Matrix-bound vesicles (MBVs) for the treatment of acute respiratory distress syndrome
Matrix-bound vesicles (MBVs) address the challenge of ARDS by modulating the immune system to reduce inflammation and promote a pro-remodeling macrophage phenotype, effectively treating ARDS and enhancing immune response without increasing secondary infections.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- UNIV OF PITTSBURGH OF THE COMMONWEALTH SYST OF HIGHER EDUCATION
- Filing Date
- 2021-04-15
- Publication Date
- 2026-04-20
AI Technical Summary
Current treatments for acute respiratory distress syndrome (ARDS) caused by viral infections like COVID-19, such as those induced by SARS-CoV-2, primarily focus on immunosuppression, which increases susceptibility to secondary infections and does not effectively modulate the immune system to prevent or resolve hypercytokinemia and associated inflammation.
Administration of matrix-bound vesicles (MBVs) derived from the extracellular matrix, which modulate the immune system by downregulating pro-inflammatory cytokines and upregulating anti-inflammatory cytokines, promoting a phenotypic switch in macrophages from a pro-inflammatory to a pro-remodeling state, thereby reducing inflammation and preventing or reversing ARDS.
MBVs effectively reduce inflammation, increase oxygen saturation, decrease pro-inflammatory cytokine production, and promote anti-inflammatory cytokine production, leading to improved patient outcomes with reduced risk of secondary infections and enhanced immune response.
Smart Images

Figure 0007847854000005 
Figure 0007847854000006 
Figure 0007847854000007
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This asserts the interests of U.S. Provisional Patent Application No. 63 / 011,177, filed on April 16, 2020, which is incorporated herein by reference in its entirety.
[0002] Field of Invention This application relates to the administration of matrix-bound vesicles (MBVs) derived from the extracellular matrix for treating ARDS such as acute respiratory distress syndrome (ARDS) caused by SARS-CoV-2 (COVID-19). [Background technology]
[0003] background The COVID-19 pandemic, resulting from severe acute respiratory syndrome-coronavirus 2 (SARS-CoV-2) infection, also known in the art as 2019-novel coronavirus or 2019-nCoV, is currently a source of public health concern worldwide. Treatment has been clinically challenging in many patients (Mehta et al. (2020) COVID-19: Consider Cytokine Storm Syndromes and Immunosuppression. Lancet. 395 (10229): 1033-1034). While massive resources have been mobilized to develop antiviral, anti-inflammatory, immunosuppressant, and vaccine drugs, the mountain of evidence suggests that hypercytokinemia, also known as cytokine release syndrome or cytokine storm syndrome, is a common feature and a major cause of death in the most severely ill COVID-19 patients (Tian, S. et al. (2020) Pulmonary Pathology of Early-Phase 2019 Novel Coronavirus (COVID-19) Pneumonia in Two Patients With Lung Cancer. J. Thorac. Oncol. S1556-0864(20)30132-5). Furthermore, hypercytokinemia is a strong indicator of patient mortality, typically attributable to acute respiratory distress syndrome (ARDS). Both hypercytokinemia and ARDS reflect pathological dysregulation of the immune system caused by SARS-CoV-2 virus infection. Current treatments address abnormal inflammation by immunosuppressing or inhibiting specific inflammatory mediators, but this allows for increased susceptibility to secondary infections. [Prior art documents] [Non-patent literature]
[0004] [Non-Patent Document 1] Mehta et al., Lancet. (2020) 395(10229):1033~1034 [Non-Patent Document 2] Tian, S. et al., J. Thorac. Oncol. (2020) S1556-0864(20)30132~5 [Overview of the project] [Means for solving the problem]
[0005] Therefore, there remains a significant need for new and effective treatments to modulate the immune system in cases of immune system disorders, such as those resulting from viral infections like ARDS caused by SARS-CoV-2. overview Methods for treating or preventing acute respiratory distress syndrome (ARDS) are provided herein.
[0006] In one embodiment, the present invention provides a method for treating or preventing acute respiratory distress syndrome (ARDS) in subjects at risk of developing ARDS. The method involves administering a pharmaceutical composition containing a therapeutically effective amount of isolated matrix-bound vesicles (MBVs) derived from the extracellular matrix to a subject, thereby treating or preventing ARDS in the subject. The disclosed method may include the step of selecting subjects who have or are at risk of developing ARDS.
[0007] ARDS in patients can result from several underlying conditions. For example, in one embodiment, the subject has a lung infection of viral, bacterial, or fungal origin. For example, the subject may have a lung infection caused by a virus selected from SARS-CoV-2, SARS-CoV, MERS-CoV, Ebola virus, influenza virus, cytomegalovirus, or herpesvirus. In any of the embodiments described above, the subject may have pneumonia. In one embodiment, the subject is infected with SARS-CoV-2 or COVID-19. In another embodiment, the subject has influenza. In yet another embodiment, the subject has SARS or MERS. In yet another embodiment, the subject has inhaled a toxic substance such as smoke, chemical fogging, or vapor from vaping (e.g., from an e-cigarette). In yet another embodiment, the subject has inhaled water, vomit, or food into the lungs. In another embodiment, the subject has a head or chest injury that damages the lungs or a part of the brain that controls respiration. In yet another embodiment, the subject has sepsis. In yet another embodiment, the subject has pancreatitis. In another embodiment, the subject has severe burns. In yet another embodiment, the subject has received a blood transfusion.
[0008] In accordance with the present invention, in some embodiments, the method of the present invention is carried out in subjects experiencing hypercytokinemia. For example, administration of MBV according to the present invention reverses the effects of hypercytokinemia in subjects. In some embodiments, MBV is administered to subjects prior to the onset of ARDS in order to prevent the onset of ARDS. In other embodiments, MBV is administered to subjects after the onset of ARDS in order to treat ARDS and prevent its progression.
[0009] In one embodiment of the method of the present invention, the subject is a human subject.
[0010] According to one embodiment of the present invention, a pharmaceutical composition comprising MBV is administered by systemic intravenous (IV) injection. For example, the systemic intravenous injection is via a standard IV line or a central line. In some embodiments, the central line is a peripherally inserted central catheter (PICC), a tunnel catheter, or an implantable port. In some embodiments, the standard IV line is in a vein in the wrist, arm, or hand. In yet other embodiments, the intravenous injection is a bolus injection, a continuous infusion, or a pump injection.
[0011] In another embodiment, the pharmaceutical composition is administered to the lungs of a subject. For example, the pharmaceutical composition is administered as an aerosol by a nebulizer. In yet another embodiment, the pharmaceutical composition is administered by intratracheal drip infusion. For example, administration is via an endotracheal tube placed in the subject. In yet another embodiment, the pharmaceutical composition is administered to the lungs by a metered-dose inhaler.
[0012] According to another embodiment, MBV(i) does not express one or more of CD63, CD81 and / or CD9, or has CD63, CD81 and / or CD9 at barely detectable levels; and / or (ii) MBV comprises (a) a phospholipid content including at least 55% of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (b) a phospholipid content including 10% or less of sphingomyelin (SM); (c) a phospholipid content including 20% or less of phosphatidylethanolamine (PE); and / or (d) a phospholipid content including 15% or more of phosphatidylinositol (PI).
[0013] In yet another embodiment, MBV originates from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. In one embodiment, MBV originates from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. In one embodiment, MBV does not originate from the extracellular matrix of the bone.
[0014] In yet another embodiment, the MBV is derived from the bladder matrix (UBM), the submucosal tissue of the small intestine (SIS), or the submucosal tissue of the bladder (UBS). In one embodiment, the MBV is derived from the bladder matrix (UBM). In one embodiment, the MBV is derived from the submucosal tissue of the small intestine (SIS). In one embodiment, the MBV is derived from the submucosal tissue of the bladder (UBS).
[0015] In yet another embodiment, the MBV is derived from the extracellular matrix of a mammalian vertebrate selected from humans, monkeys, pigs, cattle, or sheep.
[0016] In another embodiment, MBV is 1 × 10⁶ per kg of body weight per dose. 6 ~1 × 10 12 It is administered in the amount of MBV specified.
[0017] In some embodiments, the subject receives antibiotic, antiviral, or anti-inflammatory drug therapy. For example, the subject receives remdesivir, favipiravir, azithromycin, or hydroxychloroquine. For example, the subject receives remdesivir, favipiravir, azithromycin, or hydroxychloroquine, and the subject has COVID-19. For example, in some embodiments, the subject receives tocilizumab, anakinra, or a Janus kinase (JAK) inhibitor. For example, the subject receives tocilizumab, anakinra, or a Janus kinase (JAK) inhibitor, and the subject has COVID-19.
[0018] In another embodiment, subjects have a reduced risk of secondary infection as a result of treatment with MBV compared to subjects treated with immunosuppressants. For example, the secondary infection may be a lung infection. For example, the secondary infection may be a blood infection. For example, the secondary infection may be of the heart, kidneys, or liver. For example, the secondary infection may be a bacterial infection. For example, the secondary infection may be a viral infection.
[0019] In a further embodiment, the subject experiences an increase of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% in its oxygen saturation index after administration of the pharmaceutical composition. In another embodiment, the subject experiences an increase of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% in its oxygen saturation index after administration of the pharmaceutical composition. In another embodiment, the subject experiences an increase of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% in its oxygen index after administration of the pharmaceutical compound. The increase may occur within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, or 24 hours after administration of the pharmaceutical composition.
[0020] In another embodiment, the subject experiences a decrease in the production of pro-inflammatory cytokines after MBV administration. For example, the pro-inflammatory cytokines are one or more of TNF-α, IFN-γ, IL-8, IL-6, IL-1β, or IL-12. In yet another embodiment, the subject experiences an increase in the production of anti-inflammatory cytokines after MBV administration. For example, the anti-inflammatory cytokines are TGF-β, IL-4, or IL-10. In one embodiment, the increase or decrease is measured by sampling bronchoalveolar lavage fluid from the subject's lungs before and after MBV administration. In yet another embodiment, the increase or decrease is measured by sampling the subject's blood before and after MBV administration. In yet another embodiment, the effectiveness of the treatment is measured by a reduction in symptoms associated with ARDS and / or hypercytokinemia.
[0021] The aforementioned and other objects, features and advantages of the present invention will become more apparent from the following detailed description, which proceeds with reference to the accompanying drawings. [Brief explanation of the drawing]
[0022] [Figure 1-1]Figures 1A–1G show morphological characterization of liquid-phase extracellular vesicles (EVs) and matrix-bound vesicles (MBVs). Figure 1A shows a scanning electron microscope image of an ECM scaffold derived from bladder matrix (UBM), where distinct spheres approximately 100 nm in diameter are dispersed throughout the matrix. Scale bar = 1 μm. Figure 1B shows a diagram of a 3T3 fibroblast cell culture model used to selectively collect vesicles from liquid-phase (EVs) or solid-phase extracellular compartments (MBVs). Figure 1C shows phase-contrast microscopy, hematoxylin and eosin (H&E) staining, and 4',6-diamidino-2-phenylindole (DAPI) staining demonstrating the absence of cells and intact nuclei after decellularization. Figure 1D shows transmission electron microscope images of liquid-phase EVs and MBVs isolated from the 3T3 fibroblast cell culture model. Scale bar = 100 nm. Figure 1E shows size distribution plots from nanoparticle tracking analysis (NTA) of liquid-phase EV and MBV isolated from 3T3 fibroblast cultures. Figure 1F shows immunoblot analysis comparing CD9, CD63, CD81, and Hsp70 expression levels in liquid-phase EV and MBV. Figure 1G shows silver staining analysis of electrophoretically separated proteins in liquid-phase EV and MBV. [Figure 1-2] Same as above. [Figure 1-3] Same as above. [Figure 1-4] Same as above. [Figure 1-5] Same as above.
[0023] [Figure 2-1]Figures 2A–2E show the differences in miRNA cargo between EVs and MBVs. Figure 2A shows bioanalyzer analysis of total RNA isolated from 3T3 parental cells, the liquid-phase EVs they secreted, and their MBVs. Figure 2B shows principal component analysis (PCA) comparing RNA-seq datasets of liquid-phase EVs (green), MBVs (blue), and cells (red). Figure 2C shows a volcano plot demonstrating differential miRNA expression in liquid-phase EVs, MBVs, and parental cells. The inclusion criterion was a difference of two times log2 in either direction (fold change), with a P value < 0.05. Each dot represents a specific miRNA transcript; green dots to the right of the vertical dashed line (and above the horizontal dashed line) correspond to a relative increase in expression level, and red dots to the left (and above the horizontal dashed line) correspond to a relative decrease in expression level. Blue dots (appearing below the horizontal dashed line) indicate miRNAs that did not show significant changes in expression levels. Figure 2D shows RT-qPCR validation of miRNA sequencing results, *p<0.05, n=4. Figure 2E shows Ingenuity Pathway Analysis (IPA functional analysis). Significantly enriched molecular functions identified by IPA functional analysis were determined considering miRNAs differentially expressed in MBV (red - lower bar) and liquid-phase EV (blue - upper bar). Red bars are absent for cell growth and proliferation, cell morphology, cell-to-cell signaling, and histogenesis; blue bars are absent for digestive system development and function, hepatic system development and function, and organ development and function. [Figure 2-2] Same as above. [Figure 2-3] Same as above. [Figure 2-4] Same as above.
[0024] [Figure 3-1]Figures 3A–3H show differences in MBV miRNA cargo based on MBV cellular origin. Figure 3A shows a phase-contrast microscope image of a decellularized BMSC cell culture plate showing the absence of cells. Figure 3B shows a transmission electron microscope image of MBV isolated from a decellularized BMSC culture plate. Scale bar = 100 nm. Figures 3C–3E show size distribution plots from nanoparticle tracking analysis (NTA) of MBV isolated from decellularized culture plates of BMSC (Figure 3C), ASC (Figure 3D), and UCSC (Figure 3E). Figure 3F shows bioanalyzer analysis of total RNA isolated from MBV from BMSC, ASC, and UCSC. Figure 3G shows principal component analysis (PCA) comparing RNA-seq datasets of BMSC MBV (green; center left), UCSC MBV (blue; upper right), and ASC MBV (red; lower right). Figure 3H shows a volcano plot demonstrating differential miRNA expression in MBVs derived from BMSC, ASC, and UCSC. The inclusion criterion was a difference of two times log2 in either direction (multiplicative change), with a P value < 0.05. Each dot represents a specific miRNA transcript; green dots to the right of the vertical dashed line (and above the horizontal dashed line) correspond to a relative increase in expression level, and red dots to the left (and above the horizontal dashed line) correspond to a relative decrease in expression level. Blue dots (below the horizontal dashed line) represent miRNAs that did not show a significant change in expression level. [Figure 3-2] Same as above. [Figure 3-3] Same as above. [Figure 3-4] Same as above.
[0025] [Figure 4-1]Figures 4A–4E show the LC / MS characterization of phospholipids between MBV, liquid-phase EV, and parent cells. Figure 4A shows a typical total ion chromatogram of phospholipids obtained from MBV. Figure 4B shows the mass spectra of major phospholipid classes in MBV. The evaluation included quantification of saturated (double bond count = 0), monounsaturated (double bond count = 1), and polyunsaturated (double bond count = 2–10) phospholipid species. Figure 4C shows a pie chart showing the total content of major phospholipids. Data are shown as a percentage of total phospholipids. Figures 4D and 4E show the content of different phospholipid molecular species. Data are autoscaled to Z-scores and shown as a heatmap coded from blue (low value) to red (high value). Abbreviations are as follows: EV, exosomal vesicles; MBV, matrix-bound vesicles; PC, phosphatidylcholine; PCd, PC diacyl species; PCp, PC plasmalogen; PE, phosphatidylethanolamine; Ped, PE diacyl species; Pep, PE plasmalogen; PI, phosphatidylinositol; PS, phosphatidylserine; BMP, bis-monoacylglycerophosphate; PA, phosphatidic acid; PG, phosphatidylglycerol; and SM, sphingomyelin. [Figure 4-2] Same as above. [Figure 4-3] Same as above. [Figure 4-4] Same as above.
[0026] [Figure 5-1]Figures 5A–5D show LC / MS characterization and follow-up analyses testing differences in LPE, LPA, and LPG between MBV, liquid-phase EV, and parent cells. Figure 5A shows a typical mass spectrum of major lysophospholipids obtained from MBV. Figure 5B is a pie chart showing the total content of major lysophospholipids. Data are shown as a percentage of total lysophospholipids. Figures 5C and 5D show the content of lysophospholipid molecular species. Data are shown as a heatmap, autoscaled to Z-scores and coded from blue (low values) to red (high values), with n=3. The abbreviations are as follows: EV, exosomal vesicles; MBV, matrix-bound vesicles; LPC, lysophosphatidylcholine; LPE, lysophosphatidylethanolamine; LPI, lysophosphatidylinositol; LPS, lysophosphatidylserine; LPA, lysophosphatidic acid; LPG, lysophosphatidylglycerol; and mCL, mono-lysocardiolipin. [Figure 5-2] Same as above. [Figure 5-3] Same as above.
[0027] [Figure 6-1]Figures 6A–6C demonstrate that the levels of PUFA-containing phospholipids and their oxidatively modified molecular species are higher in MBV compared to liquid-phase EV. The content of free PUFAs (Figure 6A) and their oxygenated metabolites (Figure 6B) was assessed in parental cells, liquid-phase EV, and MBV. Data are presented as mean ± sd, *p<0.05, compared to cells or MBV, and n=3. Figure 6C shows the content of mono, bi, and triply oxygenated phospholipid species in parental cells, liquid-phase EV, and MBV. Data are autoscaled to Z-scores and presented as heatmaps coded from blue (low values) to red (high values). The abbreviations are as follows: EV, exosomal vesicles; MBV, matrix-bound vesicles; PL, phospholipids; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PI, phosphatidylinositol; PS, phosphatidylserine; BMP, bis-monoacylglycerophosphate; PA, phosphatidic acid; PG, phosphatidylglycerol; and CL, cardiolipin. [Figure 6-2] Same as above.
[0028] [Figure 7] Figure 7 shows the route of administration of MBV for the treatment of rheumatoid arthritis in a rat animal model.
[0029] [Figure 8] Figures 8A–8E show individual arthritis scores for the control group and rat models treated with pristane alone, intraperitoneal (IP) methotrexate (MTX), periarticular (PA) MBV, or intravenous (IV) MBV. Figure 8A shows the arthritis scores across treatment groups on day 7, Figure 8B shows the arthritis scores across treatment groups on day 10, Figure 8C shows the arthritis scores across treatment groups on day 13, Figure 8D shows the arthritis scores across treatment groups on day 17, and Figure 8E shows the arthritis scores across treatment groups on day 21.
[0030] [Figure 9-1]Figure 9A shows photographs taken from multiple viewpoints of Sprague-Dawley rats induced to phenotypicly mimic clinical arthritis via pristane and treated with pristane alone, IP methotrexate, PA MBV, or IV MBV. Figure 9B shows closer images of disease control and periarticular MBV-treated rat paws. [Figure 9-2] Same as above.
[0031] [Figure 10] Figure 10 shows the mean arthritis scores over the first 21 days of treatment in arthritis rat models treated with control, pristane alone, IP methotrexate, PA MBV, or IV MBV.
[0032] [Figure 11] Figure 11A shows photographs of the paws of control and arthritis rat models treated with IP methotrexate, PA MBV, and IV MBV. Figure 11B shows the mean arthritis scores over the first 77 days of treatment in arthritis rat models treated with IP methotrexate, PA MBV, and IV MBV.
[0033] [Figure 12] Figures 12A and 12B show serum levels of TNFα (Figure 12A) and IL1β (Figure 12B) in rat arthritis models treated with IP methotrexate, PA MBV, and IV MBV.
[0034] [Figure 13] Figure 13 shows histological images of mouse imiquimod models of psoriasis treated with vehicle control or MBV.
[0035] [Figure 14] Figure 14 shows FOXP3 RNA levels as a marker for TREG cells in a mouse imiquimod model of psoriasis treated with vehicle control or MBV.
[0036] [Figure 15] Figure 15 shows anti-KLH IgG levels determined by ELISA in keyhole limpet hemocyanin (KLH) rat models treated with saline (negative control), MBV, or cyclophosphamide (positive control).
[0037] [Figure 16-1] Figure 16A shows a dot plot of inflammatory macrophages infiltrating the site of cardiotoxicity after treatment with IL-33-containing MBV, as determined by fluorescence-activated cell sorting (FACS) of CD45+CD3-B220-CD11b+Ly6G- cells. Figure 16B shows the frequency of inflammatory macrophages. Figure 16C shows a dot plot of ST2+ TREGs infiltrating the site of cardiotoxicity after treatment with IL-33-containing MBV, as determined by fluorescence-activated cell sorting (FACS) of CD45+CD3+B220-CD4+ cells. Figure 16D shows the frequency of ST2+ TREGs. [Figure 16-2] Same as above.
[0038] [Figure 17] Figure 17 shows IL4 production determined by ELISA for Th1 activators that promote pro-inflammatory responses, Th2 activators that promote anti-inflammatory responses, Th17 activators that promote pro-inflammatory responses, or T cells stimulated with MBV.
[0039] [Figure 18] Figure 18 shows immunofluorescence microscopy images of formalin-fixed, paraffin-embedded mouse lung tissue after administration of fluorescently labeled MBV (green) via aerosol at a dose of 10⁹ particles / mL. Representative images (left and center panels) show that MBV is readily detectable (arrowheads) in the large and small airways of the treated lung tissue, particularly in the epithelium rather than the parenchyma. Untreated control lung tissue (right panel) shows nonspecific, low levels of autofluorescence with a scattered pattern that does not resemble that of the MBV-treated tissue.
[0040] [Figure 19-1] Figures 19A–19C show that systemic administration of matrix-bound nanovesicles alleviates virus-mediated pulmonary pathology and mononuclear neutrophil cell infiltration at 7 days post-infection. Figure 19A: Mosaic editing of 20× hematoxylin and eosin images of whole lung pathology demonstrates interstitial pneumonia at 7 days post-infection associated with diffuse mononuclear cell infiltration into the interstitial space of the lung. Systemic treatment with MBV reduced overall cell infiltration into the lung interstitium and indicated resolution of acute pneumonia 7 days post-infection. Cell density heatmaps adjacent to the H+E images showed high-density cell infiltration in the influenza + ivPBS group, along with a decrease in overall cell density in the influenza + ivMBV group. Figure 19B: Systemic MBV significantly reduced the overall frequency of CD45+ neutrophils in lavage (BAL), lung interstitium, and spleen. Figure 19C: Systemic MBV significantly reduced the concentrations of pro-inflammatory cytokines and chemokines GCSF, IL-6, IL-1β, TNFα, and IFN-γ. [Figure 19-2] Same as above. [Figure 19-3] Same as above.
[0041] [Figure 20-1] Figures 20A–20D show that systemic administration of MBV reduces the pulmonary and spleen populations of CD4+ t-cells and increases the presence of activated antiviral CD8+ T-cells. Figure 20A: Systemic MBV significantly reduced the frequency of CD4+ t-cells and increased the frequency of CD8+ T-cells in lung tissue. Figure 20B: Systemic MBV significantly reduced the frequency of CD4 T-cells and significantly increased the frequency of CD8+ T-cells in the spleen. Figure 20C: Systemic MBV induced activation of the antiviral CD4 response by increasing the frequencies of peripherally located CD69+ and Tbet+CD4+ T-cells in the spleen and lymph nodes, respectively. Figure 20D: Systemic MBV induced peripheral activation of the antiviral CD8+ T-cell response, as indicated by the increased frequency of CD69+ and Tbet+CD8 T-cells. [Figure 20-2] Same as above.
[0042] [Figure 21-1] Figures 21A–21D show that systemic administration of MBV reduces post-viral pneumonia through decreased cellular infiltration and reduces pro-inflammatory cytokine production. Figure 21A: Mosaic editing of 20× hematoxylin and eosin images of whole lung pathology demonstrates bronchopneumonia associated with concentrated mononuclear cell infiltration around the bronchi and major airways at 21 days post-infection. Systemic treatment with MBV reduced overall cellular infiltration into the pulmonary interstitium and indicated resolution of acute pneumonia 7 days post-infection. Cell density heatmaps adjacent to H+E images showed high-density cellular infiltration in the influenza + ivPBS group, along with a decrease in overall cellular density in the influenza + ivMBV group. Figure 21B: Systemic MBV significantly reduced the overall frequency of CD45+ neutrophils in the pulmonary interstitium and spleen. Figure 21C: Systemic MBV significantly increased the proportion of CD11b dendritic cells in the lungs. Figure 21D: Systemic MBV significantly reduced the concentrations of pro-inflammatory cytokines and chemokines Il-12, Il-1b, MCP-1, and KC. [Figure 21-2] Same as above. [Figure 21-3] Same as above. [Figure 21-4] Same as above.
[0043] [Figure 22] Figure 22 is a set of bar graphs showing that systemic administration of MBV significantly increased the proportion of CD62L+CD44+memory CD4 and CD8 T-cells supporting long-term antiviral resistance.
[0044] [Figure 23]Figure 23 is a set of digital images and graphs showing that systemic administration of MBV significantly reduces H1N1-related consolidation and interstitial fibrosis at 21 days post-infection. The images above show trichrome-stained and quPath-rendered images. Histopathological analysis was performed using QuPath software. Briefly, Masson trichrome-stained cells were counted using optical density data and classified based on phenotype using a random tree machine learning architecture. The ML classifier was trained on six representative images, and multiple (n>10) training regions show four possible classes: connective tissue, vascular, pulmonary interstitial tissue, and affected tissue. In the section below, the percentage of total histofibrosis / sclerosis per unit lung surface area was calculated, showing a significant reduction in total affected tissue in MBV-treated animals compared to untreated animals with H1N1.
[0045] [Figure 24] Figure 24 shows the results of the EXO-CHECK® exosome antibody array (System Biosciences) comparing the levels of various markers of interest in mouse exosomes, mouse bone matrix vesicles (bone MVs), and mouse matrix-bound nanovesicles (MBVs). The upper panel provides a digital image of the array, and the lower panel is a graph showing the relative expression of each of the markers of interest in exosomes vs. bone MVs vs. MBVs.
[0046] [Figure 25] Figure 25 shows the results of Western blot analysis of plasma exosomes and muscle MBV to detect the expression of the bone MV marker annexin V and tissue-nonspecific alkaline phosphatase (TNAP).
[0047] [Figure 26]Figure 26 is a bar graph showing the multiplicative changes in the expression of various genes in bone marrow-derived macrophages treated with different cell types: untreated (M0), IFNγ+LPS (M1), IL-4 (M2), plasma-derived exosomes, bone MVs derived from 17A cells, or MBVs isolated from muscle. [Modes for carrying out the invention]
[0048] Sequence List The nucleic acid and amino acid sequences listed in the attached sequence listing are indicated using standard letter abbreviations for nucleotide bases and three-letter codes for amino acids, as defined in Rule 1.822 of Volume 37 of the Code of Federal Regulations (37 CFR 1.822). Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by some reference to the shown strand. The sequence listing is submitted as an ASCII text file [Sequence_Listing, April 15, 2021, 1.07KB] incorporated herein by reference. In the attached sequence listing, Sequence IDs 1-3 are miRNA sequences.
[0049] Detailed explanation This disclosure provides a method for using matrix-bound nanovesicles (MBVs) in the treatment of ARDS, such as acute respiratory distress syndrome (ARDS) associated with hypercytokinemia due to viral infection. Various aspects of the invention are shown in the sections below; however, an aspect of the invention described in one particular section should not be limited to any particular section.
[0050] As the data herein illustrate, MBV is a potent modulator of macrophage activity, inducing the anti-inflammatory properties of macrophages. When macrophages are exposed to inflammatory stimuli, they secrete cytokines such as TNF, IL-1, IL-6, IL-8, and IL-12. Such cytokines increase the vascular permeability and recruitment of inflammatory cells, contributing to conditions such as ARDS. However, as illustrated herein, macrophages in contact with MBV have the ability to downregulate the production of pro-inflammatory cytokines and upregulate negative regulators of inflammation, suggesting that MBV has the ability to mitigate the "cytokine storm" of hypercytokinemia. Due to these unique properties of MBV, it is useful in the treatment of ARDS resulting from widespread inflammation in the lungs due to hypercytokinemia, which can be caused by a number of factors ranging from viral infections to injuries as described herein. In diseases such as COVID-19, where the immune response to a virus triggers a cytokine storm and the resulting ARDS, MBV has the ability to prevent or reverse the devastating effects of the cytokine storm, such as ARDS.
[0051] Overview As disclosed herein, the matrix-bound nanovesicles (MBVs) of this disclosure are used in methods for treating ARDS, such as acute respiratory distress syndrome (ARDS) associated with hypercytokinemia related to infection. In certain embodiments, hypercytokinemia is the result of infection by a pathogen, such as bacteria, viruses, fungi, or protozoa (e.g., amoebas). In certain embodiments, the disease or disorder mediated by an intracellular pathogen is an acute infection. In some embodiments, ARDS is the result of a viral infection such as MERS, SARS-CoV, or SARS-CoV2. In one embodiment, ARDS is a result of SARS-CoV2. In one embodiment, ARDS is a result of influenza.
[0052] therapeutic application In the absence of pre-existing immunity in the world's population, COVID-19 became a pandemic, devastating the global economy in less than four months after the first case was reported. In this short period, COVID-19 emerged as a highly fatal infectious disease with a mortality rate 300-400% higher than that of seasonal influenza (WHO (2020) Coronavirus disease 2019 (COVID-19): Situation Report, 67). Currently, treatment for COVID-19 is primarily supportive, with respiratory failure due to ARDS being the leading cause of death (Ruan Q, et al. (2020) Clinical predictors of mortality due to COVID-19 based on an analysis of data of 150 patients from Wuhan, China. Intensive Care Medicine: 1-3.). It is well known that viral infections and resulting tissue damage can trigger cytokine storms that can ultimately lead to ARDS (Ware LB & Matthay MA (2000) The acute respiratory distress syndrome. NEJM. 342(18):1334-1349; Matthay MA, et al. (2012) The acute respiratory distress syndrome. Journal of Clin Inves. 122(8):2731-2740; Wheeler AP & Bernard GR (2007) Acute lung injury and the acute respiratory distress syndrome: a clinical review. Lancet 369(9572):1553-1564).The defining characteristics of ARDS include diffuse alveolar damage due to dysregulation of local and systemic inflammation, pulmonary edema, and hypoxemia, which manifest as increased inflammatory cytokines (chemokines) in plasma or bronchoalveolar lavage fluid (BALF), leading to the accumulation of extravascular neutrophils (Matthay MA et al. (2012) The acute respiratory distress syndrome. Journal Clin Inves. 122(8):2731-2740). Pro-inflammatory macrophages and monocytes also play a causative role in ARDS, inducing and spreading lung tissue damage through increased local inflammation; this inflammation then contributes to increased epithelial and endothelial tissue permeability (Aggarwal NR et al. (2014) Diverse macrophage populations mediate acute lung inflammation and resolution. American Journal of Phys Lung Cell and Mol Phys. 306(8):L709-L725; Zemans RL & Matthay MA (2017) What drives neutrophils to the alveoli in ARDS? (BMJ Publishing Group Ltd); Thompson BT et al. (2017) Acute respiratory distress syndrome. New England Journal of Med. 377(6):562-572).
[0053] Despite intensive basic research and clinical trials in the population, there remains a lack of effective treatments to prevent or resolve ARDS, and supportive procedures to reduce initial inflammation are the only means of providing consistent improvement in patient outcomes (Bellani G, et al. (2016) Epidemiology, patterns of care, and mortality for patients with acute respiratory distress syndrome in intensive care units in 50 countries. Jama 315(8):788-800).
