Skeletal muscle function enhancer

Abstract

To provide a skeletal muscle function improver, an irisin production promoter and an energy metabolism promoter which contain Malpighia glabra, allow for continuous daily use, and are effective and safe.SOLUTION: Malpighia glabra has markedly excellent actions of improving skeletal muscle function, promoting irisin production, and promoting energy metabolism, so that it can be used as food, quasi drugs, or pharmaceuticals having the actions of improving skeletal muscle function, promoting irisin production, and promoting energy metabolism.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a skeletal muscle function improver characterized by containing Acerola. More specifically, it relates to an irisin production promoter and an energy metabolism promoter characterized by containing Acerola.

Background Art

[0002] Skeletal muscle is an essential organ for supporting the body, such as standing, walking, holding objects, and maintaining posture, and plays a very important role in leading a healthy daily life. However, when it becomes difficult to move due to the decline of physical functions with aging or the influence of diseases and injuries, the function of skeletal muscle deteriorates, such as gradual atrophy of skeletal muscle and decline in muscle strength.

[0003] In order to maintain and improve the function of skeletal muscle, it is necessary to activate muscle cells that make up skeletal muscle. In recent years, myokine, a bioactive protein secreted from skeletal muscle, has attracted attention as a factor for activating muscle cells. Although multiple myokines have been reported, irisin, one of them, has been particularly noted as a myokine involved in improving systemic metabolism by exercise (Non-Patent Document 1).

[0004] Irisin is a peptide released into the blood when Fibronectin Type III Domein Containing 5 (FNDC5), a membrane protein mainly produced in skeletal muscle, is cleaved from the cell membrane of muscle cells. Irisin is transported throughout the body by blood circulation, bringing about effects such as neurogenic action, anti-inflammatory disease suppression action, immune cell activation action, antioxidant action, apoptosis induction action against cancer cells, etc., and is known to play an important role in various functions related to health maintenance, such as brain function, immune function, and inflammation regulation (Non-Patent Document 2). Also, it is known to act on white adipocytes and induce white adipocytes into beige cells (cells that actively produce heat), thereby promoting body fat burning (Non-Patent Document 3).

[0005] Irisin has been reported to act on skeletal muscle itself, effectively promoting muscle cell proliferation and hypertrophy by stimulating the secretion of growth factors, and alleviating muscle atrophy by suppressing the activity of proteolytic enzymes (Non-Patent Literature 4). Therefore, promoting irisin production in skeletal muscle is one beneficial method for activating muscle cells.

[0006] Another method for activating muscle cells is to activate mitochondria. Mitochondrial activation can be achieved by activating peroxisome proliferative activated receptor gamma coactivator 1 alpha (PGC1α), an activator of transcription factors involved in regulating mitochondrial genes in muscle cells; peroxisome proliferative activated receptor alpha (PPARα) and peroxisome proliferative activated receptor gamma (PPARγ), nuclear receptors involved in energy metabolism; uncoupling protein 2 (UCP2) and uncoupling protein 3 (UCP3), which are mitochondrial uncoupling proteins; and insulin-like growth factor 1 (IGF1), a growth factor involved in muscle hypertrophy.

[0007] Mitochondria are important organelles that synthesize the energy necessary for the contraction and relaxation of skeletal muscle. In skeletal muscle with high mitochondrial activity, energy synthesis is more vigorous, making mitochondrial activation crucial for improving skeletal muscle function. Furthermore, mitochondrial activation is thought to be effective in promoting energy metabolism and improving athletic performance (Non-Patent Literature 5).

[0008] To improve skeletal muscle function, it is necessary to promote irisin production in muscle cells and activate mitochondria, and these can be achieved through exercise (Non-patent documents 1, 6). Activating muscle cells through exercise and promoting irisin production or mitochondrial activation is extremely important for maintaining Quality of Life (QOL).

