at least one n p' is linked to an adjacent nucleotide by a phosphorothioate bond, and the sense strand comprises at least one phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker.
[0288] In one embodiment, the RNAi agent is a multimer containing at least two double-stranded molecules represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId), the double-stranded molecules being linked by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further comprises ligands. Each of the double-stranded molecules may target the same gene or two different genes; or each of the double-stranded molecules may target the same gene at two different target sites.
[0289] In one embodiment, the RNAi agent is a multimer containing three, four, five, or six or more double strands represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId), where the double strands are linked by linkers. The linkers may be cleavable or non-cleavable. Optionally, the multimer further comprises ligands. Each double strand may target the same gene or two different genes; or each double strand may target the same gene at two different target sites.
[0290] In one embodiment, two RNAi agents represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at one or both of their 5' and 3' ends and optionally coupled to a ligand. Each of the agents may target the same gene or two different genes; or each of the agents may target the same gene at two different target sites.
[0291] iRNA complex The iRNA agents disclosed herein may be in the form of complexes. These complexes may be attached to any suitable position on the iRNA molecule, such as the 3' or 5' end of the sense or antisense strand. The complexes may optionally attach via linkers.
[0292] In some embodiments, the iRNA agents described herein may be chemically linked with one or more ligands, moieties, or complexes to impart functionality, for example, by influencing (e.g., promoting) activity, cell distribution, or intracellular uptake. Such moieties include cholesterol moieties (Letsinger et al., Proceedings of the National Academy of Sciences, 1989, 86:6553-6556), cholic acid (Manoharan et al., Bioorganic & Medicinal Chemistry Letters, 1994, 4:1053-1060), and thioethers such as beryl-S-tritylthiol (Manoharan et al.). n et al., Proceedings of the New York Academy of Science (Ann.NYAcad.Sci.), 1992, 660:306-309; Manoharan et al., Bioorganic & Medicinal Chemistry Letters (Biorg.Med.Chem.Let.), 1993, 3:2765-2770, Thiocholesterol (Oberhauser et al., Nucleic Acid Research (Nucl.Acids) (Res.), 1992, 20:533-538), for example, aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., European Molecular Biology Journal (EMBO J), 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), for example, phospholipids such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Letters) Lett.), 1995, 36:3651-3654; Shea et al., Nucleic Acid Research.), 1990, 18:3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., Journal of Pharmacology Experimental). Examples include, but are not limited to, the lipid portion of therapeutics (J. Pharmacol. Exp. Ther., 1996, 277:923-937).
[0293] In one embodiment, the ligand alters the distribution, targeting, or lifespan of the iRNA agent into which it is incorporated. In some embodiments, the ligand provides improved affinity to selected targets, such as molecules, cells, or cell types (e.g., hepatocytes, such as hepatocytes), compartments (e.g., intracellular or intraorganic compartments), tissues, organs, or regions of the body, compared to chemical species in which such a ligand is absent. Typical ligands do not participate in double-strand pairing in double-stranded nucleic acids.
[0294] Ligands may include natural substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or lipids. Ligands may also be recombinant or synthetic molecules, such as synthetic polymers, including synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphatidine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptide-mimicking polyamines, dendrimer polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, polyamine quaternary salts, or α-helical peptides.
[0295] The ligand may also include a targeting group such as an antibody that binds to a specific cell type, such as kidney cells, or a cell or tissue targeting agent, such as a lectin, glycoprotein, lipid, or protein. The targeting group may be thyroid-stimulating hormone, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyhydric lactose, polyhydric galactose, N-acetyl-galactosamine, N-acetylglucosamine, polyhydric mannose, polyhydric fucose, glycosylated polyamino acids, polyhydric galactose, transferrin, bisphosphonate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folic acid, vitamin B12, biotin, or RGD peptide or RGD peptide mimetic.
[0296] In some embodiments, the ligand is a GalNAc ligand comprising one or more N-acetylgalactosamine (GalNAc) derivatives. An additional description of GalNAc ligand complexes is provided in the section titled Carbohydrate Complexes.
[0297] Other examples of ligands include dyes, inserts (e.g., acridine), crosslinking agents (e.g., psoralene, mitomycin C), porphyrins (TPPC4, texaphylline, saffrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantane acetate, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl) lithoglycerol Examples include lic acid, O3-(oleoyl)colenic acid, dimethoxytrityl, or phenoxazine) and peptide complexes (e.g., Antennapedia peptide, Tat peptide), alkylating agents, phosphates, amino acids, mercaptos, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino acids, alkyls, substituted alkyls, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole complexes, Eu3+ complexes of tetraaza macrocyclic compounds), dinitrophenyl, HRP, or AP.
[0298] Ligands can be proteins, such as glycoproteins; peptides, such as molecules with specific affinity for co-ligands; or antibodies, such as antibodies that bind to a specified cell type, such as cancer cells, endothelial cells, or osteocytes. Ligands may also include hormones and hormone receptors. They may also include lipids, lectins, carbohydrates, vitamins, cofactors, and non-peptide chemical species such as polyhydric lactose, polyhydric galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyhydric mannose, or polyhydric fucose. Ligands can be lipopolysaccharides, p38 MAP kinase activators, or NF-κB activators, for example.
[0299] Ligands can be substances such as drugs that can increase the uptake of iRNA agents into cells by disrupting, for example, the cellular microtubules, microfibrils, and / or intermediate filaments, or by disrupting the cellular cytoskeleton. Drugs may include, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latruncrine A, phalloidin, swinford A, indanosine, or myoserbine.
[0300] In some embodiments, ligands that attach to iRNAs as described herein function as pharmacokinetic modifiers (PK modifiers). Examples of PK modifiers include lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, and vitamins. Exemplary PK modifiers include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, and biotin. Oligonucleotides containing several phosphorothioate bonds are also known to bind to serum proteins, and therefore, for example, short-chain oligonucleotides such as approximately 5-base, 10-base, 15-base, or 20-base oligonucleotides containing multiple phosphorothioate bonds in the main chain are also suitable as ligands (e.g., as PK modulating ligands) in the present invention. In addition, aptamers that bind to serum components (e.g., serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.
[0301] The ligand-conjugated oligonucleotide of the present invention may be synthesized using oligonucleotides having pendant-reactive functional groups, such as those derived from the addition of a binding molecule onto the oligonucleotide (described below). These reactive oligonucleotides may be reacted directly with commercially available ligands, synthesized ligands having any of the various protecting groups, or ligands having a binding portion attached thereto.
[0302] The oligonucleotides used in the complexes of the present invention may, conveniently and conventionally, be produced through well-known solid-phase synthesis techniques. Apparatus for such synthesis is available from several suppliers, including Applied Biosystems (Foster City, California). Alternatively, any other means of synthesis known in the art may be used. It is also known that other oligonucleotides, such as phosphorothioates and alkylated derivatives, can be prepared using similar techniques.
[0303] In the ligand-conjugated oligonucleotides and sequence-specific binding nucleosides having ligand molecules of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer using standard nucleotide or nucleoside precursors, or nucleotide or nucleoside complex precursors already having a binding site, or ligand-nucleotide or nucleoside complex precursors already having a binding site, or basic units having a non-nucleoside ligand.
[0304] When a nucleotide complex precursor already containing a binding site is used, the synthesis of a sequence-specific binding nucleoside is typically completed, and then the ligand molecule reacts with the binding site to produce a ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or binding nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside complexes, in addition to commercially available and conventionally used standard and non-standard phosphoramidites in oligonucleotide synthesis.
[0305] lipid complex In one embodiment, the ligand is a lipid or lipid-based molecule. Such lipids or lipid-based molecules can typically bind to serum proteins such as human serum albumin (HSA). HSA-binding ligands enable the distribution of the complex to target tissues, such as non-renal target tissues of the body. Target tissues, for example, may be the liver, including the parenchymal cells of the liver. Other molecules that can bind to HSA can also be used as ligands. For example, neproxine or aspirin can be used. Lipids or lipid-based ligands can be used to (a) increase the degradation resistance of the complex, (b) increase the targeting of target cells or cell membranes, or increase transport into them, and / or (c) modulate the binding of serum proteins, such as HSA.
[0306] Lipid-based ligands can be used for modulation, such as controlling (e.g., inhibiting) the binding of the complex to target tissues. For example, lipids or lipid-based ligands that bind more strongly to HSA are less likely to be targeted to the kidney and therefore less likely to be removed from the body. Lipids or lipid-based ligands that bind more weakly to HSA can be used to target the complex to the kidney.
[0307] In one embodiment, a lipid-based ligand binds to HSA. For example, the ligand may bind to HSA with sufficient affinity to improve the distribution of the complex to non-renal tissues. However, the affinity is typically not strong enough to prevent the HSA-ligand binding from being reversed.
[0308] In another embodiment, the lipid-based ligand may bind weakly to or not bind at all to the HSA to improve the distribution of the complex to the kidney. Other parts that target renal cells may also be used instead of, or in addition to, the lipid-based ligand.
[0309] In another embodiment, ligands are portions of vitamins, for example, that are taken up by target cells, such as proliferating cells. These are particularly useful in treating disorders characterized by unwanted cell proliferation, such as malignant or non-malignant forms, including cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include B vitamins such as folic acid, B12, riboflavin, biotin, and pyridoxal, or other vitamins or nutrients taken up by cancer cells. HSA and low-density lipoprotein (LDL) are also examples.
[0310] Cell permeabilizing agent In another embodiment, the ligand is a cell permeabilizer, such as a helical cell permeabilizer. In one embodiment, the agent is amphiphilic. Exemplary cell permeabilizers are peptides such as tat or antennopedia. If the cell permeabilizer is a peptide, it can be modified, including the use of peptidyl mimes, inverted isomers, non-peptide or pseudopeptide bonds, and D-amino acids. The helical agent is typically an α-helical agent and may have lipophilic and oleophobic phases.
[0311] The ligand may be a peptide or a peptide mimetic. Peptidimides (also referred to herein as oligopeptide mimes) are molecules that resemble natural peptides and can fold into a defined three-dimensional structure. The addition of peptides and peptide mimes to iRNA agents can affect the pharmacokinetic distribution of the iRNA, such as by enhancing cell recognition and absorption. The peptide or peptide mimetic moiety may be approximately 5 to 50 amino acids long, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
[0312] Peptides or peptide mimetic drugs can be, for example, cell-penetrating peptides, cationic peptides, amphiphilic peptides, or hydrophobic peptides (e.g., mainly composed of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, a bound peptide, or a cross-linked peptide. Alternatively, the peptide moiety may contain a hydrophobic membrane-transfer sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF with the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 3367). RFGF analogues containing hydrophobic MTS (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 3368)) can also be target moieties. The peptide moiety can be a “delivery” peptide capable of transporting a number of polar molecules, including peptides, oligonucleotides, and proteins, across the cell membrane. Sequences from, for example, HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 3369)) and Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 3370)) have been shown to function as delivery peptides. Peptides or peptide mimetic drugs can be encoded by random sequences of DNA, such as peptides identified from phage-display libraries or one-bead-one-compound (OBOC) combinatorial libraries (Lam et al., Nature, 354:82-84, 1991). Typically, peptides or peptide mimetic drugs, anchored to dsRNA agents via integrated monomer units, are cell-targeted peptides such as arginine-glycine-aspartate (RGD) peptides or RGD mimetic drugs. The peptide moiety can range in length from approximately 5 to 40 amino acids. The peptide moiety may have structural modifications that increase stability or induce conformational properties. Any of the structural modifications described below may be used.
[0313] The RGD peptides used in the compositions and methods of the present invention may be linear or cyclic, and may be modified, for example, by glycosylation or methylation to facilitate targeting to specific tissues. Examples of RGD-containing peptides and peptide mimetic agents include D-amino acids and synthetic RGD mimetic agents. In addition to RGD, other moieties that target integrin ligands may be used. Preferred ligand complexes target PECAM-1 or VEGF.
[0314] The RGD peptide moiety can be used to target specific cell types, such as tumor cells like endothelial tumor cells or breast cancer tumor cells (Zitzmann et al., Cancer Res., 62:5139-43, 2002). RGD peptides can facilitate the targeting of dsRNA agents to tumors in a variety of other tissues, including the lungs, kidneys, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Typically, RGD peptides facilitate the targeting of iRNA agents to the kidneys. RGD peptides can be linear or cyclic and can be modified, for example, by glycosylation or methylation, to facilitate targeting of specific tissues. For example, glycosylated RGD peptides can be α V iRNA agents can be delivered to tumor cells expressing s3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001).
[0315] "Cell-permeable peptides" can penetrate cells such as microbial cells, including bacterial or fungal cells, or mammalian cells, including human cells. Microbial cell-permeable peptides may be, for example, α-helical linear peptides (e.g., LL-37 or ceropin P1), disulfide bond-containing peptides (e.g., α-defensin, β-defensin, or bactenesin), or peptides containing only one or two major amino acids (e.g., PR-39 or indolicidine). Cell-permeable peptides may also contain nuclear localization signals (NLS). For example, cell-permeable peptides may be bifidopphimotic peptides such as MPG, derived from the fusion peptide domain of HIV-1 gp41 and the NLS of the SV40 large T antigen (Simeoni et al., Nucleic Acids Res., Vol. 31, pp. 2717-2724, 2003).
[0316] Carbohydrate complex In some embodiments of the compositions and methods of the present invention, the iRNA oligonucleotide further comprises a carbohydrate. Carbohydrate-conjugated iRNAs are advantageous for the in vivo delivery of nucleic acids and compositions suitable for in vivo therapeutic applications, as described herein. As used herein, “carbohydrate” means a carbohydrate itself, which consists of one or more monosaccharide units (which may be linear, branched, or cyclic) having at least six carbon atoms, each having an oxygen, nitrogen, or sulfur atom bonded to each carbon atom; or a compound having a carbohydrate moiety as part thereof, which consists of one or more monosaccharide units (which may be linear, branched, or cyclic) having at least six carbon atoms, each having an oxygen, nitrogen, or sulfur atom bonded to each carbon atom. Typical carbohydrates include sugars (monosaccharides, disaccharides, trisaccharides, and oligosaccharides containing about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starch, glycogen, cellulose, and polysaccharide gums. Examples of specific monosaccharides include sugars with 5 or more C molecules (e.g., C5, C6, C7, or C8); disaccharides include sugars having 2 or 3 monosaccharide units (e.g., C5, C6, C7, or C8).
