Plasmonics sensing nanoplatform and method for human stem cell application

Plasmonics sensing nanoplatforms like the iMS nanoprobe system address the challenge of monitoring transplanted stem cell health in vivo, ensuring viability and functionality through optical signal detection, enhancing stem cell therapy efficacy.

JP7862798B2Active Publication Date: 2026-05-20DUKE UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2022546370
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-01-29
Filing Date
2021-01-29
Publication Date
2026-05-20
Estimated Expiration
2041-01-29

AI Technical Summary

Technical Problem

Current methods struggle to monitor the health status and functional viability of transplanted stem cells in vivo, leading to high mortality rates due to the lack of non-invasive real-time monitoring capabilities.

Method used

The development of plasmonics sensing nanoplatforms, such as iMS nanoprobe systems, which utilize plasmon-active nanoparticles and stem-loop nucleic acid probes to provide health status information through optical signals, enabling real-time monitoring of stem cell viability and functionality.

Benefits of technology

Enables non-invasive, real-time monitoring of stem cell health and functionality, potentially triggering timely interventions and improving the success of stem cell therapies by maintaining cell viability and functionality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007862798000004
    Figure 0007862798000004
  • Figure 0007862798000005
    Figure 0007862798000005
  • Figure 0007862798000006
    Figure 0007862798000006
Patent Text Reader

Abstract

A method for monitoring the viability of stem cell-derived cells used in stem cell therapy, comprising: introducing one or more stem cell-derived cells into a cell culture medium; introducing one or more nanoprobes into the cell culture medium, thereby transfecting the one or more stem cell-derived cells with the one or more nanoprobes; and detecting an optical signal from the one or more nanoprobes after transfection. The method may further comprise administering the one or more transfected stem cell-derived cells to a subject and detecting an optical signal from the one or more nanoprobes in vivo. The one or more stem cell-derived cells may comprise stem cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority to U.S. Provisional Patent Application No. 62 / 967,143, filed on January 29, 2020, the entire disclosure of which is incorporated herein by reference.

Background Art

[0002] Stem cell technology holds the promise of providing renewable types of therapeutics for regenerative medicine for a wide variety of diseases. Although there have been great advances in the in vitro differentiation of stem - cell - derived cells, tissues, and organoids, the survival of these cells in vivo often poses a significant barrier because most of the cells die immediately after transplantation. Currently, the ability to monitor the health status of transplanted cells using non - invasive readouts is still very difficult. To achieve this goal, there is a strong need to develop real - time, practical, and efficient sensing nanopatforms, systems, and methods for monitoring the viability, health status, and functional capabilities of transplanted stem - cell lines. Furthermore, such sensing capabilities will ultimately lead to important advances and improvements in stem - cell - based therapies because the sensing nanopatform can provide warning signals of cell non - functionality that trigger timely repair procedures and / or replacement of non - functional stem cells when needed.

Summary of the Invention

[0003] The summary is provided to introduce a selection of concepts that are further described below in the mode for carrying out the invention. This summary is not intended to identify key or essential features of the claimed subject matter, nor is it intended to be used as an aid in limiting the scope of the claimed subject matter.

[0004] In a first aspect of the present invention, an in vivo method for monitoring the viability of stem cell-derived cells used in stem cell therapy includes introducing one or more stem cell-derived cells having one or more nanoprobes, wherein the one or more nanoprobes are configured to provide health status information relating to one or more stem cell-derived cells, and detecting optical signals from the one or more nanoprobes after the introduction of the one or more stem cell-derived cells.

[0005] In this embodiment, the health status information of one or more stem cell-derived cells includes information regarding the viability, functional capacity, and / or health status of one or more stem cell-derived cells.

[0006] In a second aspect of the present invention, a method for monitoring the viability of stem cell-derived cells comprises introducing one or more stem cell-derived cells into a cell culture medium and introducing one or more nanoprobes into the cell culture medium so that one or more stem cell-derived cells are transfected with one or more nanoprobes, and detecting an optical signal from one or more nanoprobes after transfection. In this aspect, one or more nanoprobes include a plasmon-active nanoparticle and a stem-loop nucleic acid probe with one end bound to the nanoparticle, wherein the nucleic acid comprises a first sequence (stem-loop probe) and is labeled with an optical reporter, and an unlabeled capture placeholder nucleic acid chain comprising the stem-loop nucleic acid probe and a second sequence (placeholder). In another aspect of this aspect, transfection comprises electroporating a cell culture medium containing one or more stem cell-derived cells and one or more nanoprobes, wherein at least a portion of the one or more stem cell-derived cells remain viable after electroporation.

[0007] In a third aspect of the present invention, a method for transfecting stem cell-derived cells with nanoprobes using electroporation while maintaining the configuration of at least a portion of the nanoprobes comprises providing a cell culture medium containing one or more stem cell-derived cells and one or more nanoprobes having an initial configuration, and electroporating the cell culture medium containing one or more stem cell-derived cells and one or more nanoprobes, wherein at least a portion of the one or more nanoprobes maintain their initial configuration after electroporation.

[0008] In a fourth aspect of the present invention, a method for increasing the uptake of nanoprobes into stem cell-derived cells while maintaining the viability of stem cell-derived cells includes providing a cell culture medium containing one or more stem cell-derived cells and a plurality of nanoprobes, and electroporating the cell culture medium containing one or more stem cell-derived cells and a plurality of nanoprobes, wherein the amount of nanoprobes transfected into one or more stem cell-derived cells is greater than the amount that would have been transfected into one or more stem cell-derived cells if the transfection consisted only of passive uptake.

[0009] The accompanying drawings and examples are provided as illustrations, not as limitations. The aforementioned aspects and other features of this disclosure are described in the following description in relation to the accompanying illustrative drawings (also known as "Figures") relating to one or more embodiments. [Brief explanation of the drawing]

[0010] [Figure 1] This is a schematic diagram illustrating the operating principle of an "inverse molecular sentinel" (iMS) detection approach ("off-to-on" scheme) according to one embodiment of the present disclosure. [Figure 2] This figure shows the design of an iMS nanoprobe for miRNA biomarkers (miR-34a, miR-200-3p, and miR200c-3p) for cell apoptosis according to one embodiment of the present disclosure. [Figure 3] This figure shows a design of an iMS nanoprobe for the miRNA biomarker miR-34a using locked nucleic acid, according to one embodiment of the present disclosure. [Figure 4] This graph shows the "therapeutic window" in tissues and the absorption spectra of biological components. [Figure 5] The images above show (top) TEM images of nanostars formed under different Ag+ concentrations according to one embodiment of the present disclosure, and (bottom) images showing a simulation of the electric field |E| near the nanostar in response to a unit amplitude z-polarized plane wave incident E field. [Figure 6A] This is a schematic diagram illustrating the delivery of transfected stem cell-derived cells according to one embodiment of the present disclosure. [Figure 6B] This is a schematic diagram illustrating the delivery of transfected stem cell-derived cells according to one embodiment of the present disclosure. [Figure 7A] This is a schematic diagram illustrating the monitoring of the health status and functional viability of transfected stem cell-derived cells using a portable fiber-optic-based Raman diagnostic system according to one embodiment of the present disclosure. [Figure 7B] This is a schematic diagram illustrating the monitoring of the health and functional viability of transfected stem cell-derived cells using a handheld Raman reader. [Figure 8A] This graph shows the absorbance spectrum of a gold nanostar solution in citrate in citrate buffer according to one embodiment of the present disclosure. [Figure 8B] This is a graph showing the corresponding finite element method (FEM) generated absorption spectrum according to one embodiment of the present disclosure. [Figure 8C] This graph shows a scatter plot of the average polarization absorption for an aspect ratio (AR) adjusted by changing the branch height while keeping the base width, core and tip diameters and the number of branches constant, according to one embodiment of the present disclosure. [Figure 9] This is a schematic diagram of a gold nanoprobe for intracellular sensing within stem cells, according to one embodiment of the present disclosure. [Figure 10]Graph showing electroporation of INS1 cells with AuNS-PEG according to an embodiment of the present disclosure. [Figure 11A] Image showing the cells after electroporation according to an embodiment of the present disclosure. [Figure 11B] Image showing that the iMS signal remains "off" after electroporation according to an embodiment of the present disclosure. [Figure 12A] Image showing the cells after electroporation according to an embodiment of the present disclosure. [Figure 12B] Image showing that the iMS signal remains "on" after the electroporation protocol according to an embodiment of the present disclosure. [Figure 13] Graph showing SERS spectra at iMS "on" (upper curve) and iMS probe "off" (lower curve) according to an embodiment of the present disclosure. [Figure 14A] Graph showing the SERS spectrum of CEL-miR39 (Cy5) nanoprobe in solution according to an embodiment of the present disclosure. [Figure 14B] Graph showing the SERS spectrum of CEL-miR39 (Cy5) in INS1 cells according to an embodiment of the present disclosure. [Figure 15A] Graph showing inductively coupled plasma / mass spectrometry (ICP / MS) quantification of AuNS in hESCs 48 hours after electroporation (0.15 nM AuNS, OPTIMEM) according to an embodiment of the present disclosure. [Figure 15B] Graph showing inductively coupled plasma / mass spectrometry (ICP / MS) quantification of AuNS in hESCs 48 hours after electroporation (0.15 nM AuNS, OPTIMEM) according to an embodiment of the present disclosure. [Figure 16A] Graph showing ICP / MS quantification of AuNS in hESCs immediately after electroporation (0.15 nM AuNS, PBS) according to an embodiment of the present disclosure. [Figure 16B]Graph showing ICP / MS quantification of AuNS in hESCs immediately after electroporation (0.15 nM AuNS, PBS), according to one embodiment of the present disclosure. [Figure 17] A series of images showing multi-photon z-stack images of hESC cells 24 hours after electroporation with 0.15 nM AuNS, according to one embodiment of the present disclosure. [Figure 18] A series of flow cytometry images showing hESCs stained with DAPI 30 minutes after electroporation, according to one embodiment of the present disclosure. [Figure 19] A series of images showing bright-field images and fluorescence images of clusters at D1, D5, and D20 respectively (all clusters contain AuNS), according to one embodiment of the present disclosure. [Figure 20A] Graph showing ICP / MS quantification of AuNS at different stages of beta cell differentiation, according to one embodiment of the present disclosure. [Figure 20B] Graph showing ICP / MS quantification of AuNS at different stages of beta cell differentiation, according to one embodiment of the present disclosure. [Figure 21A] Flow cytometry analysis of D2 spheres electroporated with 0.15 nM AuNS, according to one embodiment of the present disclosure. [Figure 21B] Flow cytometry analysis of D2 spheres electroporated with 1.5 nM AuNS, according to one embodiment of the present disclosure. [Figure 22A] Flow cytometry analysis of D20 spheres electroporated with 0.15 nM AuNS, according to one embodiment of the present disclosure. [Figure 22B] Flow cytometry analysis of D20 spheres electroporated with 1.5 nM AuNS, according to one embodiment of the present disclosure.