[0009] However, in modern society, lifestyles tend to be irregular, and maintaining a regular exercise routine is not easy. Furthermore, age-related decline in physical function, or the effects of illness or injury, often make exercise itself difficult. Lack of exercise, aging, illness, and injury can lead to a decrease in myokine production, a decrease in mitochondria, and mitochondrial dysfunction (Non-Patent Literature 7). In addition, it has been reported that a decline in overall bodily function increases the risk of fractures due to falls and aspiration pneumonia (Non-Patent Literature 8). As described above, improving skeletal muscle function can be expected to improve overall physical health, particularly in the improvement of locomotive syndrome and frailty, enhanced exercise performance, and promotion of body fat burning.

[0010] Therefore, if it becomes possible to improve skeletal muscle function by activating muscle cells with stimuli that do not necessarily require exercise, thereby promoting irisin production and mitochondrial activation in muscle cells, the above-mentioned problems can be addressed. From this perspective, one compound being studied as an exercise mimetic is 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). This compound has been reported to increase glucose uptake and mitochondrial enzyme activity in muscle cells by substituting some of the physiological activity caused by exercise, similar to exercise (Non-Patent Literature 9).

[0011] However, because AICAR's effects occur in cells throughout the body, it also affects organs other than skeletal muscle. In particular, it can cause many side effects, such as accelerated cell death in various organs throughout the body and increased appetite by the hypothalamus, making long-term administration difficult (Non-patent Literature 10).

[0012] Therefore, there is a need to develop food-derived skeletal muscle function enhancers that are highly safe and can be taken continuously over a long period of time. To date, myoblast activators containing ingredients such as thorny pear and Agaricus mushroom (Patent Document 1) and myocyte activators containing adzuki bean extract (Patent Document 2) have been proposed, but there is a need for proposals for more effective food-derived skeletal muscle function enhancers.

[0013] In light of this situation, the inventors conducted tests using various foods and found that acerola has an excellent effect in improving skeletal muscle function. Acerola is known to exhibit activity in reducing triglyceride absorption (Patent Document 3), activity in preventing arteriosclerosis (Patent Document 4), and antioxidant activity (Patent Document 5), but no skeletal muscle function improving agent characterized by containing acerola is known at all. [Prior art documents] [Patent Documents]

[0014] [Patent Document 1] Japanese Patent Publication No. 2008-156294 [Patent Document 2] Japanese Patent Publication No. 2007-230965 [Patent Document 3] Japanese Patent Publication No. 2005-154432 [Patent Document 4] Japanese Patent Publication No. 2011-052028 [Patent Document 5] Japanese Patent Publication No. 2018-035080 [Non-patent literature]

[0015] [Non-Patent Document 1] Nature Vol.481(7382) 463-468(2012)

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Non-Patent Document 8

Non-Patent Document 9

Non-Patent Document 10

Summary of the Invention

Problems to be Solved by the Invention

[0016] The present invention relates to a skeletal muscle function improving agent characterized by containing Acerola. More specifically, it relates to an agent for promoting the production of ericinol and an agent for promoting energy metabolism, which are characterized by containing Acerola.

Means for Solving the Problems

[0017] As a result of intensive research, the present inventors have found that Acerola has an excellent effect of promoting the production of ericinol and an effect of promoting energy metabolism.

[0018] The acerola used in this study can be Malpighia emarginata DC., a plant belonging to the Malpighiaceae family. Acerola, also known as Barbados cherry, is thought to originate from the West Indies and is cultivated mainly in tropical regions such as Brazil and the Caribbean. The part of the acerola used in this invention is not particularly limited, but examples include leaves, fruits, seeds, and bark, with the use of the fruit being particularly preferred.

[0019] The acerola used in this invention can be used as is, or, if necessary, processed by juicing, drying, crushing, or shredding can be used. Extracts obtained by extracting acerola as is or after the above processing can also be used. Examples of solvents for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, petroleum ether, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). These solvents may be used individually or in mixtures of two or more. In this invention, it is preferable to use fruit juice or fruit juice extract obtained by juicing the acerola fruit.

[0020] The above extract may be used as is, or it may be treated as needed by concentration, dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, fermentation, etc. Furthermore, the extracted solution may be treated by concentration to dryness, spray drying, freeze-drying, etc., and used as a dried product.