[0054] The initial response to respiratory viral infections (e.g., SARS-CoV-2) involves macrophages releasing pro-inflammatory cytokines that induce severe ARDS, mobilize more immune cells, and phagocytose virus-infected cells (Conti P, et al. (2020) Induction of pro-inflammatory cytokines (IL-1 and IL-6) and lung inflammation by Coronavirus-19 (COVID-19 or SARS-CoV-2): anti-inflammatory strategies. J Biol Regul Homeost Agents. 34(2)). A retrospective cohort study of patients in Wuhan, China, shows that approximately 93% of deaths are due to acute respiratory distress syndrome (ARDS) and excessive inflammation in the lungs associated with COVID-19 (Zhou F, et al. (2020) Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study. Lancet. 395(10229):1054-1062). Mobilized monocytes differentiate into macrophages, which play a dominant role in host defense against the virus, but these same cells also facilitate the resolution of inflammation and lung repair. In the early stages of the antiviral immune response, M1-like macrophages recruit more immune cells, phagocytose virus-infected cells, and, in some cases, release pro-inflammatory cytokines that induce ARDS (Conti P, et al. (2020) Induction of pro-inflammatory cytokines (IL-1 and IL-6) and lung inflammation by Coronavirus-19 (COVID-19 or SARS-CoV-2): anti-inflammatory strategies. J Biol Regul Homeost Agents. 34(2)).The transition from an M1-like (pro-inflammatory) macrophage activation state to an M2-like pro-remodeling phenotype can alleviate respiratory distress, restore epithelial barrier function, and facilitate the development of acquired immunity against the virus within 14 days (He W, et al. (2017) Alveolar macrophages are critical for broadly-reactive antibody-mediated protection against influenza A virus in mice. Nat Commun. 8(1):846). However, without a macrophage phenotype switch, epithelial barrier function is disrupted, and cell death and edema can lead to ARDS. Drugs such as hydroxychloroquine (HCQ) are being studied in clinical pilot trials as treatments for COVID-19; however, importantly, HCQ addresses hyperinflammation, such as the hyperinflammation seen in ARDS cases, through immunosuppression (Liang N, et al. (2018) Immunosuppressive effects of hydroxychloroquine and artemisinin combination therapy via the nuclear factor-kappaB signaling pathway in lupus nephritis mice. Exp Ther Med 15(3):2436-2442). Therefore, HCQ and similar immunosuppressants place patients at a greater risk of secondary infections, such as secondary pneumonia, and inhibit the development of antiviral immunity (Liang N, et al. (2018) Immunosuppressive effects of hydroxychloroquine and artemisinin combination therapy via the nuclear factor-kappa B signaling pathway in lupus nephritis mice. Exp Ther Med 15(3):2436-2442).Therefore, satisfactory treatment of COVID-19 requires the simultaneous development of cytokine storm resolution and protective antibody-mediated immunity. Since factors within the ECM modulate the phenotypic transition of macrophages and T helper cells from a pro-inflammatory to a pro-remodeling state, the present invention targets the modulation / reprogramming of the host immune system (without impairing immunocompromise) facilitated by molecular factors embedded within the extracellular matrix (ECM) (Hussey GS, et al. (2018) Extracellular matrix-based materials for regenerative medicine. Nature Rev Mater; Allman AJ, et al. (2002) The Th2-restricted immune response to xenogeneic small intestinal submucosa does not influence systemic protective immunity to viral and bacterial pathogens. Tissue Eng Part A. 8(1):53-62). The degradation products of ECM scaffolds have potent and clinically relevant anti-inflammatory and pro-healing effects in skeletal muscle repair, rodent models of ulcerative colitis, and the optic nerve and upper respiratory tract (see, for example, International Patent Application Publication Nos. WO2017 / 151862 and WO2018 / 204848).
[0055] Therefore, a satisfactory and preferred treatment of COVID-19 requires the resolution of hypercytokinemia without impairing immunity. As disclosed herein, MBV is used in methods for treating hyperinflammation such as hyperinflammation associated with hypercytokinemia (e.g., hypercytokinemia associated with viral infection).
[0056] A foreseeable and other purpose, feature, and benefit of the MBV therapy of this disclosure is that it can be administered in both hospital and non-hospital settings. In some embodiments, the MBV therapy of this disclosure is administered to treat patients with COVID-19-associated cytokine storm syndrome. Such a therapeutic platform that can be safely and easily administered to patients to limit inflammation and redirect the default inflammatory healing response toward a response that promotes functional tissue remodeling does not currently exist and therefore represents a long-standing and urgent unmet need.
[0057] MBVs are endogenous components of the extracellular matrix (ECM), distinct from exosomes, and effectively redirect hyperinflammation in preclinical models (Hussey GS, et al. (2020) Lipidomics and RNA sequencing reveal a novel subpopulation of nanovesicle within extracellular matrix biomaterials. Sci Adv 6(12):eaay4361; van der Merwe Y, et al. (2019) Matrix-bound nanovesicles prevent ischemia-induced retinal ganglion cell axon degeneration and death and preserve visual function. Sci Rep 9(1):3482). MBVs are also distinct from bone matrix vesicles involved in osteogenicity and calcification. For example, bone matrix vesicles express alkaline phosphatase, while MBVs do not. In some embodiments, MBV contains immunomodulatory miRNAs, proteins, and lipids that are rapidly taken up by macrophages, triggering a signaling cascade and modulating gene expression essential for phenotypic switching, a phenomenon well-studied in the context of ECM-based biomaterials (Hussey GS, et al. (2019) Matrix bound nanovesicle-associated IL-33 activates a pro-remodeling macrophage phenotype via a non-canonical, ST2-independent pathway. J Immunol Regen Med 3:26-35; Huleihel L, et al. (2017) Macrophage phenotype in response to ECM bioscaffolds. Semin Immunol 29:2-13). Furthermore, in some embodiments, MBV administration is linked to regulatory T cell (T) expression, a phenomenon previously characterized in the context of ECM-based biomaterials. REGThis results in upward adjustment of ). MBV rapidly and effectively induces restorative immune responses in harsh environments, including rheumatoid arthritis, traumatic muscle injury, ulcerative colitis, and esophageal cancer (Huleihel L, et al. (2017) Matrix-Bound Nanovesicles Recapitulate Extracellular Matrix Effects on Macrophage Phenotype. Tissue Eng Part A 23(21-22):1283-1294; Dziki JL, et al. (2016) Immunomodulation and Mobilization of Progenitor Cells by Extracellular Matrix Bioscaffolds for Volumetric Muscle Loss Treatment. Tissue Eng Part A 22(19-20):1129-1139; Keane TJ, et al. (2017) Restoring Mucosal Barrier Function and Modifying Macrophage Phenotype with an Extracellular Matrix Hydrogel: Potential Therapy for Ulcerative Colitis. J Crohns Colitis) 11(3):360-368; Saldin LT, et al. (2019) Extracellular Matrix Degradation Products Downregulate Neoplastic Esophageal Cell Phenotype. Tissue Eng Part A 25(5-6):487-498.).
[0058] Cytokine cargo stored within MBV supports reparative and regulatory M2 macrophages and controls inflammation following bacterial infections and acute lung injury (Liu Q, et al. (2019) IL-33-mediated IL-13 secretion by ST2+ T). REGControls inflammation after lung injury. JCI Insight 4(6)). ECM bioscaffolds are useful in various clinical applications involving musculoskeletal, gastrointestinal, urogenital, and CNS tissues (Badylak SF (2007) The extracellular matrix as a biologic scaffold material. Biomaterials. 28(25):3587-3593). ECMs consist of structural and functional molecules secreted by the resident cells of each tissue, defining the tissue's identity. Such heterogeneous scaffolds do not induce harmful innate or adaptive immune responses; instead, they support anti-inflammatory and restorative innate and adaptive immune responses (Brown BN, et al. (2009) Macrophage phenotype and remodeling outcomes in response to biologic scaffolds with and without a cellular component. Biomaterials. 30(8):1482-1491). The use of such naturally occurring biomaterials is typically associated with the functional site and appropriate (at least) partial restoration of tissue; this is a process referred to as “constructive remodeling” (Badylak SF (2007) The extracellular matrix as a biologic scaffold material. Biomaterials. 28(25):3587-3593). ECM bioscaffolds or degradation products of ECM bioscaffolds have been shown to direct tissue repair through the recruitment of anti-inflammatory M2-like macrophages and T helper 2 (Th2) cell responses, such responses are often associated with reduced local inflammation and constructive crosstalk with progenitor cells.
[0059] Matrix-bound nanovesicles (MBVs) activate M2-like reparative and anti-inflammatory macrophage phenotypes. Studies have shown that MBVs are a distinct class of extracellular vesicles, separate from exosomes found in body fluids (Hussey GS, et al. (2020) Lipidomics and RNA sequencing reveal a novel subpopulation of nanovesicle within extracellular matrix biomaterials. Sci Advances. 6(12):eaay4361). Because MBVs persist even through the harsh process of tissue decellularization, they can play fundamental roles in tissue and organ development, cross-species homeostasis, and regulatory roles in tissue responses to injury. MBVs can be derived from multiple diverse tissue sources. MBVs are abundant, can be lyophilized, are highly stable, and can be readily administered by tracheal drip infusion or spray.
[0060] MBV can replicate the effect of ECM on promoting the remodeling-promoting macrophage phenotype. Functional capacity, determined by macrophage gene and protein expression, cell surface markers, and observed phagocytic activity, nitric oxide (NO) production, and antimicrobial activity, is most representative of the modulatory / anti-inflammatory phenotype after MBV treatment, which is consistent with previous reports describing the effects of ECM-based bioscaffolds on macrophage phenotype and function (see, e.g., PCT publication number WO2017 / 151862A1). MBV has been shown to exert its immunomodulatory effects through a combination of miRNA, protein, and phospholipid cargo. For example, compared to exosomes present in body fluids, MBVs are highly enriched with pro-resolving lipid mediators activated by different phospholipases depending on the pro-inflammatory / anti-inflammatory context of the extracellular environment (Hussey GS, et al. (2020) Lipidomics and RNA sequencing reveal a novel subpopulation of nanovesicle within extracellular matrix biomaterials. Sci Adv 6(12):eaay4361). Furthermore, MBVs are an abundant and stable source of IL-33, which signals and directs immune cells toward a reparative M2-like phenotype, while in damaged lungs, T REG It also stimulates repair and regulatory functions (Liu Q, et al. (2019) IL-33-mediated IL-13 secretion by ST2+ T REGControls inflammation after lung injury. JCI Insight 4(6)). IL-33 delivery reduces bacterial superinfection after H1N1 infection by improving bacterial clearance (Robinson KM, et al. (2018) Novel protective mechanism for interleukin-33 at the mucosal barrier during influenza-associated bacterial superinfection. Mucosal immunology. 11(1):199-208). Furthermore, MBV is enriched with miRNAs 125b-5p, 143-3p, and 145-5p. Inhibition of these miRNAs within macrophages is associated with gene and protein expression profiles consistent with pro-inflammatory rather than anti-inflammatory / regulatory phenotypes (Huleihel L, et al. (2017) Matrix bound nanovesicles recapitulate extracellular matrix effects on macrophage phenotype. Tissue Eng Part A).
[0061] As described in Example 2, we evaluated whether MBV could reduce arthritis scores using a rodent model of pristane-induced arthritis (PIA). Eight-week-old Sprague Dolly rats received an intradermal injection of 300 μL of pristane (2,6,10,14-tetramethylpentadecane) on day 0 of the study. On day 4, a second dose of 300 μL of pristane was administered intradermally. Animals receiving pristane were then randomized to the following groups: pristane alone, intraperitoneal injection of methotrexate (IP MTX), periarthral injection of MBV (PA MBV), and intravenous injection of MBV (IV MBV). Treatments were administered on days 7, 10, 14, 17, and 21. Starting on day 7, arthritis scores were determined for each animal on days 7, 10, 14, 17, 21, and 28, and then weekly for 100 days thereafter. The results of the study showed that both PA and IV administration of MBV significantly reduced arthritis scores compared to control animals treated with pristine alone. After day 21, the animals were followed long-term without any further treatment to assess secondary sudden relapses (flare-ups). Results at day 100 showed that MBV-treated animals exhibited a sustained reduction in arthritis scores compared to the control (untreated) group, even without additional treatment. Furthermore, macroscopic morphological examination of the paws showed reduced redness and edema in the MBV-treated group. In addition, as shown in Example 4, the rodent KLH (keyhole limpet hemocyanin) immunization assay showed that MBV therapy is directed towards modulation / reprogramming of the host immune system without impairing immunocompromise, in contrast to current therapeutics that address abnormal inflammation through immunosuppression. Examples 10–13 provide further evidence that systemic administration of MBV reduces acute virus-mediated pulmonary pathology and chronic inflammation in an animal model of influenza infection. As these data demonstrate, MBV therapy has potential for use in the treatment of many disorders involving abnormal inflammatory responses, such as ARDS.
[0062] Intratracheal infusion of decellularized bladder matrix (UBM) powder promotes chemotaxis, migration, and repair of lung epithelial cells in a mouse model of bleomycin-induced pulmonary fibrosis (Manni ML, et al. (2011) Extracellular matrix powder protects against bleomycin-induced pulmonary fibrosis. Tissue Eng Part A. 17(21-22):2795-2804). Furthermore, tracheal infusion of decellularized ECM powder significantly reduced bacterial load and attenuated bacterial-induced cytokine / chemokine secretion, protecting inoculated mice from severe bacterial-induced lung infections. This suggests that the ECM scaffold can provide protection from secondary complications arising from acute respiratory distress syndrome, such as bacterial-induced infections (Chen C, et al. (2019) Urinary bladder matrix protects host in a murine model of bacterial-induced lung infection. Tissue Eng Part A. 25(3-4):257-270). In addition, decellularized ECM delivered into rat lungs by either tracheal infusion or spraying showed ameliorative effects against acute lung injury induced by sustained hyperoxia, including attenuated alveolar septal thickening, cellular apoptosis, and oxidative damage under sustained hyperoxia. However, the potential for the clinical application of ECM powder for the treatment of IPF is limited by the maximum concentration and volume of such ECM suspensions that can be sprayed (Wu J, et al. (2017) Lung protection by inhalation of exogenous solubilized extracellular matrix. PloS One 12(2):e01711650). Given its nanometer size, MBV suggests that it overcomes the challenges associated with ECM powder delivery to the lungs and can be administered by direct tracheal infusion or spraying into the lungs.
[0063] In contrast to exosome isolation from bodily fluids or cell culture supernatants, the complex ultrastructure of ECM structural molecules presents unique challenges for the isolation of MBVs from ECM scaffold materials.
[0064] In some embodiments, MBV is delivered by spray, inhalation, or intravenous injection, allowing for rapid targeting or systemic delivery. MBV is a potent natural regulator of the initial immune response after injury, restoring local and systemic equilibrium. Thus, MBV can alleviate ARDS without impairing native immunity. MBV promotes inflammation resolution without immunosuppression. Cytokine screening reveals a large amount of anti-inflammatory cytokines stored in MBV, indicating that MBV promotes an immunophenotype that restores equilibrium and confers resilience against ARDS, with the advantage of not impairing native immunity. Thus, MBV promotes inflammation resolution without immunosuppression. Furthermore, MBV and ECM derived from decellularized porcine tissue or organs are readily available, safe, and do not cause adverse immune responses, making this technology ready for clinical application.
[0065] Biological scaffolds composed of extracellular matrix (ECM) have been developed as surgical mesh materials and are used in abdominal wall hernia repair (Alicuban et al., Hernia. 2014;18(5):705-712), musculoskeletal reconstruction (Mase et al., Orthopedics. 2010;33(7):511), esophageal reconstruction (Badylak et al., Tissue Eng Part A. 2011; 17(11-12):1643-50), dural replacement (Bejjani et al., J Neurosurg. 2007;106(6):1028-1033), tendon repair (Longo et al., Stem Cells Int. 2012;2012:517165), and breast reconstruction (Salzber, Ann Plast Surg.). It is used in clinical applications including (2006;57(1):1-5) and others (Badylak et al., Acta Biomater. 2009; 5(1):1-13).
[0066] Matrix-bound nanovesicles (MBVs) are embedded within the filamentous network of the extracellular matrix (ECM). Such nanoparticles shield their cargo from degradation and denaturation during the ECM scaffolding fabrication process.
[0067] In contrast, exosomes (or extracellular vesicles "EVs") are microvesicles previously identified almost exclusively in body fluids and cell culture supernatants. MBVs and exosomes have been demonstrated to be distinct. MBVs differ from other vesicles, for example, in that they are resistant to surfactant and / or enzymatic digestion, have a distinctive lipid profile, and contain different microRNA clusters. MBVs do not possess the same characteristic surface proteins found in other vesicles, such as exosomes.
[0068] As disclosed herein, MBV modulates systemic immune responses (e.g., by systemic administration) to preserve or restore biological functions. For example, administration of MBV can preserve or restore immune responses, such as modulating excessive inflammatory immune responses, including ARDS such as acute respiratory distress syndrome (ARDS) associated with viral infections.
[0069] Treatment of ARDS related to viral infections In certain embodiments, ARDS is associated with a viral infection. In certain embodiments, the virus is a retrovirus (e.g., human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), human T-cell lymphotropic virus (HTLV)-1, HTLV-2, HTLV-3, HTLV-4), Ebola virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, herpes simplex virus (HSV) (e.g., HSV-1, HSV-2, varicella-zoster virus, cytomegalovirus), adenovirus, orthomyxovirus (e.g., influenza virus A, influenza virus B, influenza virus C, influenza virus D, sogotovirus), flavivirus (e.g., dengue virus, Zika virus), Westna The virus is selected from the group consisting of ilviruses, Rift Valley fever virus, arenavirus, Crimean-Congo hemorrhagic fever virus, echovirus, rhinovirus, coxsackievirus, coronavirus (e.g., severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), MERS, or SARS-CoV), respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus (e.g., adeno-associated virus), vaccinia virus, smallpox virus, molluscum contagiosum virus, bovine leukemia virus, poliovirus, rabies virus, polyomavirus (e.g., JC virus, BK virus), alphaviruses, and rubiviruses (e.g., rubella virus). In some embodiments, the virus is a coronavirus. In some embodiments, ARDS associated with a viral infection is associated with hypercytokinemia. In one embodiment, the ARDS is caused by SARS-CoV-2. In another embodiment, the ARDS is caused by influenza virus. In some embodiments, the ARDS is associated with sepsis caused by a bacterial infection.
[0070] In certain embodiments, the MBV described herein refers to ARDS associated with viral infections, e.g., acquired immunodeficiency syndrome (AIDS), HTLV-1-associated myelopathy / tropical spastic paraplegia, Ebola virus disease, hepatitis A, hepatitis B, hepatitis C, herpes, herpes zoster, acute varicella, mononucleosis, respiratory infections, pneumonia, influenza, dengue fever, encephalitis (e.g., Japanese encephalitis), West Nile fever, Rift Valley fever, Crimean-Congo hemorrhagic fever, Kasanur forest disease, yellow fever, Zika fever, aseptic meningitis, SARS, myocarditis, common cold, lung infections, molluscum contagiosum, enzootic bovine leukemia, coronavirus disease 2019 (COVID-19), mumps, gastroenteritis, measles, rubella, and slapped-cheek disease. It is used to treat ARDS associated with viral infections selected from the group consisting of disease, smallpox, warts (e.g., genital warts), molluscum contagiosum, polio, rabies, and pityriasis rosea. In some embodiments, ARDS associated with viral infections are associated with hypercytokinemia. In some embodiments, the MBV described herein is used to treat ARDS associated with Ebola virus. In some embodiments, the MBV described herein is used to treat ARDS associated with influenza. In some embodiments, the MBV described herein is used to treat ARDS associated with SARS. In some embodiments, the MBV described herein is used to treat ARDS associated with COVID-19. In some embodiments, the MBV described herein is used to treat ARDS associated with sepsis caused by a viral infection.
[0071] In some embodiments, the virus associated with the infection is an RNA virus (having a genome composed of RNA). RNA viruses can be single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA). Because RNA polymerase lacks proofreading ability, RNA viruses have a higher mutation rate compared to DNA viruses (see Steinhauer DA, Holland JJ (1987). "Rapid evolution of RNA viruses". Annu. Rev. Microbiol. 41: 409-33). Exemplary RNA viruses include, without limitation, bunyaviruses (e.g., hantavirus), coronaviruses (e.g., MERS-CoV, SARS-CoV, SARS-CoV-2), flaviviruses (e.g., yellow fever virus, West Nile virus, dengue virus), hepatitis viruses (e.g., hepatitis A virus, hepatitis C virus, hepatitis E virus), influenza viruses (e.g., influenza A virus, influenza B virus, influenza C virus), measles virus, mumps virus, norovirus (e.g., Norwalk virus), poliovirus, respiratory syncytial virus (RSV), retroviruses (e.g., human immunodeficiency virus-1 (HIV-1)), and toroviruses. In some embodiments, the RNA virus is influenza virus, e.g., influenza A. In some embodiments, the RNA virus is RSV. In some embodiments, the RNA virus is MERS-CoV. In some embodiments, the RNA virus is SARS-CoV. In some embodiments, the RNA virus is SARS-CoV-2. In some embodiments, the RNA virus is SARS-CoV-2. In some embodiments, the RNA virus is Zika.
[0072] RNA viruses are classified according to their genome type (double-stranded, minus (-), or plus (+) single-stranded). Double-stranded RNA viruses contain numerous different RNA molecules, each encoding one or more viral proteins. Possible ssRNA viruses utilize their genome directly as mRNA; ribosomes in the host cell translate the mRNA into a single protein, which is then modified to form various proteins required for viral replication. One such protein is RNA-dependent RNA polymerase (RNA replicase), which copies the viral RNA to form a double-stranded replication morphology. Minus-sense ssRNA viruses produce positive-sense RNA for replication by having their genome copied by the RNA replicase enzyme. Therefore, the virus contains the RNA replicase enzyme. The resulting positive-sense RNA then acts as viral mRNA and is translated by the host ribosome. In some embodiments, the virus is a dsRNA virus. In some embodiments, the virus is a minus-ssRNA virus. In some embodiments, the virus is a plus-ssRNA virus. In some embodiments, the plus ssRNA virus is a coronavirus.
[0073] SARS-CoV-2, sometimes referred to as the novel coronavirus of 2019 or 2019-nCoV, is a positive-sense single-stranded RNA virus. SARS-CoV-2 has four structural proteins known as the S (spike), E (envelope), M (membrane), and N (nucleocapsid) proteins. The N protein holds the RNA genome; together, the S, E, and M proteins form the viral envelope. The spike allows the virus to attach to the membrane of host cells, such as the ACE2 receptor in human cells (Kruse RL (2020), Therapeutic strategies in an outbreak scenario to treat the novel coronavirus originating in Wuhan, China (version 2). F1000Research, 9:72). SARS-CoV-2 is the highly transmissible viral factor responsible for the global pandemic coronavirus disease 2019 (COVID-19). In some embodiments, acute respiratory distress syndrome is associated with SARS-CoV-2 (COVID-19). In some embodiments, the treated ARDS is related to SARS-CoV-2 (COVID-19). In some embodiments, the treated ARDS is related to SARS-CoV-2 (COVID-19)-related hypercytokinemia.
[0074] In some embodiments, the virus associated with the infection is a DNA virus (having a genome composed of DNA). Exemplary DNA viruses include, without limitation, parvoviruses (e.g., adeno-associated viruses), adenoviruses, asphaviruses, herpesviruses (e.g., herpes simplex virus 1 and 2 (HSV-1 and HSV-2), Epstein-Barr virus (EBV), cytomegalovirus (CMV)), papillomaviruses (e.g., HPV), polyomaviruses (e.g., monkey vacuolated virus 40 (SV40)), and poxviruses (e.g., vaccinia virus, cowpox virus, smallpox virus, fowlpox virus, sheeppox virus, myxoma virus). In certain embodiments, the DNA virus is an adenovirus, e.g., AdV5. In certain embodiments, the DNA virus is an enterovirus, e.g., EV71. In certain embodiments, the DNA virus is a herpesvirus, e.g., HSV-1.
[0075] In some embodiments, the infection is systemic. In some embodiments, the infection is localized to an organ or tissue, for example. In some embodiments, the infection is localized to an organ including, but not limited to, the eye, ear, inner ear, lung, trachea, bronchi, bronchioles, liver, gallbladder, bile ducts, kidney, bladder, testes, cervix, ovaries, uterus, skin, or brain. In certain embodiments, the infection is localized to the lungs.
[0076] Treatment of ARDS related to other pathogen infections In certain embodiments, ARDS is associated with bacterial infections. In certain embodiments, ARDS is associated with Chlamydia (e.g., C. trachomatis), Escherichia coli (e.g., enteropathogenic E. coli, enterohemorrhagic E. coli, urinary tract disease E. coli, intestinal invasive E. coli), Helicobacter pylori, Mycobacterium (e.g., M. tuberculosis, M. leprae, M. lepromatosis), Listeria (e.g., L. monocytogenes), Shigella (e.g., S. flexneri), Staphylococcus (e.g., S. aureus), Streptococcus (e.g., S. pyogenes), Streptomyces, Pneumococcus, Meningococcus, Gonococcus, Klebsiella (e.g., K. pneumoniae), Prot eus, Serratia, Pseudomonas (e.g., P. aeruginosa), Legionella, Acinetobacter (e.g., A. baumannii), Corynebacterium (e.g., C. diphtheria), Coxiella (e.g., C. burnetii), Bacillus (e.g., B. anthricis), Bacteroides, Bordetella, Enterococcus (e.g., E. faecalis), Francisella (e.g., F. tularensis), Haemophilus It relates to bacteria selected from the group consisting of influenza, Neisseria (e.g., N. meningitides, N. gonorrhoeae), Rickettsia, Salmonella (e.g., S. typhimurium), Vibrio cholerae, Clostridium (e.g., C. tetan, C. botulinum), Yersinia (e.g., Y. pestis), Borrielia (e.g., B. burgdorferi), Brucella, Burkholderia, Campylobacter, and Mycoplasma.In some embodiments, ARDS associated with bacterial infection is associated with hypercytokinemia. In some embodiments, ARDS is associated with sepsis resulting from bacterial infection.
[0077] In certain embodiments, the MBV described herein is used, for example, in the treatment of ARDS associated with bacterial infections, such as ARDS associated with intracellular bacterial infections. The methods described herein include, for example, Chlamydia, tuberculosis, peptic ulcer, leprosy, listeriosis, sialadenitis, diarrhea or food poisoning caused by bacteria, streptococcal pharyngitis (strep throat), scarlet fever, impetigo, cellulitis, pneumonia, meningitis, bacterial endocarditis, diverticulitis, disseminated gonococcal sepsis, septic arthritis, gonococcal neonatal ophthalmitis, urinary tract infections, soft tissue infections, spondyloarthritis (e.g., ankylosing spondylitis), Legionnaires' disease (e.g., Legionnaires' disease, Pontiac fever), diphtheria, salmonellosis, anthrax, cholera, tetanus, botulism, fasciitis, gas gangrene, plaque, Lyme disease, brucellosis, melioidosis, Q fever, tularemia, gonorrhea, typhus, mycoplasma pneumonia, gastroenteritis, and walking pneumonia (walking It can be used to treat ARDS associated with bacterial diseases or disorders selected from the group consisting of pneumonia. In some embodiments, ARDS associated with bacterial infections is associated with hypercytokinemia. In some embodiments, MBV is for use in the treatment of ARDS associated with sepsis caused by bacterial infections.
[0078] In certain embodiments, ARDS is associated with fungal infections. In certain embodiments, ARDS is associated with a fungal infection, where the fungi are Candida (e.g., C. albicans, C. krusei, C. glabrata, C. tropicalis), Cryptococcus (e.g., C. neoformans, C. gattii), Aspergillus (e.g., A. fumigatus, A. niger), Mucorales (e.g., M. mucor, M. absidia, M. rhizopus), Sporothrix (e.g., S. schenkii), Blastomyces (e.g., B. dermatitidis), Paracoccidioides (e.g., P. brasiliensis), Coccidioides (e.g., C. immitis), Histoplasma (e.g., H. capsulatum), Acremonium, Basidiobolus (e.g., B. ranarum), Cladophialophora (e.g., C. bantiana), Cunni The group is selected from nghamella (e.g., C. bertholletiae), Epidermophyton, Exophiala, Exserohilum, Fonsecaea (e.g., F. pedrosoi), Hortaea (e.g., H. werneckii), Lacazia (e.g., L. loboi), Leptosphaeria (e.g., L. maculans), Madurella (e.g., M. mycetomatis), Malassezia, Microsporum, Mucor, Neotestudina, Onychocola, Phialophora, Piedraia, Pneumocystis (e.g., P. jirovecii), Pseudallescheria (e.g., P. boydii), Pyrenochaeta, Rhizomucor, Scedosporium, Scytalidium, Sporothrix, Trichophyton, Trichosporon, and Zygomycete. In some embodiments, ARDS associated with fungal infections is associated with hypercytokinemia.
[0079] In certain embodiments, the MBV described herein is an ARDS associated with intracellular fungal infections, such as candidiasis, cryptococcosis, aspergillosis, mucormycosis, sporotrichosis, blastomycosis, paracoccidioidomycosis, coccidioidomycosis, histoplasmosis, mycomas, onychomycosis, hyalohifomycosis, subcutaneous zygomycosis, brain abscess, pheohypomycosis, chromoblastomycosis, mycomas, pulmonary mucormycosis, tinea corporis, tinea capitis, tinea cruris, tinea pedis, onychomycosis, tinea cruris, tinea pedis, tinea unguium, lobo's disease, and blackleg syndrome. It is used to treat ARDS associated with intracellular fungal infections selected from the group consisting of disease, myctoma, tinea versicolor, Malassezia folliculitis, steroid acne, seborrheic dermatitis, neonatal pustulosis of the head, mucormycosis, mazuramycosis, black sand hair, pneumocystis pneumonia, pseudoalescheririosis, skedosporium disease, sporotrichosis, and zygomycosis. In some embodiments, ARDS associated with fungal infections is associated with hypercytokinemia. In some embodiments, ARDS is associated with sepsis resulting from fungal infections.
[0080] In certain embodiments, ARDS is associated with intracellular protozoan infection. In some embodiments, the protozoan is an amoeba. In certain embodiments, the amoeba is selected from the group consisting of Apicomplexans (Plasmodium (e.g., P. vivax, P. falciparum, P. ovale, P. malariae, Toxoplasma gondii, Cryptosporidium parvum, Babesia microti, Cyclospora cayetanensis, Cystoisospora belli), Trypanosoma (e.g., Trypanosoma brucei, Trypanosoma cruzi), and Leishmania (e.g., Leishmania donovani). In some embodiments, ARDS associated with protozoan infection is associated with hypercytokinemia.
[0081] In certain embodiments, the MBV described herein is used to treat diseases or disorders resulting from intracellular amoebic infections, such as ARDS associated with amoebic infections selected from the group consisting of babesiosis, malaria, cryptosporidiosis, cyclosporiasis, cystoisosporiasis, toxoplasmosis, trypanosomiasis, Chagas disease, and leishmaniasis. In some embodiments, ARDS associated with amoebic infections is associated with hypercytokinemia.
[0082] assay for cytokine release The expression of cytokines such as chemokines can be evaluated by the methods disclosed herein. In some embodiments, pro-inflammatory cytokines known in the art are tested as chemokines. Examples of chemokines include, but are not limited to, CXCL8, CCL2, CCL3, CCL4, CCL5, CCL11, and CXCL10. In some embodiments, cytokine release is tested in vitro, for example, in cell culture. In certain embodiments, in vitro cytokine release is quantified from cell culture supernatant. In some embodiments, cytokine release is tested in vivo, for example, in an animal model. In certain embodiments, in vivo cytokine release is quantified from body fluids, for example, whole blood, serum, plasma, or lymph. In certain embodiments, the animal model is a mouse model. In certain embodiments, the animal model is a non-human primate. In certain embodiments, cytokine release is tested in a human patient.
[0083] In some embodiments, cytokine release is assessed by quantifying cytokine expression levels. In some embodiments, cytokine expression levels are quantified using enzyme-linked immunosorbent assay (ELISA). In some embodiments, cytokine expression levels are quantified using a multiplex immunoassay, such as Luminex. In some embodiments, cytokine expression levels are quantified using a cytokine array. In some embodiments, cytokine expression levels are quantified using Western blotting. In some embodiments, cytokine expression levels are quantified using mass spectrometry.
[0084] In some embodiments, cytokine release is assayed by monitoring changes in the immune system. Methods for testing the immune system are known in the art and include, but are not limited to, fluorescence-activated cell sorting (FACS), transcriptome profiling (e.g., by RNA sequencing (RNA Seq)), blood smears, total blood count, and hematocrit.
[0085] In certain embodiments, symptoms of disease or disorder, such as fever, pneumonia, shortness of breath, and low blood oxygen levels, indicate a change in the immune system. In certain embodiments, a reduction in symptoms of disease or disorder, such as fever, pneumonia, shortness of breath, and low blood oxygen levels, i.e., a reduction in symptoms after treatment with MBV therapy as disclosed herein, indicates a change in the immune system.