Mode for Carrying Out the Invention

[0011] For the purpose of facilitating an understanding of the principles of this disclosure, preferred embodiments are referenced herein, and certain language is used to describe them. However, it will be understood that no limitation of the scope of this disclosure is intended therein, and any such changes and further modifications to this disclosure as shown herein are intended to be as commonly recalled by those skilled in the art.

[0012] The articles "a" and "an" are used herein to refer to one or more (i.e., at least one) grammatical objects of the article. For example, "element" means at least one element and may include two or more elements.

[0013] "Approximately" is used to provide flexibility in the endpoint of a numerical range by indicating that a given value may be "slightly above" or "slightly below" the endpoint without affecting the desired result.

[0014] The use of the terms “including,” “comprising,” or “having,” and their variations herein, means to include the elements and their equivalents listed thereafter, as well as any additional elements. Where used herein, “and / or” means and includes any possible combination of one or more of the related listed items, and the absence of any combination, as interpreted by the alternative ("or").

[0015] As used herein, the transitional phrase “essentially from” (and grammatical variations) should be interpreted as encompassing the enumerated materials or processes of the claimed invention “that do not substantially affect the basic and novel features.” Therefore, as used herein, the term “essentially from” should not be interpreted as “comprising.”

[0016] Furthermore, this disclosure is also intended to allow for the exclusion or omission of any feature or combination of features described herein in some embodiments. For illustrative purposes, where this specification states that a complex comprises components A, B, and C, it is particularly intended that any one of A, B, or C, or any combination thereof, may be omitted and discarded individually or in any combination.

[0017] The enumeration of value ranges in this specification is intended solely as a convenient way to refer individually to each distinct value within the range, unless otherwise indicated herein, and each distinct value is incorporated herein as if it were individually enumerated herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values ​​such as 2% to 40%, 10% to 30%, or 1% to 3% are explicitly enumerated herein. These are merely examples of what is specifically intended, and all possible combinations of numerical values ​​between the enumerated lowest and highest values ​​should be considered expressly stated in this disclosure.

[0018] As used herein, “treatment,” “therapy,” and / or “therapy regimen” refer to clinical interventions performed in response to a disease, disorder, or physiological condition indicated by or to which a patient may be susceptible. The goals of treatment include relief or prevention of symptoms, delay or cessation of progression or worsening of a disease, disorder, or condition, and / or remission of a disease, disorder, or condition.

[0019] The term "effective dose" or "therapeutic effective dose" refers to a quantity sufficient to produce a beneficial or desirable biological and / or clinical outcome.

[0020] As used herein, the terms “subject” and “patient” are interchangeable herein and refer to both humans and non-human animals. The term “non-human animal” in this disclosure includes all vertebrates, e.g., mammals and non-mammals, e.g., non-human primates, sheep, dogs, cats, horses, cattle, chickens, amphibians, reptiles, etc. The methods and compositions disclosed herein can be used on samples either in vitro (e.g., on isolated cells or tissues) or in vivo in a subject (i.e., a living organism such as a patient). In some embodiments, the subject includes humans being treated with the compositions, systems and methods described herein.

[0021] As used herein, the term “transfection” refers to the process of passively or actively delivering nucleic acids, small proteins, and other particles (e.g., nanoprobes as described herein) to eukaryotic cells. Delivery can be achieved by using any number of known means, including but not limited to passive uptake, chemical transfection reagents, electroporation (gene electrotransfer), and viral transduction.

[0022] As used herein, the terms “administer” or “dosage” refer to the site and / or route and / or path to which the nanoprobe, transfected stem cell-derived cells, etc., are introduced according to this disclosure. Appropriate forms of administration include, but are not limited to, intradermal injection, subcutaneous injection, intramuscular injection, intravenous injection, intraperitoneal injection, intracavitary injection (e.g., injection into an existing physiological or pathological body cavity), oral, rectal, inhalation, nasal spray, and skin patch. Those skilled in the art will readily be able to select the route that is most likely to be the therapeutically effective modality for a particular agent. In some embodiments, the route of administration includes subcutaneous injection.

[0023] Unless otherwise defined, all technical terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure belongs.

[0024] This disclosure describes various compositions, systems, methods, and devices that utilize the concept of an in vivo plasmonics sensing (IPS) nanoplatform for stem cell applications. The sensing principle is based on an enhancement mechanism of electromagnetic field effects. This disclosure presents specific novel and unique concepts that enable in situ and in vivo sensing (e.g., implantable sensors), regenerative medicine (e.g., stem cells), and IPS probe technology for use with stem cell technology for other biomedical applications. Novel embodiments include novel nanobiosensors, combinations of IPS nanoplatforms and stem cells, combinations of IPS + stem cell sensing systems, portable fiber optic-based readout systems (e.g., at the point of care), and combinations of IPS + stem cell sensing systems and handheld readout systems (e.g., at home or wherever needed).

[0025] 1. Composition The in vivo plasmonics sensing probes disclosed herein utilize a nucleic acid detection scheme that may be called a “reverse molecular sentinel,” or iMS (see, for example, U.S. Patent Application No. 14 / 861,353, which is incorporated herein by reference in its entirety). An exemplary approach is schematically shown in Figure 1, which illustrates a schematic design of an iMS using a gold nanostar platform.

[0026] Generally, as shown in Figure 1, the iMS nanoprobe according to this disclosure comprises (1) at least one plasmon-active nanoparticle, (2) a stem-loop nucleic acid probe with one end bound to the nanoparticle and labeled with a Raman-active reporter, and (3) an unlabeled capture placeholder nucleic acid strand complementary to the target sequence.

[0027] Referring again to Figure 1, in such an embodiment, the iMS “stem-loop” probe, having a Raman label at one end of its stem, is immobilized on a metal nanoparticle or nanostar via a metal-thiol bond. A partially complementary DNA probe, acting as a “placeholder” strand bound to the iMS nanoprobe, pushes the Raman dye away from the nanostar surface. In the absence of a target, the probe is “open” with a very low SERS signal (i.e., “off” state) because plasmon field enhancement decreases significantly as the distance from the metal surface increases. Upon exposure to a target sequence, the placeholder capture strand detaches from the “open” stem-loop probe based on placeholder base pairing with the complementary target strand after a non-enzymatic strand substitution process. The target first binds to the toehold region (intermediate I), initiates the movement of the nucleic acid probe from the placeholder via branch point migration (intermediate II), and finally releases the placeholder from the nanoparticle system. This allows the stem-loop to “close,” and the Raman label migrates onto the plasmonic-active metal surface. This results in a strong SERS signal and is therefore indicated as being in the "on" state. iMS probes can be designed to detect various targets (DNA, mRNA, RNA, miRNA). Several exemplary miRNA designs are provided below in Figure 2.

[0028] Referring to Figure 2, in one embodiment, the first sequence (stem-loop probe) includes the nucleotide sequence AAAAACTAAGAAAAAAAAATGGCAGTGTCTTAG (miR-34a stem-loop probe, SEQ ID NO: 1), and the second sequence (placeholder) includes the nucleotide sequence ACAACCAGCTAAGACACTGCCATTTT (miR-34a placeholder, SEQ ID NO: 2) for miR-34a miRNA sensing.

[0029] In another embodiment, the first sequence (stem-loop probe) comprises the nucleotide sequence AAAAATACCCTTTATATAAAAATAATACTGCCGGGTA (miR-200b-3p stem-loop probe, SEQ ID NO: 3), and the second sequence (placeholder) comprises the nucleotide sequence TCCATCATTACCCGGCAGTATTATTTT (miR200b-3p placeholder, SEQ ID NO: 4) for miR200b-3p miRNA sensing.

[0030] In another embodiment, the first sequence (stem-loop probe) comprises the nucleotide sequence AAAAAACCCAAATAAAAAATAATACTGCCGGGT (miR200c-3b stem-loop probe, SEQ ID NO: 5), and the second sequence (placeholder) comprises the nucleotide sequence TCCATCATTACCCGGCAGTATTA (miR200c-3p, SEQ ID NO: 6) for miR200c-3p miRNA sensing.

[0031] In this embodiment, iMS generates a Raman signal in the presence of a target based on a non-enzymatic chain displacement process followed by a conformational change of the hairpin oligonucleotide probe. Upon exposure to the target, the target first binds to the overhang region of the probe-placeholder double helix, then initiates the movement of the stem-loop probe from the placeholder via a branching point migration process, and finally releases the placeholder from the nanobiosensor. The stem-loop structure then closes, transferring the Raman label onto the surface of the plasmonic-activated gold nanoparticles and generating a strong SERS signal. Since different labels can be bound to the stem-loop probe, multiple targets can be detected simultaneously while maintaining specificity and sensitivity.

[0032] In particular, within the scope of another embodiment, the nanobiosensor can have a dual role as a target miRNA trap. When the placeholder captures the target miRNA, the miRNA is no longer functional and its effect on gene expression is blocked.

[0033] In another embodiment, the nanoprobe is further modified to achieve highly sensitive detection that generates low background in the absence of the target, i.e., the lower limit of optical detection, or LOD. In an exemplary embodiment, the physical length of the Raman-labeled stem-loop probe is designed to be about 10 nm for its off-state low-background SERS signal. This distance is designed to keep the Raman label away from the gold nanostar (i.e., to have a weak or no "lightning rod" effect). Because the short sequence length of miRNA makes it difficult to design a stem-loop probe with the desired length, a spacer sequence of about 10 nucleotides is added between the loop and the 5' terminal stem. This spacer is used to increase the physical length of the probe to keep the Raman label at an appropriate distance from the nanostar surface while hybridizing to a placeholder strand. Importantly, this "internal" spacer does not affect the generation of a strong SERS signal when the probe is in a closed stem-loop configuration.

[0034] In another embodiment, a short poly(T) tail (four thymine bases) is added to the 3' end of the placeholder strand (i.e., hybridizing into a portion of the internal spacer in the probe) to minimize background signal without affecting sensor functionality. The addition of the poly(T) tail reduces strong SERS background signal by increasing hybridization efficiency between the placeholder and the stem-loop probe.