[0317] In one embodiment, the carbohydrate complex comprises a monosaccharide. In one embodiment, the monosaccharide is N-acetylgalactosamine (GalNAc). The GalNAc complex is described, for example, in U.S. Patent No. 8,106,022, which is incorporated herein by reference in its entirety. In some embodiments, the GalNAc complex acts as a ligand that targets iRNA to specific cells. In some embodiments, the GalNAc complex targets iRNA to hepatocytes by acting as a ligand for the asialoglycoprotein receptor in hepatocytes (e.g., hepatocytes).
[0318] In some embodiments, the carbohydrate complex comprises one or more GalNAc derivatives. The GalNAc derivatives may be attached via linkers, such as divalent or trivalent branched linkers. In some embodiments, the GalNAc complex is conjugated to the 3' end of the sense strand. In some embodiments, the GalNAc complex is conjugated to the iRNA agent (e.g., to the 3' end of the sense strand) via a linker, such as a linker described herein.
[0319] In some embodiments, the GalNAc complex is [ka] That is the case.
[0320] In some embodiments, the RNAi agent attaches to the carbohydrate complex via a linker, for example, where X is O or S, as shown in the schematic diagram below. [ka]
[0321] In some embodiments, the RNAi agent is conjugated to L96, as defined in Table 1 and shown below. [ka]
[0322] In some embodiments, the carbohydrate complex used in the compositions and methods of the present invention is [ka] [ka] [ka] [ka] [ka] [ka] It is selected from the group consisting of the following.
[0323] Another representative carbohydrate complex for use in the embodiments described herein is: [ka] (In the formula, (One of X or Y is an oligonucleotide, and the other is hydrogen.) These are some examples, but are not limited to them.
[0324] In some embodiments, the carbohydrate complex further comprises one or more of the above-mentioned additional ligands, such as but not limited to PK regulators and / or cell-permeable peptides.
[0325] In one embodiment, the iRNA of the present invention is coupled to a carbohydrate via a linker. Non-limiting examples of iRNA carbohydrates coupled to the linker of the composition and method of the present invention include: [ka] [ka] (In the formula, (One of X or Y is an oligonucleotide, and the other is hydrogen.) These are some examples, but are not limited to them.
[0326] Linker In some embodiments, the complexes or ligands described herein may be attached to the iRNA oligonucleotide by various linkers, which may be cleavable or incleavable.
[0327] The term "linker" or "linking group" refers to an organic part that connects two parts of a compound, such as by covalently bonding two parts of the compound. Linkers are typically directly bonded; or atoms such as oxygen or sulfur; units such as NR8, C(O), C(O)NH, SO, SO2, SO2NH; or substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkyl Roaryl alkenyl, alkenyl heteroaryl alkinyl, alkinyl heteroaryl alkyl, alkinyl heteroaryl alkenyl, alkinyl heteroaryl alkinyl, alkyl heterocyclyl alkyl, alkyl heterocyclyl alkenyl, alkyl herrerocyclyl alkinyl, alkenyl heterocyclyl alkyl, alkenyl heterocyclyl alkenyl, alkenyl heterocyclyl alkinyl, alkinyl heterocyclyl alkyl, alkinyl heterocyclyl alkenyl, alkinyl heterocyclyl The atom comprises an atomic chain including, but not limited to, krylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, and one or more methylene groups may be interrupted or terminated by O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocyclic compounds, where R8 is hydrogen, acyl, aliphatic, or substituted aliphatic.In one embodiment, the linker consists of approximately 1 to 24 atoms, 2 to 24, 3 to 24, 4 to 24, 5 to 24, 6 to 24, 6 to 18, 7 to 18, 8 to 18 atoms, 7 to 17, 8 to 17, 6 to 16, 7 to 16, or 8 to 16 atoms.
[0328] In one embodiment, the dsRNA of the present invention is conjugated to a bivalent or trivalent branched linker selected from the structural group represented by any of formulas (XXXI) to (XXXIV). [ka] During the ceremony, q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B, and q5C independently represent each occurrence from 0 to 20, and the repeating units may be identical or different; P 2A , P 2B , P 3A , P 3B , P 4A , P 4B , P 5A , P 5B , P 5C , T 2A , T 2B , T 3A , T 3B , T 4A , T 4B , T 4A , T 5B , T 5C Each occurrence is independently of the others: absence, CO, NH, O, S, OC(O), NHC(O), CH2, CH2NH, or CH2O; Q 2A Q 2B Q 3A Q 3B Q 4A Q 4B Q 5A Q 5B Q 5C Each occurrence is independently of the others: absent, alkylene, substituted alkylene, and one or more methylene groups: O, S, S(O), SO2, N(R) N), C(R')=C(R''), C≡C or C(O), one or more of these may be interrupted or terminated; R 2A , R 2B , R 3A , R 3B , R 4A , R 4B , R 5A , R 5B , R 5C Each occurrence is independently: absence, NH, O, S, CH2, C(O)O, C(O)NH, NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CO, CH=NO, [ka] or heterocycline; L 2A , L 2B , L 3A , L 3B , L 4A , L 4B , L 5A , L 5B and L 5C R represents a ligand; that is, independently for each occurrence, it is a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; R a is H or an amino acid side chain. Trivalent conjugated GalNAc derivatives are Formula (XXXV), [ka] (In the formula, L 5A , L 5B and L 5C It is particularly useful when used in conjunction with RNAi agents to inhibit the expression of target genes (such as monosaccharides represented by GalNAc derivatives).
[0329] Suitable divalent and trivalent branched linker groups conjugated to GalNAc derivatives include, but are not limited to, the structures listed above as formulas II, VII, XI, X, and XIII.
[0330] The cleavable linking group is sufficiently stable outside the cell but is cleaved upon entry into the target cell, releasing the two parts held together by the linker. In a preferred embodiment, the cleavable linking group is cleaved at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 or more, or at least about 100 times faster in the target cell or under a first standard condition (which may be selected to mimic or represent, for example, intracellular conditions) than in the target blood or under a second standard condition (which may be selected to mimic or represent, for example, conditions found in blood or serum).
[0331] Cleavable linkers are susceptible to the influence of cleavage agents, such as pH, redox potential, or the presence of degradable molecules. Generally, cleavage agents are more common in cells than in serum or blood, or are found at higher levels or activity. Examples of such degradable agents include oxidative or reductases or reducing agents such as mercaptans present in cells that can degrade redox-cleavable linkers by reduction, and redox-selected or non-substrate-specific redox agents selected for specific substrates; esterases; agents that can create acidic environments, such as endosomes or those that result in a pH of 5 or less; and enzymes that can hydrolyze or degrade acid-cleavable linkers by acting as general acids, peptidases (which may be substrate-specific), and phosphatases.
[0332] Cleavable linking groups, such as disulfide bonds, can be highly sensitive to pH. While human serum has a pH of 7.4, the mean intracellular pH is slightly lower, ranging from approximately 7.1 to 7.3. Endosomes have a more acidic pH in the range of 5.5 to 6.0, and lysosomes have an even more acidic pH of approximately 5.0. Some linkers have cleavable linking groups that are cleaved at a favorable pH, thereby releasing cationic lipids from ligands within the cell or to desired compartments of the cell.
[0333] Linkers may contain cleavable linking groups that can be cleaved by specific enzymes. The type of cleavable linking group incorporated into a linker may depend on the target cell. For example, a ligand targeting the liver may link to a cationic lipid via a linker containing an ester group. Hepatocytes are rich in esterases, and therefore linkers are cleaved more efficiently in hepatocytes than in cell types that are not rich in esterases. Other cell types rich in esterases include lung, renal cortex, and testicular cells.
[0334] Linkers containing peptide bonds can be used to target peptidase-rich cell types such as hepatocytes and synovial cells.
[0335] Generally, the suitability of candidate cleavable linkers can be evaluated by testing the ability of degrading agents (conditions) to cleave the candidate linkers. It is also desirable to test the candidate cleavable linkers for their resistance to cleavage in the blood or in contact with other non-target tissues. Therefore, the relative susceptibility to cleavage between a first and second condition can be determined, with the first condition selected to demonstrate cleavage in target cells and the second condition selected to demonstrate cleavage in other tissues or in biological fluids such as blood or serum. Evaluations can be performed in cell-free systems, in cells, in cell cultures, in organ or tissue cultures, or in whole animals. It may be useful to perform an initial evaluation in cell-free or culture conditions and confirm it with further evaluation in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
[0336] Redox-cleavable linking groups In one embodiment, the cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of a reductively cleavable linking group is a disulfide linking group (-SS-). Methods described herein can be relied upon to determine whether a candidate cleavable linking group is a suitable “reductively cleavable linking group” or suitable for use with, for example, a specific iRNA moiety and a specific targeting agent. For example, a candidate may be evaluated by incubation with dithiothreitol (DTT) or other reducing agents using reagents known in the art that mimic the cleavage rate observed in cells, such as target cells. Candidates may also be evaluated under conditions selected to mimic blood or serum conditions. In one embodiment, a candidate compound is cleaved by up to about 10% in blood. In another embodiment, a useful candidate compound is degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times more rapidly in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The cleavage rate of the candidate compound can be determined using a standard enzyme kinetics assay under conditions selected to mimic an intracellular medium, compared to conditions selected to mimic an extracellular medium.
[0337] Phosphate-based cleavable linking groups In another embodiment, the cleavable linker comprises a phosphate-based cleavable linking group. The phosphate-based cleavable linking group can be cleaved by an agent that decomposes or hydrolyzes the phosphate group. An example of an agent that cleaves the phosphate group in a cell is an enzyme such as a phosphatase in the cell. Examples of phosphate-based linking groups are -OP(O)(ORk)-O-, -OP(S)(ORk)-O-, -OP(S)(SRk)-O-, -SP(O)(ORk)-O-, -OP(O)(ORk)-S-, -SP(O)(ORk)-S-, -OP(S)(ORk)-S-, -SP(S)(ORk)-O-, -OP(O)(Rk)-O-, -OP(S)(Rk)-O-, -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-S-, and -OP(S)(Rk)-S-. Preferred embodiments are -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, and -OP(S)(H)-S-. A preferred embodiment is -OP(O)(OH)-O-. These candidates can be evaluated using methods similar to those described above.
[0338] Acid-cleavable linking group In another embodiment, the cleavable linker comprises an acid-cleavable linking group. An acid-cleavable linking group is a linking group that is cleaved under acidic conditions. In a preferred embodiment, the acid-cleavable linking group is cleaved in an acidic environment with a pH of approximately 6.5 or less (e.g., approximately 6.0, 5.75, 5.5, 5.25, or 5.0 or less), or by an active agent such as an enzyme that can act as a general acid. In cells, certain low-pH organelles such as endosomes and lysosomes can provide a cleavage environment for acid-cleavable linking groups. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and amino acid esters. Acid-cleavable groups may have the general formulas -C=NN-, C(O)O, or -OC(O). In preferred embodiments, when the carbon is attached to the oxygen of the ester (alkoxy group), the group may be an aryl group; a substituted alkyl group; or a tertiary alkyl group such as dimethylpentyl or t-butyl. These candidates can be evaluated using methods similar to those described above.
[0339] Ester-based cleavable linking groups In another embodiment, the cleavable linker comprises an ester-based cleavable linking group. The ester-based cleavable linking group is cleaved in cells by enzymes such as esterases and amidases. Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene, and alkylylene groups. The ester-based cleavable linking group has the general formula -C(O)O- or -OC(O)-. These candidates can be evaluated using methods similar to those described above.
[0340] Peptide-based cleavable linking groups In yet another embodiment, the cleavable linker comprises a peptide-based cleavable linking group. The peptide-based cleavable linking group is cleaved in cells by enzymes such as peptidases and proteases. The peptide-based cleavable linking group is a peptide bond, which is formed between amino acids to produce oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. The peptide-based cleavable linking group does not contain an amide group (-C(O)NH-). An amide group can be formed between any alkylene, alkenylene, or alkylene. A peptide bond is a special type of amide bond that is formed between amino acids to produce peptides and proteins. The peptide-based cleavable linking group is generally limited to peptide bonds (i.e., amide bonds) that are formed between amino acids to produce peptides and proteins, and does not include the entire amide functional group. The peptide-based cleavable linking group has the general formula -NHCHRAC(O)NHCHRBC(O)- (SEQ ID NO: 13), where RA and RB are the R groups of two adjacent amino acids. These candidates can be evaluated using methods similar to those described above.
[0341] Representative U.S. patents teaching the preparation of RNA complexes are, as incorporated herein by reference in their entirety, U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; and 5,109,1 U.S. Patent No. 24; U.S. Patent No. 5,118,802; U.S. Patent No. 5,138,045; U.S. Patent No. 5,414,077; U.S. Patent No. 5,486,603; U.S. Patent No. 5,512,439; U.S. Patent No. 5,578,718; U.S. Patent No. 5,608,046; U.S. Patent No. 4,587,044; U.S. Patent No. 4,605,735; U.S. Patent No. 4,667,025; U.S. Patent No. 4,762,779; U.S. Patent No. 4,789,737; U.S. Patent No. 4,824,941 Specification; US Patent No. 4,835,263; US Patent No. 4,876,335; US Patent No. 4,904,582; US Patent No. 4,958,013; US Patent No. 5,082,830; US Patent No. 5,112,963; US Patent No. 5,214,136; US Patent No. 5,082,830; US Patent No. 5,112,963; US Patent No. 5,214,136; US Patent No. 5,245,022; US Patent No. 5,254,469; US Patent No. 5,258,506 Document; US Patent No. 5,262,536; US Patent No. 5,272,250; US Patent No. 5,292,873; US Patent No. 5,317,098; US Patent Nos. 5,371,241, 5,391,723; US Patent Nos. 5,416,203, 5,451,463; US Patent No. 5,510,475; US Patent No. 5,512,667; US Patent No. 5,514,785; US Patent No. 5,565,552; US Patent No. 5,567,810; US Patent No. 5,574,142;U.S. Patent Nos. 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; and 8,106,022 are examples, but are not limited to these.
[0342] It is not necessary for all positions in a given compound to be uniformly modified; in fact, two or more of the aforementioned modifications can be incorporated into a single compound, or even into a single nucleoside within an iRNA. The present invention may also include iRNA compounds that are chimeric compounds.
[0343] A "chimeric" iRNA compound or "chimeras" in the context of this invention is an iRNA compound, e.g., a dsRNA, that contains two or more chemically distinct regions, each composed of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region in which the RNA is modified to give the iRNA increased resistance to nuclease degradation, increased intracellular uptake, and / or increased binding affinity to a target nucleic acid. The additional region of the iRNA may act as an enzyme substrate capable of cleaving RNA:DNA or RNA:RNA hybrids. For example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA double-stranded molecule. Therefore, activation of RNase H results in cleavage of the RNA target, thereby significantly increasing the efficiency of iRNA inhibition of gene expression. As a result, when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs that hybridize to the same target region, comparable results are often obtained with shorter iRNAs. Cleavage of RNA targets can conventionally be detected by gel electrophoresis and, if necessary, by relevant nucleic acid hybridization techniques known in the art.