[0086] Treatment of acute respiratory distress syndrome The present invention also provides a method for treating acute respiratory distress syndrome (ARDS) with MBV as described herein.
[0087] Acute respiratory distress syndrome (ARDS) is a disorder characterized by insufficient blood oxygenation, fluid infiltration into the lungs, and a high degree of onset (Diamond et al. (2020). Acute Respiratory Distress Syndrome (ARDS). StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing). ARDS onset usually occurs within 7 days of the causative event. ARDS is clinically defined by the ratio of the patient's arterial oxygen level (PaO2) to inspiratory oxygen (FiO2). ARDS is defined as a patient exhibiting a PaO2 / FiO2 ratio of less than 300. ARDS has a high morbidity and high mortality rate. Clinical ARDS is further described, for example, in Fan et al. (2018). Acute Respiratory Distress Syndrome: Advances in Diagnosis and Treatment. JAMA. 319 (7): 698-710.
[0088] Risk factors for ARDS include, but are not limited to, infectious diseases or disorders (e.g., viral infections, e.g., bacterial infections), graft-versus-host disease, massive blood transfusions, organ trauma, tissue trauma (e.g., severe burns), chronic alcoholism, hemophagocytic lymphohistiocytosis, sepsis, systemic inflammatory response syndrome, drowning (e.g., water inhalation), drug overdose (e.g., vomit inhalation), food inhalation, fat embolism, inhalation of toxic fumes (e.g., smoke or chemical fumes), and pancreatitis. Smoking e-cigarettes, known as "vaping," has also been determined to be a risk factor for developing ARDS. In certain embodiments, the subject has a head injury affecting a portion of the brain that controls respiration. In certain embodiments, the subject has a chest injury affecting the lungs. In some embodiments, the risk factor for ARDS is an infectious disease or disorder, e.g., a virus, e.g., coronavirus, e.g., SARS-CoV-2. In some embodiments, risk factors for ARDS are infectious diseases or disorders, such as viruses, such as Ebola virus. In some embodiments, risk factors for ARDS are infectious diseases or disorders, such as bacteria, such as Streptococcus pneumoniae. In some embodiments, ARDS is associated with hypercytokinemia. In certain embodiments, ARDS is associated with hypercytokinemia related to SARS-CoV-2 (COVID-19). In some embodiments, ARDS is associated with death related to SARS-CoV-2 (COVID-19). Any of these subjects can be selected for treatment by the methods disclosed herein.
[0089] Existing treatments for patients with ARDS include supportive and / or symptomatic care, without limiting the reduction of shunt fraction, increased oxygen delivery, reduced oxygen consumption, and avoidance of further damage to affected tissues and organs. In some embodiments, patients with ARDS are connected to a ventilator. In certain embodiments, ventilator-connected patients are administered MBV as described herein. In certain embodiments, ventilator-connected patients are administered MBV as described herein intravenously. In certain embodiments, if a patient is at risk of ARDS, the patient receives MBV before the onset of ARDS.
[0090] This invention is based on the discovery that MBV has the ability to modulate the immune system when administered to subjects suffering from diseases or disorders characterized by pathological dysregulation of the immune system, such as diseases or disorders caused by viral infections. In particular, it has been found that systemically delivered MBV has a therapeutic effect in treating symptoms of inflammatory disorders that is commensurate with the therapeutic effect achieved from topical administration of MBV to affected tissues. Furthermore, because MBV modulates rather than suppresses the immune system, the therapeutic effect of MBV administration does not present the risk of secondary infections often observed with immunosuppression. This thus positions MBV as a specific systemic treatment for inflammatory disorders, such as acute respiratory distress syndrome. Because the method of this invention does not suppress the innate immune system and maintains its function of fighting disease and preventing secondary infections, patients treated with MBV can therefore experience a reduced risk of developing secondary infections due to infection, in contrast to traditional anti-inflammatory or immunosuppressive drugs. For example, patients with COVID-19-induced ARDS experience a reduced risk of developing secondary infections when administered MBV to treat ARDS, compared to patients in similar situations receiving traditional anti-inflammatory or immunosuppressant drugs to treat ARDS.
[0091] As described in Example 2 below, in a rat model of rheumatoid arthritis as an exemplary inflammatory disease, arthritis scores in rats administered MBV either systemically via intravenous injection into the tail vein or locally via periarticular injection were improved compared to arthritis scores in rats receiving periarticular methotrexate, the absolute standard of treatment for rheumatoid arthritis. Surprisingly, the improvement in arthritis scores was comparable between rats receiving either systemic or local injections. Examples 10–13 further demonstrate that systemic administration of MBV reduces acute virus-mediated pulmonary pathology and chronic inflammation in an animal model of influenza infection.
[0092] Therefore, systemic administration of MBV can be used to treat disorders resulting from abnormal immune responses that are not localized to a part of the body or are unsuitable for local treatment, such as ARDS. In cases of hyperimmune disorders such as ARDS, the underlying cause (e.g., hypercytokinemia) is present in the circulation and is therefore a systemic disorder. Thus, in some embodiments, systemic therapy provides an efficient mechanism for modulating the immune response throughout the body.
[0093] In some embodiments, administration may be systemic. Systemic administration may be intravenous, oral, enteral, parenteral, intranasal, intratracheal, rectal, sublingual, buccal, sublabial, intraperitoneal, or intramuscular. In a specific and non-limiting example, systemic administration is intravenous. In certain embodiments, administration may be local, such as to the lungs. For example, local administration may be inhalation or intratracheal. For example, administration may be inhalation by spray or inhalation by intranasal administration.
[0094] In some embodiments, MBV administration results in a decrease in the number of CD45+ neutrophils in the lungs of the subject. In other embodiments, MBV administration results in an increase in the number of CD8+ T cells and a decrease in the number of CD4+ T cells in the lungs of the subject. In other embodiments, MBV administration results in an increase in the number of CD8+ T cells and a decrease in the number of CD4+ T cells in the spleen of the subject. In further embodiments, administration results in an increase in the number of CD69+CD4+ T cells in the spleen of the subject. In yet another embodiment, administration results in an increase in the number of antiviral Tbet+CD4+ T cells in the lymph nodes of the subject. In yet another embodiment, administration results in an increase in the number of antiviral Tbet+CD8+ T cells in the spleen of the subject. In yet another embodiment, administration results in an increase in the number of CD69+CD8+ T cells in the spleen of the subject. In many embodiments, administration results in an increase in the number of immunomodulatory CD11b+ dendritic cells in the lungs of the subject. In some embodiments, administration results in an increase in the number of CD62L+ / CD44+ memory CD4 and CD8 T cells in the lungs of the subject. Administration may result in one or more of these effects in a subject. An increase may be 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or greater than 100% compared to the parameter in the subject before MBV administration or compared to the standard value. A decrease may be 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or greater than 100% compared to the parameter in the subject before MBV administration or compared to the standard value.
[0095] In more embodiments, administration reduces virus-related tissue damage in the subject. For example, administration can result in reduced lung damage in the subject. In some embodiments, virus-related tissue damage is reduced by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% compared to the tissue in the subject before MBV administration.
[0096] Nanovesicles derived from the extracellular matrix (ECM) Nanovesicles derived from the extracellular matrix (also known as matrix-bound nanovesicles, or "MBVs") are generally described in PCT publication numbers WO2017 / 151862, WO2018 / 204848, and WO2019 / 213482, which are incorporated herein by reference. It is disclosed that MBVs are embedded in the extracellular matrix. Such MBVs can be isolated and are biologically active. In some embodiments, the MBVs do not contain alkaline phosphatase, osteopontin, osteoprogeterin, complement C5, and / or c-reactive proteins. Such MBVs can be used alone or in combination with the ECM for therapeutic purposes.
[0097] The extracellular matrix is a complex mixture of structural and functional biomolecules and / or biomacromolecules, including but not limited to structural proteins, specialized proteins, proteoglycans, glycosaminoglycans, and growth factors, that surrounds and supports cells within mammalian tissues, and is, unless otherwise indicated, cell-free. Generally, the disclosed MBVs are embedded in any type of extracellular matrix (ECM) and can be isolated from this site. Thus, MBVs are not detachably present on the surface of the ECM, nor are they exosomes (also known as extracellular vesicles or EVs).
[0098] The extracellular matrix is, for example, but is not limited to, U.S. Patent Nos. 4,902,508; 4,956,178; 5,281,422; 5,352,463; 5,372,821; 5,554,389; 5,573,784; 5,645,860; 5,771,969; 5,753,267; 5,762,966; 5,866,41 Disclosed in No. 4; No. 6,099,567; No. 6,485,723; No. 6,576,265; No. 6,579,538; No. 6,696,270; No. 6,783,776; No. 6,793,939; No. 6,849,273; No. 6,852,339; No. 6,861,074; No. 6,887,495; No. 6,890,562; No. 6,890,563; No. 6,890,564; and No. 6,893,666. However, ECM can be produced from any tissue or any in vitro source, in which case the ECM is produced by cultured cells and contains one or more polymeric components (components) of the native ECM. ECM preparations can be considered “descentd” or “cell-free,” meaning that the cells have been removed from the source tissue or culture.
[0099] In some embodiments, the extracellular matrix (ECM) is isolated from vertebrates, including but not limited to mammalian vertebrates such as humans, monkeys, pigs, cattle, and sheep. The ECM may originate from any organ or tissue, including, but not limited to, the bladder, intestines (small or large intestine, etc.), heart, dermis, liver, kidneys, uterus, brain, blood vessels, lungs, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. In some embodiments, the ECM may originate from any tissue except bone. In specific and non-limiting examples, the extracellular matrix is isolated from esophageal tissue, bladder (bladder matrix or bladder submucosa, etc.), small intestinal submucosa, dermis, umbilical cord, pericardium, cardiac tissue, or skeletal muscle. The ECM may include, for example, but not limited to, any portion or tissue obtained from an organ, including submucosa, epithelial basement membrane, tunica propria, etc. In one non-limiting embodiment, the ECM is isolated from the bladder. In some embodiments, the ECM is derived from human subjects. In other embodiments, the ECM is derived from porcine subjects.
[0100] The ECM may or may not include the basement membrane. In another non-limiting embodiment, the ECM includes at least a portion of the basement membrane. The ECM material may or may not retain some of the cellular elements that make up the original tissue, such as capillary endothelial cells or fibrous cells. In some embodiments, the ECM includes both basement membrane surfaces and non-basement membrane surfaces.
[0101] In some embodiments, the ECM is collected from pig bladder (also known as bladder matrix or UBM). Briefly, the ECM is prepared by removing bladder tissue from a mammal such as a pig and scraping off the outer connective tissue of the residue, including adipose tissue. All residual urine is removed by repeated washing with tap water. First, the tissue is delaminated by immersing it in a deepithelializing solution, for example, but not limited to, hypertonic saline (e.g., 1.0 N saline) for a period of 10 minutes to 4 hours. Exposure to hypertonic saline removes epithelial cells from the underlying basement membrane. Calcium chelating agents may be added to the saline solution as needed. The tissue remaining after the initial delamination procedure includes the epithelial basement membrane and the tissue layer antiluminal to the epithelial basement membrane. The relatively brittle epithelial basement membrane is always damaged and removed by any mechanical abrasion on the luminal surface. This tissue is then subjected to further treatment to remove most of the antiluminal tissue but to preserve the epithelial basement membrane and lamina propria. The outer serosa, adventitia, muscularis mucosa, submucosa, and most of the muscularis mucosa are removed from the remaining deepithelialized tissue by mechanical abrasion or by a combination of enzymatic treatment (e.g., using trypsin or collagenase) followed by hydration and abrasion. Mechanical removal of these tissues is achieved, for example, but not limited to, removal of mesenteric tissue using Adson-Brown forceps and Metzenbaum scissors, and wiping of the muscularis and submucosa using longitudinal wiping motions with a scalpel handle wrapped in moist gauze or other hard object. Automated robotic procedures involving cutting blades, lasers, and other tissue separation methods are also considered. After these tissues have been removed, the resulting ECM consists mainly of the epithelial basement membrane and the underlying lamina propria.
[0102] In another embodiment, the extramucosal membrane (ECM) is prepared by abrading the pig bladder tissue using a longitudinal wiping motion with a scalpel handle and damp gauze to remove the outer layers, including both the serosal and muscular layers. After abduction of the tissue segments, the luminal portions of the mucosa are interlaminated from the underlying tissue using the same wiping motion. Care is taken to avoid perforating the submucosa. After these tissues have been removed, the resulting ECM consists mainly of submucosa (see Figure 2 of U.S. Patent No. 9,277,999, incorporated herein by reference).
[0103] ECM can also be prepared as a powder. Such a powder can be prepared according to the method of Gilbert et al., Biomaterials 26 (2005) 1431-1435, which is incorporated herein by reference in whole. For example, a UBM sheet can be freeze-dried and then cut into smaller sheets for immersion in liquid nitrogen. The flash-frozen material can then be pulverized so that the particles are small enough to be placed in a rotary knife mill into which the ECM is pulverized. Similarly, by precipitating the NaCl in the ECM structure, the material will be crushed into particles of uniform size that can be flash-frozen, freeze-dried and pulverized.
[0104] In one non-limiting embodiment, the ECM is derived from the submucosa of the small intestine or SIS. Commercial preparations include, but are not limited to, SURGISIS®, SURGISIS-ES®, STRATASIS® and STRATASIS-ES® (Cook Urological Inc.; Indianapolis, Ind.) and GRAFTPATCH® (Organogenesis Inc.; Canton Mass.). In another non-limiting embodiment, the ECM is derived from the dermis. Commercial preparations include, but are not limited to, PELVICOL® (sold as PERMACOL® in Europe; Bard, Covington, Ga.), REPLIFORM® (Microvasive; Boston, Mass.) and ALLODERM® (LifeCell; Branchburg, NJ). In yet another embodiment, the ECM is derived from the bladder. Commercial preparations include, but are not limited to, UBM (ACell Corporation; Jessup, Md.).
[0105] MBV can be obtained (released) from the extracellular matrix using the methods disclosed below. In some embodiments, the ECM is digested with enzymes such as pepsin, collagenase, elastase, hyaluronidase, or proteinase K to isolate MBV. In other embodiments, MBV is released and separated from the ECM by changing the pH with a solution such as glycine HCl, citrate, or ammonium hydroxide; by using chelating agents such as EDTA, EGTA, etc.; by using salts such as potassium chloride (KCl), sodium chloride, magnesium chloride, sodium iodide, or sodium thiocyanate, etc., to increase ionic strength and / or chaotropic effect; or by exposing the ECM to denaturing conditions such as guanidine HCl or urea.
[0106] In certain embodiments, MBV is prepared after digestion of ECM by enzymes such as pepsin, elastase, hyaluronidase, proteinase K, salt solution or collagenase. The ECM can be frozen and thawed or subjected to mechanical disruption.
[0107] In some embodiments, the expression of CD63, CD81 and / or CD9 cannot be detected in MBV. Thus, in some embodiments, MBV does not express CD63 and / or CD81 and / or CD9. In a specific example, CD63, CD81 and CD9 cannot be detected in nanovesicles. In other embodiments, MBV has CD63, CD81 and CD9 at levels that are barely detectable, such as those detectable by Western blot. Such MBV is CD63 lo CD81 lo CD9 lo That is. In other embodiments, MBV does not express one or more of CD63, CD81 or CD9 at detectable levels. In other embodiments, MBV expresses one or more of CD63, CD81 or CD9 at levels that are barely detectable. One skilled in the art can readily identify MBV that is, for example, CD63 lo and / or CD81 lo and / or CD9 lo by using antibodies that specifically bind to CD63, CD81 and CD9. The low levels of these markers can be established using procedures such as fluorescence-activated cell sorting (FACS) and fluorescently labeled antibodies to determine the thresholds for low and high amounts of CD63, CD81 and CD9. In further embodiments, MBV does not contain detectable alkaline phosphatase, osteopontin, osteoprotegerin, complement C5 and / or c-reactive protein. Since MBV binds to ECM in vivo and is not found in biological fluids, the disclosed MBV is different from nanovesicles such as exosomes that can transiently attach to the surface of ECM due to their presence in biological fluids.
[0108] MBVs have a characteristic phospholipid content compared to, for example, exosomes. In some embodiments, the total phospholipid content of MBVs is at least 50%, 55%, 60%, 65%, 70%, 75%, 85%, or 90%, or about 50%-90%, 50%-65%, 50%-60%, 50%-70%, 60%-70%, 60%-90%, or 70%-90% of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In specific embodiments, the total phospholipid content of MBVs is at least 55% of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In specific embodiments, the total phospholipid content of MBVs is at least 60% of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In some embodiments, the phospholipid content of MBV includes a phosphatidylcholine (PC) to phosphatidylinositol (PI) ratio of less than 8:1 (e.g., less than 7:1, less than 6:1, less than 5:1, less than 4:1, less than 3:1, or less than 2:1). In some embodiments, the phospholipid content of MBV includes a phosphatidylcholine (PC) to phosphatidylinositol (PI) ratio in the range of 0.5 to 1:1, or 1:0.5 to 1, or 0.5 to 1:2, or 2:0.5 to 1, or 0.8 to 1:1, or 1:0.8 to 1. In one embodiment, the phospholipid content of MBV includes a phosphatidylcholine (PC) to phosphatidylinositol (PI) ratio of about 1:1. In a specific embodiment, the phospholipid content of MBV includes a phosphatidylcholine (PC) to phosphatidylinositol (PI) ratio of about 0.9:1.
[0109] In some embodiments, the total phospholipid content of MBV is 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, or less, or approximately 5%-10%, 5%-15%, 10%-15%, or 8%-12% sphingomyelin (SM). In specific embodiments, the total phospholipid content of MBV is 10% or less sphingomyelin (SM). In some embodiments, the total phospholipid content of MBV is 15% or less sphingomyelin (SM), 14% or less sphingomyelin, 13% or less sphingomyelin, 12% or less sphingomyelin, 11% or less sphingomyelin, 10% or less sphingomyelin, 9% or less sphingomyelin, 8% or less sphingomyelin, 7% or less sphingomyelin, 6% or less sphingomyelin, 5% or less sphingomyelin, or 4% or less sphingomyelin.
[0110] In some embodiments, the total phospholipid content of MBV is 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, or 10% or less, or about 10% to 20%, 15% to 20%, 14% to 18%, or 12% to 16% phosphatidylethanolamine (PE). In specific embodiments, the total phospholipid content of MBV is 20% or less phosphatidylethanolamine (PE).
[0111] In some embodiments, the total phospholipid content of MBV is 5%, 10%, 12%, 15%, 18%, 20%, 25%, or 30% or higher, or approximately 5%–30%, 10%–20%, 10–25%, 15%–25%, or 12%–18% phosphatidylinositol (PI). In specific embodiments, MBV contains a phospholipid content of 15% or more phosphatidylinositol (PI). In specific embodiments, the total phospholipid content of MBV includes 15% or more phosphatidylinositol, less than 20% phosphatidylethanolamine, and less than 10% sphingomyelin. In specific embodiments, the total phospholipid content of MBV is 15% or more phosphatidylinositol and less than 20% phosphatidylethanolamine. In specific embodiments, the total phospholipid content of MBV is 15% or more phosphatidylinositol and 10% or less sphingomyelin. In specific embodiments, the total phospholipid content of MBV includes 20% or less phosphatidylethanolamine and 10% or less sphingomyelin. In specific embodiments, the total phospholipid content of MBV is more than 15% phosphatidylinositol, 20% or less phosphatidylethanolamine, 10% or less sphingomyelin, and at least 55% of a combination of phosphatidylinositol and phosphatidylcholine. In one embodiment, the total phospholipid content of MBV is at least 55% of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI), and 10% or less sphingomyelin (SM). In specific embodiments, the total phospholipid content of MBV is at least 55% phosphatidylinositol and phosphatidylcholine, and more than 15% phosphatidylinositol. In specific embodiments, the total phospholipid content of MBV is 55% phosphatidylinositol and phosphatidylcholine, and less than 20% phosphatidylethanolamine.
[0112] MBVs can also contain lysyl oxidase (Lox). Generally, nanovesicles derived from the extracellular matrix (ECM) have a higher Lox content than exosomes. Lox is expressed on the surface of MBVs. Lox proteins can be detected using nano-LC MS / MS proteomics analysis. Lox can be quantified (see, for example, Hill RC, et al., Mol Cell Proteomics. 2015;14(4):961-73, which is incorporated herein by reference in its entirety).
[0113] In certain embodiments, MBV comprises one or more miRNAs. In specific and non-limiting examples, MBV comprises one, two, or all three of miR-143, miR-145, and miR-181. miR-143, miR-145, and miR-181 are known in the art.
[0114] The miR-145 nucleic acid sequence is provided to MiRbase accession number MI0000461, which is incorporated herein by reference. The miR-145 nucleic acid sequence is CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU (Sequence ID 1). The miR-181 nucleic acid sequence is provided to miRbase accession number MI0000269, which is incorporated herein by reference. The miR-181 nucleic acid sequence is AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGUCCUUA (Sequence ID 2). The miR-143 nucleic acid sequence is provided in NCBI accession number NR_029684.1, March 30, 2018, which is incorporated herein by reference. The DNA encoding the miR-143 nucleic acid sequence is GCGCAGCGCC CTGTCTCCCA GCCTGAGGTG CAGTGCTGCA TCTCTGGTCA GTTGGGAGTC TGAGATGAAG CACTGTAGCT CAGGAAGAGA GAAGTTGTTC TGCAGC (Sequence ID 3).
[0115] Following administration, MBV maintains the expression of F4 / 80 (macrophage marker) and CD-11b on the surface of target macrophages. Nanovesicle-treated macrophages are predominantly F4 / 80+Fizz1+, indicating the M2 phenotype.
[0116] The MBV disclosed herein can be formulated into compositions for pharmaceutical delivery. The MBV is further disclosed and described in PCT Publication No. WO2017 / 151862, which is incorporated herein by reference.
[0117] Isolation of MBV from ECM To produce MBV, as described above, ECM can be produced by any of the target cells or is available from a commercial source. See also Quijano et al., Tissue Eng, Part C 2020; (10):528-540. DOI: 10.1089 / ten.tec.2020.0243. PMID: 33012221, which is incorporated herein by reference in its entirety. MBV can be produced from the same species as the subject being treated or from a different species. In some embodiments, such methods include the step of enzymatically digesting ECM to produce digested ECM. In specific embodiments, ECM is digested with one or more of pepsin, elastase, hyaluronidase, collagenase, metalloproteinase and / or proteinase K. In specific and non-limiting examples, ECM is digested with elastase and / or metalloproteinase alone. In another non-limiting example, the ECM is not digested with collagenase and / or trypsin and / or proteinase K. In other embodiments, the ECM is treated with a surfactant. In further embodiments, the method does not involve the use of enzymes. In specific and non-limiting examples, the method isolates MBV by utilizing a chaotropic agent or ionic strength, such as a salt of potassium chloride. In additional embodiments, the ECM may be manipulated to increase the MBV content prior to the isolation of MBV. Techniques for isolating MBV from ECM are described, for example, in international patent application WO2017 / 151862.
[0118] In some embodiments, ECM is enzymatically digested. ECM can be enzymatically digested for approximately 12 to 48 hours, such as approximately 12 to 36 hours. ECM can be enzymatically digested for approximately 12, 24, 36, or 48 hours. In a specific and non-limiting example, ECM is enzymatically digested at room temperature. However, digestion can occur at approximately 4°C or at any temperature between approximately 4°C and 25°C. Generally, ECM is enzymatically digested at any temperature for any length of time sufficient to remove collagen fibrils. The digestion process may vary depending on the tissue source. If necessary, ECM is treated by freezing and thawing either before or after enzymatic digestion. ECM can be treated with surfactants, including ionic and / or nonionic surfactants.
[0119] Next, the digested ECM is processed by centrifugation or other means to isolate the fibrillary-free supernatant. In some embodiments, the digested ECM is centrifuged at approximately 300 to 1000 g for the first step, for example. Thus, the digested ECM can be centrifuged at approximately 400 g to 750 g, such as approximately 400 g, approximately 450 g, approximately 500 g, or approximately 600 g. This centrifugation can be carried out for approximately 10 to 12 minutes, such as approximately 10 to 15 minutes, such as approximately 10, approximately 11, approximately 12, approximately 14, approximately 14, or approximately 15 minutes. The supernatant containing the digested ECM is collected.
[0120] In some embodiments, MBV comprises Lox. In some embodiments, a method for isolating such MBV includes the steps of: digesting the extracellular matrix with elastase and / or metalloproteinase to produce digested extracellular matrix; centrifuging the digested extracellular matrix to remove collagen fibrillary remnants, thereby producing a fibrillary supernatant; centrifuging the fibrillary supernatant to isolate a solid material; and suspending the solid material on a carrier.
[0121] In some embodiments, the digested ECM can also be centrifuged at approximately 2000g to approximately 3000g for a second step. Thus, the digested ECM can be centrifuged at approximately 2,500g to approximately 3,000g, such as approximately 2,000g, 2,500g, 2,750g, or 3,000g. This centrifugation can be carried out over approximately 20 to approximately 30 minutes, such as approximately 20, approximately 21, approximately 22, approximately 23, approximately 24, approximately 25, approximately 26, approximately 27, approximately 28, approximately 29, or approximately 30 minutes. The supernatant containing the digested ECM is collected.
[0122] In additional embodiments, the digested ECM can be centrifuged at approximately 10,000 to 15,000 g for a third step. Thus, the digested ECM can be centrifuged at approximately 10,000 g to 12,500 g, such as approximately 10,000 g, 11,000 g, or 12,000 g. This centrifugation can occur over approximately 25 to 30 minutes, for example, approximately 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 minutes. The supernatant containing the digested ECM is collected. One, two, or all three of these centrifugation steps can be used independently. In some embodiments, all three centrifugation steps are used. The centrifugation steps can be repeated two, three, four, or five times, for example. In one embodiment, all three types of centrifugal separation steps are repeated three times.
[0123] In some embodiments, the digested ECM is centrifuged at approximately 500 g for approximately 10 minutes, at approximately 2,500 g for approximately 20 minutes, and / or at approximately 10,000 g for approximately 30 minutes. These steps(s) are repeated two, three, four, or five times, such as three times. Thus, in a non-limiting example, the digested ECM is centrifuged at approximately 500 g for approximately 10 minutes, at approximately 2,500 g for approximately 20 minutes, and at approximately 10,000 g for approximately 30 minutes. These three steps are repeated three times. Thus, a fibrillary supernatant is produced. Next, the fibrillary supernatant is centrifuged to isolate MBV. In some embodiments, the fibrillary supernatant is centrifuged at approximately 100,000 g to approximately 150,000 g. Therefore, the fiber-free supernatant is centrifuged at approximately 100,000 g, 105,000 g, 110,000 g, 115,000 g, or 120,000 g, etc., ranging from approximately 100,000 g to approximately 125,000 g. This centrifugation can be carried out over approximately 70 to 80 minutes, for example, approximately 60, 65, 70, 75, 80, 85, or 90 minutes, etc. In a non-limiting example, the fiber-free supernatant is centrifuged at approximately 100,000 g for approximately 70 minutes. The solid material, which is the MBV, is collected. Such MBV can then be resuspended in any carrier of choice, including but not limited to buffers.
[0124] In further embodiments, the ECM is not digested by enzymes. In such a method, the ECM is suspended in an isotonic saline solution, such as phosphate-buffered saline. Then, salt is added to the suspension so that the final concentration of salt is greater than about 0.1 M. The concentration can be, for example, up to about 3 M, e.g., about 0.1 M salt to about 3 M or about 0.1 M to about 2 M. The salt can be, for example, about 0.1 M, 0.15 M, 0.2 M, 0.3 M, 0.4 M, 0.7 M, 0.6 M, 0.7 M, 0.8 M, 0.9 M, 1.0 M, 1.1 M, 1.2 M, 1.3 M, 1.4 M, 1.5 M, 1.6 M, 1.7 M, 1.8 M, 1.9 M or 2 M. In some non-limiting examples, the salt is potassium chloride, sodium chloride, or magnesium chloride. In other embodiments, the salt is sodium chloride, magnesium chloride, sodium iodide, sodium thiocyanate, sodium salt, lithium salt, cesium salt, or calcium salt.
[0125] In some embodiments, the ECM is suspended in a salt solution for about 10 minutes to about 2 hours, such as about 15 minutes to about 1 hour, about 30 minutes to about 1 hour, or about 45 minutes to about 1 hour. The ECM can be suspended in a salt solution for about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 minutes. The ECM can be suspended in a salt solution at temperatures of about 4°C to about 50°C, including but not limited to about 4°C to about 25°C or about 4°C to about 37°C. In a specific and non-limiting example, the ECM is suspended in a salt solution at about 4°C. In another specific and non-limiting example, the ECM is suspended in a salt solution at about 22°C or about 25°C (room temperature). In a further non-limiting example, the ECM is suspended in a salt solution at approximately 37°C.
[0126] In some embodiments, the method includes the steps of incubating the extracellular matrix at a salt concentration higher than about 0.4 M, centrifuging the digested extracellular matrix to remove collagen fibrillary remnants, isolating the supernatant, centrifuging the supernatant to isolate the solid material, and suspending the solid material on a carrier to isolate MBV from the extracellular matrix.
[0127] After incubation in a salt solution, the ECM is centrifuged to remove collagen fibrils. In some embodiments, the digested ECM can also be centrifuged at approximately 2,000 g to approximately 5,000 g. Thus, the digested ECM can be centrifuged at approximately 2,500 g to approximately 4,500 g, such as approximately 2,500 g, approximately 3,000 g, 3,500, approximately 4,000 g, or approximately 4,500 g. In a specific and non-limiting example, centrifugation is performed at approximately 3,500 g. This centrifugation can occur over approximately 20 to 40 minutes, such as approximately 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 minutes, approximately 31, 32, 33, 34, or 35 minutes, such as approximately 25 to approximately 35 minutes. The supernatant is then collected.
[0128] In an additional embodiment, the supernatant can then be centrifuged at approximately 100,000 to 150,000 g for a third step. Thus, the digested ECM can be centrifuged at approximately 100,000 g to 125,000 g, such as approximately 100,000 g, 110,000 g, or 120,000 g. This centrifugation can take place over approximately 30 minutes to 2.5 hours, such as approximately 1 to 3 hours, for example, approximately 30 minutes, approximately 45 minutes, approximately 60 minutes, approximately 90 minutes, or approximately 120 minutes (2 hours). The solid material is collected and suspended in a solution such as buffered saline, thereby isolating the MBV.
[0129] In yet another embodiment, the ECM is suspended in an isotonic buffer solution, including but not limited to phosphate-buffered saline. Larger particles can be removed by centrifugation or other methods (see below). Next, MBVs, which are particles between approximately 10 nm and 10,000 nm, such as between approximately 10 nm and 300 nm, or between approximately 10 nm and 1,000 nm, are isolated from the ECM using ultrafiltration.
[0130] In specific and non-limiting examples, the isotonic buffered saline solution has a total salt concentration of about 0.164 mM and a pH of about 7.2 to about 7.4. In some embodiments, the isotonic buffered saline solution contains 0.002 M KCl to about 0.164 M KCl, such as about 0.0027 M KCl (concentration of KCl in phosphate-buffered saline). This suspension is then treated by ultracentrifugation.
[0131] After incubation in an isotonic buffer salt solution, the ECM is centrifuged to remove collagen fibrils. In some embodiments, the digested ECM can also be centrifuged at approximately 2,000 g to approximately 5,000 g. Thus, the digested ECM can be centrifuged at approximately 2,500 g to approximately 4,500 g, such as approximately 2,500 g, approximately 3,000 g, 3,500, approximately 4,000 g, or approximately 4,500 g. In a specific and non-limiting example, centrifugation is performed at approximately 3,500 g. This centrifugation can occur over approximately 20 to 40 minutes, such as approximately 20, approximately 21, approximately 22, approximately 23, approximately 24, approximately 25, approximately 26, approximately 27, approximately 28, approximately 29, approximately 30 minutes, approximately 31, approximately 32, approximately 33, approximately 34, or approximately 35 minutes, such as approximately 25 to approximately 35 minutes.
[0132] High molecular weight materials can be removed from suspensions using and in combination with microfiltration and centrifugation. In one embodiment, large molecular weight materials, such as those larger than 200 nm, are removed using microfiltration. In another embodiment, large molecular weight materials are removed using centrifugation. In a third embodiment, both microfiltration and ultracentrifugation are used to remove high molecular weight materials. High molecular weight materials, such as those larger than approximately 10,000 nm, larger than approximately 1,000 nm, larger than approximately 500 nm, or larger than approximately 300 nm, are removed from the suspended ECM.