[0035] In another embodiment, the disclosure provides intracellular iMS nanoprobes comprising, consisting of, or essentially comprising locked nucleic acids and nuclease-resistant modifications, respectively, which can enhance double-strand stability and prevent degradation. LNA is a conformationally restricted nucleic acid analog in which the ribose ring is locked to a rigid C3'-end (or N-type) conformation by a simple 2'-O,4'-C methylene bridge. LNA possesses many attractive properties, including high binding affinity, excellent base mismatch discrimination ability, and possibly reduced sensitivity to nuclease digestion. Double-strands containing LNA (hybridized to either DNA or RNA) exhibit a significant increase in melting temperature, ranging from +3.0°C to +9.6°C per LNA modification, compared to the corresponding unmodified reference double-strand. Furthermore, LNA oligonucleotides can be synthesized using conventional phosphoramidite chemistry, enabling the automated synthesis of both fully modified LNA oligonucleotides and chimeric oligonucleotides such as DNA / LNA and LNA / RNA. Other advantages of LNA include its close structural similarity to natural nucleic acids, which results in particularly good solubility and easy handling under physiological conditions. Furthermore, due to its charged phosphate backbone, LNA is non-toxic. All of these properties are highly advantageous for molecular tools for diagnostic applications.

[0036] Nuclease degradation is a concern when oligonucleotides are used in cell culture or in vivo experiments, for example, in antisense and RNAi applications, and in ribozyme technologies. When used in intracellular analysis, nucleic acid probes tend to produce dramatic false-positive signals due to nuclease degradation, protein binding, and thermodynamic fluctuations. Oligonucleotide stability is typically important for these types of studies, but unmodified DNA and RNA oligonucleotides are rapidly digested in vitro and in vivo by endogenous nucleases. Multiple endonucleases and exonucleases are present in vivo. For example, unmodified phosphodiester oligonucleotides have been reported to have a short half-life of 15-20 minutes in living cells. In serum, most biologically significant nuclease degradation activity arises as 3'-exonuclease activity, but intracellularly, nuclease degradation activity is affected by both 5'-exonuclease and 3'-exonuclease. Different modifications are substituted to limit nuclease sensitivity.

[0037] First, the phosphorothioate (PS) bond replaces the non-crosslinked oxygen in the phosphate backbone of the oligonucleotide with a sulfur atom. For about 50% of the time (due to the two resulting stereoisomers that may be formed), the PS modification makes the internucleotide bond more resistant to nuclease degradation. Therefore, according to one embodiment of the present disclosure, at least three PS bonds are included at the 5' and 3' oligonucleotide ends to inhibit exonuclease degradation.

[0038] Naturally occurring post-transcriptional modifications of RNA 2'OMe are found in tRNA and other small RNAs. Oligonucleotides can be directly synthesized to contain 2'OMe. This modification prevents attack by single-stranded endonucleases but not by exonuclease digestion. Therefore, terminal blocking of these oligonucleotides is also important. DNA oligonucleotides containing this modification are typically 5 to 10 times less sensitive to DNase than unmodified DNA. 2'OMe modification increases stability and binding affinity to target transcripts.

[0039] In one embodiment, the disclosure provides a miR-34a iMS DNA / LNA nanoprobe (LNA is indicated by a "+") as shown in Figure 3.

[0040] This iMS enables a longer lifespan for intracellular sensors. Sequences with alternating DNA / LNA bases or all LNA bases have been shown to resist nonspecific protein binding and impair DNase I digestion. Furthermore, sequences consisting of DNA stretches of less than 3 bases between LNA bases were able to block RNase H function. Referring again to Figure 3, 6-base pair stems and alternating DNA / LNA bases are useful for intracellular application because they ensure a reasonable hybridization rate, reduce protein binding, and resist nuclease degradation of both targets and probes.

[0041] Various plasmon-active nanoparticles can be used with the iMS nanoprobes provided herein to obtain strongly labeled SERS signals at different plasmon resonance wavelengths. Therefore, in some embodiments, the nanoparticles may include, but are not limited to, silver nanospheres, gold nanospheres, nanoshells, nanostars, and the like.

[0042] Furthermore, various optical reporters can be used with the iMS nanoprobes provided herein. In some embodiments, the optical reporters include Raman dyes, 3,3'-diethylthiadicarbocyanine iodide (DTDC), 3,3'-diethylthiatricarbocyanine iodide (DTTC), 1,1',3,3,3',3'-hexamethylindotricarbocyanine iodide (HITC), CY3 dyes, CY3.5 dyes, CY5 dyes, CY5.5 dyes, CY7 dyes, CY7.5 dyes, and positively charged hydrophobic near-infrared (NIR) The following substances are selected from the group consisting of dyes, IR-780, IR-792, IR-797, IR-813, methylene blue hydrate (MB), 4-mercaptobenzoic acid (4-MBA), 5,5'-dithiobis-2-nitrobenzoic acid (DTNB), 4-aminothiophenol (4ATP), fluorescein, fluorescein isothiocyanate (FITC), thionine dyes, rhodamine-based dyes, crystal violet, and fluorescent or absorbance labels.

[0043] In practice, the thiolated SERS reporter chain has a Raman dye at one end as a reporter and a thiol group at the other end for binding to nanoparticles. The reporter chain has four segments: stem-L, stem-R, spacer, and placeholder. The stem-L and stem-R segments allow the placeholder chain to form a stem-loop structure after binding to the target molecule and detaching from the nanoconstruct. The spacer segment is designed to provide sufficient distance (e.g., more than 10 nm) between the Raman dye and the nanoparticle surface to reduce background SERS signal when the probe is open. The placeholder segment (e.g., 8-15 nucleotides) binds to the placeholder chain to prevent the formation of a stem-loop structure. The placeholder chain has two segments: placeholder C and targeting region. The placeholder C segment is complementary to the placeholder segment and target sequence of the reporter chain. The targeting region (20-30 nucleotides) is complementary to the target sequence.

[0044] Light with wavelengths within the so-called "therapeutic window" can be used to sense and monitor the viability, health status, and functional capacity of transplanted stem cells. The ability of light to penetrate tissue depends on absorption. Within the therapeutic window (or "diagnostic window"), most tissues are weak enough absorbers to allow significant light transmission. This window extends from the orange / red region of the visible spectrum to the near-infrared (NIR), approximately 600 nm to 1300 nm. At the short-wavelength end, the window is bounded by the absorption of hemoglobin, in both its oxygenated and deoxygenated forms. The absorption of oxyhemoglobin increases by about two orders of magnitude as the wavelength shortens in the region around 600 nm. At shorter wavelengths, more absorbent biomolecules become important, including DNA and the amino acids tryptophan and tyrosine. At the infrared (IR) end of the window, transmission is limited by the absorbent properties of water. Within the therapeutic window, scattering is dominant over absorption, so propagating light diffuses, but not necessarily entering the diffusion limit. Figure 4 shows a diagram of the optical window or therapeutic window in tissue.

[0045] In some embodiments, plasmon-active nanoparticles include gold nanostars. Gold nanostars (GNS) are particularly interesting because they offer a wide range of optical tuning by introducing subtle variations in their geometric shape. Multiple sharp branches on the GNS create a “lightning rod” effect that dramatically enhances the local electromagnetic (EM) field. This unique tip-enhancing plasmon property can be tuned in near-infrared (NIR) diagnostic and therapeutic optics windows, allowing photons to travel further within the tissue. In some embodiments, plasmon tuning is achieved by adjusting the Ag+ concentration. Specifically, higher concentrations of Ag+ gradually redshift the plasmon band by forming longer, sharper, and more numerous branches. This is illustrated, for example, above in Figure 5. Nanostar S5 consists of several protrusions, while S30 includes multiple long, sharp branches that appear to branch further. Simulations of |E| near the nanostar in response to a unit-amplitude z-polarized plane wave incident E field propagating in the y-direction and having a wavelength of 800 nm show plasmon enhancement at the tip of the nanosat, i.e., a "lightning rod" effect (see, for example, bottom of Figure 5).

[0046] In Figure 5, the upper image is a TEM image of nanostars formed under different Ag+ concentrations (S5: 5 μM, S10: 10 μM, S20: 20 μM, S30: 30 μM). The lower image is a simulation of |E| near the nanostar in response to a unit amplitude z-polarized plane wave incident E field propagating in the y direction and having a wavelength of 800 nm. The inset shows the 3D geometric shape of the star. The figure is not to scale.

[0047] In several embodiments, GNS can be synthesized in a controlled manner and used for deep tissue NIR excitation and absorption in the diagnostic window for stem cell application. The nanostar plasmon peak can be adjusted, for example, from 600 nm to 1000 nm.

[0048] Plasmonated gold nanostars (AuNS) can be synthesized for in vivo use. AuNS of various sizes can be synthesized by known methods, which involve adding AgNO3 (along with other components) during synthesis. The synthesis is rapid and reproducible and does not require polymers as surfactants. The size of the nanostars can be adjusted based on the concentrations of the components used during synthesis. Silver ions play a role in controlling the formation of the star geometric shape. In the absence of Ag+, the resulting particles are polydisperse in both size and shape. The addition of small amounts of Ag+ can help synthesize monodisperse star-shaped particles. Nanoparticle diameters can be in the range of approximately 50–70 nm. Although not bound by theory, it is thought that Ag+ does not form Ag branching, but rather supports the anisotropic growth of Au branching on specific crystal facets on the multiple twinned citrate seed.

[0049] 2. Monitoring and therapeutic application of stem cells Stem cells are defined as cells that have the ability to divide indefinitely and subsequently develop into many different specialized cell types used to build tissues and organs. When a stem cell divides into two daughter cells, each daughter cell has the potential to remain a stem cell, meaning it is a non-specialized cell that can either self-replicate or become one of the specialized cells that make up the human body, such as neurons, muscle cells, blood cells, or endocrine cells.

[0050] Stem cells play a crucial role in both embryonic development and adult tissue formation. After fertilization, a mammalian embryo undergoes a series of cell divisions to form a cell aggregate called a morula. Further cell division transforms the morula into a blastocyst, a cystic-like structure with a lumen. The cells localized in this lumen, also known as the inner cell mass (ICM) cells, differentiate into all types of cells that make up all tissues and organs, giving rise to the entire organism. The isolation and in vitro culture of ICM cells led to the establishment of human embryonic stem cells (hESCs).

