Immunogenic composition containing conjugate capsule sugar antigen and its use
The immunogenic composition with glycoconjugates from specific Streptococcus pneumoniae serotypes addresses the limitations of current vaccines by offering broad protection against pneumococcal diseases, including strains not covered by PREVNAR13®, particularly benefiting children under 2 years of age.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- PFIZER INC
- Filing Date
- 2024-10-25
- Publication Date
- 2026-05-26
AI Technical Summary
Current pneumococcal vaccines, such as PREVNAR13®, fail to provide adequate protection against certain Streptococcus pneumoniae serotypes, and there is a risk of serotype substitution due to antibiotic resistance, necessitating a broader immune response, particularly in children under 2 years of age.
An immunogenic composition comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 15B, 22F, 33F, 12F, 10A, 11A, and optionally including additional serotypes, conjugated to carrier proteins like DT, TT, or CRM 197, to induce immune responses against a broader range of pneumococcal strains.
The composition provides protection against serotypes not covered by existing vaccines, maintaining immune responses to covered serotypes, thereby enhancing overall immunity, especially in vulnerable populations.
Smart Images

Figure 0007866021000032 
Figure 0007866021000033 
Figure 0007866021000034
Abstract
Description
[Technical Field]
[0001] This invention relates to a novel immunogenic composition comprising a conjugated capsule sugar antigen (glycoconjugate) and its use. The immunogenic composition of this invention typically comprises a glycoconjugate in which the sugar is derived from a serotype of Streptococcus pneumoniae. The invention also relates to the vaccination of human subjects, particularly infants and the elderly, against pneumococcal infection using the novel immunogenic composition. [Background technology]
[0002] Infections caused by Streptococcus pneumoniae are the leading cause of morbidity and death worldwide. Pneumonia, febrile bacteremia, and meningitis are the most common manifestations of invasive pneumococcal disease, while bacterial spread within the airways can lead to middle ear infections, sinusitis, or recurrent bronchitis. Compared to invasive disease, non-invasive manifestations are usually less severe but are even more common.
[0003] In Europe and the United States, pneumococcal pneumonia is the most common community-acquired bacterial pneumonia, with an estimated 100 cases per 100,000 adults each year. The corresponding figures for febrile bacteremia and meningitis are 15–19 and 1–2 per 100,000, respectively. The risk for one or more of these manifestations is much higher in infants and the elderly, as well as in immunocompromised individuals of any age. Even in economically developed areas, invasive pneumococcal disease has a high mortality rate; for adults with pneumococcal pneumonia, the mortality rate is 10–20% on average, but can exceed 50% in high-risk groups. Pneumonia is by far the most common cause of death from pneumococcal disease worldwide.
[0004] Streptococcus pneumoniae (Pneumococcus), the causative agent of pneumococcal disease, is a Gram-positive, encapsulated cocci surrounded by a polysaccharide capsule. Differences in the composition of this capsule allow for serological differentiation between approximately 91 capsule types, some of which are frequently associated with pneumococcal disease, while others are rarely. Invasive pneumococcal infections include pneumonia, meningitis, and febrile bacteremia; in particular, common non-invasive manifestations include otitis media, sinusitis, and bronchitis.
[0005] Pneumococcal conjugate vaccines (PCVs) are pneumococcal vaccines used to protect against diseases caused by Streptococcus pneumoniae (S. pneumoniae). Currently, there are three PCV vaccines available on the global market: PREVNAR® (called Prevenar in some countries) (7-valent vaccine), SYNFLORIX® (10-valent vaccine), and PREVNAR13® (13-valent vaccine).
[0006] The recent emergence of broad microbial resistance to essential antibiotics, coupled with the increasing number of immunocompromised individuals, highlights the need for a pneumococcal vaccine that offers broader protection.
[0007] In particular, there are serotypes that are not found in PREVNAR13(registered trademark), and there is a possibility that serotype substitution may occur in the future. Therefore, the medical need to cover pneumococcal diseases has not yet been met, and action is needed. 13 in PREVNAR13(registered trademark) The specific serotypes that cause disease exceeding 200% vary by region and population, and may change over time due to the acquisition of antibiotic resistance, the introduction of pneumococcal vaccines, and long-term trends of unknown origins. There is a need for immunogenic compositions that can be used to induce further immune responses against Streptococcus pneumoniae in humans and, in particular, in children under 2 years of age. [Overview of the project] [Problems that the invention aims to solve]
[0008] The objective of the novel immunogenic compositions of the present invention is to provide adequate protection against Streptococcus pneumoniae serotypes not found in PREVNAR13®. In one embodiment, the objective of the immunogenic compositions of the present invention is to provide adequate protection against Streptococcus pneumoniae serotypes not found in PREVNAR® (7-valent vaccine), SYNFLORIX® and / or PREVNAR13®, while maintaining an immune response to the serotypes currently covered by said vaccines. [Means for solving the problem]
[0009] The present invention relates to an immunogenic composition comprising at least one glycoconjugate selected from the group consisting of a glycoconjugate derived from Streptococcus pneumoniae serotype 15B, a glycoconjugate derived from Streptococcus pneumoniae serotype 22F, a glycoconjugate derived from Streptococcus pneumoniae serotype 33F, a glycoconjugate derived from Streptococcus pneumoniae serotype 12F, a glycoconjugate derived from Streptococcus pneumoniae serotype 10A, a glycoconjugate derived from Streptococcus pneumoniae serotype 11A, and a glycoconjugate derived from Streptococcus pneumoniae serotype 8.
[0010] In one embodiment, the present invention provides an immunogenic composition comprising at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15B, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 22F, and at least one glycoconjugate derived from Streptococcus pneumoniae serotype 33F.
[0011] In another embodiment, the present invention relates to at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15B, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 22F, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 33F, and Streptococcus pneumoniae The present invention provides an immunogenic composition comprising at least one glycoconjugate derived from serotype 12F, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 10A, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 11A, and at least one glycoconjugate derived from Streptococcus pneumoniae serotype 8.
[0012] In one embodiment, the above immunogenic composition is Streptococcus pneumoniae (S Further comprising glycoconjugates derived from serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F of *Pneumoniae*.
[0013] In another embodiment, the immunogenic composition further comprises glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 5, and 7F.
[0014] In another embodiment, the immunogenic composition further comprises glycoconjugates derived from Streptococcus pneumoniae serotypes 6A and 19A.
[0015] In another embodiment, the immunogenic composition further comprises a glycoconjugate derived from Streptococcus pneumoniae serotype 3.
[0016] In another embodiment, the immunogenic composition further comprises glycoconjugates derived from Streptococcus pneumoniae serotypes 2, 9N, 17F, 20 and / or 15C.
[0017] In one embodiment, the immunogenic composition described above does not contain capsular sugars derived from Streptococcus pneumoniae serotypes 9N, 9A, and / or 9L.
[0018] In one embodiment, the immunogenic composition is an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent Streptococcus pneumoniae conjugate composition. In another embodiment, the immunogenic composition is a 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25-valent Streptococcus pneumoniae conjugate composition.
[0019] In one aspect, glycoconjugates include DT (diphtheria toxin), TT (tetanus toxin), and CRM. 197 They are individually conjugated to carrier proteins selected from a group consisting of other DT variants, PD (Haemophilus influenzae protein D), or their immunologically functional equivalents.
[0020] In one embodiment, the present invention provides a container filled with any immunogenic composition as defined herein.
[0021] In one embodiment, the present invention provides any immunogenic composition as defined herein for use as a pharmaceutical, in particular for use as a vaccine.
[0022] In one embodiment, the present invention provides a method for preventing, treating, or improving an infection, disease, or condition associated with Streptococcus pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of any immunogenic composition as defined herein. [Brief explanation of the drawing]
[0023] [Figure 1] This figure shows the repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 8 (Pn-8). [Figure 2] This figure shows the repeat polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 10A (Pn-10A). [Figure 3] This figure shows the repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 11A (Pn-11A). [Figure 4] This figure shows the repeat polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 12F (Pn-12F). [Figure 5] This figure shows the repeat polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 15B (Pn-15B). [Figure 6] This figure shows the repeat polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 22F (Pn-22F). [Figure 7] This figure shows the repeat polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 33F (Pn-33F). [Figure 8]This figure shows typical process flowcharts for the activation (A) and conjugation (B) processes that can be used in the preparation of Pn-33F glycoconjugates. [Figure 9] This figure shows the effect on DO due to changes in the amount of NCS in the TEMPO / NCS oxidation reaction. [Figure 10] This figure shows the evaluation of the stability of Pn-12F glycoconjugate. [Figure 11] This figure shows the cross-functional OPA response. A subset of 59 serum samples from adults vaccinated with the 13-valent pneumococcal conjugate vaccine (US Study 6115A1-004; ClinicalTrials.gov Identifier: NCT00427895) was evaluated by OPA for the presence of functional antibodies against serotypes 9V, 9A, 9L, and 9N. The percentage of samples with OPA-positive titers (i.e., ≥1:8) is shown above each group. Geometric mean titers (GMT) are listed on the x-axis below each group. [Figure 12] This figure shows the cross-functional OPA response of 66 correlated pre / post-vaccination serum samples. A subset of 66 correlated pre- and post-vaccination serum panels from adults vaccinated with the 13-valent pneumococcal conjugate vaccine (Trial 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572) was evaluated for the presence of functional antibodies against serotypes 9V, 9A, 9L, and 9N using OPA. The percentage of samples with OPA-positive titers (i.e., ≥1:8) is shown above each group. Geometric mean titers (GMT) are listed on the x-axis below each group. [Figure 13]This figure shows the inverse cumulative distribution curves (RCDC) of serotype 9V (Pn9V) before and after immunization. It represents the inverse cumulative distribution curves of OPA titers for serotype 9V from matched pre- and post-vaccination serum panels (N=66) vaccinated with the 13-valent pneumococcal conjugate vaccine (Trial 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plots represent the percentage of serum with OPA-positive titers (i.e., ≥1:8). [Figure 14] This figure shows the inverse cumulative distribution curves (RCDC) of immunization with Streptococcus pneumoniae serotype 9A (Pn9A) before and after vaccination. It represents the inverse cumulative distribution curves of OPA titers for serotype 9A from matched pre- and post-vaccination serum panels (N=66) vaccinated with the 13-valent pneumococcal conjugate vaccine (Trial 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plots represent the percentage of serum with OPA-positive titers (i.e., ≥1:8). [Figure 15] This figure shows the inverse cumulative distribution curves (RCDC) of immunization with Streptococcus pneumoniae serotype 9L (Pn9L) before and after vaccination. It represents the inverse cumulative distribution curves of OPA titers for serotype 9L from matched pre- and post-vaccination serum panels (N=66) vaccinated with the 13-valent pneumococcal conjugate vaccine (Trial 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plots represent the percentage of serum with OPA-positive titers (i.e., ≥1:8). [Figure 16]This figure shows the inverse cumulative distribution curves (RCDC) of serotype 9N (Pn9N) before and after immunization with Streptococcus pneumoniae. It represents the inverse cumulative distribution curves of OPA titers for serotype 9N from a matched pre- and post-vaccination serum panel (N=66) vaccinated with the 13-valent pneumococcal conjugate vaccine (Trial 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plots represent the percentage of serum with an OPA-positive titer (i.e., ≥1:8). [Modes for carrying out the invention]
[0024] 1. Immunogenic composition of the present invention The immunogenic compositions of the present invention typically contain a conjugated capsule saccharide antigen (also called a glycoconjugate) derived from a serotype of Streptococcus pneumoniae.