[0133] Next, the effluent or supernatant from the microfiltration is subjected to ultrafiltration. Thus, the effluent containing particles smaller than approximately 10,000 nm, 1,000 nm, 500 nm, or 300 nm is collected and used. This effluent is then subjected to ultrafiltration through a membrane with a molecular weight cutoff (MWCO) of 3,000 to 100,000. 100,000 MWCO was used in the examples.
[0134] Methods for treating acute respiratory distress syndrome (ARDS) Methods for treating ARDS in subjects requiring such treatment are disclosed herein. These methods include the steps of selecting subjects requiring treatment to reduce inflammation and administering a therapeutically effective amount of MBV to the subjects (for example, by administering a pharmaceutical preparation containing a therapeutically effective amount of MBV), thereby treating the ARDS.
[0135] The subject may be a mammal. The subject may be a human. The subject may be a veterinary subject. The subject may be a bird or domestic pet, such as a cat, dog, or rabbit. The subject may be a non-human primate (such as a monkey), or livestock, including pigs, ruminants, horses, and poultry. The method comprises the steps of selecting a subject that requires treatment to reduce inflammation, and administering a therapeutically effective dose of MBV to the subject (for example, by administering a pharmaceutical preparation containing a therapeutically effective dose of MBV). In some embodiments, MBV may be administered systemically. In other embodiments, MBV may be administered topically. The MBV may be derived from the same or a different species as the subject that requires reduction of inflammation. The MBV may be autologous.
[0136] The methods disclosed herein can result in a reduction of inflammation in a subject. In some embodiments, signs or symptoms of excessive inflammatory disorders, such as hypercytokinemia, are reduced or eliminated. For example, the methods disclosed herein can result in the treatment of ARDS in a subject. In some embodiments, the methods disclosed herein can be used to prevent the progression of ARDS in a subject or to reverse ARDS in a subject.
[0137] In one embodiment, treatment of ARDS can be measured according to the relevant clinical signs (indicia). In some embodiments, ARDS may be severe and can be scored, for example, using Murray scores for acute lung injury, hypoxemia (PaO2 / FiO2), PEEP (cmH2O), compliance (ml / cmH2O), and CXR infiltration quadrant. In some embodiments, ARDS can be scored using a modified Downe's scoring system determined, for example, by respiratory rate, cyanosis, regression, grunting, and air entry. In some embodiments, ARDS can be scored using, for example, another scoring system known in the art. Improvement in ARDS due to MBV treatment can be indicated by a change in scoring associated with improvement in ARDS symptoms.
[0138] In one embodiment, treatment of ARDS can be measured according to relevant clinical signs. For example, treatment of ARDS can be measured by, for example, improvement in the oxygen index (OI), oxygen saturation index (OSI), or oxygen saturation (OS). The effectiveness of treatment of ARDS can be measured by, for example, an increase in OI, OSI, or OS. For example, in one embodiment, oxygen saturation in a subject increases by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% after administration of MBV. In another embodiment, the oxygen saturation index in the subject increases by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% after MBV administration. In yet another embodiment, the oxygen index in the subject increases by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% after MBV administration. In yet another embodiment, treatment of ARDS can be indicated by measuring the levels of pro-inflammatory cytokines in the subject. For example, a decrease in pro-inflammatory cytokines can indicate the effectiveness of treatment of ARDS. For example, a decrease in TNF-α, IFN-γ, IL-8, IL-12, IL-6, and / or IL-1β after MBV administration can indicate effectiveness in treating ARDS. In another embodiment, an increase in anti-inflammatory cytokines such as IL-10, IL-4, and / or TGF-β can be used as an indicator of effectiveness in treating ARDS. Cytokine levels can be determined in the above embodiments, for example, by sampling from the recovered bronchoalveolar lavage fluid of the subject before and after MBV treatment. Cytokine levels can be determined in the above embodiments, for example, by sampling from blood before and after MBV treatment. Cytokine levels in body fluid or cell samples can be determined by conventional methods known to those skilled in the art.For example, cytokine concentrations in cell culture supernatant and bronchoalveolar lavage fluid can be measured as recommended by the manufacturer of the ELISA kit (R&D Systems, Minneapolis, MN).
[0139] The effectiveness of MBV treatment can be measured by monitoring lung function using methods known to those skilled in the art. For example, various measurable parameters of lung function can be tested before, during, or after treatment. Lung function can be monitored by examining any of several physically measurable functions of the lungs, including but not limited to inspiratory flow rate, expiratory flow rate, and lung volume. A statistically significant increase in one or more of these parameters, determined by formulas well known to those skilled in the art, indicates the effectiveness of MBV treatment.
[0140] The most commonly used methods for measuring lung function in clinical practice involve timed measurements of inspiratory and expiratory operations to measure specific parameters. For example, FVC measures the total volume in liters forcefully exhaled by the patient from the initial deep inspiration. This parameter, when evaluated in conjunction with FEV1, allows for a quantitative assessment of bronchoconstriction. A statistically significant increase in FVC or FEV1, determined by formulas well known to those skilled in the art, reflects a reduction in bronchoconstriction and indicates that MBV therapy is effective.
[0141] The problem with determining forced vital capacity (FVC) is that the FVC operation (i.e., forced exhalation from maximal inspiration to maximal expiration) is largely technique-dependent. In other words, a given subject can produce different FVC values during a series of consecutive FVC operations. FEF 25-75 or forced expiratory flow rate, determined over the middle portion of the forced expiratory operation, tends to be less technique-dependent than FVC. Similarly, FEV1 tends to be less technique-dependent than FVC. Therefore, a statistically significant increase in FEF 25-75 or FEV1, determined by formulas well known to those skilled in the art, reflects a reduction in bronchoconstriction and indicates that MBV therapy is effective.
[0142] In addition to measuring the volume of exhaled air as an indicator of lung function, flow rates in liters per minute measured across different parts of the expiratory cycle can be useful in determining the state of a patient's lung function. In particular, peak expiratory flow rate, received as the highest airflow velocity in liters per minute during maximal forced exhalation, correlates well with overall lung function in patients with asthma and other respiratory diseases. Therefore, a statistically significant increase in peak expiratory flow rate after MBV administration, determined by a formula well known to those skilled in the art, indicates that the treatment is effective.
[0143] The patient may receive one or more doses of MBV as part of the course of treatment. The course of treatment may be systemic administration. The course of treatment may be once-daily administration of MBV until ARDS subsides. Alternatively, the course of treatment may be twice-daily administration of MBV until ARDS subsides. The course of treatment may be administered in one dose or over a period of several hours. For example, MBV may be administered by bolus IV administration or bolus endotracheal infusion, or by infusion into the oxygen stream of a ventilator or oxygen mask for continuous administration over several minutes or several hours. For example, MBV may be administered by continuous IV infusion.
[0144] In some embodiments, the target is approximately 1 × 10⁶ per kg of body weight per dose. 1 ~Approx. 1×10 20 The subject is administered approximately 1 × 10⁶ MBV, concentrated into a microliter volume, for example, for inhalation. 1 ~Approx. 1×10 2 Each MBV, etc., approximately 1 x 10 1 ~Approx. 1×10 3A certain number of MBV can be administered. For example, in one embodiment, the volume is 50 μL to 500 μL. For example, in one embodiment, the volume is 100 μL to 300 μL. For example, in one embodiment, the volume is 200 μL to 400 μL. For example, in one embodiment, the volume is 300 μL to 400 μL. In a further embodiment, the volume is 250 μL. In a further embodiment, the volume is 300 μL. In many more embodiments, the volume may be about 1 μL to 5 μL, such as about 1 μL to 4 μL, about 1 μL to 3 μL, or about 1 μL to 2 μL. In one embodiment, about 1 × 10 1 ~Approx. 1×10 3 Each MBV is provided for inhalation administration in a volume of approximately 50–500 μL.
[0145] In an additional embodiment, the target is approximately 1 × 10⁶ times per kg of body weight per dose. 6 ~Approx. 1×10 12 Each MBV, etc., approximately 1 x 10 6 ~Approx. 1×10 20 The subject is administered an amount of MBV / kg body weight. In the embodiment, the subject is approximately 1 × 10⁶ 6 ~Approx. 1×10 19 Each MBV, approximately 1 x 10 6 ~Approx. 1×10 18 Each MBV, approximately 1 x 10 6 ~Approx. 1×10 17 Each MBV, approximately 1 x 10 6 ~Approx. 1×10 16 Each MBV, approximately 1 x 10 6 ~Approx. 1×10 15 Each MBV, approximately 1 x 10 6 ~Approx. 1×10 14 Each MBV, approximately 1 x 10 6 ~Approx. 1×10 13 1 MBV or approximately 1 x 10 6 ~Approx. 1×10 12 In another embodiment, the subject is administered approximately 1 × 10⁶ MBV per kg of body weight per dose. 7 ~Approx. 1×10 11 In another embodiment, the subject is administered 1 × 10⁶ MBV per kg of body weight per dose. 7 ~1 × 10 8In another embodiment, the subject is administered 1 × 10⁶ MBV per kg of body weight per dose. 8 ~1 × 10 10 In another embodiment, the subject is administered 1 × 10⁶ MBV per kg of body weight per dose. 9 ~1 × 10 10 In another embodiment, the subject is administered 1 × 10⁶ MBV per kg of body weight per dose. 6 ~1 × 10 8 In another embodiment, the subject is administered 1 × 10⁶ MBV per kg of body weight per dose. 7 ~1 × 10 9 In another embodiment, the subject is administered 1 × 10⁶ MBV per kg of body weight per dose. 8 ~1 × 10 11 In another embodiment, the subject is administered 1 × 10⁶ MBV per kg of body weight per dose. 9 ~1 × 10 11 In another embodiment, the subject is administered 1 × 10⁶ MBV per kg of body weight per dose. 10 ~1 × 10 11 In another embodiment, the subject is administered 1 × 10⁶ MBV per kg of body weight per dose. 11 ~1 × 10 12 In another embodiment, the subject is administered 1 × 10⁶ MBV per kg of body weight per dose. 6 ~1 × 10 14 In another embodiment, the subject is administered 1 × 10⁶ MBV per kg of body weight per dose. 12 ~1 × 10 14 A certain amount of MBV is administered. In one embodiment, the administration of MBV according to any of the above amounts is done by systemic administration. For example, in one embodiment, the administration is intravenous. In another embodiment, the administration is done by inhalation. In one embodiment, the inhalation is done by a nebulizer or inhaler pump.
[0146] In another embodiment, MBV is administered intranasally in a dose-per-unit amount in a set volume of liquid. For example, in one embodiment, the volume is 50 μL to 500 μL. For example, in one embodiment, the volume is 100 μL to 300 μL. For example, in one embodiment, the volume is 200 μL to 400 μL. For example, in one embodiment, the volume is 300 μL to 400 μL. In a further embodiment, the volume is 250 μL. In a further embodiment, the volume is 300 μL. In many more embodiments, the volume may be about 1 μL to 5 μL, such as about 1 μL to 4 μL, about 1 μL to 3 μL, or about 1 μL to 2 μL. In one embodiment, about 1 × 10 1 ~Approx. 1×10 3 Each MBV is provided for intranasal administration in a volume of approximately 50-500 μL. In one embodiment, the substance is concentrated into a 50-200 μL carrier such as saline for intranasal administration, such as by a nasal spray pump, and is approximately 1 × 10⁶ of MBV. 1 ~Approx. 1×10 3 In one embodiment, the total dose administered is approximately 1 × 10⁶ units per kg of body weight. 8 ~Approx. 1×10 20 To provide a specific amount of MBV, the subject may be administered multiple doses of the MBV concentrate solution.
[0147] In one embodiment, the number of MBVs in a dose is 1 × 10⁻⁶ 8 ~1 × 10 10 This is the number of MBVs. For example, in one embodiment, the number of MBVs in a dose is 1 × 10⁶ 9 This is the number of MBVs. In one embodiment, the MBVs are sprayed in a physiologically acceptable carrier, such as physiological saline. For example, the number of MBVs in the dose to be sprayed is 1 × 10⁶ per kg of body weight per dose. 6 ~1 × 10 20 This is the number of MBVs. For example, the number of MBVs in the dose to be sprayed is 1 × 10⁶ per kg of body weight per dose. 6 ~1 × 10 12 This is the MBV per unit. For example, the dose is 1 × 10⁶ per kg of body weight per administration. 7 ~1 × 10 11MBV per dose or 1×10 per kg body weight per dose 7 ~1×10 8 MBV per dose or 1×10 per kg body weight per dose 8 ~1×10 10 MBV per dose or 1×10 per kg body weight per dose 9 ~1×10 10 MBV per dose or 1×10 per kg body weight per dose 6 ~1×10 8 MBV per dose or 1×10 per kg body weight per dose 7 ~1×10 9 MBV per dose or 1×10 per kg body weight per dose 8 ~1×10 11 MBV per dose or 1×10 per kg body weight per dose 9 ~1×10 11 MBV per dose or 1×10 per kg body weight per dose 10 ~1×10 11 MBV per dose or 1×10 per kg body weight per dose 11 ~1×10 12 MBV.
[0148] In another embodiment, the MBV is administered in a set volume of liquid by intratracheal administration at a dose of 1×10 7 ~1×10 11 MBV. For example, in one embodiment, the volume is 0.5 mL to 5.0 mL. In other embodiments, the volume is in microliter amounts. In another embodiment, the volume is 1 mL to 3 mL. For example, in one embodiment, the volume is 2 mL to 4 mL. In yet another embodiment, the volume is 3 mL. For example, in one embodiment, the number of MBV in the dose is 1×10 8 ~1×10 10 MBV. For example, in one embodiment, the number of MBV in the dose is 1×10 9 MBV. For example, in one embodiment, the number of MBV in the dose is 1×10 per kg body weight per dose 10 ~1×10 11This is the number of MBVs. For example, in one embodiment, the number of MBVs in a dose is 1 × 10⁶ per kg of body weight per dose. 11 ~1 × 10 12 This is an individual MBV.
[0149] In another embodiment, MBV is 1 × 10⁶ per dose in a set volume of liquid administered intravenously. 7 ~1 × 10 11 It is administered in units of MBV. For example, in one embodiment, the volume is 0.5 mL to 10.0 mL. In another embodiment, the volume is 1 mL to 5 mL. In yet another embodiment, the volume is 3 mL to 8 mL. In yet another embodiment, the volume is 3 mL. For example, in one embodiment, the number of MBVs in the dose is 1 × 10⁶ 8 ~1 × 10 10 This is the number of MBVs. For example, in one embodiment, the number of MBVs in a dose is 1 × 10⁶ 9 This is the number of MBV units. For example, the number of MBV units in a dose to be administered intravenously is 1 × 10⁶ units per kg of body weight per dose. 6 ~1 × 10 20 This is the number of MBV units. For example, the number of MBV units in a dose to be administered intravenously is 1 × 10⁶ units per kg of body weight per dose. 6 ~1 × 10 12 This is the MBV per unit. For example, the dose is 1 × 10⁶ per kg of body weight per administration. 7 ~1 × 10 11 Individual MBV or 1 x 10⁶ per kg of body weight per dose 7 ~1 × 10 8 Individual MBV or 1 x 10⁶ per kg of body weight per dose 8 ~1 × 10 10 Individual MBV or 1 x 10⁶ per kg of body weight per dose 9 ~1 × 10 10 Individual MBV or 1 x 10⁶ per kg of body weight per dose 6 ~1 × 10 8 Individual MBV or 1 x 10⁶ per kg of body weight per dose 7 ~1 × 10 9 Individual MBV or 1 x 10⁶ per kg of body weight per dose 8 ~1 × 10 11Individual MBV or 1 x 10⁶ per kg of body weight per dose 9 ~1 × 10 11 Individual MBV or 1 x 10⁶ per kg of body weight per dose 10 ~1 × 10 11 Individual MBV or 1 x 10⁶ per kg of body weight per dose 11 ~1 × 10 12 Individual MBV or 1 x 10⁶ per kg of body weight per dose 12 ~1 × 10 14 Individual MBV or 1 x 10⁶ per kg of body weight per dose 14 ~1 × 10 20 This is an individual MBV.
[0150] In another embodiment, MBV is 1 × 10⁶ per dose in a set volume of liquid administered intraperitoneally. 7 ~1 × 10 11 It is administered in units of MBV. For example, in one embodiment, the volume is 10 mL to 200 mL. In another embodiment, the volume is 50 mL to 100 mL. In yet another embodiment, the volume is 50 mL to 125 mL. In yet another embodiment, the volume is 50 mL. For example, in one embodiment, the number of MBVs in the dose is 1 × 10⁶ 8 ~1 × 10 10 This is the number of MBVs. For example, in one embodiment, the number of MBVs in a dose is 1 × 10⁶ 9 This is the number of MBV units. For example, the number of MBV units in a dose to be administered intraperitoneally is 1 × 10⁶ units per kg of body weight per dose. 6 ~1 × 10 20 This is the MBV per unit. For example, the dose is 1 × 10⁶ per kg of body weight per administration. 6 ~1 × 10 12 Individual MBV or 1 x 10⁶ per kg of body weight per dose 7 ~1 × 10 11 Individual MBV or 1 x 10⁶ per kg of body weight per dose 7 ~1 × 10 8 Individual MBV or 1 x 10⁶ per kg of body weight per dose 8 ~1 × 10 10 Individual MBV or 1 x 10⁶ per kg of body weight per dose 9 ~1 × 1010 Individual MBV or 1 x 10⁶ per kg of body weight per dose 6 ~1 × 10 8 Individual MBV or 1 x 10⁶ per kg of body weight per dose 7 ~1 × 10 9 Individual MBV or 1 x 10⁶ per kg of body weight per dose 8 ~1 × 10 11 Individual MBV or 1 x 10⁶ per kg of body weight per dose 9 ~1 × 10 11 Individual MBV or 1 x 10⁶ per kg of body weight per dose 10 ~1 × 10 11 Individual MBV or 1 x 10⁶ per kg of body weight per dose 11 ~1 × 10 12 Individual MBV or 1 x 10⁶ per kg of body weight per dose 12 ~1 × 10 14 Individual MBV or 1 x 10⁶ per kg of body weight per dose 14 ~1 × 10 20 This is an individual MBV.
[0151] In some embodiments, administration is systemic. Exemplary routes of systemic administration include, but are not limited to, intravenous, oral, enteral, parenteral, intranasal, inhaled, tracheal, rectal, sublingual, buccal, vaginal, intraperitoneal, transdermal, transmucosal, or intramuscular administration.
[0152] In some embodiments, systemic administration includes intravenous administration. In some embodiments, intravenous administration includes systemic intravenous (IV) injection. In certain embodiments, IV includes bolus injection, continuous infusion, or pump injection. In some embodiments, systemic intravenous injection includes the use of a standard IV line or central line. In certain embodiments, a standard IV line is placed in a vein in the wrist, arm, or hand. In certain embodiments, the central line is selected from the group consisting of a peripherally inserted central catheter (PICC), subclavian line, internal jugular line, femoral line, tunnel catheter, or implantable port. In certain embodiments, patients with anticipated long-term treatment, i.e., patients requiring long-term hospitalization, such as patients with COVID-19, are placed in a central line for systemic intravenous injection.
[0153] In some embodiments, administration is, for example, local to the lungs. For example, administration is by inhalation via the nose and / or mouth. For example, administration is intratracheal. In patients with COVID-19, for example, intratracheal administration or inhalation via the nose and / or mouth may be used.
[0154] Inhalation administration can be mediated through the oral cavity and / or nasal cavity. In certain embodiments, inhalation is facilitated by aerosol administration of a pharmaceutical composition containing MBV. In some embodiments, inhalation includes the assistance of a nebulizer or inhaler (e.g., a metered-dose inhaler or a dry powder inhaler). In some embodiments, administration includes inhalation of a liquid mist. In some embodiments, administration is by inhalation of a solid form. In certain embodiments, the solid is nano-sized and is formulated in combination with nanoparticles, nanodiamonds or nanocarbons, or packaged in liposomes or liposome-based packages. In some embodiments, systemic administration includes intratracheal administration, also known as intratracheal drip infusion. In certain embodiments, systemic administration of MBV includes administration via an endotracheal tube for rapid administration to the lungs of subjects requiring it, e.g., subjects with severe ARDS, e.g., subjects with severe ARDS related to COVID-19.
[0155] For inhalation administration, MBV can be conveniently delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable atomizer, such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. In the case of pressurized aerosols, the dosage unit can be determined by providing a valve for delivering the measured amount. Capsules and cartridges for use in inhalers or insufflators can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch. Inhalation preparations may include aerosols, particulates, and others. Generally, the target particle size for inhalation is about 1 μm or less so that the drug can reach the alveolar region of the lungs for absorption. However, particle size can be modified to adjust the area of placement in the lungs. Thus, larger particles (diameter of about 1 to about 5 μm, etc.) can be used to achieve deposition in the respiratory bronchioles and air spaces.
[0156] Pharmaceutical compositions containing MBV as described herein as the active ingredient will typically be formulated with a suitable solid or liquid carrier depending on the chosen specific mode of administration. For example, pharmaceutically and physiologically acceptable fluid vehicles such as water, physiological saline, other equilibrium salt solutions, aqueous dextrose, glycerol, etc., can be used for injectable formulations or for spray or aerosolized formulations. Excipients that may be included are proteins such as human serum albumin or plasma preparations. If desired, the pharmaceutical composition to be administered may also contain small amounts of non-toxic adjuvants such as humectants or emulsifiers, preservatives and pH buffers, etc., such as sodium acetate or sorbitan monolaurate. Practical methods for preparing such dosage forms are known or will be apparent to those skilled in the art.
[0157] In some embodiments, pharmaceutical compositions containing MBV will be formulated in unit dosage forms suitable for individual administration of precise dosages. The amount of active compound(s) administered will depend on the subject being treated, the severity of the disease, and the mode of administration, and is best left to the discretion of the prescribing clinician. Within these limits, the formulation to be administered will contain an amount of active component(s) that is effective in achieving the desired effect in the subject being treated.
[0158] For example, one method of administration to an individual's lungs is by inhalation using a nebulizer or inhaler. For instance, MBV is formulated in aerosol or microparticle form and drawn into the lungs using a standard nebulizer well known to those skilled in the art.
[0159] The dosage is 1 × 10⁶ times the amount of body weight per dose. 6 ~1 × 10 12The delivery of a certain number of MBVs (i.e., the absolute number of vesicles) can be via a single dose schedule or multiple dose schedules. Administration can be provided as a single dose, as a periodic bolus, or as a sustained infusion, such as by sustained release over a specific period from a sustained-release drug or drug delivery device. A subject may be administered an appropriate number of doses. If multiple doses are administered, the administration may be intermittent. In exemplary embodiments, the administration of a therapeutically effective amount of MBV (systemic administration, e.g., intravenous administration or any other route of administration) can be done once, or repeatedly, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times. In exemplary embodiments, administration can be done once daily, twice daily, or every two days until the symptoms of ARDS subside. In other embodiments, only a single dose is required to achieve the therapeutic benefit.
[0160] Individual doses are typically greater than or equal to the amount required to produce a measurable effect in the subject and can be determined based on the pharmacokinetics and pharmacology of the absorption, distribution, metabolism and excretion ("ADME") of the composition or its by-products, and thus based on the arrangement of the composition within the subject. This includes consideration of the route of administration, as well as the amount of dosage that may be adjusted for topical and systemic (e.g., intravenous) application. Effective doses and / or dose regimens can be readily determined empirically from preclinical assays, safety and escalation and dose-range studies, individual clinician-patient relationships, and in vitro and in vivo assays. Generally, these assays will assess inflammatory disorders (such as encephalitis or atopic dermatitis).
[0161] A therapeutically effective amount of MBV can be suspended in a pharmaceutically acceptable carrier (e.g., in a pharmaceutical preparation) in an isotonic buffer solution with a pH of approximately 3.0 to approximately 8.0, preferably approximately 3.5 to approximately 7.4, 3.5 to 6.0, or 3.5 to approximately 5.0. Useful buffers include sodium citrate-citric acid, sodium phosphate-phosphate, and sodium acetate / acetic acid buffer. Other agents, such as preservatives and antibacterial agents, can be added to the composition. Such compositions can be administered topically, such as intravenously, or systemically.
[0162] Pharmaceutical preparations containing therapeutically effective amounts of MBV can be formulated in unit dosage forms suitable for individual administration of precise dosages. The amount of active compound(s) administered will depend on the patient being treated, the severity of the distress, and the mode of administration, and is best left to the discretion of the prescribing clinician. Within these limits, the preparation to be administered will contain an amount of active component(s) that is effective in achieving the desired effect in the patient being treated. In some embodiments, treatment with MBV results in a reduction or decrease of signs or symptoms of acute respiratory distress syndrome (ARDS) present at the time of administration.
[0163] In some cases, treatment with MBV can result in a reduction or decrease in inflammation in the subject compared to the level of inflammation before MBV administration. In some cases, treatment with MBV can result in a reduction or elimination of signs or symptoms of ARDS, such as ARDS associated with viral infections, such as COVID-19.
[0164] Combination therapy The MBV treatment method of the present invention can be used as monotherapy or in combination with one or more other treatments (e.g., anti-infective agents such as antivirals) that can be used to treat a disease or disorder, such as acute respiratory distress syndrome (ARDS) or an infection associated with ARDS. The term “combination” is understood, as used herein, to mean that two or more different treatments are delivered to a subject during the course of the subject’s suffering due to the disorder, such that the effects of the treatments on the patient overlap at some point in time. In certain embodiments, the delivery of one treatment is still occurring when the delivery of the second treatment begins, so that there is an overlap in terms of administration. This is sometimes referred to herein as “simultaneous” or “concurrent delivery.” In other embodiments, the delivery of one treatment is completed before the delivery of the other treatment begins. In certain embodiments of either case, the treatments are more effective due to the combined administration. For example, the second treatment is more effective, e.g., an equivalent effect is observed with less of the second treatment, or the second treatment reduces symptoms to a greater extent than would be observed if the second treatment were administered in the absence of the first treatment, or a similar situation is observed. In certain embodiments, the delivery is such that the reduction in symptoms or other parameters related to the disorder is greater than that observed with one treatment delivered in the absence of the other treatment. The effects of the two treatments can be partially additive, fully additive, or greater than additive. The delivery may be such that the effect of the delivered first treatment is still detectable when the second treatment is delivered.
[0165] The subject may be administered additional therapeutic agents in the same or different compositions or pharmaceutical preparations. In some embodiments, the subject has ARDS and is administered additional therapeutic agents such as nonsteroidal anti-inflammatory drugs (NSAIDs, e.g., aspirin, ibuprofen, and naproxen), antileukotrienes, immunoselective anti-inflammatory drug derivatives (ImSAIDs), bioactive compounds, steroids (corticosteroids, etc.), and opioids, etc.
[0166] Accordingly, in certain embodiments, the subject has received, is receiving, or is scheduled to receive one or more other treatments suitable for use in the treatment of a disease or disorder. In certain embodiments, the treatment method of the present invention further includes the step of administering one or more other treatments suitable for use in the treatment of a disease or disorder, for example, an infection, to the subject. In certain embodiments, one or more other treatments include agents that improve one or more symptoms of an infection caused by an intracellular pathogen. In certain embodiments, one or more other treatments include surgical removal of infected tissue.
[0167] It is understood that the uses disclosed herein can be used in combination with agents that improve one or more symptoms of a disease or disorder associated with intracellular pathogens, such as anti-infective agents. For example, the uses disclosed herein can be used in combination with antiviral agents.
[0168] Suitable treatments for infections caused by intracellular pathogens are generally known in the art and are outlined, for example, by Kamaruzzaman et al. (2017) Br. J. Pharmacol. 174(14): 2225-36 and De Clercq et al. (2016) Clin. Microbiol. Rev. 29(3): 695-747. In certain embodiments, anti-infective agents inhibit or reduce the viability, proliferation, infectivity, and / or virulence of intracellular pathogens. Intracellular pathogens can evade immune surveillance and challenge by remaining in a latent state. Therefore, in certain embodiments, anti-infective agents reverse the latent state of intracellular pathogens so that the infection can be recognized by the host's immune system.
[0169] In certain embodiments, the intracellular pathogen is a virus, and the anti-infective agent is an antiviral agent. Exemplary antiviral agents that can be used in combination include abacavir, acyclovir, adefovir, amprenavir, atazanavir, cidofovir, darunavir, delavirdin, didanosine, docosanol, efavirenz, elvitegravir, emtricitabine, enfuvirtide, entecavir, etravirine, famciclovir, favipiravir, foscarnet, homivirsen, ganciclovir, indinavir, idoxuridine, lamivudine, and lopinavir. This includes, but is not limited to, maraviroc, MK-2048, nelfinavir, nevirapine, penciclovir, raltegravir, rilpivirine, ritonavir, saquinavir, stabudine, tenofovir trifluridine, valacyclovir, valganciclovir, vidarabine, ivacitabine, amantadine, oseltamivir, rimantidine, tipranavir, zalcitabine, zanamivir, peramivir, danoprevir, remdesivir, and zidovudine. In particular, when the intracellular pathogen is HIV, exemplary anti-HIV agents that can be used in combination include nucleoside / nucleotide reverse transcriptase inhibitors (e.g., lamivudine, abacavir, zidovudine, stabudine, didanosine, emtricitabine, and tenofovir), non-nucleoside reverse transcriptase inhibitors (e.g., delavirudine, efavirenz, etravirine, and nevirapine), protease inhibitors (e.g., amprenavir, fosamprenavir, atazanavir, darunavir, indinavir, lopinavir, ritonavir, nelfinavir, saquinavir, and tipranavir), fusion or entry inhibitors (e.g., enfvirtide and maraviroc), integrase inhibitors (e.g., raltegravir and cabotegravir), and latency-reversing agents. The agent includes, but is not limited to, an HDAC inhibitor (e.g., vorinostat) and a TLR7 agonist (e.g., GS-9620, as described in U.S. Patent Publication No. US20160008374A1). In certain embodiments, the virus is SARS-CoV-2, and the combination therapy includes hydroxychloroquine.In certain embodiments, the virus is SARS-CoV-2, and the combination therapy includes an antiviral agent. In certain embodiments, the virus is SARS-CoV-2, and the combination therapy includes an antibacterial agent as a preventive measure against secondary infections.
[0170] In certain embodiments, the intracellular pathogen is a bacterium, and the anti-infective agent is an antibacterial agent. Exemplary antibacterial agents that can be used in combination include azithromycin, vancomycin, metronidazole, gentamicin, colistin, fidaxomicin, teravancin, oritabancin, dalbavancin, daptomycin, cephalexin, cefuroxime, cefadroxil, cefazolin, cephalothin, cefaclor, cephamandol, cefoxitin, cefprodil, ceftoviprole, cipro, levaquin, floxin, tequin, avelox, norflox, and tetras. This list includes, but is not limited to, iClean, minocycline, oxytetracycline, doxycycline, amoxicillin, ampicillin, penicillin V, dicloxacillin, carbenicillin, methicillin, ertapenem, doripenem, imipenem / cilastatin, meropenem, amikacin, kanamycin, neomycin, netylmycin, tobramycin, paromomycin, cefixime, cefdinir, cefditoren, cefoperazone, cefotaxime, ceftazidime, ceftibutene, ceftizoxime, ceftriaxone, cefoxotin, and streptomycin.
[0171] In certain embodiments, the intracellular pathogen is a fungus and the anti-infective agent is an antifungal agent. Exemplary antifungal agents that can be used in the combination include, but are not limited to, natamycin, rimocidin, filipin, nystatin, amphotericin B, candicin and hamycin, miconazole, ketoconazole, clotrimazole, econazole, omoconazole, bifonazole, butoconazole, fenticonazole, isoconazole, oxiconazole, sertaconazole, sulconazole, tioconazole, fluconazole, itraconazole, isavuconazole, ravuconazole, posaconazole, voriconazole, terconazole and albaconazole, abafungin, terbinafine, naftifine, butenafine, anidulafungin, caspofungin, micafungin, polygodial, benzoic acid, ciclopirox, tolnaftate, undecylenic acid, flucytosine or 5-fluorocytosine, griseofulvin and haloprogin.