[0051] Some stem cells remain undifferentiated until adulthood. Adult stem cells have been identified in many organs and tissues, including but not limited to bone marrow, mesenchyme, blood, skeletal muscle, skin, heart, intestines, liver, and brain. Adult stem cells typically generate the cell type of the tissue in which they reside and represent replacements for cells lost during injury or disease. Therefore, in contrast to embryonic stem cells, adult stem cells have limited differentiation potential.

[0052] The term "stem cell" was coined more than a century ago (as demonstrated in Ernst Haeckel's research in 1868), but the first signs of pluripotency in stem cells were first brought about in the early 1960s, thanks to the pioneering research on hematopoietic stem cells conducted by Ernest McCulloch and James Till. Their experiments showed that different blood cells originated from a single type of cell. These cells could form "colonies," each colony originating from a single cell. Furthermore, these colony-forming cells were not only able to "self-replicate" but could also specialize into three different blood cell types. Twenty years later, in the early 1980s, Martin Evans, Matthew Kaufmann, and Gail Martin showed that ICM-derived mouse cells could be isolated and cultured in vitro without losing their pluripotency and self-renewal ability. The cultured mouse cells were artificial embryonic stem cells (ESCs) due to their ability to mimic the differentiation ability of ICM cells. The immense potential of mouse ESCs was demonstrated in subsequent studies when it was shown that reintroducing ESCs into host blastocysts could produce chimeric animals containing cells derived from both the injected ESCs and host ICM cells. Furthermore, breeding of chimeric animals yielded offspring possessing only the genetic material of the cultured ESCs, thus demonstrating that ESCs can contribute to the germline of the host animal. Finally, in 1998, Thomson et al. were able to isolate embryonic stem cells (hESCs) from early human embryos, thereby setting the stage for subsequent efforts to create distinct cell types for cell replacement therapy in patients. In addition to hESCs, it is now possible to reprogram adult somatic cells to become induced pluripotent stem cells (iPSCs). Human iPSCs were first reported in 2007. iPSCs are adult cells that have been genetically reprogrammed into an embryonic stem cell-like state. Patient-derived cells can be cultured, differentiated, and reintroduced into the patient. Thus, it is possible to create a donor-specific source of stem cells, increasing the likelihood of compatibility.This represents a significant advantage as it may avoid immune rejection that can occur when incompatible stem cell derivatives are used and require continuous administration of immunosuppressants. Finally, UCSF researchers demonstrated that they can create human pluripotent stem cell lines from blastocysts and thus isolate cells capable of differentiating into the three germ layers earlier than the ICM stage (Human stem cells from single blastomeres reveal pathways of Embryonic or trophoblast fate specification. (2015); Development, 2015, 142(23):4010-25. doi:10.1242 / dev.122846. Epub October 19, 2015).

[0053] Today, one of the most important potential applications of human pluripotent stem cells, including but not limited to hESCs, iPSCs, blastocyst-derived stem cells, and adult stem cells, is the generation of cells and tissues that can be used in cell-based therapies. Laboratory-grown stem cells are capable of long-term self-renewal, and a starting population of stem cells can grow for many years, yielding billions of non-specialized cells. Furthermore, these stem cells can be differentiated in vitro and guided to become any specialized cells that can be used to regenerate and repair diseased or damaged tissue in a patient. This approach forms the basis of regenerative medicine. Examples of diseases that may be treated by transplanting cells produced from hESCs, iPSCs, or blastocyst-derived and organ stem cells include diabetes, heart disease, Duchenne muscular dystrophy, traumatic spinal cord injury, and vision loss and hearing loss. In fact, adult stem cells, such as bone marrow-derived adult hematopoietic stem cells, have already been used in transplantation for more than 40 years.

[0054] The inventors have made significant progress in generating functional beta cells from human stem cell populations. The underlying strategy is to closely replicate the pathway that pluripotent stem cells follow during embryogenesis, from the formation of the endoderm of the embryo, to the pancreatic endoderm, endocrine progenitor cells, and finally to pancreatic islet cells. These recent advances in the differentiation of human stem cells into pancreatic islet cells suggest a tangible alternative to more conventional treatment options for type 1 and type 2 diabetes, the two major forms of diabetes that currently affect more than 400 million people worldwide.

[0055] In type 1 diabetes, insulin-producing beta cells in the pancreas are destroyed by the body's immune system. In the more common form, type 2 diabetes, beta cells are depleted due to high insulin demand, often resulting from insulin resistance in peripheral tissues. This high demand leads to a gradual decline in the function and mass of beta cells until the pancreatic islets can no longer produce enough insulin to overcome insulin resistance.

[0056] While islet transplantation is an effective intervention for restoring glucose levels, the number of cadaveric islets required exceeds the supply, and patients undergoing islet transplantation require lifelong immunosuppressants. This is why cell replacement therapy has emerged as a viable alternative for treating diabetes. (See Charles A. Goldthwaite, Jr., "Are Stem Cells the Next Frontier for diabetes treatment?" Regenerative Medicine, https: / / stemcells.nih.gov / info / Regenerative_Medicine / 2006Chapter7.htm)

[0057] Since most cells die immediately after transplantation, the transplantation itself is a difficult procedure.

[0058] For stem cells to be useful for transplantation, they must not only proliferate extensively in culture and differentiate into the desired cell type, but also survive in the recipient after transplantation and function for the patient's lifetime. Currently, there is no technology to monitor the health of transplanted cells post-transplantation and over time using non-invasive readout.

[0059] To achieve effective strategies for using stem cell therapy, it is crucial to develop real-time, practical, and efficient detection and monitoring systems and methods for monitoring the viability, health status, and functional capacity of transplanted stem cells.

[0060] 3. Method The compositions and systems disclosed herein are particularly useful for in vitro, in situ, and / or in vivo sensing and real-time monitoring of stem cells during stem cell therapy. The nanoprobes provided herein are designed to detect miRNAs, small non-coding RNAs, or mRNAs that regulate gene expression at the post-transcriptional level and thus function as early biomarkers. In the presence of target miRNAs, small non-coding RNAs, or mRNAs, the iMS nanoprobes generate a Raman signal based on a non-enzymatic strand substitution process and subsequent conformational changes of the hairpin oligonucleotide probe, as described herein.

[0061] Accordingly, another aspect of the present disclosure provides a method for detecting and monitoring stem cell differentiation in vitro in real time, comprising, comprising, or essentially comprising: (1) obtaining one or more stem cell-derived cells; (2) transfecting the stem cell-derived cells with an iMS nanoprobe; and (3) detecting an optical signal from the nanoprobe.

[0062] Physical approaches can be used to directly deliver or transfect drugs or gene probes to desired intracellular locations (e.g., cytosol or nucleus). Among these physical methods, electroporation is widely used due to its simplicity, uptake efficiency, fewer limitations on probes or cell types, and ease of operation. In electroporation, short, high-voltage electrical pulses are applied to exceed the cell membrane capacitance, thereby making the offered cells temporarily permeable. In some embodiments, stem cell-derived cells are transfected using electroporation.

[0063] Another aspect of the present disclosure provides a method for monitoring in vivo stem cell transplantation in a subject in real time, comprising, or essentially comprising: (1) obtaining one or more stem cell-derived cells; (2) transfecting the stem cell-derived cells with an iMS nanoprobe; (3) administering the transfected stem cell-derived cells to a subject; and (4) detecting an optical signal from the nanoprobe.

[0064] Figure 6 shows an example of an in vivo diagnostic modality method using the compositions and systems of this disclosure that can function as a real-time, permanent, and continuous “health monitor.” Transfected stem cell-derived cells are administered to or introduced (e.g., transplanted) into a subject or patient (Figure 6A). Depending on the specific treatment, the stem cell delivery method may include, but is not limited to, subcutaneous transplantation with or without a synthetic scaffold, intravenous injection, intra-arterial injection, and intrathecal injection. The health status of the transfected stem cell-derived cells may be monitored by the subject and / or healthcare provider using a portable Raman diagnostic system having an excitation light source and an optical detector (Figure 6B). The health status of the transfected stem cell-derived cells may include information regarding the viability, functional capacity, and / or health status of the transfected stem cell-derived cells. One or more stem cell-derived cells may be transfected with one or more nanoprobes. One or more nanoprobes may include inverse molecular sentinels (iMS). iMS may also include a plasmon-active nanoparticle and a stem-loop nucleic acid probe, one end of which is bound to the nanoparticle, wherein the nucleic acid comprises a first sequence (stem-loop probe) and is labeled with an optical reporter, and an unlabeled capture placeholder nucleic acid chain comprising a second sequence (placeholder).

[0065] In another embodiment, a portable, pocket-sized Raman diagnostic system with optical fiber excitation and detection may be used to monitor transfected stem cell-derived cells, as shown in Figure 7 (Figure 7A). Alternatively, a handheld, battery-powered Raman reader system can be remotely controlled by an iPhone® or similar device (Figure 7B).

[0066] In addition to the specific embodiments described herein, it should be noted that the compositions, systems, and methods disclosed herein may also be used to monitor many other types of targets in stem cells. Alternative embodiments include, but are not limited to, other bioreceptors, including, aptamers, antibodies, enzymes, and cell-based receptors. Other alternative embodiments use chemoreceptors and ligands for target recognition and sensing. Other alternative embodiments use chemical sensing species that exhibit changes in Raman / SERS signaling when target species or biochemical conditions arise. Some non-limiting examples include pH, O2, metabolites, and chemical ligands. Various aspects of this disclosure can also be used to monitor viability, operation, injury, and shelf life for use in a wide variety of medical applications, including stem cells and progenitor cells from a wide variety of sources (e.g., embryos, pregnant tissues, and adult tissues), stem cells derived from reprogrammed differentiated cells, and insulin-producing pancreatic islets.

[0067] The SERS detection methods described herein can be combined with other spectroscopic modalities such as conventional Raman, fluorescence, phosphorescence, absorption sensing, and imaging techniques to obtain a more complete picture of the health of the cells being monitored. Some non-limiting examples include the combination of SERS detection of miRNA targets using the sensing platform disclosed herein with conventional Raman detection or imaging. The sensing platform disclosed herein can monitor the viability, health, and functional capacity of transplanted stem cell lines, while Raman techniques can provide information about the chemical structure of cells or chemical species (proteins, lipids, and DNA) within the cells according to their vibrational spectra.

[0068] The SERS detection methods described herein can be used for other stem cell therapy applications, including the production of tissues and organs. Some examples include tissue-engineered cardiomyocytes, functional tissues and organs, tissue-engineered skin derived from the patient's own cells, tissue-engineered bladder derived from the patient's own cells, and small intestinal submucosa (SIS) used to help the body close wounds that are difficult to heal. Further examples include tissue-engineered products for inducing bone and connective tissue growth, tissue-engineered vascular grafts for cardiac bypass surgery and the treatment of cardiovascular disease, and "custom-made" organs from 3D molecular / organic 3D printing.