[0025] Preferably, the number of Streptococcus pneumoniae capsular sugars may range from 8 different serotypes (or "v", valency) to 20 different serotypes (20v). In one embodiment, there are 8 different serotypes. In one embodiment, there are 9 different serotypes. In one embodiment, there are 10 different serotypes. In one embodiment, there are 11 different serotypes. In one embodiment, there are 12 different serotypes. In one embodiment, there are 13 different serotypes. In one embodiment, there are 14 different serotypes. In one embodiment, there are 15 different serotypes. In one embodiment, there are 16 different serotypes. In one embodiment, there are 17 different serotypes. In one embodiment, there are 18 different serotypes. In one embodiment, there are 19 different serotypes. In one embodiment, there are 20 different serotypes. The capsular sugars are conjugated to a carrier protein to form a glycoconjugate as described below herein.
[0026] If a protein carrier is identical for two or more sugars in its composition, the sugars can be conjugated to the same molecule of the protein carrier (a carrier molecule having two or more different sugars conjugated to it) [see, for example, WO2004 / 083251]. I want to be treated that way.
[0027] However, in a preferred embodiment, the sugars are individually conjugated to different molecules of the protein carrier (each molecule of the protein carrier having only one type of sugar conjugated to it). In the above embodiment, the capsule sugars are said to be individually conjugated to the carrier protein.
[0028] For the purposes of this invention, the term "glycoconjugate" refers to a capsular sugar covalently linked to a carrier protein. In one embodiment, the capsular sugar is directly linked to the carrier protein. In a second embodiment, the bacterial sugar is linked to the protein via a spacer / linker.
[0029] 1.1 Carrier protein of the present invention The component of the glycoconjugate of the present invention is a carrier protein to which sugars are conjugated. The terms "protein carrier," "carrier protein," and "carrier" can be used interchangeably herein. The carrier protein should be prepared according to a standard conjugation procedure.
[0030] In preferred embodiments, the carrier protein of the glycoconjugate is DT (diphtheria toxin), TT (tetanus toxin), or a fragment of TT C, CRM 197(Non-toxic but antigenically identical variants of diphtheria toxin), other DT variants (CRM176, CRM228, CRM45 (Uchida et al. (1973) J. Biol. Chem. 218:3838~3844), CRM9, CRM102, CRM103 or CRM107; Nicholls and Youle, Genetically Engineered Toxins, Frankel (ed.), Maecel Dekker Other mutations described by Inc. (1992); deletions or mutations from Glu-148 to Asp, Gln or Ser and / or Ala-158 to Gly, and other mutations disclosed in U.S. Patent Nos. 4,709,017 and 4,950,740; mutations of at least one residue among Lys516, Lys526, Phe530 and / or Lys534, and other mutations disclosed in U.S. Patent Nos. 5,917,017 and 6,455,673; or fragments disclosed in U.S. Patent No. 5,843,711, Streptococcus pneumoniae pneumomolinsin (ply) (Kuo et al. (1995) Infect lmmun 63:2706~2713), for example, ply detoxified in several forms, e.g., dPLY-GMBS (WO2004 / 081515, WO2006 / 032499) or dPLY-formol, PhtX, e.g., PhtA, PhtB, PhtD, PhtE (the sequences of PhtA, PhtB, PhtD or PhtE are disclosed in WO00 / 37105 and WO00 / 39299) and fusions of Pht proteins, e.g., PhtDE fusion, PhtBE fusion, PhtAE (WO01 / 98334, WO03 / 054007, WO2009 / 000826), usually Neisseria meningitidis. OMPC (Meningococcal outer membrane protein) (EP0372501), extracted from serogroup B of Neisseria meningitidis (N.This includes proteins derived from Haemophilus influenzae (PhD), PD (Haemophilus influenzae protein D; see, e.g., EP0594610B), or immunologically functional equivalents thereof, synthetic peptides (EP0378881, EP0427347), heat shock proteins (WO93 / 17712, WO94 / 03208), pertussis proteins (WO98 / 58668, EP0471177), cytokines, lymphokines, growth factors or hormones (WO91 / 01146), artificial proteins containing multiple human CD4+ T cell epitopes derived from various pathogen-derived antigens (Falugi et al. (2001) Eur J Immunol 31:3816-3824), e.g., N19 protein (Baraldoi et al. (2004) Infect lmmun The group selected consists of 72:4884-4887), pneumococcal surface protein PspA (WO02 / 091998), iron uptake protein (WO01 / 72337), Clostridium difficile toxin A or B (WO00 / 61761), transferrin-binding protein, pneumococcal adhesion protein (PsaA), and recombinant Pseudomonas aeruginosa exotoxin A (especially its non-toxic variants (such as exotoxin A carrying a substitution at glutamic acid 553) (Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971)). Other proteins, such as obalbumin, keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), or purified protein derivatives (PPD) of tuberculin, can also be used as carrier proteins. Other suitable carrier proteins include inactivated bacterial toxins such as cholera toxoid (e.g., described in WO2004 / 083251), Escherichia coli LT, Escherichia coli ST, and exotoxin A derived from Pseudomonas aeruginosa.
[0031] In preferred embodiments, the carrier protein of the glycoconjugate is TT, DT , DT variants (CRM 197 etc.), Haemophilus influenzae (H. influenzae) protein D, PhtX, PhtD, PhtDE fusion (especially those described in WO01 / 98334 and WO03 / 054007), detoxified pneumolysin, PorB, N19 protein, PspA, OMPC, toxin A or B of Clostridium difficile (C. difficile), and PsaA, are independently selected from the group consisting of.
[0032] In one embodiment, the carrier protein of the glycoconjugate of the present invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugate of the present invention is TT (tetanus toxin).
[0033] In another embodiment, the carrier protein of the glycoconjugate of the present invention is PD (Haemophilus influenzae (H. influenzae) protein D; see, for example, EP0594610B).
[0034] In a preferred embodiment, the capsular polysaccharide of the present invention is conjugated to CRM 197 protein. CRM 197 protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. CRM 197 is a non-toxigenic phage β197 produced by nitrosoguanidine mutagenesis of toxigenic corynephage beta (Uchida et al. (1971) Nature New Biology 233:8 - 11) tox- and is produced by Corynebacterium diphtheriae infected with it. CRM 197 protein has the same molecular weight as diphtheria toxin, but is different from it due to a single base change (from guanine to adenine) in the structural gene. This single base change causes an amino acid substitution (from glutamic acid to glycine) in the mature protein, removing the toxicity of diphtheria toxin. CRM 197Proteins are safe and effective T cell-dependent carriers for carbohydrates. 197 Further details regarding its production can be found, for example, in U.S. Patent No. 5,614,382.
[0035] In one embodiment, the capsule sugars of the present invention are CRM 197 Protein or CRM 197 It is conjugated to the A chain (see CN103495161). In one embodiment, the capsule sugars of the present invention are obtained via expression by genetically modified Escherichia coli (E. coli) in CRM 197 It is conjugated to the A chain (see CN103495161). In one embodiment, all capsule sugars of the present invention are CRM 197 It is conjugated to. In one embodiment, all of the capsule sugars of the present invention are CRM 197 It is conjugated into the A chain.
[0036] Therefore, in a common embodiment, the glycoconjugate of the present invention uses CRM as the carrier protein. 197 It includes, where the capsule polysaccharide is CRM 197 It is sharedly connected to it.
[0037] 1.2 Capsule sugars of the present invention Throughout this specification, the term "sugars" may include, or may include, polysaccharides and / or oligosaccharides. In common embodiments, sugars are polysaccharides, in particular, Streptococcus pneumoniae capsular polysaccharides.
[0038] Capsular polysaccharides are prepared by standard techniques known to those skilled in the art.
[0039] In the present invention, the capsular polysaccharide is, for example, serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 1 of Streptococcus pneumoniae. These can be prepared from 1A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. Typically, the capsular polysaccharides are produced by growing each Streptococcus pneumoniae serotype in a culture medium (e.g., soybean-based medium), and then prepared from the bacterial culture. The Streptococcus pneumoniae bacterial strains used to produce each polysaccharide used in the glycoconjugates of the present invention can be obtained from established culture stock facilities or clinical specimens.
[0040] Populations of organisms (each Streptococcus pneumoniae serotype) are often subcultured in one or more seed fermenters of increasing capacity, scaled up from seed vials to seed bottles, until production-scale fermentation capacity is reached. At the end of the growth cycle, the cells are lysed, and the lysate culture is harvested for downstream (purification) processes (see, for example, WO2006 / 110381, WO2008 / 118752, and U.S. Patent Applications Publications 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).
[0041] Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO2006 / 110352 and WO2008 / 118752).
[0042] The purified polysaccharides can be activated (e.g., chemically activated) to enable them to react (e.g., with eTEC spacers) and then incorporated into the glycoconjugate of the present invention as further described herein.
[0043] The capsular polysaccharide of Streptococcus pneumoniae contains repeating oligosaccharide units that may contain up to eight sugar residues.
[0044] In one embodiment, the capsule saccharides of the present invention may be shorter than the natural length of a single oligosaccharide unit or a repeating oligosaccharide unit. In one embodiment, the capsule saccharides of the present invention are a single repeating oligosaccharide unit of the associated serotype.
[0045] In one embodiment, the capsule sugars of the present invention may be oligosaccharides. Oligosaccharides have a small number of repeating units (typically 5 to 15 repeating units) and are typically derived synthetically or by hydrolysis of polysaccharides.
[0046] However, preferably, all of the capsular saccharides in the present invention and in the immunogenic compositions of the present invention are polysaccharides. High molecular weight capsular polysaccharides can induce certain antibody immune responses due to epitopes present on the antigen surface. Isolation and purification of high molecular weight capsular polysaccharides are preferably intended for use in the conjugates, compositions and methods of the present invention.
[0047] In some embodiments, the polysaccharide purified before conjugation has a molecular weight of 10 kDa to 4,000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 4,000 kDa. In further such embodiments, the polysaccharide is 50kDa~3,500kDa; 50kDa~3,000kDa; 50kDa~2,500kDa; 50kDa~2,000kDa; 50kDa~1,750kDa; 50kDa~1,500kDa; 50kDa~1,250kDa; 50kDa~1,000kDa; 50kDa~750kDa; 50kDa~500kDa; 100kDa~4,000kDa; 100kDa~3,500kDa; 100kDa~3,000kDa; 100kDa~2,500kDa; 100kDa~2,000kDa; 100kDa~2 ,000kDa;100kDa~1,750kDa;100kDa~1,500kDa;100kDa~1,250kDa;100kDa~1,000kDa;10 0kDa~750kDa;100kDa~500kDa;200kDa~4,000kDa;200kDa~3,500kDa;200kDa~3,000kDa;2 The molecules have molecular weights of 00kDa to 2,500kDa; 200kDa to 2,000kDa; 200kDa to 2,000kDa; 200kDa to 1,750kDa; 200kDa to 1,500kDa; 200kDa to 1,250kDa; 200kDa to 1,000kDa; 200kDa to 750kDa; or 200kDa to 500kDa. Any integer within any of the above ranges is intended as an embodiment of this disclosure.
[0048] The polysaccharide may undergo a slight size reduction during the normal purification procedure. Furthermore, as described herein, the polysaccharide may be subjected to sizing techniques before conjugation. Mechanical or chemical sizing can be used. Chemical hydrolysis can be carried out using acetic acid. Mechanical sizing can be carried out using high-pressure homogenization shear. The molecular weight ranges mentioned above refer to the purified polysaccharide before conjugation (e.g., before activation).
[0049] In a preferred embodiment, the purified polysaccharide is a capsular polysaccharide derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, or 33F of Streptococcus pneumoniae, having a molecular weight within one of the molecular weight ranges described herein.
[0050] As used herein, the term “molecular weight” of a polysaccharide or carrier protein-polysaccharide conjugate refers to the molecular weight calculated by size exclusion chromatography (SEC) in combination with multi-angle laser scattering detectors (MALLS).
[0051] In some embodiments, the pneumococcal sugars derived from serotypes 9V, 18C, 11A, 15B, 22F, and / or 33F of the present invention are O-acetylated.