[0021] The amount of acerola used in this invention can be appropriately adjusted depending on the administration method, purpose of use, age, weight, etc. For adults, the daily intake of acerola can be in the range of 0.05 to 3000 mg, preferably 10 to 2000 mg, in terms of acerola fruit, taken orally once to several times a day. In some cases, a smaller amount than the above range may be sufficient, while in other cases, it may be necessary to consume more than the range. Furthermore, the method of adding the active ingredient in the formulation can be either added beforehand or during manufacturing; the appropriate method should be chosen based on ease of handling.

[0022] The skeletal muscle function enhancer, irisin production promoter, and energy metabolism promoter of the present invention can be used as food, quasi-drugs, and pharmaceuticals. As food, they can be used as soft capsules, hard capsules, granules, tablets, gummies, beverages, jellies, etc. As quasi-drugs and pharmaceuticals, they can be used as oral capsules, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, liquids, emulsions, etc., and as parenteral eye drops, injections, suppositories, topical skin preparations, etc. In order to achieve the objectives of the present invention, oral administration is preferred.

[0023] The skeletal muscle function enhancer, irisin production promoter, and energy metabolism promoter of the present invention may, as necessary and within limits that do not impair their effects, contain ingredients commonly used in foods, quasi-drugs, or pharmaceuticals, such as excipients, stabilizers, lubricants, preservatives, binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH adjusters, preservatives, and fragrances. Furthermore, they may also contain ingredients such as plant materials, polyphenols, vitamins, sugars, proteins, and oils. [Effects of the Invention]

[0024] The present invention provides a skeletal muscle function enhancer, irisin production promoter, and energy metabolism promoter, characterized by containing acerola, which possess extremely excellent skeletal muscle function enhancer, irisin production promoter, and energy metabolism promoter effects. [Modes for carrying out the invention]

[0025] The following examples are illustrative and the claims of the present invention are not limited in any way to these examples. The percentages of content shown in the examples are in weight percentages. [Examples]

[0026] Manufacturing Example 1: Acerola Juice Extract 1 kg of acerola fruit was juiced to obtain 700 mL of juice. 2 L of purified water was added to 500 mL of this juice, and 0.8% yeast was added to the resulting juice. The juice was fermented at 37°C for 30 hours. After fermentation, the yeast was removed and inactivated, and 10 g of dextrin was added and dissolved. After dissolution, the mixture was spray-dried to obtain 20 g of acerola juice extract.

[0027] Production Example 2: Acerola Fruit Hot Water Extract 100g of acerola fruit was mixed with 2L of purified water and extracted at 95-100°C for 2 hours. The filtrate was then concentrated and freeze-dried to obtain 9.6g of acerola fruit hot water extract.

[0028] Manufacturing Example 3: Acerola Fruit 30% Ethanol Extract 100 g of acerola fruit was mixed with 1.4 L of purified water and 0.6 L of ethanol, and after extraction at room temperature for 5 days, the filtrate was concentrated to dryness to obtain 2.4 g of acerola fruit 30% ethanol extract.

[0029] Manufacturing Example 4: Acerola Fruit 50% Ethanol Extract 100g of acerola fruit was mixed with 1L of purified water and 1L of ethanol, and extracted at room temperature for 5 days. The filtrate was then concentrated to dryness to obtain 2.1g of acerola fruit 50% ethanol extract.

[0030] Next, we will give an example of a formulation using acerola, but the present invention is not limited thereto. [Examples]

[0031] Prescription example 1: Tablets <Prescription> Component Content (%) 1. Acerola fruit juice extract (Manufacturing example 1) 1.0 2. Add maltitol so that the total amount becomes 100. 3. Cellulose 5.0 4. Sucrose fatty acid ester 3.0 <Manufacturing method> Components 1-3 were mixed, 10% water was added as a binder, and the mixture was granulated in a fluid bed. Component 4 was added to the formed granules and mixed, and then compressed into tablets to obtain 300 mg tablets. <Usage> Take 3 tablets per day.