[0069] Furthermore, the disclosed compositions, systems, and methods have the potential for a wide variety of applications based on DNA / RNA / protein detection, including biomedical applications, point-of-care diagnostics, quality control applications, global health, cancer research, cardiac disease diagnosis, and national defense.

[0070] Furthermore, the disclosed compositions, systems, and methods may lead to improved stem cell-based therapeutic uses. A major challenge in stem cell therapy is the survival of these cells in vivo. Currently, most stem cells die or become dysfunctional after several periods post-transplantation. Currently, the ability to monitor the health of transplanted cells using non-invasive readout remains particularly challenging. The proposed sensing platform disclosed herein provides a critical real-time, practical, and efficient nanosystem capable of monitoring the viability, health, and functional capacity of transplanted stem cell lines. This sensing capability will significantly improve the effectiveness of stem cell-based therapies, as the sensing nanoplatform can provide warning signals of cellular non-functionality, triggering timely repair procedures and / or replacement of non-functional stem cells when needed.

[0071] Other possible novel and additional features using the disclosed methods will be apparent to those skilled in the art. Some examples include the use of compositions, systems and methods for in vitro and in vivo monitoring of the functional properties of stem cell derivatives for cell therapy; stem cell in vivo plasmonics sensing (SC-IPS) probes made of metal; SC-IPS probes for multiple detection; SC-IPS systems and methods using multispectral Raman imaging for multiple detection; SC-IPS systems and methods using pulsed laser excitation and time-resolved Raman detection; and SC-IPS systems and methods using periodic excitation and phase-resolved Raman detection.

[0072] Furthermore, the disclosed systems and methods can be developed in several different formats. Some examples include portable in vivo diagnostic systems using SC-IPS probes, pocket-sized or palm-sized in vivo diagnostic systems using SC-IPS probes, and watch-sized in vivo diagnostic systems using SC-IPS probes.

[0073] Another embodiment of this disclosure provides a method for performing in vivo monitoring using the disclosed system and method.

[0074] The following examples are provided as illustrations, not as limitations. [Examples]

[0075] Example 1: Absorbance spectrum of gold nanostar solution To evaluate the use of gold nanostars for deep tissue NIR excitation and absorption in the diagnostic window for stem cell applications, absorbance spectra were measured for exemplary gold nanostar solutions (S5, S10, S20, S30). Nanostar size increased from S5 to S30, with S5 being the smallest and S30 being the largest. Figure 8(a) is a chart showing the absorbance spectra of exemplary nanostar solutions (approximately 0.1 nM in citrate buffer). Figure 8(b) is a chart showing the corresponding finite element method (FEM) generated absorption spectra of exemplary nanostars embedded in water. In Figure 8(b), the solved data points (±1SD) were interpolated using spline fitting.

[0076] Figure 8(c) is a scatter plot chart of the average polarization absorption against the aspect ratio (AR) adjusted by changing the branch height while keeping the base width, core and tip diameters and the number of branches constant. In the inset of Figure 8(c), the linear relationship between the plasmon peak position and the AR is shown as branch height (circle, R 2 =0.997) and base width (square, R 2 This was adjusted by changing (=0.987) while keeping all other parameters constant.

[0077] The plasmon peak of Nanostar is adjustable from 600 nm to 1000 nm by adjusting the Ag+ concentration. This is accompanied by a visible change in the color of the solution during synthesis, from dark blue to dark gray, as the plasmon redshifts and broadens. Both the plasmon peak position and spectral width followed a linear trend with increasing Ag+ concentration. A plateau was reached around an Ag+ concentration of 30 μM. These results indicate that Nanostar can be synthesized in a controlled manner and utilized as a potential candidate for deep tissue NIR excitation and absorption in the diagnostic window for stem cell applications.

[0078] Example 2: Synthesis of exemplary plasmon gold nanostars AuNS was synthesized using a known method. A 12 nm gold seed solution was prepared by adding 15 mL of 1% trisodium citrate to 100 mL of a boiling solution of 1 mM HAuCl4. The solution was boiled for a further 15 minutes, cooled to room temperature in an ice bath, filtered through a 0.22 μm nitrocellulose membrane, and stored at 4°C until use. To produce larger AuNS (called S30), 100 μL of gold seed was added to a 10 mL solution of 0.25 mM HAuCl4 containing 10 μL of 1N HCl, and immediately afterward, 50 μL of 0.1 M AA and 100 μL of 3 mM AgNO3 were simultaneously added under moderate stirring. Smaller AuNS (called S5) was produced in the same manner as above, except that 0.5 mM AgNO3 was used instead of 3 mM AgNO3.

[0079] Next, nanostars were generated by reducing tetrachloroauric acid onto 12 nm citrate-stabilized gold seeds in an acidic environment using ascorbic acid (AA), a weak reducing agent, and then stabilizing them with sodium citrate. Nanostar growth on the seeds was completed in less than 30 seconds. This was a simple and rapid method. The particles were stable at 4°C for at least one week after centrifugal washing.

[0080] Exemplary nanostars generated the most redshifted plasmons under lower pH, higher vortex rate, and an AA / HAuCl4 ratio of approximately 1.5–2. The concentrations of HAuCl4 and seed were selected so that the nanostar size was approximately 60 nm. Silver ions were observed to play a role in controlling the formation of the nanostar geometric shape. In the absence of Ag+, the resulting particles were polydisperse in both size and shape. The addition of small amounts of Ag+ resulted in a high yield of monodisperse star-shaped particles. The particle size of the synthesized nanoparticles was within approximately 50–70 nm. Ag+ is thought to support the anisotropic growth of Au branching on specific crystalline facets on the multiple twinned citrate seed.

[0081] Figure 9 shows a schematic diagram of an exemplary embodiment of an intracellular molecular nanoprobe, which illustrates an iMS nanosensor for intracellular sensing within stem cells.

[0082] Example 3: Transfection of INS1 beta cells with AuNS-PEG by electroporation In an exemplary method, AuNS-PEG was transfected into INS1 cell lines (i.e., rat insulinoma cell lines) using electroporation. Electroporation of AuNS-PEG resulted in a 6-fold enrichment compared to passive uptake, using 0.5 nM particles, 1 million cells, and electroporation at 250 V with a pulse length of 4 ms.

[0083] To perform electroporation, 1 million INS1 cells were resuspended in 800 μL of OptiMEM medium containing 0.5 nM AuNS-PEG. Electroporation was performed using a 4 cm cuvette at room temperature with either 250 V at a pulse length of 4 milliseconds (ms) or 300 V at a pulse length of 3 ms. Immediately after electroporation, the cuvette was placed in an incubator (37°C, 5% CO2) for 15 minutes. The cells were washed three times by centrifugation in PBS to remove free nanoparticles from the solution (300 g, 3 min), resuspended in cell culture medium, and then added to a single well in a 6-well plate. The cells were incubated for 12 hours, then washed in PBS, trypsinized, and collected for ICP-MS.

[0084] For passive uptake, 1 million INS1 cells were seeded into a single well of a 6-well plate and incubated with 0.5 nM AuNS-PEG for 12 hours. After incubation, the cells were washed three times with PBS to remove all particles in the medium, triedpsinized, and collected for ICP-MS. Figure 10 is a bar graph comparing the transfection results for passive uptake and uptake using electroporation at 250 V with a pulse length of 4 ms and 300 V with a pulse length of 3 ms. As can be seen from the figure, transfection using electroporation at 250 V with a pulse length of 4 ms resulted in the highest uptake.

[0085] We conducted tests to investigate the effect of electroporation on the structure of inverse molecular sentinel (iMS) systems.

[0086] One million INS1 cells were suspended in 800 μL of OptiMEM medium containing 0.15 nM AuNS-iMS in the off position. 800 μL of the solution was added to a 4 cm electroporation cuvette. Electroporation was performed at room temperature using either 250 V with a pulse length of 4 ms or 300 V with a pulse length of 3 ms. Immediately after electroporation, the cuvette was sprayed with ethanol and placed in an incubator (37°C, 5% CO2) for 15 minutes. The cells were washed three times by centrifugation in PBS to remove free nanoparticles from the solution (300 g, 3 min), resuspended in cell culture medium, and added to a glass dish. The cells were incubated in the incubator for 12 hours, after which Raman imaging measurements were performed using 633 nm laser excitation.

[0087] Electroporation of INS1 in untargeted AuNS-iMS at the off position (+placeholder) did not generate an on signal within the cell, and it was found that the electroporation process did not alter the iMS probe. Figure 11A is an image of INS1 cells after transfection in AuNS-iMS using electroporation. Figure 11B is 557 cm². -1This image shows a Raman spectral imaging map (false color) measured in the Raman band. The results indicate that the iMS signal remained "off" after electroporation.

[0088] A similar analysis was performed using AuNS-iMS-on. INS1 transfected with AuNS-iMS-on (i.e., no placeholder; iMS was turned on by adding the target before electroporation) was evaluated using electroporation to determine whether there was an effect of iMS-on.

[0089] 1E6 INS1 cells were suspended in 800 μL of OptiMEM medium containing 0.15 nM AuNS-iMS-one. 800 μL was added to a 4 cm electroporation cuvette. Electroporation was performed at room temperature using either 250 V with a 4 ms pulse length or 300 V with a 3 ms pulse length. Immediately after electroporation, the cuvette was sprayed with ethanol and placed in an incubator (37°C, 5% CO2) for 15 minutes. The cells were washed three times by centrifugation in PBS to remove free nanoparticles from the solution (300 g, 3 min), resuspended in cell culture medium, and added to a glass dish. The cells were incubated in the incubator for 12 hours, after which Raman imaging measurements were performed using 633 nm laser excitation.

[0090] Figure 12A is an image of cells after electroporation. Figure 12B is 557 cm². -1 The Raman spectral imaging map (false color) measured in the Raman band is shown. The result in Figure 12B shows that the iMS signal remained "on" after electroporation.

[0091] Raman measurements were performed on miR200b in INS1 cells after electroporation using an iMS nanoprobe. One million INS1 cells were suspended in 788 μL of OptiMEM medium. 12 μL of 10 nM iMS off (+ placeholder) or on (pre-activated) was added to the cell solution. 800 μL of the solution was added to a 4 cm electroporation cuvette. Electroporation was performed at room temperature using 250 V with a pulse length of 10 ms. Immediately after electroporation, the cuvette was sprayed with ethanol and placed in an incubator (37°C, 5% CO2) for 15 minutes. After washing the cells three times by centrifugation in PBS to remove free nanoparticles from the solution (300 g, 3 min), they were resuspended in 100 μL of PBS for Raman measurement (633 nm laser excitation, 1% power, 10 sec data storage time).