[0344] In some cases, the RNA of iRNA can be modified by non-ligand groups. Several non-ligand molecules are conjugated to iRNA to enhance its activity, cell distribution, or intracellular uptake, and procedures for performing such conjugations are available in academic literature. Such non-ligand moieties include lipid moieties such as cholesterol (Kubo, T. et al., Biochemical & Biophysical Research Communications, 2007, Vol. 365, No. 1, pp. 54-61; Letsinger et al., Proceedings of the National Academy of Sciences, 1989, Vol. 86, pp. 6553), and cholic acid (Manoharan et al., Bioorganic Medical Chemistry). Letters (Bioorg.Med.Chem.Let.), 1994, Vol. 4, p. 1053), for example, thioethers such as hexyl-S-tritylthiol (Manoharan et al., Proceedings of the New York Academy of Sciences (Ann.NYAcad.Sci.), 1992, Vol. 660, p. 306; Manoharan et al., Bioorganic Medical Chemistry Letters (Bioorg.Med.Chem.Let.), 1993, Vol. 3, p. 2765), thiocholesterol (Oberhauser et al., Nucleic Acid Research (Nucl.Acids) Res.), 1992, Vol. 20, p. 533), for example, aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., Journal of the European Molecular Biology Organization (EMBO J), 1991, Vol. 10, p. 111; Kabanov et al., FEBS Lett., 1990, Vol. 259, p. 327; Svinarchuk et al., Biochimie, 1993, Vol. 75, p.49) Phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, Vol. 36, p. 3651; Shea et al., Nucleoside Acids Res., 1990, Vol. 18, p. 3777), polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, Vol. 14, p. 969), or adamantane acetate (Manoharan et al., Tetrahedron Lett. This includes the palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, Vol. 1264, p. 229), or the octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., Journal of Pharmacol. Experimental Therapeutics, 1996, Vol. 277, p. 923). Representative U.S. patents teaching the preparation of such RNA complexes are listed above. A typical conjugation protocol involves the synthesis of RNA having aminolinkers at one or more positions in the sequence. The RNA is then reacted with a molecule that conjugates the amino group using an appropriate coupling or activating reagent. The conjugation reaction may be carried out in the solution phase while the RNA is still bound to the solid support, or following RNA cleavage. Purification of the RNA complex by HPLC typically yields a pure complex.
[0345] iRNA delivery The delivery of iRNA to the target organism can be achieved in several different ways. In vivo delivery can be carried out directly by administering a composition containing iRNA, such as dsRNA, to the target organism. Alternatively, delivery can be carried out indirectly by administering one or more vectors that encode and induce the expression of iRNA. These alternative forms will be discussed below.
[0346] direct delivery In general, any delivery method for nucleic acid molecules can be adapted for use with iRNA (see, for example, Akhtar S. and Julian R.L., 1992, Trends Cell. Bio., Vol. 2, No. 5, pp. 139-144 and International Publication No. 94 / 02595, whose entire contents are incorporated herein by reference). However, there are three important factors to consider for the successful delivery of iRNA molecules into the body: (a) the biological stability of the delivered molecule, (2) prevention of nonspecific effects, and (3) accumulation of the delivered molecule in the target tissue. Nonspecific effects of iRNA can be minimized by local administration, such as direct injection or transplantation into tissue (in the non-limiting case of tumors), or by local administration of a preparation. Local administration to the treatment site maximizes the local concentration of the active substance, limiting exposure to the active substance in systemic tissues, which could otherwise be harmed or degraded by the substance, and allowing for administration at lower total doses of iRNA molecules. Several studies have shown successful gene product knockdown when iRNA is administered locally. For example, intravitreal injection of VEGF dsRNA in cynomolgus monkeys (Tolentino, MJ. et al., 2004, Retina, Vol. 24, pp. 132-138) and subretinal injection in mice (Reich, SJ. et al., 2003, Molecular Vision, Vol. 9, pp. 210-216) both showed prevention of neovascularization in experimental models of age-related macular degeneration. In addition, direct intratumoral injection of dsRNA in mice reduced tumor volume (Pille, J. et al., 2005, Molecular Therapy (Mol.Ther.), Vol. 11, pp. 267-274) and extended the survival time of mice with tumors (Kim, W.J. et al., 2006, Molecular Therapy (Mol.Ther.), Vol. 14, pp. 343-350; Li, S. et al., 2007, Molecular Therapy (Mol.Ther.), Vol. 15, pp. 515-523).RNA interference is directly injected into the CNS (Dorn, G. et al., 2004, Nucleic Acids 32:e49; Tan, PH. et al., 2005, Gene Ther., Vol. 12, pp. 59-66; Makimura, H. et al., 2002, BMC Neurosci., Vol. 3, p. 18; Shishkina, GT. et al., 2004, Neuroscience, Vol. 129, pp. 521-528; Thakker, ER. et al., 2004, Proceedings of the National Academy of Sciences, Vol. 101, pp. 17270-17275; Akaneya, Y. et al., 2005, Journal) Successful local delivery has been demonstrated by intranasal administration to the lungs (Howard, K. et al., 2006, Molecular Therapy, Vol. 14, pp. 476-484; Zhang, X. et al., 2004, Journal of Biological Chemistry, Vol. 279, pp. 10677-10684; Bitko, V. et al., 2005, Nature Medicine, Vol. 11, pp. 50-55). To treat diseases, iRNAs can be systemically administered, modified, or alternatively, delivered using drug delivery systems; both methods act to prevent the rapid degradation of dsRNAs by endogenous and exonucleases.
[0347] Modification of RNA or pharmaceutical carriers can also enable the targeting of iRNA compositions to target tissues, avoiding undesirable nonspecific effects. iRNA molecules can be modified by chemical bonding with other groups, such as lipid or carbohydrate groups, as described herein. Such complexes can be used to target iRNA to specific cells, such as hepatocytes, e.g., hepatocytes. For example, a GalNAc complex or a lipid (e.g., LNP) formulation can be used to target iRNA to specific cells, such as hepatocytes, e.g., hepatocytes.
[0348] Lipophilic groups such as cholesterol enhance intracellular uptake and prevent degradation. For example, iRNA conjugated to a lipophilic cholesterol moiety and acting as an anti-ApoB agent was systemically injected into mice, resulting in apoB mRNA knockdown in both the liver and jejunum (Soutschek, J. et al., 2004, Nature, Vol. 432, pp. 173-178). Conjugation of iRNA to aptamers has been shown to suppress tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, JO. et al., 2006, Nature Biotechnology, Vol. 24, pp. 1005-1015). In alternative embodiments, iRNA may be delivered using drug delivery systems such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems facilitate the binding of negatively charged iRNA molecules and also enhance interactions with negatively charged cell membranes, enabling efficient uptake of iRNA by cells. Cationic lipids, dendrimers, or polymers can be induced to bind to iRNA or form vesicles or micelles that surround iRNA (see, e.g., Kim, SH. et al., 2008, Journal of Controlled Release, Vol. 129, No. 2, pp. 107-116). Vesicle or micelle formation further prevents iRNA degradation when administered systemically. Methods for preparing and administering cationic iRNA complexes are well within the capabilities of those skilled in the art (see, for example, Sorensen, DR. et al., 2003, Journal of Molecular Biology (J.Mol.Biol), Vol. 327, pp. 761-766; Verma, UN. et al., 2003, Clinical Cancer Research (Clin.Cancer Res.), Vol. 9, pp. 1291-1300; Arnold, AS. et al., 2007, Journal of Hypertens., Vol. 25, pp. 197-205).Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNA include DOTAP (Sorensen, DR. et al., 2003, cited above; Verma, UN. et al., 2003, cited above), oligofectamine, “solid nucleic acid lipid particles” (Zimmermann, TS. et al., 2006, Nature, Vol. 441, pp. 111-114), and cardiolipin (Chien, PY. et al., 2005, Cancer Gene Ther., Vol. 12, pp. 321-328; Pal, A. et al., 2005, International Journal of Oncology (Int J. Oncol.), Vol. 26, pp. 1087-1091), Polyethyleneimine (Bonnet, ME. et al., 2008, Pharmaceutical Research (Pharm. Res.), online pre-publication on August 16; Aigner, A., 2006, Journal of Biomedicine & Biotechnology (J. Biomed. Biotechnol.), p. 71659), Arg-Gly-Asp (RGD) peptide (Liu, S., 2006, Molecular Pharmacology (Mol. Pharm.), Vol. 3, pp. 472-487), and Polyamidoamine (Tomalia, DA. et al., 2007, Biochemical Society) Examples include Biochem. Soc. Trans., Vol. 35, pp. 61-67; Yoo, H. et al., 1999, Pharmaceutical Research (Pharm. Res.), Vol. 16, pp. 1799-1804). In some embodiments, for systemic administration, the iRNA forms a complex with cyclodextrin. Methods of administering iRNA and cyclodextrin and pharmaceutical compositions are described in U.S. Patent No. 7,427,605, which is incorporated herein by reference in its entirety.
[0349] iRNA-coding vector In another embodiment, ALAS1 gene-targeting iRNAs can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A. et al., TIG., 1996, Vol. 12, pp. 5-10; PCT International Publication No. 00 / 22113, authored by Skillern, A. et al.; PCT International Publication No. 00 / 22114, authored by Conrad; and U.S. Patent No. 6,054,299, authored by Conrad). Expression can be transient (from a few hours to several weeks) or persistent (from several weeks to several months or more), depending on the specific construct used and the target tissue or cell type. These transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which may be embedded or non-embedded vectors. The introduced gene can also be constructed to allow it to be inherited as an extrachromosomal plasmid (Gassmann et al., Proceedings of the National Academy of Sciences, 1995, Vol. 92, p. 1292).
[0350] Individual iRNA strands or strand groups can be transcribed from a promoter on an expression vector. When expressing two separate strands to generate, for example, dsRNA, two separate expression vectors can be simultaneously introduced into target cells (e.g., by transfusion or infection). Alternatively, the individual strands of the dsRNA can be transcribed by promoters located on the same expression plasmid. In one embodiment, the dsRNA is expressed as inverted repeats linked by linker polynucleotide sequences, such that the dsRNA has a stem-loop structure.
[0351] iRNA expression vectors are typically DNA plasmids or viral vectors. Recombinant constructs for iRNA expression described herein can be generated using expression vectors adapted to eukaryotic cells, such as vertebrate cells. Eukaryotic cell expression vectors are well known in the art and are available from several commercial suppliers. Typically, such vectors contain convenient restriction enzyme recognition sites for inserting desired nucleic acid fragments. Delivery of iRNA-expressing vectors may be systemic, such as by intravenous or intramuscular administration to target cells explanted from a patient and subsequent reintroduction into the patient, or by any other means that allows introduction into desired target cells.
[0352] iRNA expression plasmids can be translocated into target cells as complexes with cationic lipid carriers (e.g., oligofectamines) or non-cationic lipid-based carriers (e.g., Transit-TKO™). Multiple lipid translocation for iRNA-mediated knockdown, targeting different regions of the target RNA over a period of more than one week, is also explored in this invention. Successful introduction of the vector into host cells can be monitored using various known methods. For example, transient translocation can be indicated by a reporter, such as a fluorescent marker like green fluorescent protein (GFP). Stable translocation into cells in vitro can be ensured by using markers that provide the translocated cells with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.
[0353] Viral vector systems that can be used with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentivirus vectors and Moloney's mouse leukemia virus; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) picornavirus vectors; (i) poxvirus vectors, such as orthopox, including vaccinia virus vectors, or avipox, including canarypox or fowlpox; and (j) helper-dependent or gutless adenoviruses. Replication-defective viruses may also be advantageous. Different vectors may or may not be incorporated into the cell genome. The construct may optionally include a viral sequence for translocation. Alternatively, the construct may be incorporated into an episomal replication vector, such as EPV and EBV vectors. Constructs for the recombinant expression of iRNAs generally require regulatory factors, such as promoters and enhancers, to ensure iRNA expression in target cells. Other aspects of vectors and constructs that are considered are described in more detail below.
[0354] A vector useful for delivering iRNA contains sufficient regulatory factors (promoters, enhancers, etc.) to express the iRNA in the desired target cells or tissues. These regulatory factors can be selected to provide either constitutive or regulatory / inducible expression.
[0355] iRNA expression can be precisely regulated using inducible regulatory sequences sensitive to specific physiological regulators, such as circulating glucose levels or hormones (Docherty et al., 1994, FASEB Journal, Vol. 8, pp. 20-24). Suitable inducible expression systems for regulating dsRNA expression in cells or mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, dimerizing chemical inducers, and isopropyl-β-D1-thiogalactopyranoside (IPTG). Those skilled in the art can select appropriate regulatory / promoter sequences based on the intended use of the iRNA transgene.
[0356] In certain embodiments, viral vectors containing nucleic acid sequences encoding iRNA may be used. For example, retroviral vectors may be used (see Miller et al., Meth.Enzymol., Vol. 217, pp. 581-599, 1993). These retroviral vectors contain components necessary for the correct packaging of the viral genome and its integration into host cell DNA. The nucleic acid sequence encoding iRNA is cloned into one or more vectors to facilitate delivery of the nucleic acid to the patient. For more details on retroviral vectors, see Boesen et al., Biotherapy, Vol. 6, pp. 291-302, 1994, which describes the use of retroviral vectors to deliver the mdr1 gene to hematopoietic stem cells to generate stem cells that exhibit high resistance to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy include Clowes et al., Journal of Clinical Investigation, Vol. 93, pp. 644-651, 1994; Kiem et al., Blood, Vol. 83, pp. 1467-1473, 1994; Salmons and Gunzberg, Human Gene Therapy, Vol. 4, pp. 129-141, 1993; and Grossman and Wilson, Current Opinion in Genetics and Development, Vol. 3, pp. 110-114, 1993. Examples of lentiviral vectors that may be considered for use include, for example, HIV-based vectors described in U.S. Patent No. 6,143,520; U.S. Patent No. 5,665,557; and U.S. Patent No. 5,981,276, which are incorporated herein by reference.