[0172] In certain embodiments, the intracellular pathogen is a protozoan, and the antiinfective agent is an antiprotozoan agent. Exemplary antiprotozoan agents that can be used in combination include, but are not limited to, quinine (combined with clindamycin as needed), chloroquine, amodiaquine, artemisinin and its derivatives (e.g., artemether, artesunate, dihydroartemisinin, artetel), doxycycline, pyrimethamine, mefloquine, halofantrine, hydroxychloroquine, eflornithine, nitazoxanide, ornidazole, paromomycin, pentamidine, primaquine, pyrimethamine, proguanil (combined with atovaquone as needed), sulfonamides (e.g., sulfadoxine, sulfamethoxypyridazine), tafenoquine, and tinidazole. In specific embodiments, the intracellular pathogen is Plasmodium (e.g., P. vivax, P. falciparum, P. ovale, P. malariae), and the anti-infective agent is an antimalarial agent. Exemplary antimalarial agents that can be used in combination include, but are not limited to, quinine (combined with clindamycin as needed), chloroquine, amodiaquine, artemisinin and its derivatives (e.g., artemether, artesunate, dihydroartemisinin, arteether), doxycycline, halofantrine, mefloquine, primaquine, proguanil (combined with atovaquone as needed), sulfonamides (e.g., sulfadoxine, sulfamethoxypyridazine), and tafenoquine. These antimalarial agents can be used in combination with MBV to treat ARDS.
[0173] Additional classes of agents that can be used as part of combination therapies in the treatment of ARDS or hypercytokinemia associated with ARDS are anti-inflammatory agents and / or immunosuppressive agents, such as cytokine inhibitors, calcineurin inhibitors, mTOR inhibitors or steroids: In some embodiments, the anti-inflammatory agent includes a calcineurin inhibitor, such as tacrolimus and cyclosporine. In some embodiments, the anti-inflammatory agent includes an mTOR inhibitor, such as sirolimus. In some embodiments, the anti-inflammatory agent includes a steroid, such as prednisone. In some embodiments, the anti-inflammatory agent includes a cytokine inhibitor, such as an IL-6 antagonist, an IL-1 antagonist, a soluble tumor necrosis factor receptor, an IL-1 receptor agonist and a TGF-β1 latency associated peptide. In certain embodiments, the cytokine inhibitor includes tocilizumab, sarilumab, anakinra or siltuximab. In certain embodiments, the anti-inflammatory agent includes a Janus kinase (JAK) inhibitor, such as tofacitinib, ruxolitinib or baricitinib.
[0174] Appropriate therapies can be selected according to the diagnosis of specific infections. If the subject is infected with multiple pathogens (e.g., multiple intracellular pathogens, e.g., multiple viral infections, e.g., SARS-CoV2 and secondary infections), two or more appropriate therapies for treating these infections can be used in combination with the MBV therapy disclosed herein.
[0175] In one embodiment, the composition of the invention is used as part of a combination therapy with an antibody therapy against SARS-CoV2, such as bamlanivimab, etesevimab, casirivimab or imdevimab or combinations thereof.
[0176] In some embodiments, the method includes a step of detecting that a therapeutic benefit has been achieved. Measures of therapeutic effectiveness may be applicable to specific diseases being modified, and those skilled in the art will recognize appropriate detection methods for use in measuring therapeutic effectiveness. A subject may be evaluated for response using any method known in the art. In an exemplary embodiment, a subject has an inflammatory disorder (such as encephalitis or atopic dermatitis), and the therapeutic response in the subject can be measured by white blood cell count, polymorphonuclear neutrophil (PMN) count, degree of PMN activation (such as luminol-enhanced chemiluminescence), cytokine levels, C-reactive protein, and other measures known in the art.
[0177] term The following explanations of terms and methods are provided to better represent the disclosure and to guide those skilled in the art in the practice of the disclosure. The singular forms “a,” “an,” and “the” refer to one or more than one unless the context clearly indicates otherwise. For example, the term “a cell” refers to one or more cells and is equivalent to the phrase “at least one cell.” The term “or / or” refers to a single element from a combination of two or more elements described, or an alternative element described, unless the context clearly indicates otherwise. As used herein, “comprises” means “includes.” Thus, “comprising A or B” means “including A, B, or A and B,” without excluding any additional elements. The dates of the GENBANK® accession numbers referenced herein are sequences available as of at least September 16, 2015. All references, patent applications and publications and GENBANK® accession numbers cited herein are incorporated herein by reference. Unless otherwise indicated, “about” refers to within 5 percent. To facilitate an overview of the various embodiments of this disclosure, the following explanations of specific terms are given:
[0178] Acute Respiratory Distress Syndrome (ARDS): Acute respiratory distress syndrome, or "ARDS," refers to a type of respiratory failure characterized by the rapid onset of widespread inflammation in the lungs, with severe hypoxemia being a characteristic symptom. Signs and symptoms usually occur within hours of the causative event, but can occur within days or up to a week. In ARDS, fluid leaks from the smallest blood vessels in the lungs into the alveoli. In normal physiology, the alveolar capillary membrane protects the lungs from such fluid. However, in cases of severe lung and / or systemic injury to the alveolar capillary membrane, the membrane becomes impaired, which can lead to ARDS. In certain embodiments, ARDS is associated with lung infection.
[0179] Symptoms of ARDS can include, but are not limited to, shortness of breath, rapid breathing, decreased blood oxygenation, headache, hypotension, fever, cough, confusion, extreme fatigue, and discolored skin and / or nails due to hypoxemia. ARDS impairs the lungs' ability to exchange oxygen and carbon dioxide. Chest X-rays of ARDS patients reveal bilateral infiltration in the lungs, for example, by widespread "ground-glass" appearance in both lungs. From a diagnostic standpoint, according to the Berlin criteria, ARDS is diagnosed when PaO2 / FiO2 (the ratio of partial pressure of arterial oxygen to the fraction of inspired oxygen) is less than 300 mm Hg despite positive end-expiratory pressure ventilation (PEEP) of more than 5 cm H2O. In mild cases, PaO2 / FiO2 is greater than 200 mg Hg and less than 300 mg. In moderate cases, PaO2 / FiO2 is greater than 100 mg Hg and less than 200 mg. In severe cases, PaO2 / FiO2 is less than 100 mm Hg. Primary treatment involves oxygen administration and / or mechanical ventilation.
[0180] Administration: Introduction of the composition (MBV or a pharmaceutical preparation containing MBV, etc.) to the target via a selected route. The route may be local or systemic. For example, if the selected route is intravenous, the composition is administered by introducing the composition into the target's vein. If the selected route is local, the composition can be administered by directly introducing the composition into the target tissue.
[0181] Animals: A category of living, multicellular, vertebrate organisms, including, for example, mammals and birds. The term "mammal" includes both human and non-human mammals. Similarly, the term "subject" includes both human and veterinary subjects.
[0182] Arthritis: Arthritis is an inflammatory disease affecting the synovial membrane of one or more joints in the body. It is the most common type of joint disease and is characterized by inflammation of the joints. The disease is usually oligoarticular (affecting only a few joints), but can also be generalized. Joints commonly involved include the hip, knee, lower lumbar and cervical vertebrae, proximal and distal interphalangeal joints of the fingers, the first carpometacarpal joint, and the first tarsometatarsal joint of the foot. Symptoms include joint pain and stiffness, redness, warmth, swelling, and reduced range of motion in the affected joints. In some embodiments, arthritis can be treated using the compositions and methods disclosed herein. Types of arthritis include, but are not limited to, rheumatoid arthritis and psoriatic arthritis.
[0183] Biocompatibility: Any material that, when implanted in a mammalian subject, does not cause a harmful response in the subject. Biocompatible materials, when introduced into an organism, can perform their intended function, are neither toxic nor harmful to the organism, and do not induce immunological rejection of the material in the subject.
[0184] Concentrated: This refers to a process in which the ratio of the amount of a desired component, such as nanovesicles, present in the mixture to the amount of other undesirable components increases after the concentration process compared to before the concentration process.
[0185] Extracellular matrix (ECM): A complex mixture of structural and functional biomolecules and / or biomacromolecules, including but not limited to structural proteins, specialized proteins, proteoglycans, glycosaminoglycans, and growth factors, that surround and support cells within tissues and, unless otherwise directed, are cell-free. ECM preparations can be considered “decellularized” or “cell-free,” meaning that cells have been removed from the source tissue by processes described herein and known in the art. “ECM-derived materials,” such as “ECM-derived nanovesicles,” “matrix-bound nanovesicles,” “MBVs,” or “ECM-derived nanovesicles,” are nanovesicles prepared from natural ECM or from in vitro sources in which ECM is produced by cultured cells. ECM-derived nanovesicles are defined below.
[0186] Hypercytokineemia, or "cytokine release syndrome": Also known in the art as "cytokine storm" or "cytokine storm syndrome," is an acute hyperreaction of the immune system; such an immune response is a systemic inflammatory response syndrome that can result from infectious diseases or disorders. Hypercytokineemia occurs when, in the positive feedback loop of pathogenic inflammation, a large number of leukocytes are activated and release inflammatory cytokines, which in turn activate even more leukocytes. In addition, pro-inflammatory cytokines that bind to their homologous receptors on immune cells lead to further activation and stimulation of cytokine production. Hypercytokineemia pathology can begin locally and be associated with inflammation that spreads throughout the body, for example, via the systemic circulation, and can lead to multiple organ failure. Hypercytokineemia pathology resulting from viral infections is associated with acute lung injury and acute respiratory distress syndrome. Hypercytokineemia pathology is described, for example, in Tisonick et al., (2012) "Into the Eye of the Cytokine Storm," Microbiol. Mol. Biol. Rev., 76(1):16-32. The cytokines released in excess may include, but are not limited to, IL-6, IFN-γ, IL-8 (CXCL8), IL-10, GM-CSF, MIP-1α / β, MCP-1 (CCL2), CXCL9, and CXCL10.
[0187] Infection refers to the invasion and proliferation of a pathogen, such as a virus, bacteria, fungus, or protozoan, that is not normally present in a host, such as a patient, or is not normally present in a specific location within the host, but invades another location within the host (for example, a pathogen normally present in the gastrointestinal tract entering the urinary tract, or a pathogen normally present on the skin surface entering the bloodstream). Infection may be asymptomatic, without causing symptoms, or it may be symptomatic and clinically apparent. Infection may remain localized, or it may be systemic, for example, transmitted through blood vessels or lymphatic vessels.
[0188] Inflammation: Inflammation is a localized defense response triggered by tissue injury, working to sequester inflammatory factors. Inflammation is organized by a complex biological response of vascular tissue to harmful stimuli, such as pathogens, damaged cells, or irritants. It is a defensive attempt by the organism to remove the damaging stimulus and trigger a healing process for the tissue. The inflammatory response is characterized by the accumulation of leukocytes, either systemically or locally at the site of inflammation. The inflammatory response can be measured by many methods, including but not limited to measuring the number of leukocytes, the number of polymorphonuclear neutrophils (PMNs), measures of PMN activation such as luminol-enhanced chemiluminescence, or measures of the amount of cytokines present. C-reactive protein is a marker of the systemic inflammatory response.
[0189] Inflammatory disorders are a group of disorders in which inflammation disrupts normal or typical physiological functions. Inflammatory disorders can include a variety of conditions, such as autoimmune disorders (inappropriate inflammatory responses to endogenous antigens) and disorders resulting from inflammation caused by trauma or exogenous antigens. Primary inflammatory disorders are diseases or disorders caused by inflammation itself. Secondary inflammatory disorders are inflammation that results from another disorder. Inflammation can lead to inflammatory disorders, such as acute respiratory distress syndrome (ARDS).
[0190] In some embodiments, anti-inflammatory agents are administered to treat inflammatory diseases or disorders, such as ARDS. Anti-inflammatory agents include, but are not limited to, non-steroidal anti-inflammatory drugs (NSAIDs, e.g., aspirin, ibuprofen, and naproxen), anti-leukotriene agents, immunoselective anti-inflammatory drug derivatives (ImSAIDs), bioactive compounds, steroids (such as corticosteroids), and opioids.
[0191] Influenza: Influenza (also known as "flu") is an infectious disease caused by the influenza virus. Three types of influenza viruses can infect humans: types A, B, and C; type D has not been shown to infect humans. Influenza viruses are highly contagious; in non-limited cases, influenza viruses are transmitted through air-in droplets from the coughs or sneezes of infected individuals. Influenza spreads globally in annual pandemics, resulting in approximately 3 to 5 million cases of severe illness and approximately 290,000 to 650,000 deaths ("Influenza (Seasonal)". World Health Organization (WHO). 6 November 2018). The World Health Organization (WHO) recommends annual influenza vaccination for high-risk individuals. Larger global pandemics of virulent influenza strains can occur, for example, the 1918 Spanish flu (resulting in 17 to 100 million deaths), the 1957 Asian flu (resulting in 2 million deaths), and the 1968 Hong Kong flu (resulting in 1 million deaths). In June 2009, the WHO declared a new outbreak of influenza A, H1N1 (also known as "swine flu") a pandemic (Chan M. (2009). "World now at the start of 2009 influenza pandemic". World Health Organization (WHO). Archived from the original on 12 June 2009). Symptoms of influenza infection include, but are not limited to, fever, runny nose, pharyngitis, muscle and joint pain, headache, cough, and fatigue. In certain embodiments, influenza is associated with viral pneumonia. In certain embodiments, influenza is associated with secondary bacterial pneumonia.
[0192] Isolated: “Isolated” biological components (such as nucleic acids, proteins, cells, or nanovesicles) are substantially separated or purified from cells of organisms in which they naturally occur or from other biological components in the ECM. “Isolated” nucleic acids and proteins include nucleic acids and proteins purified by standard purification methods. Isolated MBVs are those removed from fibrous material in the ECM. This term also includes nucleic acids and proteins prepared by recombinant expression in host cells, as well as chemically synthesized nucleic acids.
[0193] Lysyl oxidase (Lox): A copper-dependent enzyme that catalyzes the formation of aldehydes from lysine residues in collagen and elastin precursors. These aldehydes are highly reactive and spontaneously react with aldehyde residues derived from other lysyl oxidases or with unmodified lysine residues. In vivo, this reaction results in crosslinking of collagen and elastin, which plays a role in the stabilization of collagen fibrils and in the integrity and elasticity of mature elastin. Complex crosslinks are formed in collagen (pyridinoline derived from three lysine residues) and elastin (desmosine derived from four lysine residues), and these differ in structure. Genes encoding the Lox enzyme have been cloned from various organisms (Hamalainen et al., Genomics 11:508, 1991; Trackman et al., Biochemistry 29:4863, 1990; incorporated herein by reference). It has been shown that residues 153-417 and 201-417 of the human lysyl oxidase sequence are important for catalytic function. There are four Lox-like isoforms called LoxL1, LoxL2, LoxL3, and LoxL4.
[0194] Macrophages: A type of white blood cell that phagocytizes and decomposes cellular debris, foreign substances, microorganisms, and cancer cells. In addition to its role in phagocytosis, such cells play an important role in both innate and adaptive immunity in terms of development, tissue maintenance and repair, and mobilizing and influencing other cells including immune cells such as lymphocytes. Macrophages can exist in many phenotypes, including phenotypes referred to as M1 and M2. Macrophages that mainly perform pro-inflammatory functions are called M1 macrophages (CD86 + / CD68 + ), while macrophages that reduce inflammation, promote and regulate tissue repair are called M2 macrophages (CD206 + / CD68 + ). Markers for identifying the various phenotypes of macrophages vary between species. Note that macrophage phenotypes are represented by a spectrum that ranges between the two extremes of M1 and M2. F4 / 80 (encoded by the adhesion-type G protein-coupled receptor E1 (ADGRE1) gene) is a macrophage marker. See GENBANK (registered trademark) accession numbers NP_001243181.1, April 6, 2018, and NP_001965, March 5, 2018, both of which are incorporated herein by reference. Without wishing to be bound by theory, it is believed that MBV has the ability to modulate the phenotype of macrophages, resulting in an increase in M2-like, regulatory or remodeling-promoting macrophages. The effect of MBV in macrophages is further characterized in WO2017 / 151862A1, which is incorporated herein by reference in its entirety. In some embodiments, the MBV of the present invention can be used to induce the M2 phenotype in macrophages and inhibit M1 macrophages in a subject.
[0195] MicroRNAs are small, non-coding RNAs, approximately 17 to 25 nucleotides in length, that post-transcriptionally regulate gene expression by typically repressing target mRNA translation. miRNAs can function as negative regulators, such that higher levels of specific miRNA correlate with lower levels of target gene expression. There are three forms of miRNA: primary miRNA (pri-miRNA), immature miRNA (pre-miRNA), and mature miRNA. Primary miRNA (pri-miRNA) is expressed as a stem-loop transcript of approximately several hundred nucleotides to over 1 kb. Pri-miRNA transcripts are cleaved in the nucleus by an RNase II endonuclease called drochae, which cleaves both strands of the stem near the base of the stem-loop. Drochae cleaves the RNA double helix in a staggered cut, leaving a 5' phosphate and a 2-nucleotide overhang at the 3' end. The cleavage product, immature miRNA (pre-miRNA), is approximately 60–110 nucleotides long and has a hairpin structure formed in a fold-back manner. Pre-miRNA is transported from the nucleus to the cytoplasm by Ran-GTP and exportin-5. In the cytoplasm, pre-miRNA is further processed by another RNase II endonuclease called Dicer. Dicer recognizes the 5' phosphate and 3' overhang and cleaves the loop from the stem-loop junction to form a miRNA double helix. The miRNA double helix binds to the RNA-induced silencing complex (RISC), where the antisense strand is preferentially degraded, and the sense strand mature miRNA directs the RISC to its target site. This is the biologically active form of miRNA, mature miRNA, which is approximately 17–25 nucleotides long.
[0196] Nanovesicles: Extracellular vesicles are nanoparticles with a diameter of approximately 10 to 1,000 nm. Nanovesicles are lipid membrane-bound particles that carry several molecules, among others, biologically active signaling molecules (e.g., microRNAs, proteins). Generally, nanovesicles are confined by a lipid bilayer, and biological molecules can be encapsulated and / or embedded within the bilayer. Thus, nanovesicles contain a lumen surrounded by a plasma membrane. Different types of vesicles can be distinguished based on their diameter, subcellular origin, density, shape, sedimentation rate, lipid composition, protein markers, nucleic acid content, and origin, such as extracellular matrix origin or secreted. Nanovesicles can be identified by their origin (see above), protein content, and / or miR content, such as matrix-bound nanovesicles derived from the extracellular matrix.
[0197] Exosomes, or liquid-phase extracellular vesicles (EVs), are membranous vesicles secreted by cells, ranging in diameter from 10 to 150 nm. Generally, late endosomes or polyvesicles contain intralumenal vesicles formed by the inward budding and fragmentation of vesicles from a limited endosomal membrane into such enclosed vesicles. These intralumenal vesicles are then released from the polyvesicle coelom into the extracellular environment, typically into bodily fluids such as blood, cerebrospinal fluid, or saliva, during exocytosis after fusion with the plasma membrane. When membrane segments invaginate and endocytosis occurs, exosomes are created within the cell. The internally translocated segments, which are broken down into smaller vesicles and eventually expelled from the cell, contain proteins as well as RNA molecules such as mRNA and miRNA. Plasma-derived exosomes largely lack ribosomal RNA. Extracellular matrix-derived exosomes contain specific miRNAs and protein components and have been shown to be present in virtually all bodily fluids, including blood, urine, saliva, semen, and cerebrospinal fluid. Exosomes can express CD11c, CD63, CD81, and / or CD9, and therefore CD11c + and / or CD63 + and / or C81 +and / or CD9 + This is possible. Exosomes do not have high levels of lysyl oxidase on their surface.
[0198] "ECM-derived nanovesicles," "matrix-bound nanovesicles," "MBVs," or "ECM-derived nanovesicles" all refer to the same membrane-bound particles, ranging in size from 10 nm to 1000 nm, present in the extracellular matrix and containing biologically active signaling molecules such as proteins, lipids, nucleic acids, growth factors, and cytokines that influence cellular behavior. These terms are interchangeable and refer to the same vesicles. Such nanovesicles are embedded in and bound to the ECM, and are not simply attached to the surface or freely circulating in body fluids. Such nanovesicles are resistant to harsh isolation conditions, including freeze-thaw cycles, digestion by proteases such as pepsin, elastase, hyaluronidase, proteinase K, and collagenase, and digestion by surfactants. MBVs are distinct from other extracellular vesicles, including exosomes, and have a distinct phospholipid composition. In certain circumstances, MBVs can also be distinguished from exosomes based on the absence of certain markers commonly associated with exosomes. MBVs are also distinct from bone matrix vesicles that express alkaline phosphatase and are involved in bone formation and calcification. MBVs do not express alkaline phosphatase.
[0199] In some embodiments, MBV is characterized by one or more of the following features of protein expression or lipid content: (i) MBVs are unable to express one or more of CD63 and / or CD81 and / or CD9, or have low or barely detectable levels of CD63 and / or CD81 and / or CD9 compared to other vesicles such as exosomes (CD63 lo and / or CD81 lo and / or CD9 lo(See, for example, Example 1) (See also Example 17 and Figure 24). Various methods, such as antibody-based methods including Western blotting or flow cytometry, can be used to distinguish between low, barely detectable, or no expression of CD63 and / or CD81 and / or CD9 in MBV (see, for example, Bashashati and Brinkman, Adv Bioinformatics, 2009: 584603). In some embodiments, if the expression of CD63 and / or CD81 and / or CD9 in MBV is at least one standard deviation or at least two standard deviations lower than the mean expression of other vesicles such as exosomes, then the MBV expression of CD63 and / or CD81 and / or CD9 is considered low or barely detectable compared to other vesicles; (ii) MBV has a phospholipid content in which at least 55% of the total phospholipids consist of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (iii) MBV has a phospholipid content in which 10% or less of the total phospholipids are sphingomyelin (SM); (iv) MBV has a phospholipid content in which 20% or less of the total phospholipids are phosphatidylethanolamine (PE); (v) MBV has a phospholipid content in which phosphatidylinositol (PI) accounts for 15% or more of the total phospholipid content, and the percentage represents the percentage of lipid concentration.
[0200] In some embodiments, the MBV is characterized by all of the following features: (i) Not expressing one or more of CD63 and / or CD81 and / or CD9, or having low or barely detectable levels of CD63 and / or CD81 and / or CD9 (CD63 lo and / or CD81 lo and / or CD9 lo (As further described above); (ii) Phospholipid content in which at least 55% of the total phospholipids consist of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (iii) Phospholipid content in which sphingomyelin (SM) is present in 10% or less of the total phospholipids; (iv) Phospholipid content in which 20% or less of the total phospholipids are phosphatidylethanolamine (PE); and (v) Phospholipid content in which phosphatidylinositol (PI) accounts for 15% or more of the total phospholipid content.
[0201] In some embodiments, the MBV is characterized by all of the following features: (i) Phospholipid content in which at least 55% of the total phospholipids consist of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (ii) Phospholipid content in which sphingomyelin (SM) is present in 10% or less of the total phospholipids; (iii) Phospholipid content in which 20% or less of the total phospholipids contain phosphatidylethanolamine (PE); and (iv) Phospholipid content in which phosphatidylinositol (PI) accounts for 15% or more of the total phospholipid content.
[0202] In some embodiments, the MBV is characterized by one or more of the following features: (i) Phospholipid content in which at least 55% of the total phospholipids consist of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (ii) Phospholipid content in which sphingomyelin (SM) is present in 10% or less of the total phospholipids; (iii) Phospholipid content in which 20% or less of the total phospholipids contain phosphatidylethanolamine (PE); and (iv) Phospholipid content in which phosphatidylinositol (PI) accounts for 15% or more of the total phospholipid content.
[0203] The ECM from which MBV is isolated can be tissue-derived, can be produced from cells in culture, or can be purchased from a commercial source.
[0204] In some embodiments, the MBV is characterized by one or more of the following features: (i) Does not contain detectable levels of alkaline phosphatase; (ii) Does not contain detectable levels of osteopontin; (iii) Does not contain detectable levels of osteoprotegerin; (iv) Does not contain detectable levels of complement C5; and / or (v) Does not contain detectable levels of c-reactive protein.
[0205] In some embodiments, the MBV is characterized by one or more of the following features: (i) Contains EpCAM at a low level or does not contain it at a detectable level. (ii) Contains ANXA5 at a low level or does not contain it at a detectable level. (iii) Contains TSG101 at a low level or does not contain it at a detectable level; (iv) Contains FLOT1 at a low level or does not contain it at a detectable level; (v) Contains ICAM1 at a low level or does not contain it at a detectable level; (vi) Contains GM130 at a low level or does not contain it at a detectable level; and / or (vii) Contains ALIX at a low level or does not contain it at a detectable level. In one embodiment, the MBV is characterized by low or undetectable levels of ANXA5, TSG101, and ICAM1. In one embodiment, the MBV is characterized by low or undetectable levels of CD81, CD63, ANXA5, TSG101, and ICAM1.
[0206] Oxygen Saturation Index (OSI): The oxygen saturation index is a non-invasive substitute for the oxygen index (OI), calculated using the specific oxygen level (SpO2). OSI = (FiO2 × mean airway pressure × 100) / SpO2. SpO2 (oxygen saturation) can be measured non-invasively, for example by pulse oximetry, and is a measure of the fraction of oxygen-saturated hemoglobin to total hemoglobin (unsaturated and saturated) in the blood.
[0207] Oxygen Index (OI): Oxygen Index = (FiO2 × mean airway pressure × 100) / PaO2. Unlike OSI, it requires invasive arterial blood gas measurement.
[0208] Pharmacopoecitable carriers: Pharmacopoecitable carriers useful in the claimed pharmaceutical preparations are conventional. Remington's Pharmaceutical Sciences, by EW Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975) describes compositions and formulations suitable for the pharmaceutically effective delivery of the fusion proteins disclosed herein.
[0209] Generally, the properties of the carrier will depend on the specific mode of administration used. For example, parenteral formulations typically contain an injectable fluid as a vehicle, which may include pharmaceutically and physiologically acceptable fluids such as water, saline, equilibrium salt solutions, aqueous dextrose, glycerol, etc. For solid compositions (e.g., in powder, pill, tablet, or capsule form), conventional non-toxic solid carriers may include, for example, pharmaceutical-grade mannitol, lactose, starch, or magnesium stearate. In addition to a biologically neutral carrier, the pharmaceutical preparation to be administered may contain small amounts of non-toxic auxiliary substances, such as humectants or emulsifiers, preservatives, and pH buffers, for example, sodium acetate or sorbitan monolaurate.
[0210] Pharmaceutical agent: A compound or composition that, when appropriately administered to a target or cell, can induce a desired therapeutic or prophylactic effect.
[0211] Phospholipids are a class of lipids having a structure consisting of two hydrophobic fatty acid tails and a hydrophilic head consisting of a phosphate group. Major classes of phospholipids include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), phosphatidylserine (PS), phosphatidylglycerol (PG), sphingomyelin (SM), cardiolipin (CL), phosphatidic acid (PA), and bis-monoacylglycerol phosphate (BMP). Phospholipids can be measured in various ways. For example, comprehensive lipidomics and redox lipidomics based on LC-MS can be used. In some embodiments, specific phospholipid content is indicated as a percentage concentration of total phospholipids (e.g., total phospholipids in MBV), and the percentage concentration is weight / weight.
[0212] Pneumonia: An infection that causes inflammation of the alveoli (air sacs) in one or both lungs. In some embodiments, the lungs are filled with fluid or pus. In some embodiments, pneumonia is associated with viral infections, e.g., coronaviruses (e.g., SARS-CoV2, SARS-CoV, MERS-CoV), e.g., influenza viruses (e.g., influenza A), e.g., Ebola virus. In some embodiments, pneumonia is associated with bacterial infections, e.g., Streptococcus pneumoniae. In some embodiments, pneumonia is associated with fungal infections, e.g., Pneumocystis jirovecii. In some embodiments, pneumonia is a secondary infection, i.e., a patient with a pre-existing infection (e.g., COVID-19) develops pneumonia. In some embodiments, pneumonia is due to hospital-acquired infection. In some embodiments, pneumonia is due to community-acquired infection. Symptoms of pneumonia include, but are not limited to, cough, fever, rapid breathing, shortness of breath, chest pain, and fatigue. In certain embodiments, pneumonia is associated with ARDS.
[0213] Polynucleotides are nucleic acid sequences of any length (such as linear sequences). Therefore, polynucleotides include oligonucleotides and gene sequences found in chromosomes. An "oligonucleotide" is a series of linked nucleotides connected by native phosphodiester bonds. Oligonucleotides are polynucleotides with a length between 6 and 300 nucleotides. Oligonucleotide analogs refer to parts that function similarly to oligonucleotides but have parts that do not exist in nature. For example, oligonucleotide analogs may contain parts that do not exist in nature, such as phosphorothioate oligodeoxynucleotides, modified sugar moieties, or inter-sugar linkages. Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA and may include peptide nucleic acid (PNA) molecules.
[0214] Preventive: As used herein, refers to a drug therapy or treatment designed and used to prevent the occurrence of a disease or disorder. As used herein, the terms “preventive” and “prevention” are used interchangeably.
[0215] Purified: The term "purified" does not require absolute purity; rather, it is intended as a relative term. Therefore, for example, a purified nucleic acid molecular preparation is a preparation in which the referenced nucleic acid is purer than the nucleic acid in its natural environment within the cell. For example, a nucleic acid preparation is purified so that the nucleic acid makes up at least 50% of the total protein content of the preparation. Similarly, a purified MBV preparation is a preparation in which the exosomes are purer than those in the environment containing the cell in which the microvesicles and exosomes reside. Purified populations of nucleic acids or MBVs are purer than approximately 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or do not contain other nucleic acids or cellular components, respectively.
[0216] Preventing or treating a disease: “Preventing” a disease refers to, for example, inhibiting the onset of a disease in a person known to be predisposed to the disease. Examples of a person known to be predisposed include someone with a family history of the disease or someone who has been exposed to factors that make them susceptible to a certain condition. “Treatment” refers to a therapeutic intervention that improves the signs or symptoms of a disease or pathological condition after the onset of symptoms.
[0217] SARS-CoV-2, also known in the art as 2019-novel coronavirus or 2019-nCoV, or severe acute respiratory syndrome-coronavirus 2 (SARS-CoV-2), is a novel coronavirus that originated in Wuhan, China, in late 2019 and is the cause of the 2020 global pandemic. The disease caused by SARS-CoV-2 is called coronavirus disease 2019 or COVID-19. COVID-19 causes a variety of symptoms, including cough, fever, fatigue, body aches, and shortness of breath. Patients with severe COVID-19 may experience acute respiratory distress syndrome and require mechanical ventilation.
[0218] Sepsis: Sepsis is a disorder that can occur when cytokines and chemokines released into the bloodstream (e.g., to fight infection, e.g., intracellular pathogens or viruses) cause systemic inflammation throughout the body. Sepsis can result in widespread organ damage, organ failure, and death. Symptoms of sepsis include, but are not limited to, an elevated heart rate, confusion or disorientation, extreme pain or discomfort, fever, and shortness of breath. In some embodiments, sepsis is associated with ARDS. In some embodiments, sepsis is associated with hypercytokinemia.
[0219] Subjects: Humans and non-human animals, including all vertebrates such as non-human primates, mice, rabbits, sheep, dogs, cats, horses, cattle, chickens, amphibians and reptiles, mammals and non-mammals, etc. In many embodiments of the methods described, the subjects are humans. The term "subject" is used interchangeably with the term "patient". A subject may be an individual diagnosed with a disease or disorder, e.g., an infectious disease or disorder (e.g., an immunocompromised individual, a healthcare worker), a person diagnosed with a disease or disorder, e.g., an infectious disease or disorder, a person who has previously suffered from a disease or disorder, e.g., an infectious disease or disorder, or an individual evaluated for symptoms or signs of a disease or disorder, e.g., an infectious disease or disorder.
[0220] Therapeutic effective dose: The amount of a specific substance, such as MBV, sufficient to achieve the desired effect in the treated subject. When administered to a subject, the dosage that will achieve the target tissue concentration (e.g., in the lungs) that has been shown to achieve the desired in vitro effect will generally be used.
[0221] Total phospholipid content: When used herein in relation to MBV, "total phospholipids" or "total phospholipid content" refers to the sum of all phospholipids present in isolated MBV, i.e., MBV isolated from ECM, at a given content. MBV can be isolated, for example, by enzymatic digestion and fractional centrifugation of decellularized ECM. Total phospholipid content can be determined by methods such as comprehensive lipidomics and redox lipidomics based on LC-MS. Total phospholipid content is measured by weight. The percentage of total phospholipid content refers to the percentage concentration on a weight / weight basis.