[0052] The purified polysaccharides described herein are chemically activated to produce sugars that can react with carrier proteins. These pneumococcal conjugates are prepared by separate processes and formulated into single-dose formulations as described below.
[0053] 1.2.1 Pneumococcal polysaccharides derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F Capsular polysaccharides derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F can be prepared by standard techniques known to those skilled in the art (see, for example, WO2006 / 110381). Capsular polysaccharides can be produced by growing each Streptococcus pneumoniae serotype in culture medium; at the end of the growth cycle, after lysing the cells, the lysate culture is harvested for downstream (purification) processes. Individual polysaccharides are typically purified by centrifugation, sedimentation, ultrafiltration, and / or column chromatography (see, for example, WO2006 / 110352 and WO2008 / 118752). The purified polysaccharide can be further processed as described herein to prepare the glycoconjugate of the present invention.
[0054] In some embodiments, purified polysaccharides derived from pre-conjugation Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and / or 23F have a molecular weight of 10 kDa to 4,000 kDa. In other such embodiments, the polysaccharides have a molecular weight of 50 kDa to 4,000 kDa; 50 kDa to 3,000 kDa or 50 kDa to 2,000 kDa. In further such embodiments, the polysaccharide is 50kDa~3,500kDa; 50kDa~3,000kDa; 50kDa~2,500kDa; 50kDa~2,000kDa; 50kDa~1,750kDa; 50kDa~1,500kDa; 50kDa~1,250kDa; 50k 100kDa~3,500kDa;100kDa~3,000kDa;100kDa~2,500kDa;100kDa~2,000kDa;100kDa~1,750k 200k The molecules have molecular weights of Da ~ 2,500 kDa; 200 kDa ~ 2,000 kDa; 200 kDa ~ 1,750 kDa; 200 kDa ~ 1,500 kDa; 200 kDa ~ 1,250 kDa; 200 kDa ~ 1,000 kDa; 200 kDa ~ 750 kDa; or 200 kDa ~ 500 kDa. Any integer within any of the above ranges is intended as an embodiment of this disclosure.
[0055] The polysaccharide may undergo a slight decrease in size during the normal purification procedure. Furthermore, as described herein, the polysaccharide may be subjected to sizing techniques before conjugation. The molecular weight ranges mentioned above refer to the purified polysaccharide after the final sizing step and before conjugation (e.g., before activation).
[0056] In some embodiments, the pneumococcal sugars derived from serotype 9V and / or 18C of the present invention are O-acetylated. In some embodiments, the pneumococcal sugars derived from serotype 9V of the present invention are O-acetylated, and the pneumococcal sugars derived from serotype 18C of the present invention are de-O-acetylated.
[0057] 1.2.2 Pneumococcus polysaccharide serotype 8 The polysaccharide repeat unit of serotype 8 consists of a linear tetrasaccharide having one glucuronic acid (GlcpA), two glucopyranoses (Glcp), and one galactopyranose (Galp) (Jones et al. (1957) The Journal of the American Chemical Society. 79(11):2787~2793). All four monosaccharides are linked by 1,4-linkages, as shown in Figure 1.
[0058] Serotype 8 sugars can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Publications 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, as well as WO2008 / 118752). Furthermore, they can be produced using synthetic protocols.
[0059] Serotype 8 strains of Streptococcus pneumoniae can be obtained from established culture stock facilities (e.g., Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens. It is possible.
[0060] In some embodiments, the purified polysaccharide derived from Streptococcus pneumoniae serotype 8 before conjugation has a molecular weight of 10 kDa to 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In yet another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa.
[0061] In a further embodiment, the capsule polysaccharide is 100kDa~600kDa; 100kDa~500kDa; 100kDa~400kDa; 150kDa~600kDa; 150kDa~500kDa; 150kDa~400kDa; 200kDa~600kDa; 200kDa~500kDa; 200kDa~400kDa; Molecular weights of 250kDa to 600; 250kDa to 500kDa; 250kDa to 400kDa; 250kDa to 350kDa; 300kDa to 600kDa; 300kDa to 500kDa; 300kDa to 400kDa; 400kDa to 600kDa; 500kDa to 600kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is contemplated as an embodiment of the present disclosure.
[0062] The polysaccharide may undergo a slight decrease in size during the normal purification procedure. Furthermore, as described herein, the polysaccharide may be subjected to sizing techniques before conjugation. The molecular weight ranges mentioned above refer to the purified polysaccharide after the final sizing step and before conjugation (e.g., before activation).
[0063] 1.2.3 Pneumococcus polysaccharide serotype 10A The polysaccharide repeat unit of serotype 10A consists of two galactofuranoses (Gal f ), three galactopyranoses (Gal p ), one N-acetylgalactosamine (Gal pIt consists of branched hexasaccharide repeat units having a NAc (Na) and phosphoribitol skeleton (Jones, C. (2005) Carbohydrate Research 269(1):175~181). As shown in Figure 2, there are two branched monosaccharides in the β-GalpNAc moiety (β-3-Galp and β-6-Galf).
[0064] Serotype 10A sugars can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Publications 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, as well as WO2008 / 118752). Furthermore, they can be produced using synthetic protocols.
[0065] Serotype 10A strains of Streptococcus pneumoniae are stored in established culture facilities (e.g., Streptococcal Reference Laboratory (Centers for Disease Control)). It can be obtained from clinical specimens (and Prevention, Atlanta, GA, etc.) or from clinical samples.
[0066] In some embodiments, the purified polysaccharide derived from Streptococcus pneumoniae serotype 10A before conjugation has a molecular weight of 10 kDa to 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In yet another embodiment, the capsular polysaccharide is 100 It has a molecular weight of kDa ~ 800 kDa.
[0067] In a further embodiment, the capsule polysaccharide is 100kDa~600kDa; 100kDa~500kDa; 100kDa~400kDa; 150kDa~600kDa; 150kDa~500kDa; 150kDa~400kDa; 200kDa~600kDa; 200kDa~500kDa; 200kDa~400kDa; 2 Molecular weights of 50kDa to 600kDa; 250kDa to 500kDa; 250kDa to 400kDa; 250kDa to 350kDa; 300kDa to 600kDa; 300kDa to 500kDa; 300kDa to 400kDa; 400kDa to 600kDa; 500kDa to 600kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is contemplated as an embodiment of the present disclosure.
[0068] The polysaccharide may undergo a slight decrease in size during the normal purification procedure. Furthermore, as described herein, the polysaccharide may be subjected to sizing techniques before conjugation. The molecular weight ranges mentioned above refer to the purified polysaccharide after the final sizing step and before conjugation (e.g., before activation).
[0069] 1.2.4 Pneumococcus polysaccharide serotype 11A The polysaccharide repeat unit of serotype 11A is a linear tetrasaccharide skeleton (two galactopyranoses (Gal p ) and two glucopyranoses (Glc p It consists of )) and pendant phosphoglycerol (Richards et al. (1988) Adv. Exp. Med. Biol. 228: 595-597). The polysaccharide is O-acetylated at multiple positions, and based on data reported in the literature (Calix et al. (2011) J Bacteriol. 193(19): 5271-5278), the total amount of O-acetylation in 11A polysaccharide is approximately 2.6 O-acetyl groups per polysaccharide repeat unit.
[0070] Serotype 11A sugars can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Publications 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, as well as WO2008 / 118752). Furthermore, they can be produced using synthetic protocols.
[0071] Serotype 11A strains of Streptococcus pneumoniae should be stored in established culture cell storage facilities (e.g., Streptococcal Reference Laboratory (Centers for Disease Control)). It can be obtained from clinical specimens (and Prevention, Atlanta, GA, etc.) or from clinical samples.
[0072] The sizing of isolated serotype 11A capsular polysaccharides obtained by the purification of serotype 11A polysaccharides derived from Streptococcus pneumoniae lysates, and optionally the purified polysaccharides, can be characterized by various attributes, such as molecular weight (MW) and mM of acetate per mM of serotype 11A capsular polysaccharide.
[0073] In some embodiments, the purified polysaccharide derived from Streptococcus pneumoniae serotype 11A before conjugation has a molecular weight of 10 kDa to 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In yet another embodiment, the capsular polysaccharide is 100 It has a molecular weight of kDa ~ 800 kDa.
[0074] In further embodiments, the capsule polysaccharide is 100kDa~600kDa; 100kDa~500kDa; 100kDa~400kDa; 100kDa~300kDa; 100kDa~200kDa; 150kDa~600kDa; 150kDa~500kDa; 150kDa~400kDa; 150kDa~300kDa; 150kDa~200kDa; 200kDa~600kDa; 2 Molecular weights of 00kDa to 500kDa; 200kDa to 400kDa; 250kDa to 600kDa; 250kDa to 500kDa; 250kDa to 400kDa; 250kDa to 350kDa; 300kDa to 600kDa; 300kDa to 500kDa; 300kDa to 400kDa; 400kDa to 600kDa; 500kDa to 600kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is contemplated as an embodiment of the present disclosure.
[0075] The polysaccharide may undergo a slight decrease in size during the normal purification procedure. Furthermore, as described herein, the polysaccharide may be subjected to sizing techniques before conjugation. The molecular weight ranges mentioned above refer to the purified polysaccharide after the final sizing step and before conjugation (e.g., before activation).
[0076] In one embodiment, the size of the purified serotype 11A polysaccharide is reduced by high-pressure homogenization. High-pressure homogenization achieves a high shear rate by pumping the process flow through a channel having sufficiently small dimensions. The shear rate can be increased by using a larger applied homogenization pressure, and the exposure time can be increased by recirculating the feed flow with a homogenizer.
[0077] The high-pressure homogenization process is particularly suitable for reducing the size of purified serotype 11A polysaccharide while preserving the structural characteristics of the polysaccharide, such as the presence of O-acetyl groups.
[0078] The presence of O-acetyl in purified, isolated, or activated serotype 11A capsular polysaccharide or in serotype 11A polysaccharide-carrier protein conjugates is expressed as the number of mM acetates per mM of the polysaccharide, or as the number of O-acetyl groups per polysaccharide repeat unit.
[0079] In a preferred embodiment, the purified polysaccharide derived from Streptococcus pneumoniae serotype 11A contains at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, or 1.6 μmol of acetate per μmol of serotype 11A capsular polysaccharide.
[0080] 1.2.5 Pneumococcus polysaccharide serotype 12F The polysaccharide repeat unit of serotype 12F has two branches, as shown in Figure 4: Fuc p A pendant α-galactopyranose (Gal) linked at C3 of NAc p ) and Man p α-Glc coupled at NAcA's C3 p -(1→2)-α-Glc p A linear trisaccharide skeleton with disaccharide branches (one N-acetylfucosamine (Fuc p NAc), one N-acetylgalactosamine (Gal p NaAc) and one N-acetylmanuronic acid (Man p It consists of NAcA (Leontein et al. (1983) Carbohydrate Research 114(2):257~266).
[0081] Serotype 12F strains of Streptococcus pneumoniae are stored in established culture cell storage facilities (e.g., Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)). It can be obtained from (or) clinical specimens.
[0082] Capsular saccharides derived from Streptococcus pneumoniae serotype 12F are prepared by standard techniques known to those skilled in the art. Typically, the capsular polysaccharides are produced by growing each Streptococcus pneumoniae serotype in a culture medium (e.g., soybean-based medium), after which the polysaccharides are prepared from the bacterial culture. The population of organisms (Streptococcus pneumoniae serotype 12F) is often subcultured in one or more seed fermenters of increasing capacity, scaled up from seed vials to seed bottles, until production-scale fermentation capacity is reached. At the end of the growth cycle, after lysing the cells, the lysate culture is harvested for downstream (purification) processes (see, e.g., WO2006 / 110381 and WO2008 / 118752, U.S. Patent Application Publications 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838). The polysaccharides are purified typically by centrifugation, sedimentation, ultrafiltration, and / or column chromatography (see, e.g., WO2006 / 110352 and WO2008 / 118752).