[0092] For each experiment, three SERS measurements were performed per sample and averaged into a single spectrum. The SERS spectrum was smoothed by subtracting background using a Savitsky-Golay filter (5-point window and first-order polynomial). After measurement, cells were seeded in 6-well plates and returned to the incubator. Figure 13 shows 558 cm² associated with the iMS probe with iMS "on". -1 This shows the presence of a Raman peak (upper curve) and the absence of a peak with iMS off (lower curve).

[0093] Example 4: Monitoring of CEL-miR39(Cy5) nanoprobe To advance the monitoring of intracellular iMS throughout the stem cell differentiation process, a pseudo-sensor was developed. The sensor is designed for CEL-miR-39 (a sequence commonly used as a spike-in control for RT-qPCR) which has single-chain binding protein (SSB) and modified bases (2'-O-methoxyethyl base and phosphorothioate (PS) bond) that are resistant to nuclease degradation. This probe has a stem with a higher melting temperature than the unmodified probe. For these reasons, the probe was expected to remain in the "on" position throughout differentiation. Figure 14A shows the SERS spectrum of a pure CEL-miR39(Cy5) nanoprobe in solution. Figure 14B shows the SERS spectrum of the CEL-miR39(Cy5) nanoprobe after transfection in INS1 cells.

[0094] The curve in Figure 14A shows the SERS spectrum of the CEL-miR-39MS probe (with Cy5 labeling) at a concentration of 0.15 nM in PBS (633 nm laser excitation, 1% power, 10 sec accumulation). The curve in Figure 14B shows the SERS spectrum obtained after electroporation of INS1 cells with the CEL-miR-39MS probe (with Cy5 labeling).

[0095] One million INS1 cells were suspended in 788 μL of OptiMEM medium. 12 μL of 10 nM CEL-miR-39MS-ON was added to the cell solution. 800 μL of the solution was added to a 4 cm electroporation cuvette. Electroporation was performed at room temperature using 250 V with a pulse length of 10 ms. Immediately after electroporation, the cuvette was sprayed with ethanol and placed in an incubator (37°C, 5% CO2) for 15 minutes. The cells were washed three times in PBS using centrifugation to remove free nanoparticles from the solution (300 g, 3 min), and then resuspended in 100 μL of PBS for Raman measurement (633 nm excitation, 1% power, 10 sec accumulation).

[0096] For each experiment, three SERS measurements were performed per sample and averaged into a single spectrum. All SERS spectra reported herein were smoothed by subtracting background using a Savitsky-Golay filter (5-point window and first-order polynomial). After measurement, cells were seeded in 6-well plates and returned to the incubator.

[0097] Table 1 shows the results of a viability test of electroporated INS1 cells. One million INS1 cells were suspended in 800 μL of OptiMEM medium. [Table 1] [Table 2]

[0098] Cell solution was added to a 4 cm electroporation cuvette. Electroporation was performed at room temperature using 250 V with pulse lengths of 0.5, 3, or 10 ms. If a replication pulse was used, the cells were allowed to recover at 37°C for 2 minutes. After electroporation was complete, the cuvette was immediately sprayed with ethanol and placed in an incubator (37°C, 5% CO2) for 15 minutes. The cells were washed three times by centrifugation in PBS (300 g, 3 min), resuspended in culture medium, and seeded in a 6-well plate. After incubating the cells in the incubator for 12 hours, viability was assessed. The cells were trypsinized, centrifuged, and the pellet was collected. The pellet was dispersed in 1 mL of cell culture medium. Viability during counting was assessed using trypan blue dye.

[0099] Example 5. Retention of AuNS-PEG in hESC The uptake and retention of AuNS-PEG in hESCs were measured. Table 2 and Figures 15-18 show the results of this test. The survival rate of hESCs 24 hours after electroporation performed at various voltages, pulse lengths, and pulse counts was measured. The results are shown in Table 2. As the results in Table 2 show, the survival rate of hESCs after electroporation was adversely affected by voltages exceeding 300V, pulse lengths exceeding 10ms, and the number of subsequent pulses. [Table 3]

[0100] Electroporation efficiency (measured as the number of gold nanoparticles taken up per cell) was found to improve by increasing the pulse length rather than the voltage (see, e.g., Figures 16A and 16B). The optimal condition was determined to be 250V for 10ms using a single pulse (see, e.g., Figure 17). Figures 16A and 16B are charts showing the ICP / MS quantification of AuNS in hESC immediately after electroporation (0.15nM AuNS, PBS). Figures 16A and 16B show the same data in different formats. Figure 16A shows the absolute number of particles per cell, while Figure 16B shows the calculated magnification change.

[0101] Figure 17 provides a multiphoton z-stack image of hESC cells 24 hours after electroporation with 0.15 nM AuNS.

[0102] A balance between cell viability and electroporation efficiency was found by optimizing the electroporation medium. Electroporation in PBS increased the number of particles per cell by up to 10 times (compared to passive uptake; see Figure 16), but hESC viability immediately after electroporation was reduced compared to electroporation performed in serum-depleted OPTIMEM. This result is shown in Figure 18, including images of flow cytometry analysis of hESCs stained with DAPI 30 minutes after electroporation.

[0103] Electroporation in OPTIMEM with reduced serum showed up to a 4-fold increase in AuNS and up to 60K AuNS per cell 48 hours after electroporation compared to passive uptake (see Figure 16). High electroporation efficiency was achieved when hESCs were rested at 37°C for 15 minutes before washing cells in PBS to remove excess particles (not taken up). Washing performed immediately after electroporation resulted in a complete loss of uptake concentration, likely due to inefficient pore closure (see Figure 15). Figures 15A and 15B are charts showing ICP / MS quantification of AuNS in hESCs 48 hours after electroporation (0.15 nM AuNS, OPTIMEM). Figures 15A and 15B show the same data in different formats. Figure 15A shows the absolute number of particles per cell, while Figure 15B shows the calculated magnification change.

[0104] Complete serum medium showed the highest cell viability, but higher cell viability reflects reduced pore formation and AuNS uptake.

[0105] The retention of AuNS was tested during the 20-day differentiation period of hESCs into pancreatic beta cells. The differentiation protocol was initiated on day 1 of differentiation and was based on the formation of 3D cell clusters (spheres) starting from 2D culture.

[0106] The following protocol was used for the differentiation of hESCs into pancreatic beta cells: Human embryonic stem cells (hESCs) were maintained and proliferated on mouse embryonic fibroblasts (MEFs) in hESC medium (DMEM F-12 supplemented with 1×Glutamax, 1×MEM-NEAA, 1×beta-mercaptoethanol, KSR, and FGF-2). Confluent hESC cultures were dissociated into single-cell suspensions and seeded onto suspension plates in hESC medium supplemented with activin A (10 ng / ml, R&D Systems) and heregulin B (10 ng / ml, Peprotech). The plates were incubated on an orbital shaker to induce 3D sphere formation. The spheres were cultured for 20 days using the following medium. Day 1: RPMI (Gibco) containing 0.2% FBS, 1:5,000 ITS (Gibco), 100 ng / ml activin A, and 50 ng / ml WNT3a (R&D Systems). Day 2: RPMI containing 0.2% FBS, 1:2,000 ITS, and 100 ng / ml activin A. Day 3: RPMI containing 0.2% FBS, 1:1,000 ITS, 2.5 μM TGFbi IV (CalBioChem), and 25 ng / ml KGF (R&D Systems). • Days 4-5: RPMI containing 0.4% FBS, 1:1,000 ITS, 25 ng / ml KGF • Days 6-7: 1:100 DMEM (Gibco) containing 25 mM glucose with B27 (Gibco) and 3 nM TTNBP (Sigma) Day 8: 1:100 DMEM (R&D Systems) containing 25 mM glucose with B27, 3 nM TTNBP, and 50 ng / ml EGF. Days 9-11: 1:100 DMEM containing 25mM glucose with B27, 50ng / ml EGF, and 50ng / ml KGF. Days 12-20: DMEM containing 25 mM glucose with 1:100 B27, 1:100 Glutamax (Gibco), 1:100 NEAA (Gibco), 10 μm ALKi II (Axxora), 500 nM LDN-193189 (Stemgent), 1 μm Xxi (Millipore), 1 μM T3 (Sigma-Aldrich), 0.5 mM vitamin C, 1 mM N-acetylcysteine ​​(Sigma-Aldrich), 10 μM zinc sulfate (Sigma-Aldrich), and 10 μg / ml heparin sulfate.

[0107] Figure 19 provides bright-field and fluorescence images of clusters at days 1, 5, and 20 of differentiation, showing that AuNS-electroporated hESCs can form spheres. All clusters contained AuNS. Figures 20A and 20B provide charts showing that AuNS-electroporated hESCs retained AuNS until the end of the differentiation protocol.

[0108] Due to the high levels of cell proliferation occurring at different stages of differentiation, the particle count per cell was rapidly diluted in daughter cells. To counteract this loss, two different concentrations of AuNS, 0.15 nM and 1.5 nM, were tested. The highest concentration of AuNS showed no toxicity and resulted in the formation of D20 spheres containing up to 800 particles per cell (see, e.g., Figure 20). Each sphere contained between 5,000 and 8,000 pancreatic progenitor cells. Therefore, each sphere may contain between 4 million and 6.6 million AuNS particles.

[0109] The interference of AuNS with the differentiation potential of hESCs into beta cells was monitored by intracellular staining of markers expressed during endodermal formation and at the final pancreatic beta cell stage. Specifically, on day 2, intracellular staining was performed to quantify the percentage of cells that were double-positive for endodermal markers FOXA2 and SOX17 and negative for the stem cell marker TRA160. On day 20, intracellular staining was performed to quantify the percentage of cells expressing PDX1, a marker for pancreatic progenitor cells, and the percentage of cells that were double-positive for beta cell markers NKX6.1 and INS. The data did not show an inhibitory effect of AuNS on endodermal formation, as observed by the presence of >90% of cells double-positive for FOXA2 and SOX17, and the loss of TRA160. Figure 21 provides images of flow cytometry analysis of spheres on day 2 that were electroporated with 0.15 nM AuNS (A) or 1.5 nM AuNS (B).