[0222] Transplantation: The placement of biocompatible materials such as MBV into the target that requires it.
[0223] Treatment, treatment and treatment: success or signs of success in any of the following, including any objective or subjective parameters such as relief, improvement, reduction of symptoms, etc., in reducing or improving an injury, pathology or condition, making the condition more tolerable for the patient, slowing the rate of degeneration or decline, mitigating the final stage of degeneration, or improving the physical or mental well-being of the subject. Treatment may be evaluated by objective or subjective parameters, including the results of a physical examination, neurological examination or psychiatric evaluation.
[0224] Unless otherwise specified, technical terms will be used according to their conventional usage. Definitions of common terms in molecular biology can be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
[0225] The foregoing describes several aspects and embodiments of the present invention. This patent application particularly intends for any combination and rearrangement of these aspects and embodiments. [Examples]
[0226] While the disclosure is described in general terms herein, it will be more readily understood by referring to the following examples, which are included solely for the purpose of illustrating certain aspects and embodiments of the disclosure and are not intended in any way to limit the scope of the disclosure.
[0227] (Example 1) Identification of matrix-bound vesicles (MBVs) and extracellular vesicles (EVs) by lipidomics and RNA sequencing. Matrix-bound nanovesicles (MBVs) have been reported as endogenous components of ECM bioscaffolds. Liquid-phase extracellular vesicles (EVs) have been the subject of intensive study, but their similarity to MBVs is limited to size and shape. This example provides a detailed comparison of liquid-phase EVs and MBV phospholipids using LC-MS-based lipidomics and redox lipidomics. Combined with comprehensive RNA sequencing and bioinformatics analysis of intravesicular cargo, this example demonstrates that MBVs are a distinct and unique subpopulation of EVs and highlights the outstanding characteristics of ECM-based biomaterials.
[0228] This embodiment identifies similarities and differences between the liquid phase (i.e., exosomes) and matrix-bound morphology (i.e., MBVs) of EVs. However, given that EVs present in biological fluids, as well as MBVs present in native tissue ECM and ECM-based biomaterials, represent heterogeneous populations secreted from multiple cellular sources, direct comparative in vivo analysis of these putative EV populations presents problems. As an alternative to using vesicles derived from body fluids or tissues, ECM and conditioned media produced in vitro by cultured cells can be isolated (Fitzpatrick et al., Biomater Sci., 3, 12-24 (2015)). This approach offers several advantages, including the use of a single cell type source (thus eliminating any doubt regarding vesicle origin); the ability to selectively collect vesicles from either liquid-phase or solid-phase compartments; and the ability to control the cell culture environment, and thus control vesicle composition and cargo as well.
[0229] material and method Preparation of in vitro cell-derived ECM: Human bone marrow stem cells (BMSCs), human adipose-derived stem cells (ASCs), and human umbilical cord stem cells (UCSCs) ECM plates were provided by StemBioSys (San Antonio, Texas) and prepared according to the published protocol (Lai et al., Stem cells and development 19, 1095-1107 (2010)). Briefly, human BMSCs, human ASCs, or human UCSCs were prepared at a density of 3,500 cells / cm³. 2 At this cell density, 75 cm³ of cells coated with human fibronectin (at 37°C for 1 hour) 2 Cells were seeded in culture flasks and cultured for 14 days in α-MEM medium supplemented with 20% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The medium was replaced the day after initial seeding, and then every 3 days thereafter. On day 7, ascorbic acid 2-phosphate (Sigma Aldrich) was added to the medium at a final concentration of 50 μM. On day 14, the plates were decellularized using 0.5% Triton in 20 mM ammonium hydroxide for 5 minutes, and rinsed twice with Hanks equilibrium salt solution (HBSS+ / +) containing both calcium and magnesium, and once with ultra-high purity H2O. Mouse NIH 3T3 fibroblasts were cultured at a density of 3,500 cells / cm². 2 At a cell density of 75 cm² 2 Cell cultures were seeded in cell culture flasks and cultured for 7 days in DMEM medium supplemented with exosome-depleted FBS (GV Shelke, et al, Journal of extracellular vesicles 3, 24783 (2014)), 1% penicillin-streptomycin, and a final concentration of 50 μM ascorbic acid 2-phosphate (Sigma Aldrich). On day 7, supernatant from the cultured 3T3 fibroblasts was collected, the plated cultures were washed three times with PBS, decellularized using 0.5% Triton in 20 mM ammonium hydroxide for 5 minutes, and then rinsed three times with ultra-high purity H2O.
[0230] Isolation of MBV and liquid-phase EV: MBV was isolated (L. Huleihel et al., Science advances 2, e1600502 (2016)). Briefly, decellularized ECM was enzymatically digested with 100 ng / ml liberase DL (Roche) in buffer (50 mM Tris pH 7.5, 5 mM CaCl2, 150 mM NaCl) at 37°C for 1 hour. Cell culture supernatant containing liquid-phase EV and digested ECM containing MBV were subjected to fractional centrifugation at 500 g (10 mins), 2500 g (20 mins), and 10,000 g (30 mins), and the supernatant was passed through a 0.22 μm filter (Millipore). Next, the clarified supernatant containing the free MBV or liquid-phase EV was centrifuged at 100,000 × g (Beckman Coulter Optima L-90K ultracentrifuge) at 4°C for 70 minutes to pelletize the vesicles. The vesicle pellets were then washed and resuspended in 1 × PBS and stored at -20°C until further use.
[0231] Preparation of bladder matrix (UBM): UBM was prepared from market-weight pigs (Tissue Source; LLC, Lafayette, IN) (L. Huleihel et al., Science advances 2, e1600502 (2016)). Briefly, the serosa, muscularis exostosis, submucosa, and muscularis mucosa were removed by mechanical delamination, and the urothelial cells of the mucosa were separated from the basement membrane by washing with deionized water. The remaining basement membrane and lamina propria (collectively referred to as UBM) were decellularized by stirring in 0.1% peracetic acid with 4% ethanol at 300 rpm for 2 hours, followed by washing with phosphate-buffered saline (PBS) and type 1 water. The UBM was then lyophilized and milled using a Wiley Mill equipped with a #60 mesh screen.
[0232] Scanning electron microscopy (SEM): UBM was fixed in cold 2.5% glutaraldehyde for 24 hours, followed by three 30-minute washes in 1×PBS. Next, the sample was dehydrated for 30 minutes each in a stepwise alcohol series (30%, 50%, 70%, 90%, 100% ethanol), and then left overnight in 100% ethanol at 4°C. The sample was washed three more times in 100% ethanol for 30 minutes each time, and then critically dried using a Leica EM CPD030 Critical Point Dryer (Leica Microsystems, Buffalo Grove, IL, USA) with carbon dioxide as a transitional medium. Next, the sample was sputter-coated with a 4.5 nm thick gold / palladium alloy coating using a Sputter Coater 108 Auto (Cressington Scientific Instruments, UK), and imaged using a JEOL JSM6330f scanning electron microscope (JEOL, Peabody, MA, USA).
[0233] Transmission electron microscopy (TEM): TEM imaging was performed on MBV or liquid-phase EV loaded onto a carbon-coated grid and fixed in 4% paraformaldehyde (L. Huleihel et al., Science advances 2, e1600502 (2016)). The grid was imaged at 80kV using a JEOL 1210 TEM equipped with a high-resolution Advanced Microscopy Techniques digital camera. The size of the MBV was determined from representative images using JEOL TEM software.
[0234] Nanoparticle Tracking Analysis (NTA): Particle size and concentration of liquid-phase EV and MBV were calculated using a Nanosight (NS300) instrument equipped with high-speed video capture and particle tracking software. Samples were diluted 1:500 using particle-free water to a final volume of 1000 μl. Samples were dispensed into the system using a syringe pump. Measurements were taken from three 45-second captures for each sample. The detection threshold was adjusted to 4 for video processing and particle calculations. Data are presented as concentration versus particle size for each sample being evaluated.
[0235] RNA Isolation: Total RNA was isolated from 3T3 cells, liquid-phase EV, and MBV using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. Prior to RNA isolation, liquid-phase EV and MBV samples were treated with RNase A (10 μg / ml) at 37°C for 30 minutes to degrade any contaminating RNA. RNA content was determined using a NanoDrop spectrophotometer, and its quality was assessed using an Agilent Bioanalyzer 2100 (Agilent Technologies).
[0236] RNA sequencing and bioinformatics analysis: Following the manufacturer's instructions, miRNA library preparation was initiated using 100 ng of each sample and the QIASEQ® miRNA library kit (Qiagen). Briefly, mature miRNAs were ligated to adapters at their 3' and 5' ends. The ligated miRNAs were then reverse transcribed to cDNA using reverse transcription (RT) primers with specific molecular identifiers (UMIs). The cDNA was then purified to remove the adapter primers, followed by library amplification using a universal forward primer and one of 48 reverse primers assigned to sample identifiers. Pre-sequencing quality control was performed using the Agilent RNA ScreenTape System. Next-generation sequencing was performed on a NextSeq 500 instrument at a loading concentration of 2.5 pM. Bioinformatics analysis was performed by Genevia Technologies (Tampere, Finland). The quality of the sequenced read data was checked using FastQC software. Using default settings, adapter sequences were removed from all samples using TrimGalore! [version 0.4.5;]. All read data were shortened to the typical microRNA size of 21 nucleotides using fastx_trimmer software (FASTX Toolkit, by Hannon Lab; version 0.0.14).
[0237] Next, the read data from each sample were aligned to the corresponding reference genome (hg38, GRCm38). Tables of miRNA counts across the samples were created using the software bowtie [version 1.2.2] and miRDeep2 [version 0.0.8]. In this process, species-specific precursor and mature miRNA sequences were obtained from miRbase. Mature miRNA counts were obtained by taking the median of all associated precursor miRNAs. DESeq2 was used to normalize the mature miRNA counts for all samples. To ensure data quality before further analysis, principal component analysis (PCA) was performed separately on mouse and human samples, and the results were visualized using ggplot2.
[0238] Normalization of mature miRNA data and statistical testing between sample groups were performed using DESeq2. P-values were corrected for multiple testing using the Benjamini-Hochberg method. miRNAs with adjusted p-values < 0.05 and absolute log2 multiplier change > 1 were considered to be significantly differentially expressed. Using the mirTARbase database of experimentally examined miRNA-target interactions, a table of differentially expressed miRNAs was annotated with their targets and their confidence levels. Differentially expressed miRNAs were also annotated with their predicted targets using the R package miRNAtap. miRNAtap aggregates miRNA target predictions from five different databases (PicTar, DIANA, TargetScan, miRanda, miRDB) and calculates an overall miRNA target score. The minimum number of database sources required for potential miRNA target interactions to be included in the annotation was 3.
[0239] Ingenuity Pathway Analysis (IPA): Ingenuity Pathway Analysis software (versions 01-14) was used for functional analysis of differentially expressed (DE) miRNAs. IPA core analysis was used to identify miRNA targets. By filtering the findings observed experimentally, information was obtained regarding significantly enriched molecular and cellular functions, as well as physiological developmental functions, influenced by miRNAs.
[0240] qPCR validation: Reverse transcription (RT) and quantitative polymerase chain reaction (qPCR) were performed using the TAQMAN® Advanced miRNA assay protocol (Applied Biosystems). Briefly, 10 ng of total RNA was used with the TAQMAN® Advanced miRNA cDNA synthesis kit (Applied Biosystems, Cat No. A28007) to synthesize and add a 3'-poly(A) tail to the miRNA. Using a universal RT primer that recognizes the poly(A) tail, cDNA was synthesized in the RT reaction, followed by the miR-AMP step using miR-AMP forward and reverse universal primers to increase the number of cDNA molecules. qPCR was performed on a QUANTSTUDIO® system instrument using TAQMAN® Fast Advanced Master Mix (Applied Biosystems, Cat No. 4444556) and a specific TAQMAN® Advanced miRNA assay (Applied Biosystems, Cat No. A25576) that recognizes mmu-miR-163-5p, mmu-miR-27a-5p, mmu-miR-92a-1-5p, mmu-miR-451a, mmu-miR-93-5p, and mmu-miR-99b-5p. Liquid-phase EV was used as a reference to calculate the compound expression changes in MBV samples for each specific target.
[0241] Immunoblotting and silver staining assays: Liquid-phase EV and MBV from three separate cultures of 3T3 fibroblasts were pooled and quantified by nanotracking particle analysis. For both immunoblotting and silver staining analysis, the same number of vesicles from both liquid-phase EV and MBV samples were loaded onto gels. 21 × 10 11 Each MBV or liquid-phase EV was mixed with 2× Laemmli buffer (R&D Systems) containing 5% β-mercaptoethanol (Sigma-Aldrich), separated by 4–20% gradient SDS-PAGE (Bio-Rad), and then transferred to a PVDF membrane. The membrane was incubated overnight with the following primary antibodies: rabbit anti-CD63, rabbit anti-CD81, rabbit anti-CD9, and rabbit anti-Hsp70, 1:1000 dilution (System Biosciences). The membrane was washed three times for 15 minutes each before and after incubation with a 1:5000 dilution goat anti-rabbit secondary antibody (System Biosciences). The washed membrane was exposed to a chemiluminescent substrate (Bio-Rad) and then visualized using a ChemiDoc Touch instrument (Bio-Rad). The gel was silver-stained using a Silver Stain Plus kit (Bio-Rad) according to the manufacturer's instructions and visualized using a ChemiDoc Touch instrument (Bio-Rad).
[0242] LC / MS analysis of phospholipids: Lipids were extracted from 3T3 cells, exosomes, and MBVs using Folch's procedure (J. Folch, et al, J biol Chem 226, 497-509 (1957)). MS analysis of phospholipids and their oxygenated products was performed using an Orbitrap®, Fusion®, and Lumos® mass spectrometer (ThermoFisher) (YY Tyurina et al., ACS nano 5, 7342-7353 (2011)). Briefly, phospholipids were separated using a DIONEX ULTIMATE 3000 HPLC system with a normal-phase column (Luna 3μm silica(2) 100Å 150×2.0mm, (Phenomenex)) at a flow rate of 0.2 ml / min. The column was maintained at 35°C. Analysis was performed using gradient solvents (A and B) containing 10 mM ammonium acetate. Solvent A contained propanol:hexane:water (285:215:5, v / v / v), and solvent B contained propanol:hexane:water (285:215:40, v / v / v). All solvents were LC / MS grade. The column was eluted at 0–23 mins using a linear gradient from 10%–32%B; 23–32 mins using a linear gradient from 32–65%B; 32–35 mins using a linear gradient from 65–100%B; retention at 35–62 mins at 100%B; 62–64 mins using a linear gradient from 100%–10%B, followed by equilibration at 64–80 mins at 10%B. Spectra were obtained in negative ion mode. Deuterated phospholipids (Avanti Polar Lipids) were used as internal standards. Three technical replicates were performed for each sample to evaluate reproducibility. Using an in-house developed analysis workflow and a non-oxidized / oxidized phospholipid database, LC / MS data was analyzed using the software package Compound DISCOVERER® (ThermoFisher). Lipids were further filtered by retention time and confirmed by fragmentation mass spectrometry.
[0243] LC / MS analysis of free fatty acids and their oxidative products: Free fatty acids were analyzed by LC / MS using a DIONEX ULTIMATE® 3000 HPLC system connected online to a Q-Exactive hybrid quadrupole-orbitrap mass spectrometer (ThermoFisher Scientific, San Jose, CA) (YY Tyurina et al., Nature Chemistry 6, 542 (2014)). Briefly, fatty acids and their oxidative derivatives were separated using a C18 column (Accliam PepMap RSLC, 300 μm 15 cm, Thermo Scientific) with solvent gradients (A: methanol (20%) / water (80%) (v / v) and B: methanol (90%) / water (10%) (v / v), both containing 5 mM ammonium acetate). The column was eluted at a flow rate of 12 μL / min using a linear gradient from 30% solvent B to 95% solvent B over 70 minutes, retention in 95% B from 70 to 80 minutes, followed by a return to initial conditions by 83 minutes, and an additional 7 minutes of re-equilibrium. Spectra were acquired in negative ion mode. Analysis data were acquired and analyzed using Xcalibur software. A minimum of three technical replicates were performed per sample to increase reproducibility.
[0244] result Isolation of liquid-phase EVs and matrix-bound nanovesicles: Scanning electron microscopy (SEM) was performed to provide high-resolution, high-magnification imaging of MBVs embedded within an ECM bioscaffold derived from porcine bladder matrix (UBM). SEM images revealed individual spheres approximately 100 nm in diameter dispersed throughout the collagen fibers (Figure 1A). To examine whether MBVs deposited in solid ECM substrates are a distinct class of extracellular vesicles, separate from EVs secreted into the liquid phase, an in vitro 3T3 fibroblast culture model was used to enable selective collection of vesicles from liquid-phase or solid-phase extracellular compartments (Figure 1B). Phase-contrast microscopy, as well as representative images of H&E and DAPI-stained sections, showed that neither residual cells nor intact nuclei were visible after decellularization of the cell culture plate (Figure 1C). TEM imaging of liquid-phase EVs collected from cell culture supernatant and MBVs isolated from decellularized ECM (Figure 1D) showed that these two vesicle populations share similar morphologies. Furthermore, nanoparticle tracking analysis (NTA) distribution plots showed similar vesicle sizes for both liquid-phase EV and MBV, with the majority of vesicles having a diameter of <200 nm (Figure 1E).
[0245] To determine whether MBV contains markers commonly associated with exosomes, immunoblot analysis was performed for CD63, CD81, CD9, and Hsp70 (J. Loetvall et al. (Taylor & Francis, 2014)). The results showed that MBV exhibited a significant decrease in CD63, CD81, and CD9, in contrast to liquid-phase EVs. MBV expressed CD9 and CD81 at levels that were barely detectable in the immunoblot assay and significantly reduced compared to those expressed in EVs. MBV also showed significantly lower CD63 expression than observed in EVs (Figure 1F). In other words, liquid-phase EVs (i.e., exosomes) are enriched with CD63, CD81, and CD9 compared to MBVs. Furthermore, silver staining of proteins separated by electrophoresis showed that MBV contained protein cargo distinctly different from that of liquid-phase EV (Figure 1G), suggesting that MBV may be a unique subpopulation of nanovesicles.
[0246] miRNAs are selectively packaged in liquid-phase vesicles (EVs) and microcellular vesicles (MBVs) derived from 3T3 fibroblasts: Comprehensive next-generation RNA sequencing (RNA-seq) was used to catalog miRNAs differentially expressed in MBVs and liquid-phase EVs compared to the parental 3T3 fibroblast cells from which these vesicles originated. Bioanalyzer analysis revealed the absence of 18S and 28S ribosomal RNAs, as well as enrichment of small RNA molecules (<200 nt), in total RNA isolated from liquid-phase EVs and MBVs. However, the small RNA size distribution in liquid-phase EVs was much broader than in MBVs, due to the significant enrichment of small RNA molecules between 100 and 200 nt in liquid-phase EVs (Figure 2A). The analysis focused on differential miRNA signatures by performing next-generation sequencing of miRNA libraries generated from parental RNA, liquid-phase EVs, and MBV isolates (n=3 per group). Principal component analysis (PCA) showed that within each group, the repeat miRNA profiles formed clusters close together (Figure 2B).
[0247] Extensive differences in miRNA content were observed between parental cells and liquid-phase EV and MBV isolates. Overall, 28 (50.91%) miRNAs were found to be differentially expressed at least twice as much in MBV compared to liquid-phase EV (Figure 2C). Furthermore, the miRNA profiles of each liquid-phase EV or MBV and parental cell were clearly distinct (Figures 2B, 2C). To validate the results of miRNA sequencing, RT-qPCR was performed to detect three upregulated miRNAs (miR-163-5p, miR-27a-5p, miR-92a-1-5p) and three downregulated miRNAs (miR-451a, miR-93b-5p, miR-99b-5p) in MBV compared to liquid-phase EV isolated from 3T3 fibroblasts (Figure 2D). The results showed that, compared to liquid-phase EV, levels of miR-163-5p, miR-27a-5p, and miR-92a-1-5p were upregulated and levels of miR-451a, miR-93b-5p, and miR-99b-5p were downregulated in MBV, thereby confirming the results of the miRNA sequencing data. Ingenuity pathway analysis (IPA) of differentially enriched miRNAs in MBV compared to liquid-phase EV showed strong associations with organ and system development and function. In contrast, differentially enriched miRNAs in liquid-phase EV compared to MBV were associated with pathways involved in cell growth, development, proliferation, and morphology (Figure 2E).
[0248] MBV miRNA content is cell origin specific: Results from a 3T3 fibroblast model showed selective packaging of miRNAs within MBV deposited in the ECM compared to liquid-phase EVs secreted into cell culture supernatant. To determine if MBV miRNA cargo is cell origin specific, the miRNA composition of MBV isolated from ECM produced in vitro by bone marrow-derived stem cells (BMSCs), adipose-derived stem cells (ASCs), and umbilical cord stem cells (UCSCs) isolated from different human donors was characterized and compared using next-generation sequencing. Representative phase-contrast microscopy images of decellularized BMSC cell culture plates showed the absence of cells and the presence of branched fibrillary structures (Figure 3A). TEM imaging of isolated MBV from decellularized BMSC cell culture plates showed characteristic morphology attributable to extracellular vesicles (Figure 3B). Furthermore, nanoparticle tracking analysis showed similar distribution plots among MBV from BMSC, ASC, and UCSC, with the majority of vesicles having a diameter <200 nm (Figures 3C-3E). Following the isolation of total RNA from these samples, bioanalyzer analysis revealed the absence of ribosomal RNA and enrichment of small RNA molecules (<200 nt) (Figure 3F). miRNA libraries were generated from the samples (BMSC, n=3 human donors; ASC, n=3 human donors; UCSC, n=3 human donors) and subjected to miRNA sequencing. Principal component analysis showed that the samples clustered primarily according to their cell type (Figure 3G). Despite the use of three separate human donors for each cell type used to generate MBV samples, principal component analysis showed a high degree of uniformity in the miRNA profiles within each group (Figure 3G). In addition, volcano plots showed that fewer miRNAs were differentially expressed between BMSC and UCSC-derived MBVs than between BMSC-ASC and UCSC-ASC.
[0249] Phospholipid profiles of liquid-phase EV, MBV, and parental cells: Several studies have characterized the lipid composition of EV (T. Skotland, et al, Journal of lipid research 60, 9-18 (2019)). However, data on the phospholipid composition of MBV are unavailable. Therefore, comprehensive lipidomics and redox lipidomics analyses based on LC-MS were performed to comparatively evaluate the phospholipid composition of MBV and liquid-phase EV compared to their 3T3 fibroblast parental cells (Figure 4A, Figure 4D). Across three sample types, nine major phospholipid classes were detected, and the total number of detected molecular species, 536, was distributed among the following major classes: bis-monoacylglycerophosphate (BMP) - 59 species, phosphatidylglycerol (PG) - 37 species, cardiolipin (CL) - 117 species, phosphatidylinositol (PI) - 33 species, phosphatidylethanolamine (PE) - 102 species, phosphatidylserine (PS) - 45 species, phosphatidic acid (PA) - 26 species, phosphatidylcholine (PC) - 107 species, and sphingomyelin (SM) - 10 species (Figure 4D). In terms of their polyunsaturated fatty acid (PUFA) residue content, PE, PI, PC, and PS represented the major reservoirs of these polyunsaturated PL species containing 4 to 7 double bonds (Figure 4B). These PUFA phospholipids represent potential precursors of signaling lipid mediators. Mediator formation occurs through catalytic oxygenation of PUFA phospholipids by 5-lipoxygenase or 15-lipoxygenase, producing oxygenated phospholipids, which are then hydrolyzed by a type of specialized phospholipase A2 to release oxygenated fatty acids (lipid mediators) (Z. Zhao et al., Endocrinology 151, 3038-3048 (2010); YY Tyurina et al., Journal of leukocyte biology, (2019)).In addition, oxidized PUFA phospholipids act as signaling molecules that coordinate many intracellular processes and cellular responses, including apoptosis, ferroptosis, and inflammation (YY Tyurina et al., Antioxidants & redox signaling 29, 1333-1358 (2018)). Significant differences in the molecular speciesization of these phospholipids and their relative content were observed between liquid-phase EV and MBV (Figure 4E). With the clear exception of SM, arachidonic acid (AA) and docosahexaenoic acid (DHA) residues were detected in all phospholipids (Figure 4E). For many phospholipids, the amount was significantly higher in MBV compared to liquid-phase EV and parental cells (Figure 4E), identifying MBV as a rich reservoir of PUFA-phospholipids. PUFA phospholipids can be hydrolyzed by PLA2, leading to the release of free PUFA and LPL (VD Mouchlis, et al, Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids 1864, 766-771 (2019)). The former can be further utilized by two major oxygenases, COX and LOX, to produce lipid mediators with pro-inflammatory or anti-inflammatory capabilities (YY Tyurina et al., Redox (phospho) lipidomics of signaling in inflammation and programmed cell death. Journal of leukocyte biology, (2019); CA Rouzer, et al., Chemical reviews 103, 2239-2304 (2003); H. Kuhn, et al., Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids 1851, 308-330 (2015)).This finding identifies MBV as a potential precursor for the synthesis of these lipid mediators, depending on the cell / tissue context (YY Tyurina et al., Journal of leukocyte biology, (2019)). Quantitatively, MBV was enriched with PI, PS, PG, and BMP (Figure 4C and Table 2). The phospholipid content shown in Figure 4C is also presented in Table 1. Table 1. Phospholipid content as a percentage of total phospholipids [Table 1]
[0250] In contrast, the content of PE, PA, and SM was higher in liquid-phase EVs. PC was the dominant phospholipid in cells and liquid-phase EVs. The content of the specific mitochondrial phospholipid, cardiolipin (CL), was significantly lower in liquid-phase EVs compared to MBVs and parental cells (Figure 4F). Since CL is a specific mitochondrial-specific phospholipid that is predominantly localized in the inner mitochondrial membrane (M. Schlame, et al., Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids 1862, 3-7 (2017)), this finding represents a possible link between the mitochondrial compartment of cells and MBV nasogenesis. Plasmarogen phospholipids (or ether phospholipids) are structurally different from diacyl phospholipids (or ester phospholipids) (M. Schlame, et al., Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids 1862, 3-7 (2017)). In plasmalogens, the vinyl ether bond links an sn-1 saturated or monounsaturated chain to the glycerol backbone of the phospholipid (NE Braverman, et al., Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease 1822, 1442-1452 (2012)). Ether lipids, PE, and PC plasmalogens have been shown to facilitate membrane fusion (PE Glaser, et al., Biochemistry 33, 5805-5812 (1994)), increase the membrane thickness of extracellular vesicles (X. Han, et al., Biochemistry 29, 4992-4996 (1990); T. Rog, et al., Biochimica et Biophysica Acta (BBA)-Biomembranes 1858, 97-103 (2016)), and therefore can play a role in the uptake of nanovesicles by cells.Detailed MS / MS analysis revealed high levels of ether PE and PC species (plasmalogens) in both liquid-phase EV and MBV. These species were identified as PE-16:0p / 20:4, PE-16:1p / 20:4, PE-18:1p / 20:4, PE-18:1p / 22:6, and PC-16:0p / 20:4, PC-18:0p / 20:4, PC-20:0p / 20:4, and PC-18:0p / 22:6, respectively (Figure 4E). Table 2. Contents of cardiolipin, phosphatidic acid, phosphatidylglycerol, and bis-monoglycerophosphate in MBV, exosomes, and parental 3T3 cells. Data are presented as pmol per nmol of phospholipid, mean ± sd. *p<0.05 for cells, #p<0.05 for liquid-phase EV. [Table 2]
[0251] Liquid-phase EV, MBV, and parent cell lysophospholipid profiles: Lysophospholipids (LPLs), hydrolyzable metabolites of phospholipids produced by phospholipase A, are bioactive signaling molecules that modulate various physiological responses, including macrophage activation (R. Ray, et al., Blood 129, 1177-1183 (2017)), inflammation and fibrosis (AM Tager et al., Nature medicine 14, 45 (2008)), tissue repair and remodeling (K. Masuda, et al., The FEBS journal 280, 6600-6612 (2013)), and wound healing (KM Hines et al., Analytical chemistry 85, 3651-3659 (2013)). LC-MS analysis showed that LPL was present in all three types of samples, although its total content in MBV and liquid-phase EV was 1.7–1.8 times greater compared to parental cells. More specifically, seven classes of LPL were identified: lysophosphatidylethanolamine (LPE), lysophosphatidylcholine (LPC), lysophosphatidylserine (LPS), lysophosphoinositol (LPI), lysophosphatidic acid (LPA), lysophosphatidylglycerol (LPG), and monolysocardiolipin (mCL) (Figure 5A). MBV was enriched with LPE, LPA, and LPG compared to parental cells (Figure 5B). The content of LPI and mCL was significantly lower in MBV and liquid-phase EV compared to cells. The content of LPA and LPG was significantly higher in MBV compared to EV. Levels of mLCL and LPI in MBV were 3 and 6.3 times higher than in EV, but 1 / 3.3 and 1 / 1.9 times higher compared to cells (Figure 5C, Figure 5D). No significant changes in LPE, LPC, and LPS content were found between MBV and EV. Non-oxidizable molecular species containing 16:0, 16:1, 18:0, and 18:1 were the major types found in all detected LPL species (Figure 5C).These findings suggest that high levels of lysophospholipids, which are bioactive molecules important for macrophage differentiation, tissue repair, remodeling, and wound healing, are a characteristic feature of MBV.
[0252] Analysis of free and oxygenated fatty acids in MBV and liquid-phase EVs: Since exposure of mouse bone marrow-derived macrophages to MBV results in the expression of M2-like markers, Fizz1 and Arg1, associated with the constructive macrophage phenotype (L. Huleihel et al., Science advances 2, e1600502 (2016)), LC / MS analysis of PUFAs and their oxygenated products in MBV versus liquid-phase EVs and parental cells was performed. MBV was strongly enriched with arachidonic acid (20:4, AA), docosahexaenoic acid (22:6, DHA), and docosapentaenoic acid (22:5, DPA) fatty acids (Figure 6A). In other words, MBV represents a reservoir of substrates for the biosynthesis of signaling lipid mediators by their respective enzymatic mechanisms - COX and LOX. In liquid-phase EV, the major PUFAs were linoleic acid (18:2) and linolenic acid (18:3) (Figure 6A).
[0253] Because extracellular vesicles contain the enzymatic mechanisms for the biosynthesis of AA-derived lipid mediators (E. Boilard, Journal of lipid research 59, 2037-2046 (2018)), redox lipidomics analysis of oxygenated fatty acids was performed. Higher levels of AA metabolites such as 12-HETE, 15-HETE, and lipoxin A4 were found in liquid-phase extracellular vesicles (EV) compared to MBV (Figure 6B). In the context of tissue repair, lipoxin A4 (LXA4) and D-series resolbin D1 (RvD1) (produced by 12 / 15-LOX from arachidonic acid (20:4, AA) and docosahexaenoic acid (22:6, DHA)) stimulate macrophage activation into an M2-like phenotype (CN Serhan, The American journal of pathology 177, 1576-1591 (2010)). Finally, oxidized phospholipids containing oxygenated AA and DHA in MBV and liquid-phase EV were characterized. The levels of oxygenated species were higher in MBV than in liquid-phase EV, with PS, PI, and PC represented by monooxygenated species. BMP, PG, and CL contained single and bioxygenated AA and DHA residues; tripoxygenated PUFA was found only in PE (Figure 6C). Overall, the lipidomics and oxidative lipidomics results indicate that the levels of free AA, DHA, and DPA as well as PUFA-containing phospholipids, and their oxidatively modified molecular species, are higher in MBV compared to levels in liquid-phase EV. PUFA-deoxygenated and oxygenated phospholipids are concentrated in MBV but not in liquid-phase EV; therefore, MBV represents a potential reservoir of oxidized and oxidizable esterified PL species, representing a potential source of lipid mediators activated by different phospholipases depending on the pro-inflammatory / anti-inflammatory context of the extracellular environment.
[0254] We initiated the LC-MS-based lipidomics and redox lipidomics studies described above to perform a detailed comparison of liquid-phase EVs and MBV phospholipids. Combined with comprehensive RNA sequencing and bioinformatics analysis of intravesicular cargo, these data reflect that MBVs are a distinct and unique subpopulation of EVs, distinct from liquid-phase EVs (i.e., exosomes), and are a prominent feature of ECM-based biomaterials, sharing similarities limited to vesicle size and shape.