[0357] Adenoviruses are also being considered for use in iRNA delivery. Adenoviruses are particularly attractive vehicles for delivering genes, for example, to the respiratory tract epithelium. Adenoviruses infect the respiratory tract epithelium naturally, causing mild disease. Other targets for adenovirus-based delivery systems include the liver, central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development, Vol. 3, pp. 499-503, 1993, present a review of adenovirus-based gene therapies. Bout et al., *Human Gene Therapy*, Vol. 5, pp. 3-10, 1994, demonstrated the use of adenovirus vectors for transferring genes into the airway epithelium of rhesus monkeys. Other examples of the use of adenowill in gene therapy can be found in Rosenfeld et al., Science, Vol. 252, pp. 431-434, 1991; Rosenfeld et al., Cell, Vol. 68, pp. 143-155, 1992; Mastrangeli et al., Journal of Clinical Investigation, Vol. 91, pp. 225-234, 1993; International Publication No. 94 / 12649 pamphlet; and Wang et al., Gene Therapy, Vol. 2, pp. 775-783, 1995. A suitable AV vector for expressing the iRNA discussed in this invention, a method for constructing a recombinant AV vector, and a method for delivering the vector to target cells are described by Xia H et al., 2002, Nature Biotechnology, Vol. 20, pp. 1006-1010.
[0358] The use of adeno-associated virus (AAV) vectors is also being considered (Walsh et al., Proceedings of the Society for Experimental Biology & Medicine, Vol. 204, pp. 289-300, 1993; U.S. Patent No. 5,436,146). In one embodiment, the iRNA may be expressed as two distinct complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, a U6 or H1 RNA promoter, or a cytomegalovirus (CMV) promoter. A suitable AAV vector for expressing the dsRNA discussed in this invention, a method for constructing a recombinant AV vector, and a method for delivering the vector to target cells are incorporated herein by reference in their entirety: Samulski R et al., 1987, Journal of Virol, Vol. 61, pp. 3096-3101; Fisher KJ et al., 1996, Journal of Virol, Vol. 70, pp. 520-532; Samulski R et al., 1989, Journal of This information is found in the Journal of Virol, Vol. 63, pp. 3822-3826; U.S. Patent No. 5,252,479; U.S. Patent No. 5,139,941; International Publication No. 94 / 13788; and International Publication No. 93 / 24641.
[0359] Other typical viral vectors include vaccinia viruses such as modified virus Ankara (MVA) or attenuated vaccinia such as NYVAC, and poxviruses such as avipox, such as fowlpox or canarypox.
[0360] The affinity of a viral vector can be modified, if necessary, by pseudotyping the vector with coat proteins or other surface antigens from other viruses, or by substitution with capsid proteins from different viruses. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mocola, etc. AAV vectors can be genetically engineered to target different cells by expressing different capsid protein serotypes; see, for example, Rabinowitz, JE et al., 2002, Journal of Virol, Vol. 76, pp. 791-801, the entire disclosure of which is incorporated herein by reference.
[0361] A vector-based drug may contain a vector in an acceptable diluent, or a sustained-release matrix in which a gene delivery vehicle is embedded. Alternatively, if a complete gene delivery vector, such as a retroviral vector, can be generated intact from recombinant cells, the drug may contain one or more cells that generate the gene delivery system.
[0362] III. iRNA-containing pharmaceutical compositions In one embodiment, the present invention provides a pharmaceutical composition comprising an iRNA described herein and a pharmaceutically acceptable carrier. The pharmaceutical composition contains an iRNA useful for treating diseases or disorders related to the expression or activity of the ALAS1 gene (e.g., diseases involving the porphyrin pathway). Such pharmaceutical compositions are formulated based on the mode of delivery. For example, a composition may be formulated for systemic administration by parenteral delivery, such as intravenous (IV) delivery. In some embodiments, the compositions provided herein (e.g., LNP formulations) are formulated for intravenous delivery. In some embodiments, the compositions provided herein (e.g., compositions comprising a GalNAc complex) are formulated for subcutaneous delivery.
[0363] The pharmaceutical compositions discussed herein are administered in doses sufficient to inhibit the expression of the ALAS1 gene. Generally, appropriate doses of iRNA range from 0.01 to 200.0 milligrams per kilogram of body weight per day, typically ranging from 1 to 50 mg per kilogram of body weight per day. For example, dsRNA may be administered in single doses of 0.05 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 2 mg / kg, 3 mg / kg, 10 mg / kg, 20 mg / kg, 30 mg / kg, 40 mg / kg, or 50 mg / kg. The pharmaceutical composition may be administered once daily, or iRNA may be administered in two or three or more partial doses at appropriate intervals throughout the day, or even by continuous infusion or controlled-release formulation. In this case, the amount of iRNA contained in each partial dose must be correspondingly smaller in order to achieve the total daily dose. The dosing unit may also be formulated for delivery over several days using conventional sustained-release formulations that provide sustained release of iRNA over several days, for example. Sustained-release formulations are well known in the art and are particularly useful for the delivery of the active ingredient to a specific site, which may be used with the active ingredient of the present invention. In this embodiment, the dosing unit contains a number of corresponding daily doses.
[0364] The effect of a single dose on ALAS1 levels can be long-lasting, with subsequent doses administered at intervals of 3, 4, or 5 days or less, or at intervals of 1, 2, 3, or 4 weeks or less.
[0365] Those skilled in the art will understand that certain factors, including but not limited to the severity of the disease or disorder, previous treatments, the subject's overall health and / or age, and other pre-existing conditions, may influence the dose and timing required to effectively treat the subject. Furthermore, treatment of the subject with a therapeutically effective amount of the composition may consist of a single treatment or a series of treatments. The effective dose and in vivo half-life of each iRNA incorporated in this invention may be estimated using conventional procedures or based on in vivo studies using appropriate animal models, as described elsewhere in this specification.
[0366] Advances in mouse genetics have led to the creation of several mouse models for studying various human diseases, such as porphyria and other pathological processes associated with porphyrins or porphyrin pathway defects, including pathological processes related to ALAS1 expression. Such models can be used for in vivo testing of iRNAs and to determine therapeutically effective doses and / or effective administration strategies.
[0367] A suitable mouse model is, for example, a mouse containing a transgene expressing human ALAS1. A mouse with a knock-in mutation (e.g., a mutation associated with acute hepatic porphyria in humans) can be used to determine the therapeutically effective dose and / or duration of administration. The present invention also includes pharmaceutical compositions and formulations comprising the iRNA compounds discussed herein. The pharmaceutical compositions of the present invention may be administered in several ways, depending on whether topical or systemic treatment is desired and depending on the therapeutic area. Administration may be topical (e.g., by a transdermal patch), transpulmonary by inhalation or blowing of a powder or fume, including by a nebulizer; intratracheal, intranasal, transepidermal and transdermal, oral or parenteral. Parenteral administration may include intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal administration, for example, through an implantable device; or intracranial administration, for example, within the brain parenchyma, subarachnoid space or ventricle.
[0368] iRNAs can be delivered in a manner that targets specific tissues, such as erythrocyte-producing tissues. For example, iRNAs can be delivered to the bone marrow, liver (e.g., hepatic parenchymal cells), lymph glands, spleen, lungs (e.g., pulmonary pleura), or spine. In one embodiment, iRNAs are delivered to the bone marrow.
[0369] Pharmaceutical compositions and formulations for topical administration include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, etc., may be necessary or desirable. Covered condoms, gloves, etc., may also be useful. Suitable topical formulations include those in which the iRNA addressed in this invention is in a miscible material with topically delivered substances such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidylcholine DMPC, distearolyphosphatidylcholine), negative (e.g., dimyristoylphosphatidylglycerol DMPG), and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidylethanolamine DOTMA). The iRNAs discussed in this invention may be encapsulated within liposomes, or they may form complexes with liposomes, particularly cationic liposomes. Alternatively, the iRNAs may form complexes with lipids, particularly cationic lipids. Suitable fatty acids and esters include arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaplate, tricaplate, monoolein, dilaurin, glyceryl 1-monocaplate, 1-dodecyl azacycloheptan-2-one, acylcarnitine, acylcholine, or C 1~20 Examples include, but are not limited to, alkyl esters (e.g., isopropylmyristate IPM), monoglycerides, diglycerides, or pharmaceutically acceptable salts thereof. Topical formulations are described in detail in U.S. Patent No. 6,747,014, which is incorporated herein by reference.
[0370] Liposome formulations Beyond microemulsions, which are studied and used for drug formulation, numerous other structures of organized surfactants exist. These include monolayers, micelles, bilayers, and vesicles. Vesicles, such as liposomes, have attracted considerable attention from the standpoint of drug delivery due to their specificity and the duration of action they provide. In the use of this invention, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or group of bilayers.
[0371] Liposomes are monolayer or multilayered membrane vesicles having a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes have the advantage of being able to fuse with the cell wall. Non-cationic liposomes cannot efficiently fuse with the cell wall but are taken up by macrophages in vivo.
[0372] To penetrate intact mammalian skin, lipid vesicles must pass through a series of pores, each less than 50 nm in diameter, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use liposomes that are highly deformable and capable of passing through such pores.
[0373] Further advantages of liposomes include: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can encapsulate a wide range of water- and lipid-soluble drugs; and liposomes can protect drugs encapsulated within their internal compartments from metabolism and degradation (from "Pharmaceutical Dosage Forms" by Rosoff, edited by Lieberman, Rieger, and Banker, 1988, translated by Marcel Dekker, Inc., New York, NY, Vol. 1, p. 245). Important considerations in the preparation of liposomal formulations include the lipid surface charge, vesicle size, and aqueous capacity of the liposomes.
[0374] Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposome membrane is structurally similar to biological membranes, when liposomes are applied to tissue, they begin to integrate with the cell membrane, and as the fusion of liposomes and cells progresses, the contents of the liposomes are released into cells where the active drug may act.
[0375] Liposome formulations are a focus of extensive research as a mode of delivery for numerous drugs. Evidence is emerging that liposomes offer several advantages over other formulations in topical administration. These advantages include reduced side effects associated with higher systemic absorption of the administered drug, increased accumulation of the drug at the desired target, and the ability to deliver a wide variety of drugs, both hydrophilic and hydrophobic, through the skin.
[0376] Several reports detail the ability of liposomes to deliver active substances, including high molecular weight DNA, into the skin. Analgesics, antibodies, hormones, and compounds including high molecular weight DNA have been administered to the skin. The majority of applications have involved targeting the upper layers of the epidermis.
[0377] Liposomes are classified into two broad classes. Cationic liposomes are positively charged liposomes that interact with negatively charged DNA molecules to form stable complexes. The positively charged DNA / liposome complexes bind to the negatively charged cell surface and are taken into endosomes. Due to the acidic pH inside the endosome, the liposomes rupture, releasing their contents into the cytoplasm (Wang et al., Biochemical & Biophysical Research Communications, 1987, Vol. 147, pp. 980-985).
[0378] pH-sensitive or negatively charged liposomes do not form complexes with DNA; rather, they encapsulate it. Because both DNA and lipids have similar charges, repulsion occurs rather than complex formation. Nevertheless, some DNA is encapsulated within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding thymidine kinase genes to a cell monolayer in culture. Expression of exogenous genes was detected in target cells (Zhou et al., Journal of Controlled Release, 1992, Vol. 19, pp. 269-274).
[0379] One major type of liposome composition contains phospholipids in addition to naturally derived phosphatidylcholine. For example, neutral liposome compositions can be produced from dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome compositions are generally produced from dimyristoylphosphatidylglycerol, while anionic fusion liposomes are mainly formed from dioleoyl sphatidylethanolamine (DOPE). Another type of liposome composition is produced from phosphatidylcholine (PC), such as soy PC and egg PC. Yet another type is produced from a mixture of phospholipids and / or phosphatidylcholine and / or cholesterol.
[0380] Several studies have evaluated the topical delivery of liposomal formulations to the skin. Topical application of interferon-containing liposomes to guinea pig skin resulted in a reduction in herpes simplex wounds, while interferon delivery by other means (e.g., as a solution or emulsion) was ineffective (Weiner et al., Journal of Drug Targeting, 1992, Vol. 2, pp. 405-410). Further studies have tested the effectiveness of interferon administration as part of liposomal formulations compared to interferon administration using aqueous systems, concluding that liposomal formulations are superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, Vol. 18, pp. 259-265).
[0381] Nonionic liposome systems, particularly those containing nonionic surfactants and cholesterol, have been studied, and their efficacy in drug delivery to the skin has been evaluated. Cyclosporine A was delivered into the dermis of mouse skin using nonionic liposome formulations containing Novasome® I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome® II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether). The results suggested that such nonionic liposome systems are effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al., STP Pharma Science, 1994, Vol. 4, No. 6, p. 466).
[0382] Liposomes also include “stereostabilized” liposomes, which, as used herein, refer to liposomes comprising one or more specialized lipids, which, when incorporated into liposomes, result in an improved circulating lifespan compared to liposomes lacking such specialized lipids. An example of a stereostabilized liposome is one in which a portion of the vesicle-forming lipid portion of the liposome is (A) monosialoganglioside G M1 (B) comprising one or more glycolipids such as, or derivatized with one or more hydrophilic polymers such as polyethylene glycol (PEG) moiety. Without wanting to be constrained by any particular theory, in the art, in sterically stabilized liposomes containing at least gangliosides, sphingomyelin, or PEG-derivativeized lipids, the improvement in the circulating half-life of these sterically stabilized liposomes is thought to be due to reduced uptake by reticuloendothelial system (RES) cells (Allen et al., FEBS Letters, 1987, Vol. 223, p. 42; Wu et al., Cancer Research, 1993, Vol. 53, p. 3765).
[0383] Various liposomes comprising one or more glycolipids are known in the art. (Papahadjopoulos et al., Proceedings of the New York Academy of Sciences, 1987, Vol. 507, p. 64) describes monosialoganglioside G M1 The ability of galactocerebroside sulfate and phosphatidylinositol to improve the half-life of liposomes in the blood has been reported. These findings are described in detail in Gabizon et al., Proceedings of the National Academy of Sciences, 1988, Vol. 85, p. 6949. Both U.S. Patent No. 4,837,028 and International Publication No. 88 / 04924, both granted to Allen et al., describe (1) sphingomyelin and (2) ganglioside G M1Liposomes comprising or galactocerebroside sulfate are disclosed. U.S. Patent No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimiristoylphosphatidylcholine are disclosed in International Publication No. 97 / 13499 (Lim et al.).