[0110] Figure 22 shows images of flow cytometry analysis of spheres electroporated with 0.15 nM AuNS (A) or 1.5 nM AuNS (B) at day 20. As can be seen in Figure 22, no effect on pancreatic beta cell formation was observed, as seen with the presence of >90% of the population expressing PDX1 and >40% of the population co-expressing C peptide and NKX6-1. The presence of higher levels of AuNS (1.5 nM vs. 0.15 nM) also did not show any effect on differentiation potential.

[0111] Those skilled in the art will readily understand that this disclosure is adapted to perform its purpose and to obtain the purposes and benefits mentioned, as well as those specific to them. The disclosures described herein are representative and illustrative of preferred embodiments and do not limit the scope of the disclosure. Those skilled in the art will be able to envision modifications and other uses therein that fall within the scope of the intent of the disclosure as defined by the claims.

[0112] No reference, including non-patent or patent documents, cited herein constitutes prior art. Unless otherwise specified, any reference to any document herein shall not constitute an endorsement that any of these documents form part of the common general knowledge in the art in the United States or any other country. Any consideration of a reference states the claims of its author, and the applicant reserves the right to challenge the accuracy and appropriateness of any of the documents cited herein. All references cited herein are incorporated entirely by reference unless otherwise specified. This disclosure shall govern any inconsistencies between any definitions and / or descriptions found in any of the cited references. This disclosure includes the following aspects: (1) An in vivo method for monitoring the viability of stem cell-derived cells used in stem cell therapy, The process involves introducing one or more nanoprobes into one or more stem cell-derived cells, wherein the one or more nanoprobes are configured to provide health status information relating to one or more stem cell-derived cells. After introducing one or more stem cell-derived cells, the optical signals from one or more nanoprobes are detected. The above in vivo methods, including those mentioned above. (2) The method according to (1), wherein the health status information of one or more stem cell-derived cells having one or more nanoprobes includes information regarding the viability, functional capacity and / or health status of one or more stem cell-derived cells. (3) One or more nanoprobes, At least one plasmon-active nanoparticle, A stem-loop nucleic acid probe, one end of which is bound to a nanoparticle, wherein the nucleic acid contains a first sequence (stem-loop probe) and is labeled with an optical reporter, and An unlabeled capture placeholder nucleic acid strand containing a second sequence (placeholder) and The method according to (1), comprising an inverse molecular sentinel (iMS) containing the same. (4) The method according to (3), wherein the unlabeled capture placeholder nucleic acid strand comprises a nucleotide sequence designed to hybridize to and capture a nucleic acid target of interest. (5) The method according to (4), wherein the target nucleic acid comprises a microRNA, a small non-coding RNA, an mRNA, or a DNA sequence. (6) The method according to (1), wherein one or more nanoprobes include a bioreceptor comprising a nucleotide sequence, aptamer, antibody, enzyme, or cell-based receptor for capturing a molecular species of interest. (7) The method according to (1), wherein one or more nanoprobes include a chemoreceptor or ligand for target recognition and sensing. (8) The method according to (1), wherein the optical signal is a Raman signal or a surface-enhanced Raman scattering (SERS) signal. (9) The method according to (1), wherein one or more stem cell-derived cells having one or more nanoprobes are introduced into a target by subcutaneous transplantation, intravenous injection, intra-arterial injection, or intrathecal injection, with or without a synthetic scaffold. (10) The method according to (1), wherein one or more stem cell-derived cells contain stem cells. (11) The method according to (1), wherein detection is performed using an optical fiber-based readout system. (12) The method according to (11), wherein the reading system is monitored by the subject and / or healthcare provider. (13) The method according to (11), wherein the reading system is portable. (14) The method according to (13), wherein the reading system is handheld. (15) A method for monitoring the viability of stem cell-derived cells, Introducing one or more stem cell-derived cells into a cell culture medium, The above introduction involves introducing one or more nanoprobes into a cell culture medium, thereby transfecting one or more stem cell-derived cells with the one or more nanoprobes. To detect optical signals from one or more nanoprobes after transfection and The above method, including. (16) The method according to (15), wherein the method for monitoring the viability of the stem cell-derived cells comprises monitoring the manipulation, injury and / or shelf life of the stem cell-derived cells for use in one or more of the following: stem cells and progenitor cells, stem cells derived from reprogrammed differentiated cells, and insulin-producing pancreatic islets. (17) The method according to (16), wherein the stem cells and progenitor cells are derived from sources such as embryos, pregnant cells and adult tissues. (18) The method according to (15), wherein one or more stem cell-derived cells are introduced into the cell culture medium before, after, or simultaneously with the introduction of one or more nanoprobes into the cell culture medium. (19) One or more nanoprobes, At least one plasmon-active nanoparticle, A stem-loop nucleic acid probe, one end of which is bound to a nanoparticle, wherein the nucleic acid contains a first sequence (stem-loop probe) and is labeled with an optical reporter, and An unlabeled capture placeholder nucleic acid strand containing a second sequence (placeholder) and The method according to (15), comprising an inverse molecular sentinel (iMS) containing . (20) The method according to (19), wherein the unlabeled capture placeholder nucleic acid strand comprises a nucleotide sequence designed to hybridize to and capture a nucleic acid target of interest. (21) The method according to (20), wherein the target nucleic acid comprises a microRNA, a small non-coding RNA, an mRNA, or a DNA sequence. (22) The method according to (3) or (19), wherein the first sequence (stem-loop probe) comprises the nucleotide sequence AAAAACTAAGAAAAAAAAATGGCAGTGTCTTAG (miR-34a stem-loop probe, SEQ ID NO: 1), and the second sequence (placeholder) comprises the nucleotide sequence ACAACCAGCTAAGACACTGCCATTTT (miR-34a placeholder, SEQ ID NO: 2) for miR-34a miRNA sensing. (23) The method according to (3) or (19), wherein the first sequence (stem-loop probe) comprises the nucleotide sequence AAAAATACCCTTTATATAAAAATAATACTGCCGGGTA (miR-200b-3p stem-loop probe, SEQ ID NO: 3), and the second sequence (placeholder) comprises the nucleotide sequence TCCATCATTACCCGGCAGTATTATTTT (miR200b-3p placeholder, SEQ ID NO: 4) for miR200b-3p miRNA sensing. (24) The method according to (3) or (19), wherein the first sequence (stem-loop probe) comprises the nucleotide sequence AAAAAACCCAAATAAAAAATAATACTGCCGGGT (miR200c-3b stem-loop probe, SEQ ID NO: 5), and the second sequence (placeholder) comprises the nucleotide sequence TCCATCATTACCCGGCAGTATTA (miR200c-3p, SEQ ID NO: 6) for miR200c-3p miRNA sensing. (25) The method according to (3) or (19), wherein the first sequence (stem-loop probe) comprises the sequence SH-AAAAA+CT+AA+GA+AA+AA+AA+AA+TG+GC+GC+AG+TG+TC+TT+AG+(miR-34a, SEQ ID NO: 7) and is labeled with a Raman reporter, (2) a plasmon-active nanoparticle, and (3) an unlabeled capture placeholder nucleic acid strand comprising a second sequence, wherein the sequence comprises AC+AA+CC+AG+CT+AA+GA+CA+CT+GC+CA+TT+TT(MIR-34a, SEQ ID NO: 8) for miR-34a miRNA sensing. (26) The method according to (3) or (19), wherein the plasmon-active nanoparticles are selected from the group consisting of silver nanospheres, gold nanospheres, silver nanoshells, gold nanoshells, silver nanostars, and gold nanostars. (27) The optical reporters include Raman dyes, 3,3'-diethylthiadicarbocyanine iodide (DTDC), 3,3'-diethylthiatricarbocyanine iodide (DTTC), 1,1',3,3,3',3'-hexamethylindotricarbocyanine iodide (HITC), CY3 dye, CY3.5 dye, CY5.5 dye, CY7 dye, CY7.5 dye, positively charged hydrophobic near-infrared (NIR) dyes, IR-780, IR-792, I The method according to (3) or (19), selected from the group consisting of R-797, IR-813, methylene blue hydrate (MB), 4-mercaptobenzoic acid (4-MBA), 5,5'-dithiobis-2-nitrobenzoic acid (DTNB), 4-aminothiophenol (4ATP), fluorescein, fluorescein isothiocyanate (FITC), thionine dye, rhodamine-based dye, crystal violet, fluorescent labeling, or absorbance labeling. (28) The method according to (15), wherein the transfection comprises electroporating a cell culture medium containing one or more stem cell-derived cells and one or more nanoprobes, wherein at least a portion of the one or more stem cell-derived cells remain viable after electroporation. (29) The method according to (28), wherein at least 35% of one or more stem cell-derived cells remain viable after electroporation. (30) The method according to (28), wherein 30% to 80% of one or more stem cell-derived cells remain viable after electroporation. (31) The method according to (28), wherein electroporation is performed at 200V to 500V, such as 250V or 300V. (32) The method according to (28), wherein electroporation is performed with pulse lengths of 0.5 to 10 milliseconds (ms), 3 to 5 milliseconds (ms), or 3 to 4 milliseconds (ms). (33) The method according to (28), wherein electroporation is performed at 250V with a pulse length of 2 to 4 milliseconds (ms). (34) The method according to (28), wherein electroporation is performed at 300V with a pulse length of 2 to 4 milliseconds (ms). (35) The method according to (28), wherein electroporation is performed in 1 to 5 pulses, 1 to 3 pulses, or 1 pulse. (36) The method according to (15), further comprising administering to one or more transfected stem cell-derived cells and detecting an optical signal from one or more nanoprobes in vivo. (37) The method according to (36), wherein the viability of one or more stem cell-derived cells is monitored in vivo in real time. (38) The method according to (15), wherein monitoring the viability of one or more stem cell-derived cells is performed in real time to monitor stem cell differentiation in vitro. (39) The method according to (1) or (15), wherein one or more stem cell-derived cells contain stem cells. (40) The method according to (1) or (15), wherein one or more stem cell-derived cells are selected from the group consisting of beta cells, cardiomyocytes, nerve cells, hepatocytes, kidney cells, epithelial cells, endothelial cells, and combinations thereof. (41) A method for transfecting stem cell-derived cells with a nanoprobe using electroporation while maintaining at least some of the components of the nanoprobe, To provide a cell culture medium comprising one or more stem cell-derived cells and one or more nanoprobes having an initial configuration, Electroporating a cell culture medium containing one or more stem cell-derived cells and one or more nanoprobes, wherein at least a portion of the one or more nanoprobes maintain their initial configuration after electroporation. The above method, including. (42) The method according to (41), wherein one or more nanoprobes include an inverse molecular sentinel (iMS) nanoprobe. (43) The method according to (42), wherein the initial configuration of the iMS nanoprobe is turned off. (44) The method according to (42), wherein the initial configuration of the iMS nanoprobe is turned on. (45) A method for increasing the uptake of nanoprobes into stem cell-derived cells while maintaining the viability of stem cell-derived cells, To provide a cell culture medium containing one or more stem cell-derived cells and one or more nanoprobes, Electroporating a cell culture medium containing one or more stem cell-derived cells and one or more nanoprobes, wherein the amount of one or more nanoprobes transfected into one or more stem cell-derived cells is greater than the amount that would have been transfected into one or more stem cell-derived cells if the transfection consisted only of passive uptake. Methods that include... (46) The method according to (45), wherein at least 35% of one or more stem cell-derived cells remain viable after electroporation. (47) The method according to (45), wherein 30% to 80% of one or more stem cell-derived cells remain viable after electroporation. (48) The method according to (41) or (45), wherein one or more stem cell-derived cells contain stem cells. (49) The method according to (45), wherein one or more nanoprobes include an inverse molecular sentinel (iMS) nanoprobe. (50) iMS nanoprobes Plasmon-activated nanoparticles and A stem-loop nucleic acid probe, one end of which is bound to a nanoparticle, wherein the nucleic acid contains a first sequence (stem-loop probe) and is labeled with an optical reporter, and An unlabeled capture placeholder nucleic acid strand containing a second sequence (placeholder) and The method according to (42) or (49), including the method described in (42) or (49).