[0083] As further described herein, purified polysaccharides derived from serotype 12F can be activated (e.g., chemically activated) to enable them to react, and then incorporated into the glycoconjugate of the present invention.
[0084] In some embodiments, the purified polysaccharide derived from Streptococcus pneumoniae serotype 12F before conjugation has a molecular weight of 10 kDa to 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 300 kDa. In yet another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 300 kDa. In further embodiments, the capsule polysaccharide is 90kDa~250kDa; 90kDa~150kDa; 90kDa~120kDa; 80kDa~120kDa; 70kDa~100kDa; 70kDa~110kDa; 70kDa~120kDa; 70kDa~130kDa; 70kDa~140kDa; 70kDa~150kDa; 70kDa~160kDa; 80kDa~110kDa; 80kDa~120kDa; 80kDa~130kDa; 80kD Molecular weights of a~140kDa; 80kDa~150kDa; 80kDa~160kDa; 90kDa~110kDa; 90kDa~120kDa; 90kDa~130kDa; 90kDa~140kDa; 90kDa~150kDa; 90kDa~160kDa; 100kDa~120kDa; 100kDa~130kDa; 100kDa~140kDa; 100kDa~150kDa; 100kDa~160kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is contemplated as an embodiment of the present disclosure.
[0085] The polysaccharide may undergo a slight decrease in size during the normal purification procedure. Furthermore, as described herein, the polysaccharide may be subjected to sizing techniques before conjugation. The molecular weight ranges mentioned above refer to the purified polysaccharide after the final sizing step and before conjugation (e.g., before activation).
[0086] 1.2.6 Pneumococcus polysaccharide serotype 15B As shown in Figure 5, the polysaccharide repeat unit of serotype 15B is Glc p αGal linked to the C4 hydroxyl group of NAc p -βGalp A branched trisaccharide skeleton containing disaccharides (one N-acetylglucosamine (Glc p NAc), one galactopyranose (Gal p ) and one glucopyranose (Glc p It consists of )). Phosphoglycerol is used in the βGal of the disaccharide branch. p It links to the C3 hydroxyl group of the residue (Jones et al. (2005)). Carbohydrate Research 340(3):403~409). Capsular polysaccharides derived from serotype 15C have the same skeletal structure as serotype 15B, but lack O-acetylation.
[0087] Serotype 15B polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Publications 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, as well as WO2008 / 118752). They can also be produced using synthetic protocols known to those skilled in the art.
[0088] Serotype 15B strains of Streptococcus pneumoniae can be obtained from established culture stockpiling institutions (e.g., American Type Culture Collection (ATCC, Manassas, VA USA) (e.g., deposited strain ATCC10354) or Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA USA)) or from clinical specimens.
[0089] Bacterial cells are grown in a culture medium, preferably a soybean-based medium. After fermentation of the bacterial cells to produce Streptococcus pneumoniae serotype 15B capsular polysaccharide, the bacterial cells are lysed to obtain a cell lysate. The serotype 15B polysaccharide can then be isolated from the cell lysate using purification techniques known in the art, including centrifugation, deep filtration, sedimentation, ultrafiltration, treatment with activated carbon, diafiltration and / or column chromatography (see, for example, U.S. Patent Applications Publications 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, as well as WO2008 / 118752). The purified serotype 15B capsular polysaccharide can then be used for the preparation of immunogenic conjugates.
[0090] The sizing of isolated serotype 15B capsular polysaccharides obtained by purification of serotype 15B polysaccharides from Streptococcus pneumoniae lysates, and optionally the purified polysaccharides, can be characterized by various parameters, such as molecular weight (MW), mM of acetate per mM of serotype 15B capsular polysaccharide, and mM of glycerol per mM of serotype 15B capsular polysaccharide.
[0091] Preferably, to produce a 15B conjugate with advantageous filtration characteristics and / or yield, the polysaccharide is sizing to a target molecular weight range before conjugation to the carrier protein. Advantageously, the size of the purified serotype 15B polysaccharide is reduced while retaining important structural features of the polysaccharide, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 15B polysaccharide is reduced by mechanical homogenization.
[0092] In a preferred embodiment, the size of the purified serum type 15B polysaccharide is reduced by high-pressure homogenization. High-pressure homogenization achieves a high shear rate by pumping the process flow through a channel having a sufficiently small dimension. The shear rate can be increased by using a larger applied homogenization pressure, and the exposure time can be increased by recirculating the feed flow with a homogenizer.
[0093] The high-pressure homogenization process is particularly suitable for reducing the size of purified serum type 15B polysaccharide while preserving the structural characteristics of the polysaccharide, such as the presence of O-acetyl groups.
[0094] In preferred embodiments, the isolated serotype 15B capsular polysaccharide has molecular weights of 5 kDa to 500 kDa, 50 kDa to 500 kDa, 50 kDa to 450 kDa, 100 kDa to 400 kDa, and 100 kDa to 350 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has molecular weights of 100 kDa to 350 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has molecular weights of 100 kDa to 300 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has molecular weights of 150 kDa to 300 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has molecular weights of 150 kDa to 350 kDa. In further embodiments, the capsule polysaccharide has a molecular weight of 100kDa-500kDa; 100kDa-400kDa; 100kDa-300kDa; 100kDa-200kDa; 150kDa-500kDa; 150kDa-400kDa; 150kDa-300kDa; 150kDa-200kDa; 200kDa-500kDa; 200kDa-400kDa; 250kDa-500kDa; 250kDa-400kDa; 250kDa-350kDa; 300kDa-500kDa; 300kDa-400kDa; and a similar desired molecular weight range. Any integer within any of the above ranges is intended to be an embodiment of the present disclosure.
[0095] The polysaccharides of serotype 15B are O-acetylated, with a total of approximately 0.8 to 0.9 O-acetyl groups per polysaccharide repeat unit. The degree of O-acetylation of the polysaccharide can be determined by any method known in the art, for example, by proton NMR (see, e.g., Lemercinier et al. (1996) Carbohydrate Research 296:83~96; Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis 30:1233~1247; WO2005 / 033148 and WO00 / 56357). Another commonly used method is described in Hestrin, S. (1949) J. Biol. Chem. 180:249~261. Preferably, the presence of O-acetyl groups is determined by ion-HPLC analysis.
[0096] The presence of O-acetyl in purified, isolated, or activated serotype 15B capsular polysaccharide or in serotype 15B polysaccharide-carrier protein conjugates is expressed as the number of mM acetates per mM of polysaccharide, or as the number of O-acetyl groups per polysaccharide repeat unit.
[0097] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM of acetate per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.5, 0.6, or 0.7 mM of acetate per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.6 mM of acetate per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.7 mM of acetate per mM of serotype 15B capsular polysaccharide.
[0098] The presence of glycerol phosphate side chains is determined by measuring glycerol using high-speed anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD) after liberation of the polysaccharide by treatment with hydrofluoric acid (HF). The presence of glycerol in purified, isolated, or activated serotype 15B polysaccharide, or in serotype 15B polysaccharide-carrier protein conjugates, is expressed as the number of mM of glycerol per mM of serotype 15B polysaccharide.
[0099] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM glycerol per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.5, 0.6, or 0.7 mM glycerol per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.7 mM glycerol per mM of serotype 15B capsular polysaccharide.
[0100] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa and contains at least 0.6 mM acetate per mM of serotype 15B capsular polysaccharide.
[0101] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa and contains at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide.
[0102] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa and contains at least 0.6 mM acetate per mM of serotype 15B capsular polysaccharide.
[0103] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa and contains at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide.
[0104] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa and contains at least 0.6 mM acetate per mM of serotype 15B capsular polysaccharide.
[0105] In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa and contains at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide.
[0106] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate and at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide.
[0107] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa and contains at least 0.6 mM acetate and at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide.
[0108] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa and contains at least 0.6 mM acetate and at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide.
[0109] In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa, and contains at least 0.6 m³ per 1 mM of the serotype 15B capsular polysaccharide. It contains M acetate and at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide.
[0110] 1.2.7 Pneumococcus polysaccharide serotype 22F As shown in Figure 6, the polysaccharide repeat unit of serotype 22F is βRha p αGlc linked to the C3 hydroxyl group p Branched pentasaccharide skeleton with branches (one glucuronic acid (Glc p A) One glucopyranose (Glc p ), one galactofuranose (Gal f ) and two rhamnopyranoses (Rha p )) consists of (Richards et al. (1989), Canadian Journal of Chemistry 67(6):1038~1050). βRha in polysaccharide repeat units p Approximately 80% of the C2 hydroxyl groups in the residues are O-acetylated.
[0111] Serotype 22F polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Publications 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, as well as WO2008 / 118752). Furthermore, they can be produced using synthetic protocols.
[0112] Serotype 22F strains of Streptococcus pneumoniae should be stored in established culture cell storage facilities (e.g., Streptococcal Reference Laboratory (Centers for Disease Control)). It can be obtained from clinical specimens (and Prevention, Atlanta, GA, etc.) or from clinical samples.
[0113] The sizing of isolated serotype 22F capsular polysaccharides obtained by purification of serotype 22F polysaccharides from Streptococcus pneumoniae lysates, and optionally the purified polysaccharides, can be characterized by various parameters, such as molecular weight (MW) and mM of acetate per mM of serotype 22F capsular polysaccharide.
[0114] Preferably, to produce a serotype 22F conjugate with advantageous filtration characteristics and / or yield, the polysaccharide is sizing to a target molecular weight range before conjugation to the carrier protein. Advantageously, the size of the purified serotype 22F polysaccharide is reduced while retaining important structural features of the polysaccharide, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 22F polysaccharide is reduced by mechanical homogenization.
[0115] In a preferred embodiment, the size of the purified polysaccharide is reduced by high-pressure homogenization. High-pressure homogenization achieves a high shear rate by pumping the process flow through a channel having a sufficiently small dimension. The shear rate can be increased by using a larger applied homogenization pressure, and the exposure time can be increased by recirculating the feed flow with a homogenizer.
[0116] The high-pressure homogenization process is particularly suitable for reducing the size of purified serum type 22F polysaccharides while preserving the structural characteristics of the polysaccharide, such as the presence of O-acetyl groups.
[0117] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae serotype 22F before conjugation has a molecular weight of 10 kDa to 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa. In yet another embodiment, the capsular polysaccharide has a molecular weight of 200 kDa to 600 kDa. In yet another embodiment, the capsular polysaccharide has a molecular weight of 400 kDa to 700 kDa.
[0118] In further embodiments, the capsule polysaccharide is 100kDa~1,000kDa; 100kDa~900kDa; 100kDa~800kDa; 100kDa~700kDa; 100kDa~600kDa; 100kDa~500kDa; 100kDa~400kDa; 100kDa~300kDa; 150kDa~1,000kDa; 150kDa~900kDa; 150kDa~ 800kDa;150kDa~700kDa;150kDa~600kDa;150kDa~500kDa;150kDa~400kDa;150kDa~300kDa;200kDa~1 ,000kDa;200kDa~900kDa;200kDa~800kDa;200kDa~700kDa;200kDa~600kDa;200kDa~500kDa;200kDa~4 00kDa;200kDa~300kDa;250kDa~1,000kDa;250kDa~900kDa;250kDa~800kDa;250kDa~700kDa;250kDa~ 600kDa;250kDa~500kDa;250kDa~400kDa;250kDa~350kDa;300kDa~1,000kDa;300kDa~900kDa;300kDa~ Molecular weights of 800kDa; 300kDa~700kDa; 300kDa~600kDa; 300kDa~500kDa; 300kDa~400kDa; 400kDa~1,000kDa; 400kDa~900kDa; 400kDa~800kDa; 400kDa~700kDa; 400kDa~600kDa; 500kDa~600kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is contemplated as an embodiment of the present disclosure.