[0384] Numerous liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods for preparing them, are known in the art. Sunamoto et al. (Bulletin of the Chemical Society of Japan (Bull. Chem. Soc. Jpn.), 1980, Vol. 53, p. 2778) described a nonionic detergent 2C containing a PEG moiety. 1215GLiposomes comprising the following are described. Illum et al., FEBS Lett., 1984, Vol. 167, p. 79, described how hydrophilic coating of polystyrene particles with polymer glycols results in a significantly improved blood half-life. Synthetic phospholipids modified by the addition of carboxylic acid groups to polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Patent Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, Vol. 268, p. 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have a significantly increased blood circulation half-life. Blume et al. (Biochimica et Biophysica Acta, 1990, Vol. 1029, p. 91) extended this observation to other PEG-derivative phospholipids, such as DSPE-PEG, which are produced from a combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having a covalently bound PEG moiety on their outer surface are described in European Patent No. 0445131B1 and International Publication No. 90 / 04384, granted to Fisher. Liposome compositions containing 1 to 20 mole percent of PEG-derivativeized PE, and methods of using the same, are described by Woodle et al. (U.S. Patent No. 5,013,556 and U.S. Patent No. 5,356,633) and Martin et al. (U.S. Patent No. 5,213,804 and European Patent No. 0496813B1). Liposomes comprising several other lipid-polymer complexes are disclosed in International Publication No. 91 / 05545 and U.S. Patent No. 5,225,212 (both granted to Martin et al.) and International Publication No. 94 / 20073 (Zalipsky et al.).Liposomes comprising PEG-modified ceramide lipids are described in International Publication No. 96 / 10391 (Choi et al.). U.S. Patent No. 5,540,935 (Miyazaki et al.) and U.S. Patent No. 5,556,948 (Tagawa et al.) describe PEG-containing liposomes whose surfaces can be further derivatized with functional moieties.
[0385] Several liposomes containing nucleic acids are known in the art. International Publication No. 96 / 40062, granted to Thierry et al., discloses a method for encapsulating high molecular weight nucleic acids in liposomes. U.S. Patent No. 5,264,221, granted to Tagawa et al., discloses protein-binding liposomes and claims that the contents of such liposomes may contain dsRNA. U.S. Patent No. 5,665,710, granted to Rahman et al., describes a specific method for encapsulating oligodeoxynucleotides in liposomes. International Publication No. 97 / 04787, granted to Love et al., discloses liposomes containing raf gene-targeted dsRNA.
[0386] Transfersomes are yet another type of liposome, highly deformable lipid aggregates, that are attractive candidates for drug delivery vehicles. Because they are so highly deformable, transfersomes may also be described as lipid droplets that can easily penetrate through pores smaller than droplets. Transfersomes can adapt to the environment in which they are used; for example, they self-optimize (adapt to skin pore shapes), self-repair, and often reach and self-load their targets without fragmentation. To create transfersomes, surface edge activators, usually surfactants, can be added to standard liposome compositions. Transfersomes have been used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a serum albumin-containing solution.
[0387] Surfactants have a wide range of applications in formulations such as emulsions (including microemulsions) and liposomes. The most common method for classifying and grading the properties of the many different types of surfactants, both natural and synthetic, is by using the hydrophile / lipophile balance (HLB). The properties of the hydrophilic group (also known as the "head") provide the most useful means of classifying different surfactants used in formulations (from "Pharmaceutical Dosage Forms" by Marcel Dekker, Inc., New York, NY, 1988, p. 285).
[0388] When a surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants have a wide range of applications in pharmaceutical and cosmetic products and can be used across a wide pH range. Generally, their HLB values range from 2 to about 18, depending on their structure. Examples of nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers, such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers, also belong to this class. Polyoxyethylene surfactants are the most commonly found components of the nonionic surfactant class.
[0389] Surfactants are classified as anionic when their molecules retain a negative charge when dissolved or dispersed in water. Examples of anionic surfactants include carboxylates such as soap, acyl lactylate, acylamides of amino acids, sulfate esters such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkylbenzene sulfonates, acyl isethionate, acyl taurate and acyl sulfosuccinate, and acyl phosphate. The most important members of the anionic surfactant class are alkyl sulfates and soaps.
[0390] Surfactants are classified as cationic if their molecules retain a positive charge when dissolved or dispersed in water. Examples of cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most commonly used components in this class.
[0391] A surfactant is classified as amphoteric if its molecule has the ability to possess either a positive or negative charge. Examples of amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkyl betaines, and phospholipids.
[0392] The use of surfactants in pharmaceuticals, formulations, and emulsions is outlined (from Rieger, "Pharmaceutical Dosage Forms," Marcel Dekker, Inc., New York, New York, 1988, p. 285).
[0393] nucleic acid lipid particles In one embodiment, the ALAS1 dsRNA addressed in the present invention is completely encapsulated in a lipid formulation to form, for example, SPLPs, pSPLPs, SNALPs, or other nucleic acid-lipid particles. In the use herein, the term "SNALP" refers to stable nucleic acid-lipid particles, including SPLPs. In the use herein, the term "SPLP" refers to nucleic acid-lipid particles comprising plasmid DNA encapsulated within lipid vesicles. SNALPs and SPLPs typically contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid complexes). SNALPs and SPLPs exhibit long circulatory lifetimes following intravenous (iv) injection and accumulate at distal sites (e.g., sites physically distant from the administration site), making them extremely useful for systemic applications. Examples of SPLPs include "pSPLPs" containing encapsulation condenser-nucleic acid complexes as described in International Publication No. 00 / 03683. The particles of the present invention typically have an average diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, and most typically about 70 nm to about 90 nm, and are substantially non-toxic. In addition, when present in the nucleic acid-lipid particles of the present invention, the nucleic acids are resistant to nuclease degradation in aqueous solution. Nucleic acid-lipid particles and methods for preparing them are disclosed, for example, in U.S. Patent No. 5,976,567; U.S. Patent No. 5,981,501; U.S. Patent No. 6,534,484; U.S. Patent No. 6,586,410; U.S. Patent No. 6,815,432; and International Publication No. 96 / 40964.
[0394] In one embodiment, the ratio of lipids to drugs (mass / mass ratio) (e.g., lipid to dsRNA ratio) is in the range of approximately 1:1 to approximately 50:1, approximately 1:1 to approximately 25:1, approximately 3:1 to approximately 15:1, approximately 4:1 to approximately 10:1, approximately 5:1 to approximately 9:1, or approximately 6:1 to approximately 9:1.
[0395] Cationic lipids include, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolelenyloxy-N,N-dimethylaminopropane (DLenDMA), and 1,2-dilinoleylcarbamoyloxy-3-dimethylamine. Minopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleyoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleythio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-Linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyoxy-3-trimethylaminopropane chloride (DLin-TMA.Cl), 1,2-Dilinoleyoyl-3-trimethylaminopropane chloride (DLin-TAP.Cl), 1,2-dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (propanedio) (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) The analogs thereof may be (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoic acid (MC3), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazine-1-yl)ethylazandiyl)didodecane-2-ol (Tech G1), or mixtures thereof. Cationic lipids may constitute approximately 20 mol% to approximately 50 mol% or approximately 40 mol% of the total lipids present in the particles.
[0396] In another embodiment, the compound 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-siRNA nanoparticles. The synthesis of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. Provisional Patent Application No. 61 / 107,998, filed October 23, 2008, which is incorporated herein by reference.
[0397] In one embodiment, the lipid-siRNA particles consist of 40% 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane, 10% DSPC, 40% cholesterol, and 10% PEG-C-DOMG (molar percentage), with a particle size of 63.0 ± 20 nm and an siRNA / lipid ratio of 0.027.
[0398] Noncationic lipids include distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylcholine (DOPC), dipalmitoyl phosphatidylcholine (DPPC), dioleoyl phosphatidylglycerin (DOPG), dipalmitoyl phosphatidylglycerin (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoyl phosphatidylcholine (POPC), palmitoyloleoyl phosphatidylethanolamine (POPE), and dioleoyl-phosphatidylethanolamine-4-(N-maleimi The noncationic lipids may include, but are not limited to, anionic or neutral lipids, such as domethyl)-cyclohexane-1-carboxylic acid (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoylphosphatidiethanolamine (SOPE), cholesterol, or mixtures thereof. If cholesterol is present, the noncationic lipids may constitute about 5 mol% to about 90 mol%, about 10 mol%, or about 58 mol% of the total lipids present in the particles.
[0399] The conjugated lipids that inhibit particle aggregation may be polyethylene glycol (PEG) lipids, including, without limitation, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), or mixtures thereof. The PEG-DAA complex may be, for example, PEG-dilauryloxypropyl (Ci2), PEG-dimyristyloxypropyl (Ci4), PEG-dipalmityloxypropyl (Ci6), or PEG-distearyloxypropyl (C8). The conjugated lipids that prevent particle aggregation may be 0 mol% to about 20 mol% or about 2 mol% of the total lipids present in the particles.
[0400] In some embodiments, the nucleic acid-lipid particles further contain, for example, about 10 mol% to about 60 mol% or about 48 mol% of the total lipids present in the particles, which is cholesterol.
[0401] In some embodiments, iRNA is formulated into lipid nanoparticles (LNPs).
[0402] LNP01 In one embodiment, lipid-dsRNA nanoparticles (e.g., LNP01 particles) can be prepared using the lipidoid ND98·4HCl (MW1487) (see U.S. Patent Application No. 12 / 056,230, filed March 26, 2008, incorporated herein by reference), cholesterol (Sigma-Aldrich), and PEG-ceramide C16 (Avanti Polar Lipids). Each stock solution in ethanol can be prepared as follows: 133 mg / ml of ND98; 25 mg / ml of cholesterol; 100 mg / ml of PEG-ceramide C16. The stock solutions of ND98, cholesterol, and PEG-ceramide C16 can then be combined, for example, in a molar ratio of 42:48:10. The combined lipid solution can be mixed with aqueous dsRNA (e.g., in sodium acetate at pH 5) so that the final ethanol concentration is about 35–45% and the final sodium acetate concentration is about 100–300 mM. Lipid-dsRNA nanoparticles typically form spontaneously during mixing. Depending on the desired particle size distribution, the resulting nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cutoff) using a thermobarrel extruder, such as a Lipex extruder (Northern Lipids, Inc.). In some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be achieved, for example, by dialysis or tangential flow filtration. The buffer can be replaced with phosphate-buffered saline (PBS) at approximately pH 7, such as approximately pH 6.9, approximately pH 7.0, approximately pH 7.1, approximately pH 7.2, approximately pH 7.3, or approximately pH 7.4. [ka]
[0403] The LNP01 formulation is described, for example, in International Publication No. 2008 / 042973, which is incorporated herein by reference.
[0404] Additional exemplary lipid dsRNA formulations are provided in the table below.
[0405] [Table 1]
[0406] [Table 2]
[0407] [Table 3]
[0408] Formulations comprising SNALP (1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) are described in International Publication No. 2009 / 127060, filed on April 15, 2009, which is incorporated herein by reference.
[0409] XTC-containing formulations are described, for example, in U.S. Provisional Patent Application No. 61 / 148,366 filed on 29 January 2009; U.S. Provisional Patent Application No. 61 / 156,851 filed on 2 March 2009; U.S. Provisional Patent Application No. 1 filed on 10 June 2009; U.S. Provisional Patent Application No. 61 / 228,373 filed on 24 July 2009; U.S. Provisional Patent Application No. 61 / 239,686 filed on 3 September 2009; and International Application PCT / US2010 / 022614 filed on 29 January 2010.
[0410] MC3-containing formulations are described, for example, in U.S. Provisional Patent Application No. 61 / 244,834 filed on 22 September 2009; U.S. Provisional Patent Application No. 61 / 185,800 filed on 10 June 2009; and International Application PCT / US10 / 28224 filed on 10 June 2010, which are incorporated herein by reference.
[0411] A formulation containing ALNY-100 is described, for example, in the international application PCT / US09 / 63933, filed on November 10, 2009, which is incorporated herein by reference.
[0412] Formulations containing C12-200 are described in U.S. Provisional Patent Application No. 61 / 175,770, filed on 5 May 2009, and in International Application PCT / US10 / 33777, filed on 5 May 2010, which are incorporated herein by reference.
[0413] Synthesis of cationic lipids For example, any of the cationic lipids and other compounds used in the nucleic acid-lipid particles discussed in this invention can be prepared by known organic synthesis techniques, including the methods described in more detail in the examples. Unless otherwise specified, all substituents are defined below.
[0414] "Alkyl" refers to a linear or branched, acyclic or cyclic, saturated aliphatic hydrocarbon containing 1 to 24 carbon atoms. Representative saturated linear alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, and n-hexyl; on the other hand, saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, and isopentyl. Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl; on the other hand, unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl.
[0415] An alkenyl is an alkyl group, as defined above, that contains at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Representative linear and branched alkenyls include ethyleneyl, propyrenyl, 1-butenyl, 2-butenyl, isobutyrenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, and 2,3-dimethyl-2-butenyl.
[0416] "Alkynyl" refers to any alkyl or alkenyl as defined above, which further contains at least one triple bond between adjacent carbon atoms. Representative linear and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, and 3-methyl-1-butynyl.
[0417] "Acyl" refers to any alkyl, alkenyl, or alkynyl group in which a carbon atom is substituted with an oxo group at the bonding site, as defined below. For example, -C(=O)alkyl, -C(=O)alkenyl, and -C(=O)alkynyl are acyl groups.
[0418] A "heterocycle" means a saturated, unsaturated, or aromatic 5- to 7-membered monocycle, or a 7- to 10-membered dicycle, or heterocycle containing one or two heteroatoms independently selected from nitrogen, oxygen, and sulfur, including a dicycle in which any of the lower heterocycles is fused to a benzene ring, wherein the nitrogen and sulfur heteroatoms may or may not be oxidized, and the nitrogen heteroatom may or may not be quaternized. Heterocycles can be attached via any heteroatom or carbon atom. Examples of heterocycles include heteroaryls as defined below. Examples of heterocycles include morpholinyl, pyrrolidinonyl, piperidinyl, piperidinyl, hydantoinyl, valerolactamyl, oxylanil, oxetanyl, tetrahydrofuranil, tetrahydropyranil, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranil, tetrahydropyrimidinyl, tetrahydrothiophenyl, and tetrahydrothiopyranil.
[0419] The terms "optional alkyl," "optional alkenyl," "optional alkynyl," "optional acyl," and "optional heterocyclic" all mean that, if substituted, at least one hydrogen atom is substituted by the substituent. In the case of an oxo substituent (=O), two hydrogen atoms are substituted. In this regard, substituents include oxo, halogen, heterocyclic, -CN, and -OR. x , -NR x R y , -NR x C(=O)R y , -NR x SO2R y -C(=O)R x , -C(=O)OR x -C(=O)NR x R y , -SO n R x , and -SO n NR x R y These include n, where n is 0, 1, or 2, and R x and R y These are either identical or different, independently being hydrogen, alkyl, or heterocyclic, and each of the alkyl and heterocyclic substituents is one or more oxo, halogen, -OH, -CN, alkyl, -OR x , complex algebra, -NR x R y , -NR x C(=O)R y , -NR x SO2R y -C(=O)R x , -C(=O)OR x -C(=O)NR x R y , -SO n R x , and -SO n NR x R y It may be further replaced by...