[0032] Prescription Example 2: Hard Capsules <Prescription> Component Content (%) 1. Acerola fruit hot water extract (production example 2) 20.0 2. Add cornstarch until the total amount is 100. 3. Sucrose fatty acid ester 3.0 <Manufacturing method> Components 1-3 were mixed and filled into No. 2 hard capsules with 250 mg each to obtain hard capsules. <Usage> Take two tablets per day.

[0033] Prescription Example 3: Soft Capsules <Prescription> Component Content (%) 1. Acerola fruit juice extract (Manufacturing example 1) 0.2 2. Add medium-chain triglyceride oil until the total amount is 100. 3. Beeswax 5.0 4. Glycerin fatty acid ester 5.0 5. Vitamin E 3.0 <Manufacturing method> Components 1-5 were mixed, and 250 mg of the mixture was filled into a coating composed of starch, carrageenan, reduced starch syrup, and glycerin. After drying, soft capsules were obtained. <Usage> Take 3 tablets per day. [Examples]

[0034] Test Example 1: Acerola's effect on promoting irisin production. Mouse myoblasts C2C12 were cultured in DMEM containing 10% fetal bovine serum. Next, they were cultured in DMEM containing 5% horse serum (hereinafter referred to as differentiation medium) to differentiate into myotubes. After differentiation, the differentiation medium was replaced with 200 μM AICAR and acerola juice extract (Production Example 1) dissolved at concentrations of 1 μg / mL, 10 μg / mL, and 100 μg / mL, and cultured for 24 hours, followed by gene expression analysis. Similarly, the medium was replaced with acerola juice extract (Production Example 1) dissolved at 100 μg / mL, and cultured for 3 hours, 6 hours, and 24 hours, followed by gene expression analysis. Gene expression was evaluated by real-time PCR to assess the gene expression changes of FNDC5, a precursor of irisin. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal standard. Gene expression without sample addition was set to 1, and the gene expression ratio was calculated.

[0035] Primer set for FNDC5 CAAAGAACAAAGATGAGGTGACCA(Sequence 1) TTCTCCTTGTTGTTATTGGGCT(Sequence 2) Primer set for GAPDH TGGAGAAACCTGCCAAGTATG (Sequence 3) CCCTCAGATGCCTGCTTCA (sequence 4)

[0036] The results of Test Example 1 are shown in Tables 1 and 2. FNDC5 gene expression was elevated in a concentration-dependent and time-dependent manner with acerola juice extract (Production Example 1). Furthermore, the degree of elevation was superior to that of the positive control AICAR. These results indicate that acerola has excellent irisin production-promoting effects. The FNDC5 production-promoting effect was also confirmed by immunohistochemistry.

[0037] [Table 1]

[0038] [Table 2]

[0039] Test Example 2: Energy metabolism-promoting effect of acerola Mouse myoblasts C2C12 were cultured in DMEM containing 10% fetal bovine serum. Next, they were cultured in DMEM containing 5% horse serum (hereinafter referred to as differentiation medium) to differentiate into myotubes. After differentiation, the differentiation medium was replaced with a solution containing 200 μM AICAR and 100 or 200 μg / mL of acerola juice extract (Production Example 1), and the cells were cultured for 24 hours. Gene expression analysis was then performed. Real-time PCR was used to evaluate changes in gene expression for PGC1α, an activator of a transcription factor involved in mitochondrial gene regulation; PPARα and PPARγ, nuclear receptors involved in energy metabolism; UCP2 and UCP3, mitochondrial uncoupling proteins; and IGF1, a growth factor involved in muscle hypertrophy. GAPDH or β-actin was used as the internal standard. Gene expression without sample addition was set to 1, and the gene expression ratio was calculated.