[0119] The polysaccharide may undergo a slight size reduction during the normal purification procedure. Furthermore, as described above in this specification, the 22F polysaccharide may be subjected to sizing techniques before conjugation. The molecular weight ranges above refer to the purified polysaccharide after the final sizing step and before conjugation (e.g., before activation).
[0120] The degree of O-acetylation of polysaccharides can be determined by any method known in the art, for example, by proton NMR (see Lemercinier et al. (1996) Carbohydrate Research 296:83~96; Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis 30:1233~1247; WO2005 / 033148 and WO00 / 56357). Another commonly used method is described in Hestrin, S. (1949) J. Biol. Chem. 180:249~261. Preferably, the presence of O-acetyl groups is determined by ion-HPLC analysis.
[0121] The presence of O-acetyl in purified, isolated, or activated serotype 22F capsular polysaccharides or in serotype 22F polysaccharide-carrier protein conjugates is expressed as the number of mM acetates per mM of the polysaccharide, or as the number of O-acetyl groups per polysaccharide repeat unit.
[0122] In a preferred embodiment, the purified polysaccharide from Streptococcus pneumoniae serotype 22F has at least 0.2, 0.4, 0.6, 0.8, 1, 1.2, 1.4, or 1.6 μmol of acetate per μmol of serotype 22F capsular polysaccharide.
[0123] 1.2.8 Pneumococcus polysaccharide serotype 33F As shown in Figure 7, the polysaccharide repeat unit of serotype 33F is αGal within the skeleton. p Terminal αGal linked to the C2 hydroxyl group of the residue pA branched pentasaccharide skeleton having two galactopyranoses (Gal p ), two galactofuranoses (Gal f ) and one glucopyranose (Glc p (Lemercinier et al. (2006), Carbohydrate Research 341(1):68~74). Skeleton 3-β-Gal f The literature has reported that the C2 hydroxyl group of the residue is O-acetylated.
[0124] Serotype 33F polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Publications 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, as well as WO2008 / 118752). Furthermore, they can be produced using synthetic protocols.
[0125] Serotype 33F strains of Streptococcus pneumoniae should be stored in established culture cell storage facilities (e.g., Streptococcal Reference Laboratory (Centers for Disease Control)). It can be obtained from clinical specimens (and Prevention, Atlanta, GA, etc.) or from clinical samples.
[0126] Purified polysaccharides from serotype 33F can be activated (e.g., chemically activated) to enable them to react, and then incorporated into the glycoconjugate of the present invention as further described herein.
[0127] The sizing of the isolated serotype 33F capsular polysaccharide obtained by the purification of serotype 33F polysaccharide from Streptococcus pneumoniae lysate, and optionally the purified polysaccharide, can be characterized by various parameters, such as molecular weight and mM acetate per mM 1 mM serotype 33F capsular polysaccharide.
[0128] In some embodiments, the purified polysaccharides from Streptococcus pneumoniae serotype 33F before conjugation have a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the sugars have a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the sugars have molecular weights of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 7,500 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; and 100 kDa to 1,2 The molecules have molecular weights of 50kDa; 100kDa to 1,000kDa; 100kDa to 750kDa; 100kDa to 500kDa; 200kDa to 2,000kDa; 200kDa to 1,750kDa; 200kDa to 1,500kDa; 200kDa to 1,250kDa; 200kDa to 1,000kDa; 200kDa to 750kDa; or 200kDa to 500kDa. All integers within any of the above ranges are intended to be embodiments of this disclosure.
[0129] The polysaccharide may undergo a slight decrease in size during the normal purification procedure. Furthermore, as described herein, the polysaccharide may be subjected to sizing techniques before conjugation. The molecular weight ranges mentioned above refer to the purified polysaccharide after the final sizing step and before conjugation (e.g., before activation).
[0130] In purified, isolated, or activated serotype 33F capsular polysaccharides, or in serum. The presence of O-acetyl in a type 33F polysaccharide-carrier protein conjugate is expressed as the number of mM acetates per mM polysaccharide, or as the number of O-acetyl groups per polysaccharide repeat unit.
[0131] In a preferred embodiment, the purified polysaccharide from Streptococcus pneumoniae serotype 33F has at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, or 1.6 μmol of acetate per μmol of serotype 33F capsular polysaccharide.
[0132] 1.3 The Glycoconjugate of the Present Invention The purified sugars are chemically activated to produce sugars that can react with a carrier protein (i.e., activated sugars). Once activated, each capsular sugar is separately conjugated to a carrier protein to form a glycoconjugate. In one embodiment, each capsular sugar is conjugated to the same carrier protein. The chemical activation of the sugars and subsequent conjugation to the carrier protein can be achieved by the activation and conjugation methods disclosed herein.
[0133] 1.3.1 Glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F Capsular polysaccharides derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F of Streptococcus pneumoniae are prepared by standard techniques known to those skilled in the art (see, for example, WO2006 / 110381, WO2008 / 118752, WO2006 / 110352, and U.S. Patent Publications 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).
[0134] In one embodiment, a polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroboric acid (CDAP) to form a cyanate ester. The activated polysaccharide is then converted to a carrier protein (preferably CRM). 197 The amino group on the ) is coupled directly or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can then be coupled to a carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., N-[γ-maleimidobutyryloxy]succinimide ester (GMBS)) or a haloacetylated carrier protein (e.g., iodoacetimide, N-succinimidyl bromoacetate (SBA;SIB), N-succinimidyl (4-iodoacetyl)aminobenzoic acid (SIAB), sulfosuccinimidyl (4-iodoacetyl)aminobenzoic acid (sulfo-SIAB), N-succinimidyliodoacetate (SIA), or succinimidyl 3-[bromoacetamide]propionate (SBAP)). Preferably, a cyanate ester (which may be prepared by a CDAP chemical reaction) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino derivatized sugars are coupled to a carrier protein (e.g., CRM) via a carbodiimide (e.g., EDAC or EDC) chemical reaction through the carboxyl group on the protein carrier. 197 ) conjugate to such conjugates. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.
[0135] Other suitable technologies for conjugation include carbodiimide, hydrazide, active ester, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NH S, EDC, and TSTU are used. Many are described in International Patent Application Publication WO98 / 42721. The conjugation may involve a carbonyl linker, which can be formed by the reaction of the free hydroxyl group of the sugar with 1,1'-carbonyldiimidazole (CDI) (see Bethell et al. (1979), J. Biol. Chern. 254:2572~2574; Hearn et al. (1981), J. Chromatogr. 218:509~518), and subsequently by a reaction with a protein to form a carbamate bond. This may include reduction to the primary hydroxyl group at the anomeric terminus, optionally protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate with an amino group on the protein.
[0136] In a preferred embodiment, at least one capsular polysaccharide derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F of Streptococcus pneumoniae is conjugated to a carrier protein by reductive amination (as described in U.S. Patent Publications 2006 / 0228380, 2007 / 0231340, 2007 / 0184071, and 2007 / 0184072, WO2006 / 110381, WO2008 / 079653, and WO2008 / 143709). In a preferred embodiment, capsular polysaccharides derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F of Streptococcus pneumoniae are all conjugated to a carrier protein by reductive amination.
[0137] Reductive amination comprises two steps: (1) oxidation of the polysaccharide, and (2) reduction of the activated polysaccharide and carrier protein to form a conjugate. Prior to oxidation, the polysaccharide may be hydrolyzed. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be carried out using acetic acid. The oxidation step may include a reaction with a periodate. For the purposes of this invention, the term "periodate" includes both periodates and periodic acid; this term also includes metaperiodate (IO4). - ) and orthoperiodate (IO6 5- This also includes both of the above and various salts of periodates (e.g., sodium periodate and potassium periodate).
[0138] In one embodiment, a capsular polysaccharide derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, or 23F of Streptococcus pneumoniae is oxidized in the presence of metaperiodate, preferably in the presence of sodium periodate (NaIO4). In another embodiment, a capsular polysaccharide derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F of Streptococcus pneumoniae is oxidized in the presence of orthoperiodate, preferably in the presence of periodic acid.
[0139] Following the oxidation step of the polysaccharide, the polysaccharide is said to be activated and is referred to herein as the “activated polysaccharide.” The activated polysaccharide and the carrier protein can be freeze-dried independently (individual freeze-drying) or together (simultaneous freeze-drying). In one embodiment, the activated polysaccharide and the carrier protein are freeze-dried simultaneously. In another embodiment, the activated polysaccharide and the carrier protein are freeze-dried independently.
[0140] In one embodiment, freeze-drying is carried out in the presence of a non-reducing sugar, and possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melegitose, dextran, mannitol, lactitol, and palatinite.
[0141] The second step of the conjugation process is the reduction of the activated polysaccharide and carrier protein to form the conjugate (so-called reductive amination) using a reducing agent. Preferred reducing agents include cyanoboron hydride such as sodium cyanoborohydride, boran-pyridine, or boron hydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.
[0142] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. DMSO or DMF solvents can be used to restore lyophilized activated polysaccharides and carrier proteins.
[0143] At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate, which can be capped with a suitable capping agent. In one embodiment, this capping agent is sodium borohydride (NaBH4). After conjugation (reduction reaction and optionally capping), the glycoconjugate can be purified. The glycoconjugate can be purified by dialysis filtration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by dialysis filtration, ion exchange chromatography, or size exclusion chromatography. In one embodiment, the glycoconjugate is filtered by sterile filtration.
[0144] In some embodiments, the glycoconjugate derived from Streptococcus pneumoniae serotype 9V and / or 18C contains sugars having an O-acetylation degree of 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 75%-100%, 80%-100%, 90%-100%, 50%-90%, 60%-90%, 70%-90%, or 80%-90%. In other embodiments, the O-acetylation degree is 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more, or about 100%.
[0145] In some embodiments, the glycoconjugates derived from Streptococcus pneumoniae serotype 9V and / or 18C of the present invention are O-acetylated. In some embodiments, the glycoconjugate derived from Streptococcus pneumoniae serotype 9V is O-acetylated, and the glycoconjugate derived from Streptococcus pneumoniae serotype 18C is de-O-acetylated.
[0146] 1.3.2 Glycoconjugate derived from Streptococcus pneumoniae serotype 22F In one embodiment, the serotype 22F glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroboric acid (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled directly to an amino group on a carrier protein or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can then be coupled to a carrier via a thioether bond obtained after a reaction with a maleimide-activated carrier protein (e.g., GMBS) or a haloacetylated carrier protein (e.g., iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, a cyanate ester (which may be prepared by a CDAP chemical reaction) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivativeized sugar is conjugated to the support protein via a carboxyl group on the protein support using a carbodiimide (e.g., EDAC or EDC) chemical reaction. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.
[0147] Other suitable techniques use carbodiimide, hydrazide, active ester, norbornane, p-nitrobenzoic acid, N-hydroxysuccinimide, S--NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO98 / 42721. The conjugation may involve a carbonyl linker, which can be formed by the reaction of the free hydroxyl group of the saccharide with CDI (see Bethell et al. (1979), J. Biol. Chem. 254:2572 - 2574; Hearn et al. (1981), J. Chromatogr. 218:509 - 518), and subsequent reaction with a protein to form a carbamate bond. This may include reduction of the anomeric terminal primary hydroxyl group, optionally protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate with an amino group on the protein.
[0148] In a preferred embodiment, the serotype 22F glycoconjugate of the invention is prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate an aldehyde functional group from adjacent diols in individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein (e.g., CRM 197 ) to form the conjugate.
[0149] Preferably, prior to oxidation, sizing of the serotype 22F polysaccharide to the target molecular weight (MW) range is performed. Advantageously, the size of the purified serotype 22F polysaccharide is reduced while retaining important features of the polysaccharide structure, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 22F polysaccharide is reduced by mechanical homogenization (see Section 1.2.7 above).