[0420] "Halogen" refers to fluoro, chloro, bromo, and iodine.
[0421] In some embodiments, the methods described herein may require the use of protecting groups. The procedures for protecting groups are well known to those skilled in the art (see, for example, "Protective Groups in Organic Synthesis," by Green, TW et al., Wiley-Interscience, New York, NY, 1999). Briefly speaking, in the context of this invention, a protecting group is any group that reduces or eliminates the undesirable reactivity of a functional group. Protecting groups can be added to a functional group to mask its reactivity during a particular reaction and then removed to expose the original functional group. In some embodiments, "alcohol protecting groups" are used. "Alcohol protecting groups" are any group that reduces or eliminates the undesirable reactivity of an alcohol functional group. Protecting groups can be added and removed using techniques well known in the art.
[0422] Synthesis of Equation A In one embodiment, the nucleic acid lipid particles discussed in the present invention are Formula A, [ka] (In the formula, R1 and R2 are alkyl, alkenyl, or alkynyl compounds that are independently and optionally substituted, respectively; R3 and R4 are independently lower alkyl compounds; or R3 and R4 together may form an optionally substituted heterocycle. The formulation is prepared using the cationic lipid. In some embodiments, the cationic lipid is XTC(2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane). Generally, the lipid of formula A above may be prepared by the following reaction scheme 1 or 2, where all substituents are as defined above unless otherwise specified.
[0423] Scheme 1 [ka] Lipid A can be prepared according to Scheme 1, where R1 and R2 are independently alkyl, alkenyl, or alkynyl compounds, each of which can be optionally substituted; R3 and R4 are independently lower alkyl compounds; or R3 and R4 can together form an optionally substituted heterocycle. Ketone 1 and bromide 2 can be purchased or prepared according to methods known to those skilled in the art. The reaction of 1 and 2 yields ketal 3. Ketal 3 is treated with amine 4 to obtain the lipid of formula A. The lipid of formula A can be converted to the corresponding ammonium salt by an organic salt of formula 5 (wherein X is an anion counterion selected from halogens, hydroxides, phosphates, sulfates, etc.).
[0424] Scheme 2 [ka] Alternatively, the starting materials for ketone 1 may be prepared according to Scheme 2. Grignard reagent 6 and cyanide 7 can be purchased or prepared according to methods known to those skilled in the art. The reaction of 6 and 7 yields ketone 1. The conversion of ketone 1 to the corresponding lipid of formula A is as described in Scheme 1.
[0425] MC3 synthesis The preparation of DLin-M-C3-DMA (i.e., (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoic acid) was as follows: A solution of (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-ol (0.53 g), 4-N,N-dimethylaminobutyrate (0.51 g), 4-N,N-dimethylaminopyridine (0.61 g), and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.53 g) in dichloromethane (5 mL) was stirred overnight at room temperature. The solution was washed with dilute hydrochloric acid, followed by diluted aqueous sodium bicarbonate. The organic fraction was dried on anhydrous magnesium sulfate, filtered, and the solvent was removed on a rotary evaporator. The residue was passed through a silica gel column (20 g) using a 1-5% methanol / dichloromethane elution gradient. The fractions containing the purified product were combined, the solvent was removed, and a colorless oil (0.54 g) was obtained.
[0426] Synthesis of ALNY-100 Ketal 519 [ALNY-100] was synthesized using the following scheme 3. [ka]
[0427] 515 synthesis To a suspension of LiAlH4 (3.74 g, 0.09852 mol) in 200 ml of anhydrous THF stirred in 1 L of RBF, a solution of 514 (10 g, 0.04926 mol) in 70 mL of THF was slowly added at 0°C under a nitrogen atmosphere. After the addition was complete, the reaction mixture was heated to room temperature, then heated and refluxed for 4 hours. The progress of the reaction was monitored by TLC. After the reaction was complete (by TLC), the mixture was cooled to 0°C and quenched by careful addition of saturated Na2SO4 solution. The reaction mixture was stirred at room temperature for 4 hours and filtered. The residue was thoroughly washed with THF. The filtrate and washings were mixed and diluted with 400 mL of dioxane and 26 mL of concentrated HCl, and stirred at room temperature for 20 minutes. The volatilities were evaporated under vacuum to obtain the hydrochloride salt of 515 as a white solid. Yield: 7.12g 1H-NMR (DMSO, 400MHz): δ=9.34(broad,2H),5.68(s,2H),3.74(m,1H),2.66-2.60(m,2H),2.50-2.45(m,5H).
[0428] 516 synthesis To a stirred solution of compound 515 in 100 mL of dry DCM in 250 mL double-necked RBF, NEt3 (37.2 mL, 0.2669 mol) was added and the mixture was cooled to 0°C under a nitrogen atmosphere. After the slow addition of N-(benzyloxy-carbonyloxy)-succinimide (20 g, 0.08007 mol) in 50 mL of dry DCM, the reaction mixture was allowed to stand until it warmed to room temperature. After the reaction was complete (2-3 hours by TLC), the mixture was successively washed with 1N HCl solution (1 × 100 mL) and saturated NaHCO3 solution (1 × 50 mL). The organic layer was then dried on anhydrous Na2SO4, and the solvent was evaporated to obtain the crude product, which was purified by silica gel column chromatography to obtain 516 as a sticky mass. Yield: 11g (89%).1H-NMR (CDCl3, 400MHz): δ=7.36-7.27(m,5H),5.69(s,2H),5. 12(s,2H),4.96(br.,1H)2.74(s,3H),2.60(m,2H),2.30-2.25(m,2H).LC-MS [M+H]-232.3(96.94%).
[0429] Synthesis of 517A and 517B At room temperature, cyclopentene 516 (5 g, 0.02164 mol) was dissolved in 220 mL of acetone and water (10:1) in a 500 mL bottle of RBF. N-methylmorpholine N-oxide (7.6 g, 0.06492 mol) was added, followed by 4.2 mL of 7.6% OsO4 (0.275 g, 0.00108 mol) solution in tert-butanol. After the reaction was complete (approximately 3 hours), the mixture was quenched by adding solid Na2SO3, and the resulting mixture was stirred at room temperature for 1.5 hours. The reaction mixture was diluted with DCM (300 mL), washed with water (2 × 100 mL), and then with saturated NaHCO3 (1 × 50 mL) solution, water (1 × 30 mL), and finally brine (1 × 50 mL). The organic phase was dried over anhydrous Na2SO4, and the solvent was removed under vacuum. A mixture of diastereomers was obtained by silica gel column chromatography purification of the crude product, and then separated by preliminary HPLC. Yield: -6g crude 517A - Peak-1 (white solid), 5.13 g (96%). 1H-NMR (DMSO, 400 MHz): δ = 7.39-7.31 (m, 5H), 5.04 (s, 2H), 4.78-4.73 (m, 1H), 4.48-4.47 (d, 2H), 3.94-3.93 (m, 2H), 2.71 (s, 3H), 1.72-1.67 (m, 4H). LC-MS - [M+H]-266.3, [M+NH4+]-283.5 present, HPLC - 97.86%. Stereochemistry was confirmed by X-ray.
[0430] 518 synthesis Compound 518 was obtained as a colorless oil (1.2 g, 41%) using a procedure similar to that described for the synthesis of compound 505. ¹H-NMR (CDCl3, 400 MHz): δ = 7.35-7.33 (m, 4H), 7.30-7.27 (m, 1H), 5.37-5.27 (m, 8H), 5.12 (s, 2H), 4.75 (m, 1H), 4.58-4.57 (m, 2H), 2.78-2.74 (m, 7H), 2.06-2.00 (m, 8H), 1.96-1.91 (m, 2H), 1.62 (m, 4H), 1.48 (m, 2H), 1.37-1.25 (br m, 36H), 0.87 (m, 6H). HPLC - 98.65%.
[0431] Basic procedure for the synthesis of compound 519: A solution of compound 518 (1 eq) in hexane (15 mL) was added dropwise to an ice-cold solution of LAH (1 M, 2 eq) in THF. After the addition was complete, the mixture was heated at 40°C for 0.5 hours and then cooled again on an ice bath. The mixture was carefully hydrolyzed with saturated aqueous solution Na2SO4 and then filtered through Celite to concentrate into oil. Column chromatography yielded pure 519 as a colorless oil (1.3 g, 68%). 13C NMR = 130.2, 130.1 (x2), 127.9 (x3), 112.3, 79.3, 64.4, 44.7, 38.3, 35.4, 31.5, 29.9 (x2), 29.7, 29.6 (x2), 29.5 (x3), 29.3 (x2), 27.2 (x3), 25.6, 24.5, 23.3, 226, 14.1; Electrospray MS (+ve): Molecular weight of C44H80NO2(M+H)+ + calculated value 654.6, measured value 654.6.
[0432] Formulations prepared by either the standard method or a non-extrusion method can be characterized in a similar manner. For example, formulations are typically characterized by visual inspection. They should be whitish, translucent solutions free of aggregates or precipitates. The particle size and particle size distribution of lipid nanoparticles can be measured by light scattering using, for example, a Malvern Zetasizer Nano ZS (Malvern, USA). The particle size should be approximately 20–300 nm, such as 40–100 nm. The particle size distribution should be unimodal. The total dsRNA concentration in the formulation and inclusion fractions was estimated using a dye exclusion assay. Samples of formulated dsRNA can be incubated with RNA-binding dyes such as Ribogreen (Molecular Probes) in or out of the presence of a formulation-disrupting surfactant, such as 0.5% Triton-X100. The total dsRNA in the formulation can be determined by the signal from the surfactant-containing sample compared to a standard curve. The inclusion fraction is determined by subtracting the "free" dsRNA content (measured by the signal in the absence of surfactant) from the total dsRNA content. The percentage of inclusion dsRNA is typically >85%. In SNALP formulations, particle sizes are at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at least 110 nm, and at least 120 nm. Appropriate ranges are typically at least about 50 nm to at least about 110 nm, at least about 60 nm to at least about 100 nm, or at least about 80 nm to at least about 90 nm.
[0433] Compositions and formulations for oral administration include powders or granules, fine particles, nanoparticles, suspensions or solutions in water or aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids, or binders may be desirable. In some embodiments, the oral formulation is administered in combination with one or more osmotic surfactants and chelating agents. Suitable surfactants include fatty acids and / or esters or salts thereof, bile acids and / or salts thereof. Suitable bile acids / salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glycolic acid, glycolic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydrofusidate, and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecyl azacycloheptan-2-one, acylcarnitine, acylcholine, or monoglycerides, diglycerides, or pharmaceutically acceptable salts thereof (e.g., sodium). In some embodiments, combinations of osmotic enhancers are used, such as fatty acid / salt combined with bile acid / salt. One exemplary combination is lauric acid, capric acid, and the sodium salt of UDCA. Further osmotic enhancers include polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether. The DsRNA addressed in this invention may be delivered orally in granular form, including spray-dried particles, or may be complexed to form micro or nanoparticles.Examples of DsRNA complexing agents include polyamino acids; polyimines; polyacrylates; polyalkyl acrylates, polyoxetanes, polyalkylcyanoacrylates; cationized gelatin, albumin, starch, acrylates, polyethylene glycol (PEG), and starch; polyalkylcyanoacrylates; DEAE-derivativeized polyimines, pullulans, cellulose, and starch. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermine, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P (TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexyl Examples include acrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, methyl polyacrylate, polyhexyl acrylate, poly(D,L-lactic acid), poly(DL-lactic acid-coglycolic acid (PLGA), alginate, and polyethylene glycol (PEG). Oral formulations of dsRNA and their preparations are described in detail in U.S. Patent No. 6,887,906, U.S. Patent Publication No. 20030027780, and U.S. Patent No. 6,747,014, respectively, which are incorporated herein by reference.
[0434] Compositions and formulations for parenteral, intracerebral (intracerebral), subarachnoid, intraventricular, or intrahepatic administration may include sterile aqueous solutions, which may also include buffers, diluents, and other suitable additives, including but not limited to osmotic enhancers, carrier compounds, and other pharmaceutically acceptable carriers or excipients.
[0435] Examples of pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be produced from a variety of components, including, but are not limited to, pre-made liquids, self-emulsifying solids, and self-emulsifying semi-solids.
[0436] The pharmaceutical formulations discussed in this invention, which may be presented in unit dosage forms if convenient, may be prepared according to prior art well known in the pharmaceutical industry. Such art involves the step of combining an active ingredient with a pharmaceutical carrier or excipient. Generally, formulations are prepared by uniformly and closely combining an active ingredient with a liquid carrier or an ultrafine particle solid carrier or both, and then shaping the product if necessary.
[0437] The compositions covered by the present invention may be formulated into any of a number of possible dosage forms, including but not limited to tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous, or mixed media. The aqueous suspension may further contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension may also contain stabilizers.
[0438] Additional formulations Emulsion The compositions of the present invention can be prepared and formulated as emulsions. An emulsion is typically a heterogeneous system of one liquid dispersed in another liquid, usually in the form of droplets with a diameter greater than 0.1 μm (e.g., "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems," Allen, LV., Popovich, NG., and Ansel, HC., 2004; Lippincott Williams & Wilkins (8th edition), New York, NY; Idson, "Pharmaceutical Dosage Forms," edited by Lieberman, Rieger, and Banker, 1988; Marcel Decker). Dekker, Inc.), New York, New York, Vol. 1, p. 199; From "Pharmaceutical Dosage Forms" by Rosoff, edited by Lieberman, Rieger and Banker, 1988, Marcel Dekker, Inc., New York, New York, Vol. 1, p. 245; From "Pharmaceutical Dosage Forms" by Block, edited by Lieberman, Rieger and Banker, 1988, Marcel Dekker, Inc., New York, New York, Vol. 2, p. 335; "Remington's Pharmaceutical Sciences" by Higuchi et al., Mack Publishing See Co., Easton, Pennsylvania, 1985, p. 301. Emulsions are often two-phase systems comprising two immiscible liquid phases that are closely mixed and dispersed from one another.Generally, emulsions may be either water-in-oil (w / o) or oil-in-water (o / w). When the aqueous phase is finely dispersed in a bulk oily phase as microdroplets, the resulting composition is referred to as a water-in-oil (w / o) emulsion. Alternatively, when the oily phase is finely dispersed in a bulk aqueous phase as microdroplets, the resulting composition is referred to as an oil-in-water (o / w) emulsion. In addition to the dispersed phase and the active agent, which may exist as a solution in either the aqueous or oily phase, or as a separate phase itself, the emulsion may contain additional components. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and antioxidants may also be present in the emulsion as needed. Pharmaceutical emulsions may also be multiple emulsions comprising more than two phases, such as oil-in-oil (o / w / o) and water-in-oil (w / o / w) emulsions. Such complex formulations often offer specific advantages that simple two-component emulsions do not. Among these, multiple emulsions in which individual oil droplets surround smaller water droplets constitute a w / o / w emulsion. Similarly, an oil droplet system encapsulated within a water sphere and stabilized within an oily continuous phase provides an o / w / o emulsion.