[0040] Primer set for PGC1α GATGGCACGCAGCCCTATT (array 5) CGACACGGAGAGTTAAAGGAAGA (array 6) Primer set for PPARα ACGATGCTGTCCTCCTTGATG (array 7) ACTCGCGTGTGATAAAGCCATT(sequence 8) Primer set for PPARγ TCACAAGAGCTGACCCAATGG (Sequence 9) GATCGCACTTTGGTATTCTTGGA (array 10) Primer set for UCP2 GCCTCTGGAAAGGGACTTCTC(sequence 11) ACCAGCTCAGCACAGTTGACA (sequence 12) Primer set for UCP3 TTTTGCGGACCTCCTCACTT(sequence 13) TGGATCTGCAGACGGACCTT (array 14) Primer set for IGF1 GTTGCTTCCGGACGTGTGAT(array 15) GATAGAGCGGGCTGCTTTTG (array 16) Primer set for GAPDH TGGAGAAACCTGCCAAGTATG (Sequence 3) CCCTCAGATGCCTGCTTCA (sequence 4) Primer set for β-actin AGATGACCCAGATCATGTTTGAGA (Sequence 17) CACAGCCTGGATGGCTACGTA (sequence 18)

[0041] The results of Test Example 2 are shown in Table 3. Gene expression of PGC1α, PPARα, PPARγ, UCP2, UCP3, and IGF1 was enhanced with acerola juice extract (Production Example 1). From these results, acerola was found to have an energy metabolism-promoting effect. This effect was stronger than that of the positive control AICAR.

[0042] [Table 3]

[0043] Test Example 3: Effect of acerola in combination with exercise on promoting irisin production and energy metabolism. A silicone stretch chamber (32 mm x 32 mm) was coated with collagen, and mouse myoblasts C2C12 were cultured in DMEM containing 10% fetal bovine serum. Next, they were cultured in DMEM containing 5% horse serum (hereinafter referred to as differentiation medium) to differentiate into myotubes. After differentiation, the differentiation medium was replaced with a solution of acerola juice extract (production example 1) dissolved to a concentration of 100 μg / mL, and the chamber was set in a biochemical stretching device ST-140 (Strex Co., Ltd.). Stretch stimulation was applied for 1 hour in one axial direction at a stretching rate of 10% and a stretching speed of 0.5 Hz (a speed that completes one reciprocal movement of 10% over 2 seconds) to reproduce movement in the culture system, and then gene expression analysis was performed. Gene expression was evaluated using real-time PCR to assess changes in the expression of the following genes: FNDC5 (an irisin precursor), PGC1α (a transcript activator involved in mitochondrial gene regulation), PPARα and PPARγ (nuclear receptors involved in energy metabolism), UCP2 and UCP3 (mitochondrial uncoupling proteins), and IGF1 (a growth factor involved in muscle hypertrophy). GAPDH or β-actin was used as the internal standard. Gene expression in the sample-free environment was set to 1, and the gene expression ratio was calculated.

[0044] The results of Test Example 3 are shown in Table 4. Gene expression of FNDC5, PGC1α, PPARα, PPARγ, UCP2, UCP3, and IGF1 was enhanced by stretching stimulation and acerola juice extract (Production Example 1). Furthermore, the combined use of stretching stimulation and acerola juice extract (Production Example 1) enhanced the above gene expression compared to acerola juice extract alone. From these results, it was found that acerola and stretching stimulation have irisin production promoting and energy metabolism promoting effects, and even better effects were observed when used in combination.

[0045] [Table 4] [Industrial applicability]

[0046] Based on the above, the present invention can be used as a skeletal muscle function enhancer, irisin production promoter, and energy metabolism promoter containing acerola. By improving skeletal muscle function, it is expected to improve overall health, particularly locomotive syndrome and frailty, enhance athletic performance, and promote body fat burning. Furthermore, it can also be used as a skeletal muscle function enhancer, irisin production promoter, and energy metabolism promoter in vitro.

Claims

1. A skeletal muscle function improving agent containing acerola, characterized in that the improvement in skeletal muscle function is due to the promotion of FNDC5 production in skeletal muscle.

2. A food composition for improving skeletal muscle function containing acerola, characterized in that the improvement in skeletal muscle function is due to the promotion of FNDC5 production in skeletal muscle.

Images