Claims

1. A pharmaceutical composition for use in stem cell therapy, comprising one or more stem cell-derived cells having one or more nanoprobes, The one or more nanoprobes, (i) at least one plasmon-active nanoparticle, (ii) A stem-loop nucleic acid probe comprising a first sequence, wherein the first sequence is bound to the plasmon-active nanoparticle at one end and to an optical reporter at the other end of the second, (iii) A placeholder nucleic acid strand comprising a second sequence, wherein the second sequence is partially complementary to the first sequence and the nucleic acid target. Includes, When no nucleic acid target is present ("off" state), the stem-loop nucleic acid probe is bound to the placeholder nucleic acid strand; when a nucleic acid target is present ("on" state), the placeholder nucleic acid strand is detached from the stem-loop nucleic acid probe. The one or more nanoprobes emit a higher optical signal in the "on" state compared to the "off" state. After introducing the signal into one or more stem cell-derived cells, the optical signal provides detection of nucleic acid targets. The nucleic acid target is an RNA biomarker for health status information for one or more stem cell-derived cells, and the one or more stem cell-derived cells are either stem cells or cells differentiated in vitro from stem cells before introduction into the target. The above-mentioned pharmaceutical composition.

2. The pharmaceutical composition according to claim 1, wherein the health status information of one or more stem cell-derived cells includes information regarding the viability, functional capacity and / or health status of one or more stem cell-derived cells.

3. The pharmaceutical composition according to claim 1, wherein the RNA biomarker comprises microRNA, small non-coding RNA, or mRNA.

4. One or more nanoprobes, (i) a bioreceptor including a nucleotide sequence, aptamer, antibody, enzyme or cell-based receptor for capturing the target molecular species, (ii) Chemoreceptors or ligands for target recognition and sensing A pharmaceutical composition according to claim 1, comprising:

5. The pharmaceutical composition according to claim 1, wherein the optical signal is a Raman signal or a surface-enhanced Raman scattering (SERS) signal.

6. (A) One or more stem cell-derived cells having one or more nanoprobes are introduced into a subject by subcutaneous transplantation, intravenous injection, intra-arterial injection, or intrathecal injection, with or without a synthetic scaffold, or (B) Detection is performed using an optical fiber-based readout system. (i) The reading system is monitored by the subject and / or healthcare provider, (ii) The reading system is portable, (iii) The reading system is handheld. The pharmaceutical composition according to claim 1.

7. A method for monitoring the viability of one or more stem cell-derived cells for stem cell therapy, (a) Introducing one or more stem cell-derived cells into a cell culture medium, (b) Introducing one or more nanoprobes into a cell culture medium, thereby transfecting one or more stem cell-derived cells with the one or more nanoprobes, The one or more nanoprobes described above (i) at least one plasmon-active nanoparticle, (ii) A stem-loop nucleic acid probe comprising a first sequence, wherein the first sequence is bound to the plasmon-active nanoparticle at one end and to an optical reporter at the other end of a second sequence, (iii) A placeholder nucleic acid strand comprising the first sequence and a second sequence that is partially complementary to the nucleic acid target, When no nucleic acid target is present ("off" state), the stem-loop nucleic acid probe is bound to the placeholder nucleic acid strand; when a nucleic acid target is present ("on" state), the placeholder nucleic acid strand is detached from the stem-loop nucleic acid probe. The one or more nanoprobes emit a higher optical signal in the "on" state compared to the "off" state. The optical signal provides detection of nucleic acid targets. The above-mentioned introduction, and (c) Detect optical signals from one or more nanoprobes after transfection, thereby monitoring the viability of one or more stem cell-derived cells. Includes, The method described above, wherein the nucleic acid target is an RNA biomarker for the viability of one or more stem cell-derived cells, and the one or more stem cell-derived cells are stem cells or cells differentiated in vitro from stem cells.

8. Complying with monitoring the manipulation, injury, and / or shelf life of one or more stem cell-derived cells for use in one or more of the following: stem cells and progenitor cells, stem cells derived from reprogrammed differentiated cells, and insulin-producing pancreatic islets, The method according to claim 7, wherein the stem cells and progenitor cells are derived from a source selected from the group consisting of embryos, pregnant cells and adult tissues.

9. The method according to claim 7, wherein one or more stem cell-derived cells are introduced into the cell culture medium before, after, or simultaneously with the introduction of one or more nanoprobes into the cell culture medium.

10. The method according to claim 7, wherein the RNA biomarker comprises microRNA, small non-coding RNA, or mRNA.

11. (I) Plasmon-active nanoparticles are selected from the group consisting of silver nanospheres, gold nanospheres, silver nanoshells, gold nanoshells, silver nanostars, and gold nanostars, or (II) Optical reporters include Raman dyes, 3,3'-diethylthiadicarbocyanine iodide (DTDC), 3,3'-diethylthiatricarbocyanine iodide (DTTC), 1,1',3,3,3',3'-hexamethylindotricarbocyanine iodide (HITC), CY3 dye, CY3.5 dye, CY5.5 dye, CY7 dye, CY7.5 dye, positively charged hydrophobic near-infrared (NIR) dyes, IR-780, IR-79 2. The pharmaceutical composition according to claim 1, selected from the group consisting of IR-797, IR-813, methylene blue hydrate (MB), 4-mercaptobenzoic acid (4-MBA), 5,5'-dithiobis-2-nitrobenzoic acid (DTNB), 4-aminothiophenol (4ATP), fluorescein, fluorescein isothiocyanate (FITC), thionine dye, rhodamine-based dye, crystal violet, fluorescent labeling, and absorbance labeling.

12. (I) Plasmon-active nanoparticles are selected from the group consisting of silver nanospheres, gold nanospheres, silver nanoshells, gold nanoshells, silver nanostars, and gold nanostars, or (II) Optical reporters include Raman dyes, 3,3'-diethylthiadicarbocyanine iodide (DTDC), 3,3'-diethylthiatricarbocyanine iodide (DTTC), 1,1',3,3,3',3'-hexamethylindotricarbocyanine iodide (HITC), CY3 dye, CY3.5 dye, CY5.5 dye, CY7 dye, CY7.5 dye, positively charged hydrophobic near-infrared (NIR) dyes, IR-780, IR- The method according to claim 7, wherein a substance selected from the group consisting of 792, IR-797, IR-813, methylene blue hydrate (MB), 4-mercaptobenzoic acid (4-MBA), 5,5'-dithiobis-2-nitrobenzoic acid (DTNB), 4-aminothiophenol (4ATP), fluorescein, fluorescein isothiocyanate (FITC), thionine dye, rhodamine-based dye, crystal violet, fluorescent labeling, and absorbance labeling.

13. The transfection comprises electroporating a cell culture medium containing one or more stem cell-derived cells and one or more nanoprobes, wherein at least a portion of the one or more stem cell-derived cells remain viable after electroporation. At least 35% of one or more stem cell-derived cells remain viable after electroporation, or The method according to claim 7, wherein 30% to 80% of one or more stem cell-derived cells remain viable after electroporation.

14. (i) Electroporation is performed at 200V to 500V or 250V or 300V, (ii) Electroporation is performed with pulse lengths of 0.5 to 10 milliseconds (ms), 3 to 5 milliseconds (ms), or 3 to 4 milliseconds (ms). (iii) Electroporation is performed at 250V with a pulse length of 2 to 4 milliseconds (ms). (iv) Electroporation is performed at 300V with a pulse length of 2 to 4 milliseconds (ms), or (v) The method according to claim 13, wherein electroporation is performed in 1 to 5 pulses, 1 to 3 pulses, or 1 pulse.

15. The method according to claim 7, wherein monitoring the viability of one or more stem cell-derived cells is performed in real time to monitor stem cell differentiation.

16. One or more stem cell-derived cells contain stem cells, or The pharmaceutical composition according to claim 1, wherein one or more stem cell-derived cells are selected from the group consisting of beta cells, cardiomyocytes, nerve cells, hepatocytes, kidney cells, epithelial cells, endothelial cells, and combinations thereof.

17. One or more stem cell-derived cells contain stem cells, or The method according to claim 7, wherein one or more stem cell-derived cells are selected from the group consisting of beta cells, cardiomyocytes, nerve cells, hepatocytes, kidney cells, epithelial cells, endothelial cells, and combinations thereof.

18. A method according to claim 7, comprising electroporating a cell culture medium, wherein at least a portion of one or more nanoprobes maintains their initial configuration after electroporation. and If one or more nanoprobes are initially configured to be off, The method according to claim 7, wherein the initial configuration of one or more nanoprobes is turned on.

19. The method involves electroporating a cell culture medium containing one or more stem cell-derived cells and one or more nanoprobes, wherein the amount of one or more nanoprobes transfected into one or more stem cell-derived cells is greater than the amount that would have been transfected into one or more stem cell-derived cells if the transfection consisted solely of passive uptake. The method according to claim 7, wherein at least 35% of one or more stem cell-derived cells remain viable after electroporation, or 30% to 80% of one or more stem cell-derived cells remain viable after electroporation.