[0439] Emulsions are characterized by having little to no thermodynamic stability. Often, the dispersed or discontinuous phases of an emulsion are well dispersed externally or within the continuous phase and maintained in this form through emulsifiers or means of increasing the formulation viscosity. In the case of emulsion-type ointment bases and creams, any of the emulsion phases may be semi-solid or solid. Another means of stabilizing the emulsion involves the use of emulsifiers, which may be incorporated into any of the emulsion phases. Emulsifiers may be broadly classified into four categories: synthetic surfactants, natural emulsifiers, absorbent bases, and finely dispersed solids (see, for example, "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems," Allen, LV., Popovich, NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th edition), New York, NY; from "Pharmaceutical Dosage Forms" by Idson, Lieberman, Rieger, and Banker (eds.), 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 199).
[0440] Synthetic surfactants, also known as surfactants, have a wide range of applications in emulsion formulations and are outlined in the literature (e.g., "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems," Allen, LV., Popovich, NG., and Ansel, HC., 2004, Lippincott Williams & Wilkins (8th edition), New York, NY; from "Pharmaceutical Dosage Forms" by Rieger, edited by Lieberman, Rieger, and Banker, 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 285; from "Pharmaceutical Dosage Forms" by Idson) See "Forms)" edited by Lieberman, Rieger, and Banker, 1988, translated by Marcel Dekker, Inc., New York, NY, Vol. 1, p. 199. Surfactants are typically amphiphilic and consist of hydrophilic and hydrophobic moieties. The ratio of hydrophilic to hydrophobic moieties is called the hydrophilic / lipophilic balance (HLB) of a surfactant and is a useful means of classifying and selecting surfactants in the preparation of formulations.Surfactants may be classified into different classes based on the properties of their hydrophilic groups: nonionic, anionic, cationic, and amphoteric (see, for example, "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems," Allen, L.V., Popovich, N.G., and Ansel, H.C., 2004; Lippincott Williams & Wilkins (8th edition), New York, NY; and Rieger, "Pharmaceutical Dosage Forms," edited by Lieberman, Rieger, and Banker, 1988, Marcel Dekker, Inc., New York, NY; Vol. 1, p. 285).
[0441] Natural emulsifiers used in emulsion formulations include lanolin, beeswax, phospholipids, lecithin, and acacia. Absorbent bases with hydrophilic properties that can absorb water and form w / o emulsions, such as anhydrous lanolin and hydrophilic petrolatum, still maintain their semi-solid viscosity. Finely dispersed solids are also used as excellent emulsifiers in viscous preparations, particularly in combination with surfactants. These include polar inorganic solids such as heavy metal hydroxides, non-expanding clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloids of aluminum silicate and magnesium aluminum silicate, pigments, and non-polar solids such as carbon or glyceryl tristearate.
[0442] A wide variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of the emulsion. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty acid esters, humectants, hydrophilic colloids, preservatives, and antioxidants (from "Pharmaceutical Dosage Forms" by Block, edited by Lieberman, Rieger, and Banker, 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 335; from "Pharmaceutical Dosage Forms" by Idson, edited by Lieberman, Rieger, and Banker, 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 199).
[0443] Examples of hydrophilic colloids include natural gums and synthetic polymers such as polysaccharides (e.g., acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (e.g., carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (e.g., carbomer, cellulose ether, and carboxyvinyl polymer). These disperse in water or swell in water to form a colloidal solution that stabilizes the emulsion by forming a strong interfacial film around the dispersed phase droplets and by increasing the viscosity of the outer phase.
[0444] Emulsions often contain several components, such as carbohydrates, proteins, sterols, and phospholipids, which may readily support microbial growth; therefore, preservatives are often incorporated into these formulations. Commonly used preservatives in emulsion formulations include methylparaben, propylparaben, quaternary ammonium salts, benzalkonium chloride, p-hydroxybenzoic acid esters, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used may include free radical scavengers such as tocopherol, alkyl gallate, butylated hydroxyanisole, and butylated hydroxytoluene; or reducing agents such as ascorbic acid and sodium metabisulfite; and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
[0445] The application of emulsion formulations via cutaneous, oral, and parenteral routes, and methods for manufacturing them, are outlined in the literature. (See, for example, "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems," Allen, LV., Popovich, NG., and Ansel, HC., 2004, Lippincott Williams & Wilkins (8th edition), New York, NY; and "Pharmaceutical Dosage Forms," by Idson, Lieberman, Rieger, and Banker (eds.), 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 199).Emulsion formulations for oral delivery are widely used due to their ease of formulation and efficiency in terms of absorption and bioavailability (e.g., "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems," Allen, LV., Popovich, NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th edition), New York, NY; Rosoff, "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker, eds., 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 245; Idson, "Pharmaceutical Dosage Forms" See "Forms)" edited by Lieberman, Rieger, and Banker, 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 199. Mineral oil-based laxatives, fat-soluble vitamins, and high-fat nutritional supplements are among the materials commonly administered orally as o / w emulsions.
[0446] In one embodiment of the present invention, the iRNA and nucleic acid composition is formulated as a microemulsion. A microemulsion may be defined as a system of water, oil, and amphiphilic substances that is a single optically isotropic and thermodynamically stable solution (see, for example, "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems," edited by Allen, L.V., Popovich, N.G., and Ansel, H.C., 2004, Lippincott Williams & Wilkins (8th edition), New York, NY; from "Pharmaceutical Dosage Forms" by Rosoff, edited by Lieberman, Rieger, and Banker, 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 245). Typically, microemulsions are systems prepared by first dispersing an oil in an aqueous surfactant solution, and then adding a sufficient amount of a fourth component, generally an alcohol of intermediate chain length, to form a transparent system. Thus, microemulsions are described as thermodynamically stable, isotropically transparent dispersions of two immiscible liquids stabilized by an interfacial film of surfactant molecules (Leung and Shah, "Controlled Release of Drugs: Polymers and Aggregate Systems," edited by Rosoff, M., 1989, VCH Publishers, New York, pp. 185-215). Microemulsions are usually prepared through a combination of 3 to 5 components, including oil, water, surfactant, co-surfactant, and electrolyte.Whether a microemulsion is water-in-oil (w / o) or oil-in-water (o / w) depends on the properties of the oil and surfactant used, as well as the structure and geometric packing of the polar head and hydrocarbon tail of the surfactant molecule (Schott, "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pennsylvania, 1985, p. 271).
[0447] Phenomenological approaches using phase diagrams have been extensively studied, providing those skilled in the art with comprehensive knowledge of microemulsion formulation methods (e.g., "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems," Allen, LV., Popovich, NG., and Ansel, HC., 2004, Lippincott Williams & Wilkins (8th edition), New York, NY; Rosoff, "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker, eds., 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 245; Block, "Pharmaceutical Dosage Forms" See "Forms)" edited by Lieberman, Rieger, and Banker, 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 335. Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs into a naturally formed, thermodynamically stable droplet formulation.
[0448] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, nonionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), and decaglycerol decaoleate (DAO750), either alone or in combination with co-surfactants. Typically, co-surfactants, which are short-chain alcohols such as ethanol, 1-propanol, and 1-butanol, help increase interfacial fluidity by penetrating the surfactant coating, resulting in an irregular coating due to gaps between surfactant molecules. However, microemulsions may be prepared without the use of co-surfactants, and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, aqueous solutions of pharmaceuticals, glycerol, PEG300, PEG400, polyglycerol, propylene glycol, and ethylene glycol derivatives. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium-chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils, and silicone oils.
[0449] Microemulsions are of particular interest from the standpoint of drug solubilization and improved drug absorption. Lipid-based microemulsions (both o / w and w / o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see, for example, U.S. Patent Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, Vol. 11, pp. 1385-1390; Ritschel, Methods & Findings in Experimental & Clinical Pharmacol., 1993, Vol. 13, p. 205). Microemulsions offer advantages such as improved drug solubilization, protection of drugs from enzymatic hydrolysis, expected enhanced drug absorption due to changes in membrane fluidity and permeability induced by surfactants, ease of preparation, ease of oral administration compared to solid dosage forms, improved clinical efficacy, and reduced toxicity (see, for example, U.S. Patent Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, Vol. 11, p. 1385; Ho et al., Journal of Pharmaceutical Sciences (J.Pharm.Sci.), 1996, Vol. 85, pp. 138-143). Microemulsions often form spontaneously when their components are combined at ambient temperature. This can be particularly advantageous when formulating heat-unstable drugs, peptides, or iRNAs. Microemulsions have been effective for transdermal delivery of active ingredients in both cosmetic and pharmaceutical applications. The microemulsion compositions and formulations of the present invention are expected to facilitate increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve local intracellular uptake of iRNAs and nucleic acids.
[0450] The microemulsion of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and enhance the absorption of the iRNA and nucleic acids of the present invention. The penetration enhancers used in the microemulsion of the present invention may be classified into one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes is discussed above.
[0451] Penetration enhancer In one embodiment, the present invention provides efficient delivery of nucleic acids, particularly iRNAs, to animal skin using various penetration enhancers. Most drugs exist in solution in both ionized and non-ionized forms. However, typically only lipid-soluble or lipophilic drugs readily cross cell membranes. It has been found that even non-lipophilic drugs can cross cell membranes if the membrane being crossed is treated with a penetration enhancer. In addition to assisting the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also increase the permeability of lipophilic drugs.
[0452] Penetration enhancers may be classified into one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see, for example, Malmsten, M., "Surfactants and polymers in drug delivery," Informa Health Care, New York, NY, 2002; Lee et al., "Critical Reviews in Therapeutic Drug Carrier Systems," 1991, p. 92). Each of the aforementioned classes of penetration enhancers will be described in more detail below.
[0453] Surfactants: In relation to the present invention, surfactants (or "surface-active agents") are chemical substances that, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, thereby improving iRNA absorption through mucous membranes. In addition to bile salts and fatty acids, these osmotic enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, and polyoxyethylene-20-cetyl ether (see, for example, Malmsten, M., "Surfactants and polymers in drug delivery," Informa Health Care, New York, NY, 2002; Lee et al., "Critical Reviews in Therapeutic Drug Carrier Systems," 1991, p. 92; and perfluoro compound emulsions such as FC-43, Takahashi et al., Journal of Pharmacy & Pharmacol., 1988, Vol. 40, p. 252).
[0454] Fatty acids: Various fatty acids and their derivatives that act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monoleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecyl azacycloheptan-2-one, acylcarnitine, acylcholine, and its C 1~20 Examples include alkyl esters (e.g., methyl, isopropyl, and t-butyl) and their mono- and di-glycerides (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.). (See, for example, Touitou, E. et al., "Enhancement in Drug Delivery," CRC Press, Danvers, MA, Massachusetts, 2006; Lee et al., "Critical Reviews in Therapeutic Drug Carrier Systems," 1991, p. 92; Muranishi, "Critical Reviews in Therapeutic Drug Carrier Systems," 1990, Vol. 7, pp. 1-33; El Hariri et al., Journal of Pharmacy & Pharmacol., 1992, Vol. 44, pp. 651-654).
[0455] Bile salts: The physiological role of bile includes promoting the dispersion and absorption of lipids and fat-soluble vitamins (see, for example, Malmsten, M., "Surfactants and polymers in drug delivery," Informa Health Care, New York, 2002; and Brunton, Chapter 38, "Goodman & Gilman's The Pharmacological Basis of Therapeutics," 9th edition, edited by Hardman et al., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts and their synthetic derivatives act as osmotic enhancers. Therefore, the term "bile salt" includes any of the natural components of bile and any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucoseic acid (sodium glucose), glycolic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydrofusidate (STDHF), sodium glycodihydrofusidate, and polyoxyethylene-9-lauryl ether (POE).(For example, Malmsten, M., "Surfactants and polymers in drug delivery," Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Swinyard, Chapter 39, "Remington's Pharmaceutical Sciences," 18th edition, edited by Gennaro, Mack Publishing Co., Easton, Pennsylvania, 1990, pp. 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems) See also: Systems), 1990, Vol. 7, pp. 1-33; Yamamoto et al., Journal of Experimental Therapeutics (J.Pharm.Exp.Ther.), 1992, Vol. 263, p. 25; Yamashita et al., Journal of Pharmaceutical Science (J.Pharm.Sci.), 1990, Vol. 79, pp. 579-583.
[0456] Chelating agents: Chelating agents used in connection with the present invention can be defined as compounds that remove metal ions from solution by forming complexes with them, thereby improving iRNA absorption through mucous membranes. With regard to their use as penetration enhancers in the present invention, since most DNA nucleases require divalent metal ions for catalytic activity and are inhibited by chelating agents, chelating substances have the additional advantage of also acting as deoxyribonuclease inhibitors (Jarrett, J., Chromatogr., 1993, Vol. 618, pp. 315-339). Suitable chelating agents include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylic acid, and homovanilate), N-acyl derivatives of collagen, laureth-9, and N-aminoacyl derivatives of β-diketones (enamine). (See, for example, Katdare, A. et al., "Excipient development for pharmaceutical, biotechnology, and drug delivery," CRC Press, Danvers, MA, 2006; Lee et al., "Critical Reviews in Therapeutic Drug Carrier Systems," 1991, p. 92; Muranishi, "Critical Reviews in Therapeutic Drug Carrier Systems," 1990, Vol. 7, pp. 1-33; Buur et al., "Journal of Controlled Rel.," 1990, Vol. 14, pp. 43-51).
[0457] Non-chelating non-surfactant: In the usage herein, non-chelating non-surfactant penetration-enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or surfactants, but still enhance the absorption of iRNA through the gastrointestinal mucosa (see, for example, Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, Vol. 7, pp. 1-33). Examples of osmotic agents in this class include unsaturated cyclic ureas, 1-alkyl- and 1-alkenyl azacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and nonsteroidal anti-inflammatory drugs such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., Journal of Pharmacy & Pharmacol., 1987, Vol. 39, pp. 621-626).