[0150] In one embodiment, the serotype polysaccharide (a) reacting the isolated serotype 22F polysaccharide with an oxidizing agent; (b) quenching the oxidation reaction by adding a quenching agent to obtain activated serotype 22F polysaccharide Activate (oxidize) by a process comprising.
[0151] In a preferred embodiment, the oxidizing agent is periodate. For the purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes both metaperiodate (IO4 - ) and orthoperiodate (IO6 5- ) and various salts of periodate (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate used for the oxidation of serotype 22F polysaccharide is metaperiodate. In a preferred embodiment, the periodate used for the oxidation of serotype 22F polysaccharide is sodium metaperiodate.
[0152] In one embodiment, the quenching agent is selected from vicinal diols, 1,2-amino alcohols, amino acids, glutathione, sulfites, bisulfites, dithionites, metabisulfites, thiosulfates, phosphites, hypophosphites or phosphorous acid.
[0153] In one embodiment, the quenching agent is of formula (I):
[0154]
Chemical formula
[0155] In one embodiment, the quenching agent is selected from the sodium and potassium salts of sulfites, bisulfites, dithionites, metabisulfites, thiosulfates, phosphites, hypophosphites or phosphorous acid.
[0156] In one embodiment, the quenching agent is an amino acid. In such embodiments, the amino acid can be selected from serine, threonine, cysteine, cystine, methionine, proline, hydroxyproline, tryptophan, tyrosine, and histidine.
[0157] In one embodiment, the quenching agent is a sulfite such as a bicarbonate, dithionite, metabisulfite, or thiosulfate.
[0158] In one embodiment, the quenching agent is a compound containing two adjacent hydroxyl groups (adjacent diols), that is, two hydroxyl groups covalently linked to two adjacent carbon atoms.
[0159] Preferably, the quenching agent is of formula (II):
[0160] [ka] (In the formula, R 1 and R 2 Each of these is independently H, methyl, ethyl, propyl, or isopropyl It is a compound selected from Ropil.
[0161] In preferred embodiments, the quenching agent is glycerol, ethylene glycol, propane-1,2-diol, butane-1,2-diol or butane-2,3-diol, or ascorbic acid. In preferred embodiments, the quenching agent is butane-2,3-diol.
[0162] In a preferred embodiment, the isolated serotype 22F polysaccharide is (a) A step of reacting isolated serotype 22F polysaccharide with periodate; (b) The oxidation reaction is quenched by the addition of butane-2,3-diol to obtain activated serum type 22F polysaccharide. It is activated by a process that includes this process.
[0163] After the oxidation step of polysaccharides, the polysaccharides are said to be activated and will be referred to as “activated polysaccharides” hereafter in this specification.
[0164] In preferred embodiments, the activated serotype 22F polysaccharide is purified. The activated serotype 22F polysaccharide is purified by methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / diafiltration. For example, the activated 22F polysaccharide is purified by concentration and diafiltration using an ultrafiltration apparatus.
[0165] In a preferred embodiment, the degree of oxidation of the activated serotype 22F polysaccharide is 2-30, 2-25, 2-20, 2-15, 2-10, 2-5, 5-30, 5-25, 5-20, 5-15, 5-10, 10-30, 10-25, 10-20, 10-15, 15-30, 15-25, 15-20, 20-30, or 20-25. In a preferred embodiment, the degree of oxidation of the activated serotype 22F polysaccharide is 2-10, 4-8, 4-6, 6-8, 6-12, 8-14, 9-11, 10-16, 12-16, 14-18, 16-20, 16-18, 18-22, or 18-20.
[0166] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 25 kDa to 1,000 kDa, 100 kDa to 1,000 kDa, 300 kDa to 800 kDa, 300 kDa to 700 kDa, 300 kDa to 600 kDa, 400 kDa to 1,000 kDa, 400 kDa to 800 kDa, 400 kDa to 700 kDa or 400 kDa to 600 kDa. In one embodiment, the activated serotype 22F polysaccharide has a molecular weight of 300 kDa to 800 kDa. In one embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa. In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa and a degree of oxidation of 10 to 25, 10 to 20, 12 to 20 or 14 to 18. In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa and a degree of oxidation of 10 to 20.
[0167] In a preferred embodiment, the activated serotype 22F polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6 or 0.7 or about 0.8 mM of acetate per mM of serotype 22F polysaccharide. In a preferred embodiment, the activated serotype 22F polysaccharide contains at least 0.5, 0.6 or 0.7 mM of acetate per mM of serotype 22F polysaccharide. In a preferred embodiment, the activated serotype 22F polysaccharide contains at least 0.6 mM of acetate per mM of serotype 22F polysaccharide. In a preferred embodiment, the activated serotype 22F polysaccharide contains at least 0.7 mM of acetate per mM of serotype 22F polysaccharide.
[0168] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 800 kDa and contains at least 0.6 mM of acetate per mM of serotype 22F polysaccharide.
[0169] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 800 kDa, an oxidation degree of 12 to 20, and contains at least 0.6 mM acetate per mM of serotype 22F polysaccharide.
[0170] Activated polysaccharides and / or carrier proteins can be freeze-dried independently (individually) or together (simultaneously).
[0171] In one embodiment, the activated serotype 22F polysaccharide is freeze-dried, optionally in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melegitose, dextran, mannitol, lactitol, and palatinite. In a preferred embodiment, the sugar is sucrose. In one embodiment, the freeze-dried activated polysaccharide is then mixed with a solution containing a carrier protein.
[0172] In another embodiment, the activated polysaccharide and the carrier protein are freeze-dried simultaneously. In such an embodiment, the activated serotype 22F polysaccharide is mixed with the carrier protein and freeze-dried, optionally, in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melegitose, dextran, mannitol, lactitol, and palatinite. In a preferred embodiment, the sugar is sucrose. The simultaneously freeze-dried polysaccharide and carrier protein can then be resuspended in solution and reacted with a reducing agent.
[0173] The second step in the conjugation process is the reduction (reductive amination) of the activated polysaccharide and carrier protein using a reducing agent to form the conjugate.
[0174] Activated serotype 22F polysaccharide (c) The step of mixing the activated serotype 22F polysaccharide with the carrier protein; and (d) A step in which the mixed activated serotype 22F polysaccharide and carrier protein are reacted with a reducing agent to form a serotype 22F polysaccharide-carrier protein conjugate. The carrier protein can be conjugated by a process that includes this method.
[0175] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. DMSO or DMF solvents can be used to restore lyophilized activated polysaccharides and carrier proteins.
[0176] Conjugation of activated serotype 22F polysaccharides with protein carriers by reductive amination in dimethyl sulfoxide (DMSO) is preferable for preserving the O-acetyl content of the polysaccharides compared to reductive amination in an aqueous phase, for example, which can significantly reduce the level of O-acetylation of the polysaccharides. Therefore, in preferred embodiments, steps (c) and (d) are carried out in DMSO.
[0177] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, or boron hydride in the presence of Bronsted or Lewis acid. Sodium or zinc borohydride, pyridineborane, 2-picolinborane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMe i The reducing agent is an amine borane such as PrN-BH3, benzylamine-BH3, or 5-ethyl-2-methylpyridineborane (PEMB). In preferred embodiments, the reducing agent is sodium cyanoborohydride.
[0178] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, and these can be capped using a suitable capping agent. In one embodiment, this capping agent is sodium borohydride (NaBH4).
[0179] Following the conjugation of the carrier protein with serotype 22F polysaccharide, the glycoconjugate can be purified (enriched in terms of the amount of polysaccharide-protein conjugate) by various techniques known to those skilled in the art. These techniques include dialysis, concentration / diafiltration, tangential flow filtration / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and deep filtration.
[0180] In some embodiments, the serotype 22F glycoconjugate of the present invention comprises sugars having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the sugars have a molecular weight of 50 kDa to 1,000 kDa. In other such embodiments, the sugars have a molecular weight of 70 kDa to 900 kDa. In other such embodiments, the sugars have a molecular weight of 100 kDa to 800 kDa. In other such embodiments, the sugars have a molecular weight of 200 kDa to 600 kDa. In further such embodiments, the sugars are 100kDa~1,000kDa; 100kDa~900kDa; 100kDa~800kDa; 100kDa~700kDa; 100kDa~600kDa; 100kDa~500kDa; 100kDa~400kDa; 100kDa~300kDa; 150kDa~1,000kDa; 150kDa~900kDa; 1 50kDa~800kDa;150kDa~700kDa;150kDa~600kDa;150kDa~500kDa;150kDa~400kDa;150kDa~300kDa;2 00kDa~1,000kDa;200kDa~900kDa;200kDa~800kDa;200kDa~700kDa;200kDa~600kDa;200kDa~500kDa ;200kDa~400kDa;200kDa~300kDa;250kDa~1,000kDa;250kDa~900kDa;250kDa~800kDa;250kDa~700k Da;250kDa~600kDa;250kDa~500kDa;250kDa~400kDa;250kDa~350kDa;300kDa~1000kDa;300kDa~900 The molecular weights are kDa; 300kDa~800kDa; 300kDa~700kDa; 300kDa~600kDa; 300kDa~500kDa; 300kDa~400kDa; 400kDa~1,000kDa; 400kDa~900kDa; 400kDa~800kDa; 400kDa~700kDa; 400kDa~600kDa; and 500kDa~600kDa. Any integer within any of the above ranges is intended as an embodiment of the present disclosure. In some such embodiments, the serotype 22F glycoconjugate is prepared using reductive amination.
[0181] In some embodiments, the serotype 22F glycoconjugate of the present invention has a molecular weight of 400 kDa to 15,000 kDa; 500 kDa to 10,000 kDa; 2,000 kDa to 10,000 kDa; 3,000 kDa to 8,000 kDa; or 3,000 kDa to 5,000 kDa. In other embodiments, the serotype 22F glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 22F glycoconjugate has a molecular weight of 1,000 kDa to 8,000 kDa. In another embodiment, the serotype 22F glycoconjugate has a molecular weight of 2,000 kDa to 8,000 kDa or 3,000 kDa to 7,000 kDa. In a further embodiment, the serotype 22F glycoconjugate of the present invention is 200kDa~20,000kDa; 200kDa~15,000kDa; 200kDa~10,000kDa; 200kDa~7,500kDa; 200kDa~5,000kDa; 200kDa~3,000kDa; 200kDa~1,000kDa; 500kDa~20,000kDa; 500kDa~15,000kDa; 500kDa~12,500kDa; 500kDa ~10,000kDa;500kDa~7,500kDa;500kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000k Da;500kDa~1,500kDa;500kDa~1,000kDa;750kDa~20,000kDa;750kDa~15,000kDa;750kDa~12,500kDa;750kDa~10,000kDa;7 50kDa~7,500kDa;750kDa~6,000kDa;750kDa~5,000kDa;750kDa~4,000kDa;750kDa~3,000kDa;750kDa~2,000kDa;750kDa~1, 500kDa;1,000kDa~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000kDa;1,00 It has a molecular weight of 0kDa to 5,000kDa; 1,000kDa to 4,000kDa; 1,000kDa to 2,500kDa; 2,000kDa to 15,000kDa; 2,000kDa to 12,500kDa; 2,000kDa to 10,000kDa; 2,000kDa to 7,500kDa; 2,000kDa to 6,000kDa; 2,000kDa to 5,000kDa; 2,000kDa to 4,000kDa; or 2,000kDa to 3,000kDa.
[0182] In a further embodiment, the serotype 22F glycoconjugate of the present invention has a molecular weight of 3,000kDa to 20,000kDa; 3,000kDa to 15,000kDa; 3,000kDa to 10,000kDa; 3,000kDa to 7,500kDa; 3,000kDa to 5,000kDa; 4,000kDa to 20,000kDa; 4,000kDa to 15,000kDa; 4,000kDa to 12,500kDa; 4,000kDa to 10,000kDa; 4,000kDa to 7,500kDa; 4,000kDa to 6,000kDa; or 4,000kDa to 5,000kDa.