[0255] In this specification, vesicle populations were fractionated based on their compartmentalization into either liquid-phase cell culture medium or solid-phase ECM substrates. From a compositional standpoint, MBVs isolated from the ECM of 3T3 fibroblasts contained differential miRNA and lipid signatures compared to liquid-phase EVs and parental cells. These data suggest a scenario in which molecular sorting occurs during vesicle formation, specifically distributing miRNAs and lipids to vesicles destined for different extracellular locations. Furthermore, the cellular ability to distinguish between liquid interfaces and solid substrates and selectively deposit suited vesicle subpopulations with distinct lipid signatures into these heterogeneous compartments provides evidence for MBV membrane formation distinct from and independent of EV formation secreted into the liquid phase. Given that MBVs have been shown to be incorporated into the high-density microfibrillary network of the extracellular matrix, MBVs should be secreted by cells in cooperation with ECM components during matrix deposition during tissue development and homeostasis, as well as during dynamic matrix remodeling after injury. Furthermore, considering that the ECM is a complex mixture of proteins, proteoglycans, and glycosaminoglycans arranged in a tissue-specific 3D architecture (Hussey et al., Nature Review Materials, 3(7):159-173, 2018), the MBV cargo and lipid content should also be tissue and cellular origin-specific. MBV isolated from ECM bioscaffolds derived from anatomically distinct source tissues possessed differential miRNA signatures (Huleihel et al., Science Advances, 2, e1600502, 2016). The results of this study further demonstrate that MBV isolated from ECM produced in vitro by bone marrow-derived stem cells, adipose-derived stem cells, and umbilical cord stem cells from different human donors contained characteristic miRNA signatures specific to the cellular source.In addition, fewer miRNAs were found to be differentially expressed between BMSC and UCSC-derived MBV than between BMSC-ASC and UCSC-ASC, a finding that may be attributable to the tissue-specific differentiation ability of adipose-derived stem cells (L. Xu et al., Stem cell research & therapy 8, 275 (2017)). These findings further highlight the cell-specific characteristics of the MBV miRNA profile, which were not significantly affected by the intrinsic variability of the donor. However, given that all three human donors were male, further testing is needed to determine sex-related variability in the miRNA cargo of MBV derived from stem cell samples. Importantly, principal component analysis showed a high degree of batch-to-batch consistency of MBV-derived miRNA cargo deposited by specific cell types isolated from different human donors, which supports the production of MBV and ECM biomaterials as research tools or clinical therapeutics. This study establishes that the MBV incorporated into the matrix is a distinct subpopulation of EVs. In addition, MBV showed a significant decrease in proteins commonly associated with exosomes (e.g., CD63, CD81, CD9).
[0256] In contrast to extracellular proteins (EVs), which are secreted into body fluids and readily available for intercellular communication, macrophages (MBVs), embedded within the tissue extracellular matrix (ECM), stably associate with the matrix and can only be isolated after degradation of the ECM material (Huleihel et al., Science advances 2, e1600502 (2016)). The requirement of matrix degradation for MBV release can partially define its mechanism of action, including its ability to generate dissipation-promoting lipid mediators. Since MBVs remain intact and attached to the ECM even after decellularization, molecular speciation of its constituent phospholipids may facilitate such MBV-ECM interactions. We used LC-MS-based lipidomics and redox lipidomics approaches to characterize the molecular speciation of MBV phospholipids, lysophospholipids, and oxygenated and deoxygenated PUFAs in detail. High levels of lysophospholipids, which are bioactive molecules important for macrophage differentiation, tissue repair, remodeling, and wound healing, are characteristic features of MBVs. In addition, as fusion lipids, lysophospholipids can facilitate the transport of vesicular contents to intracellular targets. While PUFA-deoxygenated and oxygenated phospholipids are concentrated in MBV, they are not concentrated in liquid-phase EV; therefore, MBV represents a potential reservoir of oxidized and oxidizable esterified PL species. Notably, PUFA-enriched MBV is a significant source of lipid mediators activated by different phospholipases depending on the pro-inflammatory / anti-inflammatory context of the extracellular environment.
[0257] (Example 2) Use of MBV for the treatment of pristane-induced arthritis The bladder matrix was prepared using the methodology described in Example 1.
[0258] MBV was isolated from laboratory-produced porcine UBM by enzymatic digestion with liberase TL (highly purified collagenase I and collagenase II) in buffer solution (50 mM Tris pH 7.5, 5 mM CaCl2, 150 mM NaCl) in an orbital rocker at room temperature for 24 hours. Next, the digested ECM was centrifuged at 10,000 × g for 30 minutes to remove ECM debris. Then, the clarified supernatant containing the free MBV was centrifuged at 100,000 × g (Beckman Coulter Optima L-90K ultracentrifuge) at 4°C for 2 hours to pelletize the MBV.
[0259] In this study, the anti-inflammatory effects of MBV were evaluated after systemic or topical administration in a mouse model treated with the inflammatory agent pristane. The rat pristane-induced arthritis model is established as a clinically relevant animal model for testing rheumatoid arthritis (Tuncel et al. PLoS One. 2016; 11(5):e0155936). Pristane-induced arthritis was induced in 8-week-old female Sprague-Dolly rats by intradermal injection of 300 μL of pristane (2,6,10,14-tetramethylpentadecane) dorsally at the base of the tail, 1 cm distal to the base, on day 0 of the study. Control animals did not receive intradermal injection of pristane on day 0. A second dose of 300 μL of pristane was administered intradermally on day 4, approximately 1 cm distal to the dorsal base of the tail. Animals receiving pristane were housed together in cages. Animals receiving pristane were randomized to one of the following experimental groups: pristane alone, methotrexate, periarticular MBV, or intravenous MBV. Figure 7 shows the routes of administration for periarticular and intravenous MBV.
[0260] Arthritis scores were determined for each animal on days 7, 10, 14, 17, 21, and 28, and then weekly until the 100-day endpoint. Photographs were taken of each forelimb and hindlimb, viewed from palmar and plantar perspectives, respectively. Arthritis was assessed using a 60-point arthritis scoring criterion: 1 point was assigned for each inflamed finger or toe joint, with a maximum of 5 points allocated to affected ankles (15 points per foot, 60 points per rat). Animals designated as pristane only received no treatment on days 7, 10, 14, 17, and 21. Methotrexate animals received 0.1 mg / kg methotrexate in 1× sterile PBS, delivered intraperitoneally on days 7, 10, 14, 17, and 21. Periarticular MBV animals received 25 μL of 500 μg / mL porcine-derived UBM MBV, delivered to the plantar and palmar surfaces of the hindlimb and forelimb, respectively. The intravenous MBV group received 100 μL of 500 μg / mL UBM MBV delivered intravenously into the lateral caudal vein of each animal. Four animals in each group were assigned to a 28-day short-term trial, and four animals were assigned to a 100-day trial. Sample size was determined using the previously published effect size of methotrexate, with pre-determined alpha of 0.05 and beta of 0.80. Arthritis scores were expressed as standard error of mean + / - mean. Days 7–21 represent 8 n per group, and then day 28 and thereafter represent 4 n per group. Differences between groups were analyzed using Tukey's post-hoc corrected two-way variance analysis. Significance was determined pre-trially with an alpha of 0.05.
[0261] Administration of MBV, both targeted PA (periarticular) and systemic IV, significantly reduced arthritis severity in rats, demonstrating efficacy comparable to methotrexate, the absolute standard of care. All rats exhibited an arthritis score of 0 on day 7 (Figure 8A), but as early as day 10, high arthritis scores were observed in pristane-only rats, while all treated rats exhibited lower arthritis scores (Figure 8B). Surprisingly, starting on day 13, MBV treatment was as efficient as methotrexate, the absolute standard of arthritis treatment (Figures 8C and 8D). By day 21, MBV-treated rats (both IV and PA-treated) exhibited lower arthritis scores than methotrexate-treated rats (Figure 8E). Photographs of rat feet demonstrate differences in erythema and edema between pristane-only and methotrexate and MBV-treated rats (Figures 9A-9B). Figure 10 shows the mean arthritis scores across treatment groups over the first 21 days of the experiment. PA administration with MBV administration showed a comparable reduction in arthritis scores compared to pristane-only rats, and a comparable reduction in arthritis scores to methotrexate treatment. Unexpectedly, however, intravenous administration was found to be as effective as PA and methotrexate in reducing arthritis scores. IV administration was predicted to result in a dilution of MBV's potency and therefore a limited, if any, effect on inflamed joints, but this was not observed. Surprisingly, both PA and IV routes of MBV administration showed a comparable reduction in arthritis scores compared to pristane-only rats, and both reduced arthritis scores to a degree comparable to methotrexate treatment. Because periarticular injections at the site of inflammation are painful, and many joints in an individual can become inflamed, the unexpected finding that intravenous administration of MBV is just as effective as PA administration suggests that a systemic delivery route could be used for a less invasive but equally effective therapeutic effect, requiring only a single injection per administration (rather than multiple injections per joint), and therefore being more comfortable for the patient.
[0262] Unexpectedly, inflammation recurrence was also reduced in rats receiving MBV via both IV and PA administration. Data collected up to day 77 of the experiment support MBV treatment as an efficient treatment for arthritis in the chronic and relapsing phases of inflammation. As shown in the photograph in Figure 11A, phenotypically, rat paws treated with PA or IV MBV exhibited erythema and edema equivalent to those treated with methotrexate. PA and IV MBV reduced pristane-induced arthritis clinical scoring in the chronic and relapsing phases of inflammation with the same efficacy as methotrexate, the absolute standard of care for rheumatoid arthritis (Figure 11B). Tissue analysis from rat models of rheumatoid arthritis revealed tissue inflammation and reduced interstitial space. MBV-treated samples showed interstitial space restoration and reduced inflammation comparable to those observed with methotrexate treatment, highlighting the efficacy of MBV at both the biological and tissue levels.
[0263] Serum samples collected from mice on day 24 were evaluated for pro-inflammatory cytokine analysis by enzyme-linked immunosorbent assay (ELISA). As shown in Figure 12, MBV administered either periarticularly or intravenously significantly reduced IL-1-beta serum levels compared to pristane-only animals (Figure 12B). Furthermore, locally administered MBV (i.e., PA MBV) resulted in a decrease in TNF-alpha serum levels (Figure 12A). These data strongly suggest that MBV is a modulator of the immune system.
[0264] In summary, the data from these experiments suggest that initial treatment of MBV, whether systemic or local, has a therapeutic effect in alleviating arthritis symptoms for several weeks to several months after the completion of the initial treatment course, thereby reducing the severity or frequency of subsequent flares of rheumatoid arthritis symptoms, or even eliminating or resolving them.
[0265] The data generally suggest the usefulness of MBV in modulating inflammatory immune responses, demonstrating that MBV can downregulate the production of pro-inflammatory cytokines. This suggests the effectiveness of MBV in mitigating excessive inflammatory events such as cytokine storms, thereby making it useful in treating conditions such as ARDS resulting from excessive inflammation in the lungs.
[0266] (Example 3) Use of MBV for the treatment of imiquimod-induced psoriasis MBV derived from UBM and UBM is prepared using the methodology described in Example 2 (see above).
[0267] Imiquimod (IMQ), a compound known to induce psoriasis-like conditions in mice when applied topically, was administered to 8-week-old female C57 / bl6 mice by daily topical application of 62.5 mg of 5% imiquimod cream to the shaved backs and right auricle for 15 days. Control animals did not receive topical imiquimod throughout the study; instead, they received topical application of petrolatum to their shaved backs and right auricle. Treatment groups and therapy paradigms were divided into prevention of psoriasis flares and management of existing flares. Animals receiving prophylactic treatment were treated between days 0 and 16 of the study, while animals receiving control treatment were treated between days 7 and 16 of the study. The treatment groups consisted of intraperitoneal MBV and vehicle-only controls. Animals receiving intraperitoneal MBV received 10 treatments each day of the study as specified in the treatment schedule. 9 This individual received UBM MBV derived from pigs.
[0268] On day 7, tissue samples were collected and evaluated histologically. When MBV was administered by intraperitoneal injection (over a 7-day treatment period, 10 9 As shown in Figure 13, the psoriatic lesions subside with this daily dose of MBV.
[0269] Foxp3-expressing cells are T REG Because it is directly regulated by cells, the treatment is T REGFoxp3 RNA was quantified to determine whether it affected activity. RNA was isolated from tissue biopsy material at the test site using Trizole according to the manufacturer's instructions. RNA content and A260 / 280 were determined using a NanoDrop spectrophotometer (NanoDrop). cDNA was synthesized by first-strand reverse transcription using SuperScript III reverse transcriptase. qPCR for foxp3 was performed using Power SYBER Green PCR master mix (Applied Biosystems). All qPCRs performed with SYBER Green were carried out at 50°C for 2 minutes, 95°C for 10 minutes, and 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. qPCR was analyzed by the DeltaDeltaCT method, and the log (multiplicity change) was compared to foxp3 expression in the negative control (no imiquimod + PBS vehicle). Foxp3 primers (forward: 5'-TCTCCAGGTTGCTCAAAGTC-3' and reverse: 5'-GCAGAAGTTGCTGCTTTAGG-3') and Gapdh primers (forward: 5'-CTGGAGAAACCTGCCAAGTA-3' and reverse: 5'-TGTTGCTGTAGCCGTATTCA-3'). As shown in Figure 14, treatment with MBV significantly increased Foxp3 RNA levels, indicating that MBV is responsible for T REG This indicates that it stimulates cells. In summary, these data indicate that MBV treatment, even when administered systemically, results in an increased number of anti-inflammatory cells in the same tissue. Therefore, both topical and systemic administration can be used to treat ARDS.
[0270] (Example 4) Use of MBV in the Keyhole Limpet Hemocyanin (KLH) Mouse Model MBV derived from UBM and UBM is prepared using the methodology described in Example 2 (see above).
[0271] In this experiment, the immunotoxicity of systemically delivered MBV was evaluated using an immunosuppressive and immunotoxic keyhole limpet hemocyanin (KLH) rat model. Eight-week-old Sprague-Dolly rats were divided into four separate groups: a KLH control was used to demonstrate a normal anti-KLH response after immunization with KLH; a vehicle control was used to control any potential effects unrelated to treatment or KLH immunization; a cyclophosphamide-positive control was used as a potent immunosuppressant; and the MBV-treated group was used to evaluate the effect of MBV administration on systemic immunity. On day -7, cyclophosphamide-treated animals received 200 mg / kg intraperitoneally. MBV-treated animals received 1 × 10⁶ intravenously on days -7, -4, and -1. 9 The animals received MBV in individual particles. On day 0, all groups except the vehicle control were immunized with 0.4 mL of 1000 μg / ml reconstituted KLH in Freund's incomplete adjuvant. On days 7, 14, and 21 post-immunization, whole blood was collected from the lateral tail vein, and serum was isolated for analysis of anti-KLH IgG. Anti-KLH IgG in the serum of all animals was evaluated using enzyme-linked immunosorbent assay (ELISA), as shown in Figure 15. In summary, these data suggest that animals treated with MBV are still immunocompetent and capable of initiating an immunoglobulin-based response.
[0272] This finding has broad significance for the usefulness of MBV as an anti-inflammatory treatment. For example, many standard treatments to reduce inflammation, including hyperinflammation resulting from hypercytokinemia, are immunosuppressants, which expose the subject to the risk of secondary infection, reduce the ability to initiate a sufficient immune response to drugs that trigger an immune response, and interfere with the recovery and development of immunity. However, MBV has been shown not to interfere with the subject's ability to initiate an immune response, making it useful as an anti-inflammatory treatment, for example, in ARDS caused by viral infections such as SARS-CoV-2. This is because MBV should still reduce the production of inflammatory cytokines and modulate the immune response toward repair and healing, while not interfering with the subject's ability to initiate an immune response against the virus.
[0273] (Example 5) MBV administration is T in vivo REG increase MBV derived from UBM and UBM is prepared using the methodology described in Example 2 (see above).
[0274] Cardiotoxic muscle injury surgery was performed on knockout or wild-type C57 / bl6 mice; the mice were wild-type IL-33 expressing Arg-1 GFP ("WT B6") or knockout IL-33 deficient Arg-1 GFP The phenotype was B6 ("KO B6"). Arginase expression in these mouse cells can be detected by GFP expression, enabling the identification of the M2-like phenotype. MBV containing IL-33 naturally (see International Patent Application Publication No. WO2019 / 213482) was used in 1 × 10⁻⁶ samples. 9 MBV was administered to the site of muscle injury at a concentration of [number] units. At postoperative days (POD3) and POD7, injured transverse abdominal (TA) muscle tissue was surgically collected from mice, the tissue sample was dissected, treated with dispase, rinsed in saline, and this process was repeated to remove noncellular debris. Infiltrating leukocytes were evaluated by flow cytometry (FACS).
[0275] Figures 16A and 16B are CD45 + CD3 - B220 - CD11b + Ly6G - Representative dot plots and frequencies of inflammatory macrophages at the gate are shown. In the absence of IL-33, an increased number of macrophages are present, which are of the M1 pro-inflammatory phenotype. MBV containing IL-33 significantly reduces the inflammatory response.
[0276] Figures 16C and 16D are CD45 + CD3 + B220 - CD4+ ST2 at the gate + T REG The following shows representative dot plots and frequencies. These results indicate that IL-33 is Foxp3-positive. REG This indicates the requirements for increasing the number of cells. All p-values were calculated using one-way ANOVA (*P<0.05, **P<0.01).
[0277] (Example 6) MBV administration induces IL-4 production. MBV derived from UBM and UBM is prepared using the methodology described in Example 2 (see above).
[0278] In this experiment, naive T lymphocytes were isolated from the spleen of normal mice. T lymphocytes were stimulated to induce a T cell response. Primary mouse CD4+ T cells were isolated from the spleen of 8-week-old C57 / Bl6J mice by depletion of non-CD4+ T cells using a cocktail of biotin-conjugated antibodies against CD8a, CD11b, CD11c, CD19, CD45R, CD49b, CD105, anti-MHC-class II, Ter-119, and TCR as primary labeling reagents. Cells were magnetically labeled with anti-biotin microbeads, and unlabeled CD4+ T cells were separated using magnet-assisted cell sorting. The isolated CD4+ cells were divided into 10% fetal bovine serum, complete RPMI 1640 medium at a rate of 1.0 × 10⁶ per well. 6 Cells were cultured at a final concentration of 100 cells / mL in 12-well plates pre-coated with anti-mouse CD3 epsilon (3 μg / mL).
[0279] Each Th (T helper) subset was induced by 5 days of culture under the following conditions: Th1: anti-mouse CD28 (3 μg / ml), anti-mouse IL-4, clone (10 μg / ml), recombinant mouse Il-2 (5 ng / ml), and recombinant mouse Il-12 (10 ng / ml). Th2: anti-mouse CD28 (3 μg / ml), anti-mouse IFN-gamma (10 μg / ml), recombinant mouse Il-2 (5 ng / ml), and recombinant mouse Il-4 (10 ng / ml). Th17: anti-mouse CD28 (3 μg / ml), recombinant mouse TGFb (2.5 ng / ml), IL6 (20 ng / ml), anti-IFNg (10 μg / ml), anti-IL4 (10 μg / ml), and anti-IL2 (10 μg / ml). ThMBV: Anti-mouse CD28 (3 μg / ml), recombinant mouse Il-2 (5 ng / mL), and 1 × 10⁻¹⁰ 9 MBV of individual particles. T cells were cultured under these conditions for 5 days. On day 5, the cells were washed, replaced with serum-free complete RPMI 1640, and stimulated with 50 ng / mL phorbol 12-myristate 13-acetate for 24 hours. After 24 hours, the cell culture supernatant was collected and ELISA for Il-4 was performed.
[0280] As shown in Figure 17, when stimulated with known Th1 activators (pro-inflammatory responses), these cells produced minimal amounts of IL-4 (a potent anti-inflammatory signaling molecule). When given Th2 activators (anti-inflammatory responses), the cells produced large amounts of IL-4 as expected. When the cells were activated toward a pro-inflammatory Th17 phenotype, no IL-4 was produced. 9 Exposure to MBV (individual units / well) resulted in a significant increase in IL-4 production. In summary, these data indicate that treatment with MBV induces a strong anti-inflammatory phenotype in T helper cells.
[0281] (Example 7) MBV downregulates cytokine storm mediators in macrophages and increases the expression of negative regulators of cytokine storms. MBV derived from UBM and UBM is prepared using the methodology described in Example 2 (see above).
[0282] Mouse bone marrow was collected from 6-8 week old B6 mice. The cells collected from the bone marrow were washed and 2 × 10⁶ cells were extracted. 6 The cells were plated at 1x10⁶ cells / mL and differentiated into macrophages over 7 days in the presence of macrophage colony-stimulating factor (MCSF) with complete medium changes every 48 hours. Next, 1x10⁶ cells were introduced. 9Macrophages were treated with or without MBV / ml (n=3 per group). After a 24-hour incubation period at 37°C, cells were washed with sterile PBS, total RNA was collected, and analyzed using RNA sequencing. Bioinformatics analysis was performed using Genevia Technologies (Tampere, Finland). Differential expression (DE) analysis was performed using the R package DESeq2, version 1.24.0 (Love et al., 2014. Genome Biology 15: 550). Wald's test was used for statistical testing with p-value 0.05, set as the significance cutoff used to optimize independent filtering, with the null hypothesis being that the log2 multiplier change between the control group is equal to zero. P-values were adjusted for multiple testing using the Benjamini-Hochberg procedure (Benjamini et al. 1995. Journal of the Royal Statistical Society B 57: 289-300). Next, the results were post-filtered using 0.05 as a threshold for adjusted p-values and 1 as a threshold for absolute log2 multiplier changes. Genes were also annotated with MGI symbols, gene descriptions, and gene biotypes using biomaRt, version 2.40.5 (Durinck et al. 2009. Nature Protocols, 4: 1184-1191). Sequencing results showed that MBV treatment significantly reduced the expression of genes known to be definitive mediators of cytokine storms, including CD163, Igf1, Nlrp inflammasome, C5ar2, Hrh1, Hdac9, Igfbp4, and Pparg, as shown in Table 3. Furthermore, MBV was shown to increase the expression of negative regulators of cytokine storms, including IL-10 and Socs1-3, as shown in Table 4. Table 3: MBV reduced the expression of genes involved in cytokine storms. [Table 3] Table 4: MBV increased the expression of genes that act as negative regulators of cytokine storms. [Table 4]
[0283] As demonstrated by these data, MBV is shown to be a potent modulator of pro-inflammatory cytokine production, particularly pro-inflammatory cytokines that contribute to hypercytokinemia ("cytokine storms"). This characteristic of MBV suggests its potential usefulness as a candidate for treating or mitigating cytokine storms and ARDS resulting from excessive inflammation in the lungs.
[0284] (Example 8) Use of MBV for treating virus-induced immune responses in mouse influenza models MBV derived from UBM and UBM is prepared using the methodology described in Example 2 (see above).
[0285] To determine the ability of MBV to localize in the lungs, PKH67-labeled MBV was used. 9 At a dose of [number] particles / mL, 250 μl of MBV was administered intranasally in aerosol form to C57BL / 6 mice. Notably, immunofluorescence microscopy of mouse tissue showed significant enrichment of MBV in the lung airways and alveoli. As shown in Figure 18, MBV was clearly detectable (indicated by arrows) in the large and small airways of the treated lung tissue, particularly in the epithelium, but not observed in the parenchyma. Untreated control lung tissue (right panel) showed nonspecific low-level autofluorescence with a diffused pattern that did not resemble the MBV-treated tissue, demonstrating that the fluorescence in the left and center panels actually indicates MBV localization.
[0286] A mouse model of H1N1 is used to evaluate the therapeutic efficacy of MBV for virus-induced ARDS, such as acute respiratory distress syndrome (ARDS) associated with COVID-19. Influenza H1N1 induces pulmonary pathology similar to that observed in COVID-19 patients, following a similar disease course including an asymptomatic period, rapid ARDS-like lung injury, and persistent alveolitis lasting several weeks or months. The 2009 H1N1 pandemic virus is even more similar to SARS-CoV-2 in terms of its high infectivity and global transmission.
[0287] Male and female C57BL / 6 mice were given 10 units for survival testing. 6 10 pfu lethal doses or immunological studies 4 Infection with influenza A / CA / 07 / 2009 (H1N1 pandemic influenza) is performed by oropharyngeal aspiration at any sublethal dose of pfu. On day 3 or 5 post-infection, mice are treated with MBV by intranasal or intravenous delivery.
[0288] Mice were randomly assigned to the following six experimental groups (8 mice per group, two cohorts of 4 mice / group, both male and female mice): 1) Influenza A / CA / 07 / 2009 only; 2) Influenza A / CA / 07 / 2009 + control (vehicle only); 3) Influenza A / CA / 07 / 2009 + intranasal MBV treatment. Dosage: 1 × 10⁶ 250 μL 6 Individual MBV / ml; 4) Influenza A / CA / 07 / 2009 + Intranasal MBV treatment Dosage 250 μL 1 × 10 9 Individual MBV / ml; 5) Influenza A / CA / 07 / 2009 + Intravenous MBV treatment Dosage 250 μL 1 × 10 6 Individual MBV / ml; 6) Influenza A / CA / 07 / 2009 + Intravenous MBV treatment Dosage 250 μL 1 × 10 9MBV / ml of individual mice. A group of healthy mice was used as a baseline control. Mice were followed by daily weight tracking as a surrogate for morbidity, and mice were sacrificed if a 25% weight loss was observed. These survival studies demonstrated the efficacy of MBV against virus-induced mortality and further demonstrated the efficacy of MBV based on dosage and delivery route.
[0289] Immunological tests will be conducted for three experimental groups using the most effective drug administration strategy determined above: 1) Influenza A / CA / 07 / 2009; 2) Influenza A / CA / 07 / 2009 + control; 3) Influenza A / CA / 07 / 2009 + MBV. Mouse tissue samples (including but not limited to lungs and lymph nodes (LN), bronchoalveolar lavage fluid (BALF), and serum) will be collected at 7 and 21 days post-infection. Pulmonary function will be measured at each time point using FLEXIVENT® (SCIREQ, Quebec, CA) to determine quasi-static lung compliance as a measure of inflammation and edema. Pulmonary function measurements will be performed according to the manufacturer's instructions for use.
[0290] Lung injury and inflammation are assessed using lung protein homogenates to determine local cytokine levels by Bio-Plex® cytokine assay (Bio-Rad) according to the manufacturer's instructions for use. Histological analysis, including hematoxylin and eosin staining of lung lobes, is performed for pathological evaluation. Blood assessments are performed, including quantification of antibody isotypes and levels by enzyme-linked immunosorbent assay (ELISA), anti-hemagglutinin antibody levels, and Bio-Plex® cytokine assay evaluation of serum cytokines. Furthermore, bronchoalveolar lavage is performed to collect samples for determining air space cytokine levels and differential inflammatory cell counts by Bio-Plex® cytokine assay.
[0291] Single cells derived from lung digests, LN suspensions, and BALF were stained with fluorescently labeled antibodies, and multi-parameter spectral flow cytometry was completed using Cytek® Aurora according to the manufacturer's instructions. Flow cytometry evaluation was used to quantify changes in both the myeloid compartment (i.e., pro-inflammatory cytokine-secreting M1 macrophages and / or reparative and regulatory M2 macrophages) and the lymphoid compartment (i.e., virus-specific T effector cells along with regulatory T cells). Single-cell RNA sequencing analysis of LN and lung tissue was also performed to identify how viral infection and MBV therapy, together and independently, shape tissues and immune cell populations at the molecular level.
[0292] The results show that animals treated with MBV exhibit a significantly reduced viral morbidity compared to untreated control animals. Even more surprisingly, infected animals treated with MBV exhibit reduced lung injury and inflammation, as seen in white blood cell counts and cytokine levels. These data suggest that MBV administration is an effective immunomodulatory therapy for diseases and disorders resulting in acute respiratory distress, and that MBV can reduce the severity or incidence of ARDS induced by viral infections. This provides an effective treatment for viral diseases for which there are no existing therapies, such as pandemic H1N1 or SARS-CoV-2, as well as other influenza and coronavirus-induced respiratory diseases, among other indications.
[0293] (Example 9) Use of MBV for the treatment of COVID-19-related acute respiratory distress syndrome in clinics MBV derived from UBM and UBM is prepared using the methodology described in Example 2 above.
[0294] Patients diagnosed with SARS-CoV-2-induced acute respiratory distress syndrome (ARDS) and COVID-19-positive patients should be treated with MBV. Patients who can breathe on their own should receive approximately 1 × 10⁶ units of MBV in 3 mL of saline solution, which is sprayed via a nebulizer and inhaled into the lungs through the nose and / or mouth. 9 The patient receives the MBV dose. Intubated patients receive 1 × 10¹⁶ doses in 3 mL of saline intratracheally. 9 The MBV dose is administered. Some patients for whom intraperitoneal injection is the preferred mode of administration are given 1 × 10 in approximately 50 mL of saline via intraperitoneal administration. 9 I will receive the MBV.
[0295] Blood oxygenation levels are measured in each patient before and after receiving the MBV therapy dose to determine the therapeutic effect of the treatment. Furthermore, fluid samples are obtained from the lungs by lavage, and cytokine expression levels, e.g., the cytokines provided in Tables 3 and 4 above, are determined by ELISA. Patients continue to receive this dose every 6–24 hours until they show signs of improvement, including the ability to maintain oxygen levels without continuous mechanical ventilation or oxygen support, as well as improvement in chest X-rays indicating fluid clearance from the lungs and / or a decrease in pro-inflammatory cytokine levels as determined from the lavage fluid test.
[0296] (Example 10) Materials and methods for Examples 11-15 A mouse model of H1N1 was used to evaluate the therapeutic efficacy of MBV for virus-induced acute respiratory distress syndrome (ARDS), such as ARDS associated with COVID-19. Influenza H1N1 induces pulmonary pathology similar to that observed in COVID-19 patients and follows a similar disease course, including an asymptomatic period, rapid ARDS-like lung injury, and persistent alveolitis lasting several weeks or months. The 2009 H1N1 pandemic virus is even more similar to SARS-CoV-2 in terms of its high infectivity and global transmission.
[0297] Male and female C57BL / 6 mice were given 10 units for survival testing.6 For a lethal dose of PFU, or for immunological testing, 10 4 Mice were infected with influenza A / CA / 07 / 2009 (H1N1 pandemic influenza) by oropharyngeal aspiration using a sublethal dose of pfu. On days 3 and 5 post-infection, mice were treated with MBV by intravenous delivery.
[0298] Mice were randomly assigned to the following six experimental groups (8 mice per group, 2 cohorts of 4 mice / group, both male and female mice): 1) Influenza A / CA / 07 / 2009 only; 2) Influenza A / CA / 07 / 2009 + control (vehicle only); 3) Influenza A / CA / 07 / 2009 + intravenous MBV treatment. 1 × 10⁶ doses of 250 μL each. 6 MBV / ml; 4) Influenza A / CA / 07 / 2009 + Intravenous MBV treatment: 250 μL x 1 x 10⁶ 9 MBV / ml. A group of healthy mice was used as a baseline control. Mice were followed by daily weight tracking as a surrogate for morbidity, and were sacrificed when a 25% weight loss was observed. These survival studies demonstrate the efficacy of MBV against virus-induced mortality and further demonstrate the efficacy of MBV based on dosage and delivery route.
[0299] Immunological tests were performed on three experimental groups using the most effective drug administration strategy determined above: 1) influenza A / CA / 07 / 2009; 2) influenza A / CA / 07 / 2009 + control; 3) influenza A / CA / 07 / 2009 + MBV. Mouse tissue samples (including but not limited to lungs and lymph nodes (LN), bronchoalveolar lavage fluid (BALF), and serum) were collected on days 7 and 21 post-infection.
[0300] Lung injury and inflammation were assessed using lung protein homogenates to determine local cytokine levels by the BIO-PLEX® cytokine assay (Bio-Rad) according to the manufacturer's instructions for use. For pathological evaluation, histological analysis of lung lobes, e.g., hematoxylin and eosin staining, as well as trichrome staining, was performed. Blood assessments were performed, including leukocyte count, quantification of antibody isotypes and levels by enzyme-linked immunosorbent assay (ELISA), anti-hemagglutinin antibody levels, and BIO-PLEX® cytokine assay evaluation of serum cytokines. Furthermore, bronchoalveolar lavage was performed to collect samples for determining air space cytokine levels and differential inflammatory cell counts by the BIO-PLEX® cytokine assay.