[0458] Substances that enhance iRNA uptake at the cellular level may also be added to the pharmaceuticals and other compositions of the present invention. For example, cationic lipids such as lipofectin (U.S. Patent No. 5,705,188, granted to Junichi et al.), cationic glycerol derivatives, and polycationic molecules such as polylysine (International Publication No. 97 / 30731, granted to Lollo et al.) are also known to enhance dsRNA uptake within cells. Examples of commercially available translocation reagents include, for example, Lipofectamine™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000 (Invitrogen; Carlsbad, CA), 293fectin (Invitrogen; Carlsbad, CA), Cellfectin (Invitrogen; Carlsbad, CA), DMRIE-C (Invitrogen; Carlsbad, CA), FreeStyle™ MAX (Invitrogen; Carlsbad, CA), and Lipofectamine™ 2000. CD (Invitrogen; Carlsbad, CA), Lipofectamine (trademark) (Invitrogen; Carlsbad, CA), RNAiMAX (Invitrogen; Carlsbad, CA), Oligofectamine (trademark) (Invitrogen; Carlsbad, CA), Optifect (trademark) (Invitrogen);Carlsbad, California (CA), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam® Reagent (Promega; Madison, Wisconsin, WI), TransFast® Transfection Reagent (Promega; Madison, Wisconsin, WI), Tfx®-20 Reagent (Promega; Madison, Wisconsin, WI), Tfx(trademark)-50 Reagent (Promega; Madison, Wisconsin, WI), DreamFect(trademark) (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass; aD1 Transfection Reagent (New England Biolabs; Ipswich, MA, USA), LyoVec™ / LipoGen™ (Invivogen; San Diego, CA, USA), PerFectin Transfection Reagent (Genlantis; San Diego, CA, USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), GenePORTER Transfection Reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 Transfection Reagent (Genlantis; San Diego, CA, USA), Cytofectin Transfection Reagent (Genlantis; San Diego, CA, USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), TroganPORTER™ Transfection Reagent (Genlantis; San Diego, CA, USA), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline; Taunton, MA, USA), UniFECTOR (B-Bridge International);Examples include Mountain View, California, USA; SureFECTOR (B-Bridge International; Mountain View, California, USA); or HiFect® (B-Bridge International; Mountain View, California, USA).
[0459] Glycols such as ethylene glycol and propylene glycol; pyrroles such as 2-pyrrole; azone; and other active substances including terpenes such as limonene and menthone may be used to enhance the penetration of administered nucleic acids.
[0460] Carrier Certain compositions of the present invention also incorporate a carrier compound during formulation. In the use herein, “carrier compound” or “carrier” may refer to a nucleic acid or analogue that is inactive (i.e., not biologically active itself) but is recognized as a nucleic acid by an in vivo process that reduces the bioavailability of biologically active nucleic acids, for example, by degrading biologically active nucleic acids or facilitating their removal from circulation. Co-administration of nucleic acids and carrier compounds, typically in excess of the latter, may result in a substantial reduction in the amount of nucleic acid recovered in the liver, kidneys, or other extracirculatory storage sites, possibly due to competition between the carrier compound and nucleic acid for the normal receptor. For example, the recovery of partial phosphorothioate dsRNA in liver tissue may be reduced when it is administered concurrently with polyinosinate, dextran sulfate, polycytidic, or 4-acetamido-4'-isothiocyanostilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Research & Development (Res.Dev.), 1995, Vol. 5, pp. 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Development (DsRNA & Nucl. Acid Drug Dev.), 1996, Vol. 6, pp. 177-183).
[0461] Excipients In contrast to carrier compounds, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspension, or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. Excipients may be liquid or solid and are selected with the planned mode of administration in mind so as to provide the desired bulk, viscosity, etc., when combined with the nucleic acid and other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binders (e.g., pregelatinized corn starch, polyvinylpyrrolidone, or hydroxypropyl methylcellulose); bulking agents (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethylcellulose, polyacrylate, or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc, silica, silicon dioxide colloids, stearic acid, metal stearate salts, hydrogenated vegetable oil, corn starch, polyethylene glycol, sodium benzoate, sodium acetate); disintegrants (e.g., starch, sodium starch glycolate); and wetting agents (e.g., sodium lauryl sulfate).
[0462] The compositions of the present invention can be formulated using pharmaceutically acceptable organic or inorganic excipients that do not react adversely with nucleic acids and are suitable for oral administration. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0463] Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohol, or nucleic acid solutions in liquid or solid oil bases. The solutions may also contain buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients that do not cause adverse nucleic acid reactions and are suitable for oral administration may be used.
[0464] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, saline solutions, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0465] Other ingredients The compositions of the present invention may further contain other auxiliary components found in conventional pharmaceutical compositions, at levels of use established in the art. For example, the compositions may contain additional compatible pharmacologically active materials such as antipruritics, tasting agents, topical anesthetics, or anti-inflammatory agents, or additional materials useful for physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavorings, preservatives, antioxidants, opacifiers, thickeners, and stabilizers. However, such materials, when added, should not excessively interfere with the biological activity of the components of the compositions of the present invention. The formulations may be sterilized and, if necessary, mixed with auxiliary agents that do not adversely interact with the nucleic acids of the formulation, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts affecting osmotic pressure, buffers, colorants, flavorings, and / or aromatic substances.
[0466] The aqueous suspension may contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension may also contain stabilizers.
[0467] In some embodiments, the pharmaceutical compositions covered by the present invention include (a) one or more iRNA compounds and (b) one or more bioagents that function by a non-RNAi mechanism. Examples of such bioagents include agents that interfere with the interaction between ALAS1 and at least one ALAS1-binding partner.
[0468] The toxicity and therapeutic effects of such compounds can be determined by standard pharmaceutical procedures, for example, in cell cultures or experimental animals to measure the LD50 (lethal dose in 50% of the population) and ED50 (therapeutably effective dose in 50% of the population). The dose ratio between toxicity and therapeutic effect is the therapeutic index, which can be expressed as the LD50 / ED50 ratio. Compounds exhibiting a high therapeutic index are typical.
[0469] Data obtained from cell culture assays and animal experiments can be used to formulate dosage ranges for human use. Doses of the compositions discussed in this invention are generally within the range of circulating concentrations, including the ED50, which is minimally or completely toxic. Doses may vary within this range depending on the dosage form and route of administration used. For any compound used in the methods discussed in this invention, the therapeutically effective dose can first be estimated from cell culture assays. Doses may be formulated in animal models to achieve the circulating plasma concentration range of the compound, or, where appropriate, the polypeptide product of the target sequence, including the IC50 (i.e., the concentration of the test compound that achieves maximum half-dose inhibition of symptoms) measured in cell culture (e.g., achieving a reduction in polypeptide concentration). Such information can be used to more accurately determine useful doses in humans. Plasma levels may be measured, for example, by high-performance liquid chromatography.
[0470] As discussed above, the iRNAs discussed in this invention may be administered in combination with other known agents that are effective in treating diseases or disorders related to ALAS1 expression, in addition to their own administration. In any case, the physician administering the treatment may adjust the amount and timing of iRNA administration based on the results observed using standard means of efficacy known in the art or described herein.
[0471] Methods for treating ALAS1 gene expression-related disorders The present invention relates, in particular, to the use of ALAS1-targeting iRNAs for inhibiting ALAS1 expression and / or treating diseases, disorders, or pathological processes associated with ALAS1 expression.
[0472] In the context of this specification, “ALAS1 expression-related disorder,” “ALAS1 expression-related disease,” “ALAS1 expression-related pathological process,” etc., include any condition, disorder, or disease, or other mechisms that result in pathological changes in the heme biosynthesis pathway, in which ALAS1 expression is altered (e.g., elevated), the levels of one or more porphyrins are altered (e.g., elevated), and the levels or activity of one or more enzymes in the heme biosynthesis pathway (porphyrin pathway) are altered. For example, iRNAs targeting the ALAS1 gene, or combinations thereof, may be used to treat conditions in which porphyrin or porphyrin precursor (e.g., ALA or PBG) levels are elevated (e.g., certain porphyrias), or conditions in which there is a defect in heme biosynthesis pathway enzymes (e.g., certain porphyrias). Examples of ALAS1 expression-related disorders include X-linked sideroblastic anemia (XLSA), ALA dehydratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoiesis, late-onset cutaneous porphyria (Prophyria cutanea tarda), hereditary coproporphyria, atypical porphyria, erythropoiesis-proliferative protoporphyria (EPP), and transient erythropoiesis in infancy.
[0473] In the use herein, the “subject” to be treated according to the methods described herein may include, for example, human or non-human animals such as mammals. Mammals may be, for example, rodents (e.g., rats or mice) or primates (e.g., monkeys). In some embodiments, the subject is human.
[0474] In some embodiments, subjects have an ALAS1 expression-related disorder (e.g., have been diagnosed with porphyria or have experienced one or more symptoms of porphyria and are carriers of a porphyria-associated mutation) or are at risk of developing an ALAS1 expression-related disorder (e.g., subjects with a family history of porphyria or subjects who are carriers of a gene mutation associated with porphyria).
[0475] The classification of porphyria, including acute hepatic porphyria, is described, for example, in Balwani, M. & Desnick, RJ, Blood, 120(23), Blood, first edition, July 12, 102; DOI 10.1182 / Blood-2012-05-423186, published online. As described by Balwain & Desnick, acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), and atypical porphyria (VP) are autosomal dominant porphyria, while ALA dehydratase deficiency porphyria (ADP) is autosomal recessive. Rarely, AIP, HCP, and VP exist as homozygous dominant forms. In addition, there is a rare homozygous recessive form of porphyria cetamorphosis (PCT), a monohepatic cutaneous porphyria also known as hepatomethic porphyria. The clinical and laboratory characteristics of these porphyrias are described in Table 11 below.
[0476] [Table 4]
[0477] In some embodiments, subjects have or are at risk of developing porphyria, such as hepatic porphyria, e.g., AIP, HCP, VP, ADP, or hepatomelae porphyria.
[0478] In some embodiments, porphyria is acute hepatic porphyria, which is selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variant porphyria (VP), and ALA dehydratase deficiency porphyria (ADP).
[0479] In some embodiments, the porphyria is a double porphyria, such as at least two porphyrias. In some embodiments, the double porphyria comprises two o...
Claims
1. A double-stranded ribonucleic acid (dsRNA) or a salt thereof for inhibiting the expression of ALAS1, wherein the dsRNA comprises a sense strand and an antisense strand, the antisense strand comprises the sequence AGAUGAGAACACUCUUUCUG (SEQ ID NO: 486), and the dsRNA comprises a ligand.
2. The dsRNA or a salt thereof according to claim 1, wherein the dsRNA comprises at least one modified nucleotide, the at least one modified nucleotide being selected from the group consisting of a 2'-O-methyl modified nucleotide, a nucleotide containing a 5'-phosphorothioate group, a cholesteryl derivative or a terminal nucleotide linked to a dodecanoic acid bisdecylamide group, a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, a debasalized nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a non-natural base-containing nucleotide.
3. The dsRNA or a salt thereof according to claim 1 or 2, wherein the ligand comprises one or more N-acetylgalactosamine (GalNAc) derivatives.
4. The dsRNA or salt thereof according to claim 3, wherein the GalNAc derivative is attached to the 3' end of the sense strand of the dsRNA and has the structure shown below. 【Chemistry 1】
5. A dsRNA or salt thereof according to any one of claims 1 to 4, wherein the sense strand comprises the sequence CAGAAAAGAGUGUCUCAUCU (SEQ ID NO: 485).
6. A dsRNA or salt thereof according to any one of claims 1 to 5, comprising a double-stranded region having a length of 15 to 30 base pairs.
7. The dsRNA or a salt thereof according to claim 6, wherein the double-stranded region has a length of 19 to 23 base pairs.
8. dsRNA or a salt thereof according to any one of claims 1 to 7, wherein each chain has a length of 26 nucleotides or less.
9. A dsRNA or salt thereof according to any one of claims 1 to 8, wherein at least one strand comprises a 3' overhang of at least two nucleotides.
10. A pharmaceutical composition for use in inhibiting the expression of the ALAS1 gene, comprising dsRNA or a salt thereof as described in any one of claims 1 to 9.
11. The pharmaceutical composition according to claim 10, wherein the composition is for intravenous or subcutaneous administration.
12. (a) A step of introducing dsRNA or a salt thereof according to any one of claims 1 to 9 into a cell, An in vitro method for inhibiting ALAS1 expression in cells, comprising the steps of (b) maintaining the cells from step (a) for a time sufficient to obtain degradation of the mRNA transcript of the ALAS1 gene, thereby inhibiting the expression of the ALAS1 gene in the cells.
13. An in vitro method for reducing porphyrin or porphyrin precursor levels in cells, comprising the step of contacting the cells with a dsRNA or salt thereof according to any one of claims 1 to 9 in an amount effective for reducing porphyrin or porphyrin precursor levels in the cells.
14. A dsRNA or salt thereof according to any one of claims 1 to 9 or a pharmaceutical composition according to claim 10 or 11 for use in a method of treating ALAS1 expression-related disease, wherein a therapeutically effective amount of dsRNA or a salt thereof or composition is administered to a subject in need of such treatment.
15. (a) The subject is at risk of developing porphyria or has been diagnosed with porphyria; (b) The method described above, (i) To improve symptoms associated with ALAS1-related disorders, (ii) Inhibiting ALAS1 expression in the subject, (iii) In the subject, the porphyrin precursor or porphyrin level is reduced, (iv) In the subject, the frequency of acute attacks of symptoms associated with porphyria is reduced, or (v) When the subject is exposed to an exacerbating factor, the incidence of acute attacks of symptoms associated with porphyria is reduced among the subject; (c) The subject is at risk of developing any of the following conditions, or is diagnosed with any of the following: acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variant porphyria (VP), ALA dehydratase deficiency porphyria (ADP), and hepatic porphyria, selected from hepatic myeloid porphyria; (d) The dsRNA is administered before, during, or after an acute attack of porphyria; (e) The dsRNA is administered during the prodromal symptoms; or (f) The subject has elevated ALA and / or PBG levels, The dsRNA or a salt thereof or pharmaceutical composition according to claim 14.
16. The dsRNA or a salt thereof or pharmaceutical composition according to claim 15, wherein the prodromal symptoms are characterized by pain, nausea, psychological symptoms, emotional instability, or insomnia.
17. Cells in vitro or in vitro comprising dsRNA or a salt thereof as described in any one of claims 1 to 9.
Citation Information
Patent Citations
Carbohydrate conjugates as oligonucleotide delivery agents
JP2011505425A
Optimized method for delivering dsRNA targeting the PCSK9 gene
JP2011511004A
Lipid formulated dsrna targeting the PCSK9 gene
WO2010148013A2