[0183] In a further embodiment, the serotype 22F glycoconjugate of the present invention has a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 to 15,000 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 12,500 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa.
[0184] The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any integer within any of the above ranges is intended to be an embodiment of this disclosure.
[0185] In a preferred embodiment, the serotype 22F glycoconjugate of the present invention contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6 or 0.7 or about 0.8 mM of acetate per mM of serotype 22F polysaccharide. In a preferred embodiment, the glycoconjugate contains at least 0.5, 0.6 or 0.7 mM of acetate per mM of serotype 22F polysaccharide. In a preferred embodiment, the glycoconjugate contains at least 0.6 mM of acetate per mM of serotype 22F polysaccharide. In a preferred embodiment, the glycoconjugate contains at least 0.7 mM of acetate per mM of serotype 22F polysaccharide.
[0186] In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.9.
[0187] In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.9.
[0188] Another way to characterize the serotype 22F glycoconjugate of the present invention is to characterize the range (degree of conjugation) of the conjugated lysine, which is the carrier protein (e.g., CRM) conjugated to the sugar. 197This is due to the number of lysine residues in the protein. Evidence of lysine modification of the carrier protein due to covalent bonding to polysaccharides can be obtained by amino acid analysis using routine methods known to those skilled in the art. Conjugation is performed using CRM, which is used to generate conjugate materials. 197 This results in a reduction in the number of recovered lysine residues compared to the protein starting material. In preferred embodiments, the degree of conjugation of the serotype 22F glycoconjugate of the present invention is 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15, or 10-12. In one embodiment, the degree of conjugation of the serotype 22F glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In preferred embodiments, the degree of conjugation of the serotype 22F glycoconjugate of the present invention is 4-7. In some such embodiments, the carrier protein is CRM 197 That is the case.
[0189] The serotype 22F glycoconjugate of the present invention can also be characterized by the ratio (w / w) of the sugar to the carrier protein. In some embodiments, the ratio (w / w) of serotype 22F polysaccharide in the glycoconjugate to the carrier protein is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In other embodiments, the ratio (w / w) of sugars to carrier protein is 0.5-2.0, 0.5-1.5, 0.8-1.2, 0.5-1.0, 1.0-1.5, or 1.0-2.0. In further embodiments, the ratio (w / w) of sugars to carrier protein is 0.8-1.2. In preferred embodiments, the ratio of serotype 22F capsular polysaccharide in the conjugate to carrier protein is 0.9-1.1. In some such embodiments, the carrier Protein is CRM 197 That is the case.
[0190] The serotype 22F glycoconjugate and immunogenic composition of the present invention are not covalently conjugated to a carrier protein, but may nevertheless contain free sugars present in the glycoconjugate composition. Free sugars can be non-covalently associated with the glycoconjugate (i.e., non-covalently bound, adsorbed, or captured in or together with it).
[0191] In preferred embodiments, the serotype 22F glycoconjugate contains about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or less than 15% of the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F glycoconjugate contains about 40% of the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F glycoconjugate contains about 25% of the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F glycoconjugate contains about 20% of the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F glycoconjugate contains about 15% of the total amount of serotype 22F polysaccharide.
[0192] The molecular size distribution (K) of the serotype 22F glycoconjugate d It can also be characterized by the following. The relative molecular size distribution of the conjugate can be determined using a size exclusion chromatography medium (CL-4B). Size exclusion chromatography (SEC) is used in a gravity-fed column to profile the molecular size distribution of the conjugate. High molecular weight molecules excluded from the pores in the medium elute more rapidly than low molecular weight molecules. The column eluate is collected using a fractionation device. The fraction is colorimetrically tested by a sugar assay. K d To determine this, the column is calibrated to identify the fraction (V0) and (K) in which the molecule is completely excluded. d =0), fraction representing maximum retention (V i ), (K d Establish a fraction (V) that meets specific sample attributes. e ) is K d =(V e -V0) / (V i According to the formula -V0, K d It is related to this.
[0193] In a preferred embodiment, at least 30% of the serotype 22F glycoconjugate is present in the CL-4B column at a K level lower than or equal to 0.3. d It has the following characteristics. In a preferred embodiment, at least 40% of the glycoconjugate is present in the CL-4B column at a K level lower than or equal to 0.3. d It has the following characteristics. In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of serotype 22F glycoconjugate is present in the CL-4B column at a K level lower than or equal to 0.3. d It has the following characteristics. In a preferred embodiment, at least 60% of the serotype 22F glycoconjugate is present in the CL-4B column at a K level lower than or equal to 0.3. d It has the following characteristics. In a preferred embodiment, 50% to 80% of the serotype 22F glycoconjugate is less than or equal to 0.3 K in the CL-4B column. d It has the following characteristics. In a preferred embodiment, 65% to 80% of the serotype 22F glycoconjugate is less than or equal to 0.3 K in the CL-4B column. d It has.
[0194] 1.3.3 Glycoconjugate derived from Streptococcus pneumoniae serotype 33F In one embodiment, the serotype 33F glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroboric acid (CDAP) to form a cyanate ester. The activated polysaccharide is then coupled directly to an amino group on a carrier protein, or via a spacer (linker) group. This can be done. For example, a thiolated polysaccharide may be obtained by using cystamine or cysteamine as a spacer, and this thiolated polysaccharide can be coupled to a carrier via a thioether bond obtained after a reaction with a maleimide-activating carrier protein (e.g., GMBS is used) or a haloacetylated carrier protein (e.g., iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP is used). Preferably, a cyanate ester (which may be prepared by a CDAP chemical reaction) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivativeized sugar is conjugated to the carrier protein via a carboxyl group on the protein carrier using a carbodiimide (e.g., EDAC or EDC) chemical reaction. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.
[0195] Other preferred techniques utilize carbodiimides, hydrazides, active esters, norboranes, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication WO98 / 42721. The conjugation may also involve a carbonyl linker, which can be formed by the reaction of the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979), J. Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by a reaction with a protein to form a carbamate bond. This may include reduction of the anomeric terminus to a primary hydroxyl group, optionally protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate with an amino group on the protein.
[0196] In certain embodiments, the serotype 33F glycoconjugate of the present invention is prepared using reductive amination. In such embodiments, the serotype 33F glycoconjugate of the present invention can be prepared using reductive amination in an aqueous phase (RAC / aqueous). Reductive amination in an aqueous phase has been applied and successfully used to produce pneumococcal conjugate vaccines (see, for example, WO2006 / 110381). However, preferably, when reductive amination is used, the serotype 33F glycoconjugate is prepared by reductive amination in DMSO (RAC / DMSO). Reductive amination in DMSO is preferred considering the challenges associated with retaining the O-acetyl functional group using the RAC / aqueous process. RAC / DMSO has been applied and successfully used to produce pneumococcal conjugate vaccines (see, for example, WO2006 / 110381).
[0197] In preferred embodiments, the serotype 33F glycoconjugate of the present invention is prepared using an eTEC conjugation (hereinafter referred to as "serotype 33F eTEC-conjugate") as described in Examples 1, 2, and 3 and WO2014 / 027302. The 33F glycoconjugate comprises a sugar covalently conjugated to a carrier protein via one or more eTEC spacers, the sugar covalently conjugated to the eTEC spacer via a carbamate bond, and the carrier protein covalently conjugated to the eTEC spacer via an amide bond. The eTEC-conjugate of the present invention is expressed by general formula (III):
[0198] [ka] (In the formula, the atoms constituting the eTEC spacer are contained in the central box.)
[0199] The eTEC spacer contains seven linear atoms (i.e., -C(O)NH(CH2)2SCH2C(O)-) and provides stable thioether and amide bonds between the sugar and the carrier protein. The synthesis of the eTEC-bonded glycoconjugate involves the reaction of the activated hydroxyl group of the sugar with the amino group of a thioalkylamine reagent, such as cystamine or cysteineamine or a salt thereof, to form a carbamate bond with the sugar and produce a thiolated sugar. The generation of one or more free sulfhydryl groups is achieved by reaction with a reducing agent to obtain the activated thiolated sugar. The reaction of the free sulfhydryl group of the activated thiolated sugar with an activated carrier protein having one or more α-haloacetamide groups on an amine-containing residue generates a thioether bond and forms a conjugate, where the carrier protein is bonded to the eTEC spacer by an amide bond.
[0200] In the serotype 33F glycoconjugate of the present invention, the sugar may be a polysaccharide or an oligosaccharide. The carrier protein can be selected from any suitable carrier described herein or known to those skilled in the art. In common embodiments, the sugar is a polysaccharide. In some such embodiments, the carrier protein is CRM 197 In some such embodiments, the eTEC-conjugate contains Streptococcus pneumoniae serotype 33F capsular polysaccharide.
[0201] In a particularly preferred embodiment, the eTEC-bonded glycoconjugate is connected to the CRM via an eTEC spacer. 197 It contains Pn-33F capsule polysaccharide (serotype 33F eTEC-bound glycoconjugate) which is co-conjugated to it.
[0202] In some embodiments, the serotype 33F glycoconjugate of the present invention comprises sugars having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the sugars have a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the sugars have molecular weights of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa. The molecular weights are 0kDa; 100kDa to 1,000kDa; 100kDa to 750kDa; 100kDa to 500kDa; 200kDa to 2,000kDa; 200kDa to 1,750kDa; 200kDa to 1,500kDa; 200kDa to 1,250kDa; 200kDa to 1,000kDa; 200kDa to 750kDa; or 200kDa to 500kDa. Any integer within any of the above ranges is intended as an embodiment of this disclosure.
[0203] In some embodiments, the serotype 33F glycoconjugate of the present invention is 50 In other embodiments, the serotype 33F glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa. In yet another embodiment, the serotype 33F glycoconjugate has a molecular weight of 200 kDa to 10,000 kDa. In yet another embodiment, the serotype 33F glycoconjugate has a molecular weight of 1,000 kDa to 3,000 kDa.
[0204] In a further embodiment, the serotype 33F glycoconjugate of the present invention is 200kDa~20,000kDa; 200kDa~15,000kDa; 200kDa~10,000kDa; 200kDa~7,500kDa; 200kDa~5,000kDa; 200kDa~3,000kDa; 200kDa~1,000kDa; 500kDa~20,000kDa; 500kDa~15,000kDa; 500kDa~12,500kDa; 500kDa~10,000kDa; 500kDa~7,500kDa; 500kDa~6,000 0kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000kDa;500kDa~1,500kDa;500kDa~1,000kDa;750kDa~20,000kDa;750kDa a~15,000kDa;750kDa~12,500kDa;750kDa~10,000kDa;750kDa~7,500kDa;750kDa~6,000kDa;750kDa~5,000kDa;750kDa~4,000kDa;750kDa~3,000kDa a;750kDa~2,000kDa;750kDa~1,500kDa;1,000kDa~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000 kDa;1,000kDa~5,000kDa;1,000kDa~4,000kDa;1,000kDa~2,500kDa;2,000kDa~15,000kDa;2,000kDa~12,500kDa;2,000kDa~10,000kDa;2,000kDa~ 3,00 0kDa~12,500kDa;3,000kDa~10,000kDa;3,000kDa~9,000kDa;3,000kDa~8,000kDa;3,000kDa~7,000kDa;3,000kDa~6,000kDa;3,000kDa~5,000kDa;Or having a molecular weight of 3,000 kDa to 4,000 kDa. Any integer within any of the above ranges is intended as an embodiment of this disclosure.
[0205] Another way to characterize the serotype 33F glycoconjugate of the present invention is to characterize the range (degree of conjugation) of the conjugated lysine, which is the carrier protein (e.g., CRM) conjugated to the sugar. 197 This is due to the number of lysine residues in the protein.