[0301] Single cells from lung digests, LN suspensions, and BALF were stained with fluorescently labeled antibodies, and multi-parameter spectral flow cytometry was completed using CYTEK® Aurora according to the manufacturer's instructions for use. Flow cytometry evaluation was used to quantify changes in both the myeloid compartment (i.e., pro-inflammatory cytokine-secreting M1 macrophages and / or repairative and regulatory M2 macrophages) and the lymphoid compartment (i.e., regulatory T cells, as well as virus-specific T effector cells). Single-cell RNA sequencing analysis of LN and lung tissue was also performed to identify how viral infection and MBV therapy, together and independently, shape tissues and immune cell populations at the molecular level.
[0302] (Example 11) Systemic administration of MBV alleviates acute virus-mediated pulmonary pathology. Seven days after intratracheal inoculation with H1N1, systemic administration of matrix-bound nanovesicles substantially alleviated acute virus-associated pulmonary pathology, as evident on H+E staining of lung tissue. On day 7, the influenza + ivPBS vehicle control group demonstrated increased cell density and sclerosis in the pulmonary interstitial space, while the influenza + ivMBV group showed decreased cell density and decreased interstitial inflammatory infiltrates (Figure 19A). Using quPath artificial intelligence to visualize cell density in the form of a heatmap, the influenza + ivMBV group showed decreased cell density compared to the influenza + ivPBS group (Figure 19A). Further investigation of the composition of cellular infiltrates in the lungs after influenza infection showed increased CD45+ neutrophils in bronchiolar lavage fluid (BALF), pulmonary interstitial space, and spleen (Figure 19B, p<.05). Intravenous MBV significantly reduced the frequency of CD45+ neutrophils in the BALF, pulmonary interstitial space, and spleen (Figure 19B, p<.05). The reduction in cell infiltration and neutrophil presence with systemic MBV administration was associated with a decrease in pro-inflammatory cytokines and chemokines (Figure 19C). Specifically, systemic MBV reduced G-CSF produced in the lungs, which is involved in the recruitment of neutrophils and myeloid cells to tissues in infections (Figure 19C, p<.05). Systemic MBV administration reduced pulmonary concentrations of pro-inflammatory cytokines, including Il-6, Il-1b, TNF-alpha, and IFN-gamma, compared to the influenza + ivPBS group (Figure 19C, p<.05).
[0303] (Example 12) MBV promotes antiviral CD4 and CD8 phenotypes after H1N1 vaccination. Seven days after intratracheal H1N1 inoculation, systemic administration of MBV significantly altered the CD4:CD8 T-cell ratio in the lungs compared to the baseline ratio in the PBS-only control (Figure 20A, p<.05). This enhancement of the CD8:CD4 T-cell ratio by MBV administration was observed locally at the site of infection in the lungs and systemically in the spleen (Figures 20A and 20B, p<.05). Further investigation of CD4 and CD8 T-cells revealed that MBV not only promoted a shift supporting the increased CD8:CD4 T-cell ratio compared to the PBS-only control, but also promoted increases in both activated (CD69+) and antiviral (Tbet+) CD4 and CD8 T-cells (Figures 20C and 20D, p<.05). Specifically, at the spleen level, MBV increased the frequency of CD69+CD4 T-cells compared to the PBS-only group and the influenza + ivPBS group (Figure 20C, p<.05). Systemic MBV also increased the frequency of antiviral Tbet+CD4 T-cells in the lymph nodes compared to the PBS-only group and the influenza + ivPBS group (Figure 20C, p<.05). MBV also increased the frequency of CD69+ activated CD8 T-cells in the spleen compared to both the PBS-only group and the influenza + ivPBS group (Figure 20D, p<.05). Although not statistically significant, there was a trend of increasing frequency of Tbet+ antiviral CD8 T-cells in the spleen in the systemic MBV group compared to the influenza + ivPBS group (Figure 2D, p>.05).
[0304] (Example 13) MBV alleviates long-term virus-borne pneumonia. Twenty-one days after intratracheal inoculation with H1N1, systemic administration of MBV substantially reduced overall cell density in lung tissue compared to the influenza + ivPBS group (Figure 21A). Similar to day 7 post-infection, systemic administration of MBV significantly reduced the overall frequency of CD45+ neutrophils at a local level in the lungs and systemically in the spleen (Figure 21B). Combined with a reduction in pro-inflammatory neutrophils, there was a synchronous increase in the frequency of immunomodulatory CD11+ dendritic cells in the lungs (Figure 21C). Furthermore, systemic administration of MBV reduced pro-inflammatory chemokines and cytokines compared to those elevated in long-term viral inflammation (Figure 3D, p<.05). Specifically, MBV reduced pulmonary concentrations of IL12, IL1-beta, MCP1, and KC (Figure 3D, p<.05).
[0305] (Example 14) Systemic administration of MBV induces a pro-memory immune response in both CD4 T-cells and CD8 T-cells. Compared to influenza + ivPBS, MBV iv administration not only promoted the resolution of inflammation and cellular infiltration in virus-mediated pulmonary pathology, but also promoted the memory immune response. Specifically, systemic administration of MBV increased the frequency of CD621+ / CD44+ memory CD4 and CD8 T-cells compared to the influenza + ivPBS group (Figure 22A and 22B, p<.05).
[0306] (Example 15) Virus-related tissue damage and extracellular matrix deposition are reduced by systemic administration of MBV. Twenty-one days after H1N1 vaccination, systemic MBV compared to influenza + ivPBS significantly reduced virus-related tissue damage and new extracellular matrix deposition, as visualized on trichrome images quantified by quPath artificial intelligence (Figures 23A and 23B, p<.05).
[0307] The results show that animals treated with MBV exhibited a significantly reduced viral morbidity compared to untreated control animals. Even more surprisingly, infected animals treated with MBV showed reduced lung injury and inflammation, as observed in white blood cell counts and cytokine levels. These data demonstrate that MBV administration is an effective therapeutic agent for immunomodulation of diseases and disorders resulting in acute respiratory distress, and that MBV can reduce the severity or incidence of ARDS induced by viral infection. This provides an effective treatment for ARDS, among other indications, for viral diseases for which there are no existing treatments, such as those caused by H1N1 or SARS-CoV-2. The data also provide methods for treating other influenza and coronavirus-induced respiratory diseases.
[0308] (Example 16) Materials and methods for Examples 17-19 The quadriceps muscle is first decellularized with 0.02% trypsin and 0.05% EDTA, disinfected with 0.01% peracetic acid, and then enzymatically digested with liberase TH in a buffer solution (50 mM Tris pH 7.5, 5 mM CaCl2, 150 mM NaCl) overnight at room temperature to release MBV from the ECM.
[0309] Exosomes were isolated from C57Bl6 mouse plasma obtained from Innovative Research.
[0310] cMVs were isolated from 17IIA pre-odontoblast cells, as previously described in Chaudhary et al. Matrix Biol. 52-54:284-300, 2016. Briefly, osteogenic differentiation of 17IIA cells was induced over 24 hours using 10 mM Na-Pi buffer (pH 7.4) and 50 μg / ml ascorbic acid, followed by enzymatic digestion with 1 mg / ml collagenase IA in buffer at 37°C for 2 hours.
[0311] Isolation of vesicles: Following the appropriate preparation as described above, the sample was subjected to centrifugation at 500 × g for 10 minutes, 2,500 × g for 20 minutes, and 10,000 × g for 30 minutes to remove cells and ECM debris, and the supernatant was passed through a 0.22 μm filter. The clarified supernatant containing the vesicles was then centrifuged at 100,000 × g (Beckman Coulter Optima L-90K Ultracentrifuge) at 4°C for 70 minutes to pellet the vesicles. The vesicle pellet was resuspended in 1 × PBS, divided into aliquots, and stored at -20°C until further use.
[0312] Characterization of vesicular protein markers: Vesicular subtypes were analyzed to determine the expression levels of protein markers commonly associated with exosomes. Protein markers were analyzed using 50 μg of vesicular protein with the Exo-Check® exosome antibody array (System Biosciences). The relative expression of each analyzed protein was quantified using ImageJ.
[0313] Isolation and treatment of mouse bone marrow-derived macrophages: Bone marrow-derived macrophages were isolated from the tibia and femur of C57Bl6 mice, as previously described by Sicari et al., Biomaterials 35:8605-8612, 2014. The collected mononuclear cells were processed into 2 × 10⁶ cells. 6 Monocytes were seeded at a cell / mL ratio and differentiated into macrophages by culturing in macrophage colony-stimulating factor (MCSF)-containing medium at 37°C and 5% CO2 for 7 days. The resulting cells were referred to as naive macrophages. Naive macrophages were exposed to one of the following treatments for 24 hours: 1) LPS / IFNγ to induce M1 macrophages, 2) IL-4 to induce M2 macrophages, 3) 1 × 10⁻¹⁶ 9 Plasma exosomes at particle / mL, 4) 1 × 10 9 17 IIA cMV particles / mL, or 5) 1 × 10 9 Muscle MBV in particles / mL.
[0314] Gene Expression: After 24 hours, RNA was recovered using Trizole. 1000 ng of RNA was converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific) according to the manufacturer's instructions. Real-time qPCR was performed using PowerUp® SYBR® Green Master Mix. Relative gene expression was compared to the untreated (M0) control. -ΔΔCt It was decided by law.
[0315] Statistical analysis: Significant comparisons between groups were determined using two-way analysis of variance (ANOVA) and post-hoc analysis with Tukey correction. All statistical analyses were completed using GraphPad Prism. * P<0.05, ** P<0.01, *** P<.001.
[0316] (Example 17) MBV does not express either CD63 or CD81, which are common exosome markers. The presence or absence of common exosome markers on mouse exosomes, mouse bone marrow matrix vesicles (bone MVs), and mouse matrix-bound nanovesicles (MBVs) was compared using the EXO-CHECK® exosome antibody array (System Biosciences). The results are shown in the upper panel of Figure 24, clearly showing that MBVs are virtually devoid of standard, well-accepted exosome markers, such as CD63 and CD81. Furthermore, other signaling molecules identified in the upper panel of Figure 24 were absent in MBVs, while they were present to either moderate or high levels in bone microvesicles and exosomes. Densitometry plots of expression levels are shown in the lower panel of Figure 24.
[0317] The data show that exosomes and bone MVs share similar expression profiles with moderate to high expression of these markers, but MBVs differ significantly in the expression of these EV markers. For example, MBVs also have one or more of EpCAM, ANXA5, TSG101, FLOT1, ICAM1, and ALIX at “low” or “undetectable” levels, as indicated by the presence of a dark ring or a dark spot in the filled well compared to the same location on the exosome well, and by the relative expression levels of these markers shown in the graph in the lower panel. Bone MVs also have higher levels of expression of all of these markers compared to MBVs, as indicated by the dark spots on the well and by the relative expression levels of these markers shown in the graph in the lower panel.
[0318] In one embodiment, MBV has one or more of CD63, CD81, EpCAM, ANXA5, TSG101, FLOT1, ICAM1, and ALIX in low or undetectable levels compared to a positive control of the EXO-CHECK® exosome antibody array. In one embodiment, MBV has one or more of CD63, CD81, EpCAM, ANXA5, TSG101, FLOT1, ICAM1, and ALIX in low or undetectable levels compared to exosomes, e.g., plasma exosomes. In one embodiment, MBV has one or more of Cd63, CD81, EpCAM, ANXA5, TSG101, FLOT1, ICAM1, and ALIX in low or undetectable levels compared to bone MV. In one embodiment, MBV is characterized by ANXA5, TSG101, and ICAM1 in low or undetectable levels compared to exosomes or bone MV. In one embodiment, MBVs are characterized by CD81, CD63, ANXA5, TSG101, and ICAM1 at low or undetectable levels compared to bone MVs or plasma exosomes.
[0319] (Example 18) MBV is characterized by low or no expression of bone MV markers. The expression of the bone microvesicle marker annexin V and tissue-nonspecific alkaline phosphatase (TNAP) was evaluated by Western blot analysis. The results are shown in Figure 25. Lysates prepared from 1711A cells were used as a positive control. The results of this experiment show that matrix-bound nanovesicles (MBVs) lack expression of both TNAP and annexin V, markers for bone microvesicles. Plasma exosomes express annexin V but not TNAP. These results clearly distinguish MBVs from both exosomes and bone microvesicles.
[0320] (Example 19) MBV has differential immunomodulatory effects compared to exosomes or bone MV. Bone marrow-derived macrophages (BMDMs) collected from mice were either left untreated (M0) or treated for 24 hours with the following test items: IFNγ+LPS (M1) to induce the M1 phenotype, IL-4 (M2) to induce the M2-like phenotype, plasma-derived exosomes, bone microvesicles (MVs) derived from 17A cells, or MBV isolated from muscle. After treatment, ploidy changes in the expression of the indicated genes were evaluated by qPCR. The results shown in Figure 26 demonstrate that the downregulation of the pro-inflammatory markers IL-6 and TNF-α by MBV is clearly distinguishable from the downregulation of the same two inflammatory mediators by exosomes and bone microvesicles. MBV had a potent anti-inflammatory effect; however, exosomes and bone microvesicles did not.
[0321] Built-in by reference Unless otherwise argued, the full disclosures of each patent document and scientific paper referenced herein are incorporated by reference for all purposes.
[0322] Equal portions The present invention may be embodied in other specific forms without departing from its spirit or essential features. Therefore, the embodiments described above should be considered, in all embodiments, as illustrative rather than limiting, the invention described herein. Accordingly, the scope of the invention is indicated by the appended claims rather than the foregoing description, and all variations falling within the meaning and scope of the equivalents of the claims are intended to be accepted herein. The present invention provides, for example, the following items: (Item 1) A method for treating or preventing acute respiratory distress syndrome (ARDS) in a subject at risk of developing ARDS, comprising the step of administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of isolated matrix-bound vesicles (MBVs) derived from the extracellular matrix, thereby treating or preventing ARDS in the subject. (Item 2) The method according to item 1, wherein the subject has a lung infection of which originates from a virus, bacteria, or fungus. (Item 3) The method according to item 1 or 2, wherein the subject has a pulmonary infection caused by a virus selected from the group consisting of SARS-CoV2, SARS-CoV, MERS-CoV, Ebola virus, influenza virus, cytomegalovirus, or herpesvirus. (Item 4) The method according to any one of items 1 to 3, wherein the subject has pneumonia. (Item 5) The method described in any one of items 1 to 4, wherein the subject is infected with SARS-CoV-2 or COVID-19. (Item 6) The method according to any one of items 1 to 5, wherein the subject has influenza. (Item 7) The method according to any one of items 1 to 6, wherein the subject has SARS or MERS. (Item 8) The method described in any one of items 1 to 7, wherein the subject inhales a toxic substance. (Item 9) The method according to item 8, wherein the toxic substance is smoke, chemical fogging, or vapor from vaping. (Item 10) The method according to any one of items 1 to 9, wherein the subject has water, vomit, or food aspirated into the lungs. (Item 11) The method according to any one of items 1 to 10, wherein the subject has a head or chest injury that damages the lungs or a portion of the brain that controls respiration. (Item 12) The method according to any one of items 1 to 11, wherein the subject has sepsis. (Item 13) The method according to any one of items 1 to 12, wherein the subject has pancreatitis. (Item 14) The method according to any one of items 1 to 13, wherein the subject has severe burns. (Item 15) The method described in any one of items 1 to 14, wherein the subject has received a massive blood transfusion. (Item 16) The method described in any one of items 1 to 15, wherein the subject is experiencing hypercytokinemia. (Item 17) The method according to item 16, wherein the administration of MBV reverses hypercytokinemia in the subject. (Item 18) The method according to any one of items 1 to 17, wherein the MBV is administered to the subject prior to the onset of ARDS in order to prevent the onset of ARDS. (Item 19) The method according to any one of items 1 to 17, wherein the MBV is administered to the subject after the onset of ARDS in order to treat the ARDS and prevent the progression of ARDS. (Item 20) The method described in any one of items 1 to 19, wherein the subject is a human subject. (Item 21) The method according to any one of items 1 to 20, wherein the pharmaceutical composition is administered by systemic intravenous (IV) injection. (Item 22) The method according to item 21, wherein the systemic intravenous injection is via a standard IV line or central line. (Item 23) The method according to item 22, wherein the central line is a peripherally inserted central catheter (PICC), a tunnel catheter, or an implantable port. (Item 24) The method according to item 23, wherein the standard IV line is located in a vein in the wrist, arm, or hand. (Item 25) The method according to any one of items 20 to 24, wherein the intravenous injection is a bolus injection, a continuous infusion, or a pump injection. (Item 26) The method according to any one of items 1 to 20, wherein the pharmaceutical composition is administered to the lungs of the subject as an aerosol by a nebulizer. (Item 27) The method according to any one of items 1 to 20, wherein the pharmaceutical composition is administered by intratracheal drip infusion through an endotracheal tube placed in the subject. (Item 28) The method according to any one of items 1 to 20, wherein the pharmaceutical composition is administered to the lungs by a metered-dose inhaler via intranasal administration. (Item 29) (i) The MBV does not express one or more of CD63, CD81 and / or CD9, or has CD63, CD81 and / or CD9 at barely detectable levels, and / or (ii) The MBV is as follows: (a) Phospholipid content containing at least 55% phosphatidylcholine (PC) and phosphatidylinositol (PI), (b) Phospholipid content containing 10% or less sphingomyelin (SM), (c) Phospholipid content containing 20% or less phosphatidylethanolamine (PE), and / or (d) Phospholipid content containing 15% or more phosphatidylinositol (PI) The method described in any one of items 1 through 28, including the method described in item 1 through 28. (Item 30) The method according to any one of items 1 to 29, wherein the MBV is derived from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. (Item 31) The method according to any one of items 1 to 30, wherein the MBV is derived from the bladder matrix (UBM), the submucosal tissue of the small intestine (SIS), or the submucosal tissue of the bladder (UBS). (Item 32) The method according to any one of items 1 to 31, wherein the MBV is derived from the extracellular matrix of a mammalian vertebrate selected from humans, monkeys, pigs, cattle, or sheep. (Item 33) The aforementioned MBV is 1 × 10⁶ per kg of body weight per dose. 6 ~1×10 20 The method described in any one of items 1 to 32, administered in the amount of MBV. (Item 34) The aforementioned MBV is 1 × 10⁶ per kg of body weight per dose. 6 ~1×10 12 The method described in any one of items 1 to 33, administered in the amount of MBV. (Item 35) The aforementioned MBV is 1 × 10⁶ per kg of body weight per dose. 9 ~1×10 14 The method described in any one of items 1 to 33, administered in the amount of MBV. (Item 36) The method described in any one of items 1 to 35, wherein the subject receives antibiotic, antiviral, or anti-inflammatory drug therapy. (Item 37) The method according to any one of items 1 to 36, wherein the subject receives remdesivir, favipiravir, azithromycin, or hydroxychloroquine. (Item 38) The method according to any one of items 1 to 37, wherein the subject receives tocilizumab, anakinra, or a Janus kinase (JAK) inhibitor. (Item 39) The method according to any one of items 1 to 38, wherein the subject has a reduced risk of secondary infection as a result of treatment with MBV compared to a subject treated with an immunosuppressant. (Item 40) The method described in item 39, wherein the secondary infection is a pulmonary infection. (Item 41) The method according to item 39, wherein the secondary infection is a blood infection. (Item 42) The method according to item 39, wherein the secondary infection is in the heart, kidney, or liver. (Item 43) The method according to any one of items 39 to 42, wherein the secondary infection is a bacterial infection. (Item 44) The method according to any one of items 39 to 42, wherein the secondary infection is a viral infection. (Item 45) The method according to any one of items 1 to 44, wherein the oxygen saturation in the subject increases by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% after administration of the pharmaceutical composition. (Item 46) The method according to any one of items 1 to 44, wherein the oxygen saturation index in the subject increases by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% after administration of the pharmaceutical composition. (Item 47) The method according to any one of items 1 to 44, wherein the oxygen index in the subject increases by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% after administration of the pharmaceutical compound. (Item 48) The method according to any one of items 45 to 47, wherein the increase occurs within 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 18 hours, or 24 hours after administration of the pharmaceutical composition. (Item 49) The method according to any one of items 1 to 48, wherein the subject experiences a decrease in the production of pro-inflammatory cytokines after the administration of MBV. (Item 50) The method according to item 49, wherein the pro-inflammatory cytokine is one or more of TNF-α, IFN-γ, IL-8, IL-6, IL-1β, or IL-12. (Item 51) The method according to any one of items 1 to 50, wherein the subject experiences an increase in the production of anti-inflammatory cytokines after the administration of MBV. (Item 52) The method according to item 51, wherein the anti-inflammatory cytokine is TGF-β, IL-4, or IL-10. (Item 53) The method according to items 50-52, wherein the increase or decrease is measured by sampling bronchoalveolar lavage fluid from the lungs of the subject before and after administration of the MBV. (Item 54) The method according to items 50-53, wherein the increase or decrease is measured by sampling the subject's blood before and after the administration of the MBV. (Item 55) The step of administering the pharmaceutical composition to the subject is as follows: a) A decrease in the number of CD45+ neutrophils in the lungs of the subject, b) An increase in the number of CD8+ cells and a decrease in the number of CD4+ T cells in the lung or spleen of the subject, c) Increase in the number of CD69+CD4+ T cells in the spleen of the subject, d) Increase in the number of antiviral tbet+CD4+ T cells in the target lymph nodes, d) Increase in the number of antiviral tbet+CD8+ T cells in the spleen of the subject, e) Increase in the number of CD69+CD8+ t cells in the spleen of the subject, f) Increased number of immunomodulatory CD11b+ dendritic cells in the lungs, and g) Increased number of CD62L+ / CD44+ memory CD4 and CD8 T cells in the lungs A method described in any one of items 1 through 54, which results in one or more of the following. (Item 56) The method according to any one of items 1 to 55, wherein the step of administering the pharmaceutical composition to the subject reduces virus-related tissue damage in the subject. (Item 57) The method according to any one of items 1 to 56, wherein the MBV expresses one or more of the following markers at low or undetectable levels: EpCAM, ANXA5, TSG101, FLOT1, ICAM1, GM130, or ALIX. (Item 58) The method according to any one of items 1 to 56, wherein the MBV expresses one or more of the following markers: ANXA5, TSG101, or ICAM1, at low or undetectable levels. (Item 59) The method according to any one of items 1 to 56, wherein the MBV expresses low or undetectable levels of CD81, CD63, ANXA5, TSG101, and ICAM1. (Item 60) Use of isolated matrix-bound vesicles (MBVs) derived from the extracellular matrix to treat acute respiratory distress syndrome (ARDS).
Claims
1. A pharmaceutical composition comprising isolated matrix-bound vesicles (MBVs) derived from mammalian extracellular matrix for treating or preventing acute respiratory distress syndrome (ARDS) in subjects at risk of developing ARDS.
2. The pharmaceutical composition according to claim 1, wherein the subject has a lung infection whose origin is a virus, bacteria, or fungus.
3. The pharmaceutical composition according to claim 1 or 2, wherein the subject is a lung infection caused by a virus selected from the group consisting of SARS-CoV2, SARS-CoV, MERS-CoV, Ebola virus, influenza virus, cytomegalovirus, or herpesvirus.
4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the subject has pneumonia.
5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the subject is infected with SARS-CoV-2 or COVID-19.
6. The pharmaceutical composition according to any one of claims 1 to 5, wherein the subject is influenza.
7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the subject is SARS or MERS.
8. The pharmaceutical composition according to any one of claims 1 to 7, wherein the subject has inhaled a toxic substance.
9. The pharmaceutical composition according to claim 8, wherein the toxic substance is smoke, chemical fogging, or vapor produced by vaping.
10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the subject has water, vomit, or food inhaled into the lungs.
11. The pharmaceutical composition according to any one of claims 1 to 10, wherein the subject has a head or chest injury that damages the lungs or a part of the brain that controls respiration.
12. The pharmaceutical composition according to any one of claims 1 to 11, wherein the subject has sepsis.
13. The pharmaceutical composition according to any one of claims 1 to 12, wherein the subject has pancreatitis.
14. The pharmaceutical composition according to any one of claims 1 to 13, wherein the subject has severe burns.
15. The pharmaceutical composition according to any one of claims 1 to 14, wherein the subject has received a massive blood transfusion.
16. The pharmaceutical composition according to any one of claims 1 to 15, wherein the subject experiences hypercytokinemia.
17. The pharmaceutical composition according to claim 16, wherein the administration of MBV reverses hypercytokinemia in the subject.
18. The pharmaceutical composition according to any one of claims 1 to 17, wherein the MBV is administered to the subject prior to the onset of ARDS in order to prevent the onset of ARDS.
19. The pharmaceutical composition according to any one of claims 1 to 17, wherein the MBV is administered to the subject after the onset of ARDS in order to treat the ARDS and prevent the progression of ARDS.
20. The pharmaceutical composition according to any one of claims 1 to 19, wherein the subject is a human subject.
21. The pharmaceutical composition according to any one of claims 1 to 20, wherein the pharmaceutical composition is administered by systemic intravenous (IV) injection.
22. The pharmaceutical composition according to claim 21, wherein the systemic intravenous injection is administered via a standard IV line or a central line.
23. The pharmaceutical composition according to claim 22, wherein the central line is a peripheral insertion central catheter (PICC), a tunnel-type catheter, or an implantable port.
24. The pharmaceutical composition according to claim 22, wherein the standard IV line is located in a vein in the wrist, arm, or hand.
25. The pharmaceutical composition according to any one of claims 21 to 24, wherein the intravenous injection is a bolus injection, a sustained infusion, or a pump injection.
26. The pharmaceutical composition according to any one of claims 1 to 20, wherein the pharmaceutical composition is administered to the lungs of the target as an aerosol by a nebulizer.
27. The pharmaceutical composition according to any one of claims 1 to 20, wherein the pharmaceutical composition is administered by intratracheal drip infusion via an endotracheal tube placed on the target.
28. The pharmaceutical composition according to any one of claims 1 to 20, wherein the pharmaceutical composition is administered to the lungs by a metered-dose inhaler via intranasal administration.
29. The pharmaceutical composition according to any one of claims 1 to 28, wherein the MBV does not express one or more of CD63, CD81, and / or CD9, or has CD63, CD81, and / or CD9 at a barely detectable level.
30. The MBV is as follows: (a) Phospholipid content including at least 55% phosphatidylcholine (PC) and phosphatidylinositol (PI), (b) Phospholipid content containing 10% or less sphingomyelin (SM), (c) Phospholipid content containing 20% or less phosphatidylethanolamine (PE), and / or (d) Phospholipid content containing 15% or more phosphatidylinositol (PI) A pharmaceutical composition according to any one of claims 1 to 29, comprising:
31. The pharmaceutical composition according to any one of claims 1 to 30, wherein the MBV is derived from the extracellular matrix of a mammal from the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus.
32. The pharmaceutical composition according to any one of claims 1 to 31, wherein the MBV is derived from the bladder matrix (UBM), the submucosal tissue of the small intestine (SIS), or the submucosal tissue of the bladder (UBS).
33. The pharmaceutical composition according to any one of claims 1 to 32, wherein the mammalian extracellular matrix is derived from human, monkey, pig, cattle, or sheep.
34. The aforementioned MBV is 1 x 10 per kg of body weight per dose. 6 ~1 x 10 20 A pharmaceutical composition according to any one of claims 1 to 33, administered in an amount of MBV.
35. The aforementioned MBV is 1 x 10 per kg of body weight per dose. 6 ~1 x 10 12 A pharmaceutical composition according to any one of claims 1 to 34, administered in an amount of MBV.
36. The aforementioned MBV is 1 x 10 per kg of body weight per dose. 9 ~1 x 10 14 A pharmaceutical composition according to any one of claims 1 to 34, administered in an amount of MBV.
37. The pharmaceutical composition according to any one of claims 1 to 36, wherein the subject receives antibiotic, antiviral, or anti-inflammatory drug therapy.
38. The pharmaceutical composition according to any one of claims 1 to 37, wherein the subject receives remdesivir, favipiravir, azithromycin, or hydroxychloroquine.
39. The pharmaceutical composition according to any one of claims 1 to 38, wherein the subject is tocilizumab, anakinra, or a Janus kinase (JAK) inhibitor.
40. The pharmaceutical composition according to any one of claims 1 to 39, wherein the subject has a reduced risk of secondary infection as a result of treatment with MBV compared to a subject treated with an immunosuppressant.
41. The pharmaceutical composition according to claim 40, wherein the secondary infection is a pulmonary infection.
42. The pharmaceutical composition according to claim 40, wherein the secondary infection is a blood infection.
43. The pharmaceutical composition according to claim 40, wherein the secondary infection is in the heart, kidney, or liver.
44. The pharmaceutical composition according to any one of claims 40 to 43, wherein the secondary infection is a bacterial infection.
45. The pharmaceutical composition according to any one of claims 40 to 43, wherein the secondary infection is a viral infection.
46. The pharmaceutical composition according to any one of claims 1 to 45, wherein the oxygen saturation in the subject increases by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% after administration of the pharmaceutical composition.
47. The pharmaceutical composition according to any one of claims 1 to 45, wherein the oxygen saturation index in the subject increases by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% after administration of the pharmaceutical composition.
48. The pharmaceutical composition according to any one of claims 1 to 45, wherein the oxygen index in the subject increases by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% after administration of the pharmaceutical composition.
49. The pharmaceutical composition according to any one of claims 46 to 48, wherein the increase occurs within 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 18 hours, or 24 hours after administration of the pharmaceutical composition.
50. The pharmaceutical composition according to any one of claims 1 to 49, wherein the subject experiences a decrease in the production of pro-inflammatory cytokines after administration of MBV.
51. The pharmaceutical composition according to claim 50, wherein the pro-inflammatory cytokine is one or more of TNF-α, IFN-γ, IL-8, IL-6, IL-1β, or IL-12.
52. The pharmaceutical composition according to any one of claims 1 to 51, wherein the subject experiences an increase in the production of anti-inflammatory cytokines after administration of MBV.
53. The pharmaceutical composition according to claim 52, wherein the anti-inflammatory cytokine is TGF-β, IL-4, or IL-10.
54. The pharmaceutical composition according to any one of claims 51 to 53, wherein the increase or decrease is measured by sampling bronchoalveolar lavage fluid from the lungs of the subject before and after administration of the MBV.
55. The pharmaceutical composition according to any one of claims 51 to 53, wherein the increase or decrease is measured by sampling the blood of the subject before and after administration of the MBV.
56. The administration of the pharmaceutical composition to the subject is as follows: a) A decrease in the number of CD45+ neutrophils in the lungs of the subject, b) An increase in the number of CD8+ cells and a decrease in the number of CD4+ T cells in the lung or spleen of the subject, c) Increase in the number of CD69+CD4+ T cells in the spleen of the subject, d) Increase in the number of antiviral tbet+CD4+ T cells in the target lymph nodes, d) Increase in the number of antiviral tbet+CD8+ T cells in the spleen of the subject, e) Increase in the number of CD69+CD8+ T cells in the spleen of the subject, f) Increase in the number of immunomodulatory CD11b+ dendritic cells in the lungs of the subject, and g) Increase in the number of CD62L+ / CD44+ memory CD4 and CD8 T cells in the lungs of the subject. A pharmaceutical composition according to any one of claims 1 to 55, which provides one or more of the above.
57. The pharmaceutical composition according to any one of claims 1 to 56, wherein administration of the pharmaceutical composition to the subject reduces virus-related tissue damage in the subject.
58. The pharmaceutical composition according to any one of claims 1 to 57, wherein the MBV expresses one or more of the following markers at low or undetectable levels: EpCAM, ANXA5, TSG101, FLOT1, ICAM1, GM130, or ALIX.
59. The pharmaceutical composition according to any one of claims 1 to 57, wherein the MBV expresses one or more of the following markers: ANXA5, TSG101, or ICAM1, at low or undetectable levels.
60. The pharmaceutical composition according to any one of claims 1 to 57, wherein the MBV expresses low or undetectable levels of CD81, CD63, ANXA5, TSG101, and ICAM1.
61. A composition comprising isolated matrix-bound vesicles (MBVs) derived from mammalian extracellular matrix for the treatment of acute respiratory distress syndrome (ARDS).
Citation Information
Patent Citations
Matrix bound vesicles (MBVS) containing il-33 and their use
WO2019213482A1