[0206] In a preferred embodiment, the degree of conjugation of the serotype 33F glycoconjugate of the present invention is 2-20, 4-16, 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15, or 10-12. In one embodiment, the degree of conjugation of the serotype 33F glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20. In preferred embodiments, the degree of conjugation of the serotype 33F glycoconjugate of the present invention is 4 to 16. In some such embodiments, the carrier protein is CRM 197 That is the case.
[0207] In a preferred embodiment, the carrier protein is a CRM containing 39 lysine residues. 197 This includes. In some such embodiments, CRM 197 This may include 4 to 16 of the 39 lysine residues covalently linked to the sugars. Another way to express this parameter is approximately 10% to 41% CRM 197 The lysine is covalently linked to the sugars. In another such embodiment, CRM 197may include 2 to 20 lysine residues out of 39 that are commonly linked to the saccharide. Another way to express this parameter is about 5% to about 50% CRM 197 is that lysine is commonly linked to the saccharide. In some embodiments, CRM 197 may include about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, or about 16 lysine residues out of 39 that are commonly linked to the saccharide.
[0208] In common embodiments, the carrier protein is commonly conjugated to the eTEC spacer via an amide bond to one or more ε-amino groups of lysine residues on the carrier protein. In some such embodiments, the carrier protein includes 2 to 20 lysine residues commonly conjugated to the saccharide. In other such embodiments, the carrier protein includes 4 to 16 lysine residues commonly conjugated to the saccharide.
[0209] The serotype 33F glycoconjugate of the present invention can also be characterized by the ratio (weight / weight) of the saccharide to the carrier protein. In some embodiments, the ratio (w / w) of the saccharide to the carrier protein is 0.2 to 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the ratio (w / w) of the saccharide to the carrier protein is 1.0 to 2.5. In further embodiments, the ratio (w / w) of the saccharide to the carrier protein is 0.4 to 1.7. In some such embodiments, the carrier protein is CRM 197 is.
[0210] The frequency of sugar chain binding to lysine on the carrier protein is another parameter for characterizing the serotype 33F glycoconjugate of the present invention. For example, in some embodiments, at least one covalent bond between the carrier protein and the polysaccharide is present for every four sugar repeat units of the polysaccharide. In another embodiment, at least one covalent bond between the carrier protein and the polysaccharide is present for every ten sugar repeat units of the polysaccharide. In yet another embodiment, at least one covalent bond between the carrier protein and the polysaccharide is present for every fifteen sugar repeat units of the polysaccharide. In a further embodiment, at least one covalent bond between the carrier protein and the polysaccharide is present for every twenty-five sugar repeat units of the polysaccharide.
[0211] In a common embodiment, the carrier protein is CRM 197 CRM 197 The covalent bond between the polysaccharide and the eTEC spacer is present at least once for every 4, 10, 15, or 25 sugar repeat units of the polysaccharide.
[0212] Other embodiments include conjugates of 5-10 sugar repeat units; 2-7 sugar repeat units; 3-8 sugar repeat units; 4-9 sugar repeat units; 6-11 sugar repeat units; 7-12 sugar repeat units; 8-13 sugar repeat units; 9-14 sugar repeat units; 10-15 sugar repeat units; 2-6 sugar repeat units; 3-7 sugar repeat units; 4-8 sugar repeat units; 6-10 sugar repeat units; 7-11 sugar repeat units; 8-12 sugar repeat units; 9-13 sugar repeat units; 10-14 sugar repeat units; 10-20 Each sugar repeat unit; every 4 to 25 sugar repeat units or every 2 to 25 sugar repeat units contains at least one covalent bond between the carrier protein and the sugar. In a common embodiment, the carrier protein is CRM 197 That is the case.
[0213] In another embodiment, at least one bond between the carrier protein and the sugar is present for every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 sugar repeat units of the polysaccharide. In one embodiment, the carrier protein is CRM 197 Therefore, any integer within any of the above ranges is contemplated as an embodiment of the present disclosure.
[0214] A key consideration during conjugation is the development of conditions that allow for the retention of potentially sensitive non-sugar-substituted functional groups of individual components, such as O-acyl, phosphate, or glycerol phosphate side chains, which can form part of the sugar epitope.
[0215] In one embodiment, the serotype 33F glycoconjugate of the present invention comprises a sugar having a degree of O-acetylation of 10% to 100%. In some such embodiments, the sugar has a degree of O-acetylation of 50% to 100%.
[0216] In other such embodiments, the sugars have a degree of O-acetylation of 75% to 100%. In further embodiments, the sugars have a degree of O-acetylation of 70% or more, or equal to it (70% or more).
[0217] In preferred embodiments, the serotype 33F glycoconjugate of the present invention contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the glycoconjugate contains at least 0.5, 0.6, or 0.7 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the glycoconjugate contains at least 0.6 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the glycoconjugate contains at least 0.7 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the presence of O-acetyl groups is determined by ion-HPLC analysis.
[0218] In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.9.
[0219] In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.7. The ratio of tate to mM is at least 0.9.
[0220] The serotype 33F glycoconjugate and immunogenic composition of the present invention are not covalently conjugated to a carrier protein, but nevertheless may contain free sugars present in the glycoconjugate composition. Free sugars can be non-covalently associated with the glycoconjugate (i.e., non-covalently bound, adsorbed, or captured in or together with it).
[0221] In some embodiments, the serotype 33F glycoconjugate of the invention comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or 5% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide. Preferably, the serotype 33F glycoconjugate comprises less than 15% free saccharide, more preferably less than 10% free saccharide, even more preferably less than 5% free saccharide. In a preferred embodiment, the serotype 33F glycoconjugate comprises less than about 25% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide. In a preferred embodiment, the serotype 33F glycoconjugate comprises less than about 20% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide. In a preferred embodiment, the serotype 33F glycoconjugate comprises less than about 15% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide.
[0222] In certain preferred embodiments, the invention provides a serotype 33F glycoconjugate having one or more of the following characteristics, alone or in combination: the polysaccharide has a molecular weight of 50 kDa to 2,000 kDa; the glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa; the carrier protein comprises 2 to 20 lysine residues covalently linked to the saccharide; the ratio (w / w) of saccharide to carrier protein is 0.2 to 4.0; the glycoconjugate comprises at least one covalent bond between the carrier protein and the polysaccharide per 4, 10, 15 or 25 saccharide repeating units of the polysaccharide; the saccharide has an O-acetylation degree of 75% to 100%; the conjugate comprises less than about 15% free polysaccharide relative to the total polysaccharide; the carrier protein is CRM 197 is.
[0223] The serotype 33F glycoconjugate, its molecular size distribution (K d) can also be characterized by the following. Using a size exclusion chromatography medium (CL-4B), the relative molecular size distribution of the conjugate can be determined as described above. In one embodiment, at least 15% of the serotype 33F glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d It has the following: In one embodiment, at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, or 90% of the serotype 33F glycoconjugate of the present invention is present in a CL-4B column with a K level lower than or equal to 0.3. d It has.
[0224] In a preferred embodiment, at least 35% of the serotype 33F glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 33F glycoconjugate of the present invention are present in a CL-4B column with a K level lower than or equal to 0.3. d In a preferred embodiment, at least 60% of the serotype 33F glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d In a preferred embodiment, at least 70% of the serotype 33F glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d It has.
[0225] In a preferred embodiment, 40% to 90% of the serotype 33F glycoconjugate is present in the CL-4B column at a K level lower than or equal to 0.3. d It is preferable. In the embodiment, 50% to 90% of the serotype 33F glycoconjugate is present in the CL-4B column at a K level lower than or equal to 0.3. dIn a preferred embodiment, 65% to 80% of the serotype 33F glycoconjugate is present in the CL-4B column at a K level lower than or equal to 0.3. d It has.
[0226] 1.3.4 Glycoconjugate derived from Streptococcus pneumoniae serotype 15B In one embodiment, the serotype 15B glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroboric acid (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled directly to an amino group on a carrier protein or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can then be coupled to a carrier via a thioether bond obtained after a reaction with a maleimide-activated carrier protein (e.g., GMBS) or a haloacetylated carrier protein (e.g., iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, a cyanate ester (which may be prepared by a CDAP chemical reaction) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivativeized sugar is conjugated to a support protein via a carboxyl group on the protein support using a carbodiimide (e.g., EDAC or EDC) chemical reaction. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.
[0227] Other preferred techniques utilize carbodiimides, hydrazides, active esters, norboranes, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication WO98 / 42721. The conjugation may also involve a carbonyl linker, which can be formed by the reaction of the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979), J. Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by a reaction with a protein to form a carbamate bond. This may include reduction of the anomeric terminus to a primary hydroxyl group, optionally protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate with an amino group on the protein.
[0228] In preferred embodiments, the serotype 15B glycoconjugate of the present invention is prepared by reductive amination. Reductive amination comprises two steps: (1) oxidation of the polysaccharide to generate an aldehyde functional group from the adjacent diol in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.
[0229] Preferably, sizing of the serotype 15B polysaccharide to a target molecular weight (MW) range is performed before oxidation. Advantageously, the size of the purified serotype 15B polysaccharide is reduced while retaining important structural features of the polysaccharide, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 15B polysaccharide is reduced by mechanical homogenization (see Section 1.2.6 above).
[0230] The oxidation step may include a reaction with a periodate. For the purposes of this invention, the term "periodate" includes both periodates and periodic acid; this term also includes metaperiodate (IO4). - ) and orthoperiodate (IO6 5-This also includes both of the periodates and various salts of periodates (e.g., sodium periodate and potassium periodate). In the application method, the periodate used for the oxidation of serotype 15B capsular polysaccharide is metaperiodate. In a preferred embodiment, the periodate used for the oxidation of serotype 15B capsular polysaccharide is sodium metaperiodate.
[0231] In preferred embodiments, the polysaccharide is reacted with 0.01-10.0, 0.05-5.0, 0.1-1.0, 0.5-1.0, 0.7-0.8, 0.05-0.5, and 0.1-0.3 molar equivalents of an oxidizing agent. In preferred embodiments, the polysaccharide is reacted with about 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, and 0.95 molar equivalents of an oxidizing agent. In preferred embodiments, the polysaccharide is reacted with about 0.15 molar equivalents of an oxidizing agent. In preferred embodiments, the polysaccharide is reacted with about 0.25 molar equivalents of an oxidizing agent. In preferred embodiments, the polysaccharide is reacted with about 0.5 molar equivalents of an oxidizing agent. In a preferred embodiment, the polysaccharide is reacted with about 0.6 molar equivalents of an oxidizing agent. In a preferred embodiment, the polysaccharide is reacted with about 0.7 molar equivalents of an oxidizing agent.
[0232] In preferred embodiments, the duration of the reaction is 1 to 50 hours, 10 to 30 hours, 15 to 20 hours, 15 to 17 hours, or about 16 hours.
[0233] In a preferred embodiment, the reaction temperature is maintained at 15°C to 45°C, 15°C to 30°C, or 20°C to 25°C. In a preferred embodiment, the reaction temperature is maintained at approximately 23°C.
[0234] In a preferred embodiment, the oxidation reaction is carried out in a buffer selected from sodium phosphate, potassium phosphate, 2-(N-morpholino)ethanesulfonic acid (MES), or Bis-Tris. In a preferred embodiment, the buffer is potassium phosphate.
[0235] In a preferred embodiment, the buffer solution has a concentration of 1 mM to 500 mM, 1 mM to 300 mM, or 50 mM to 200 mM. In a preferred embodiment, the buffer solution has a concentration of approximately 100 mM.
[0236] In preferred embodiments, the oxidation reaction is carried out at a pH of 4.0–8.0, 5.0–7.0, or 5.5–6.5. In preferred embodiments, the pH is approximately 6.0.
[0237] In a preferred embodiment, activated serotype 15B capsular polysaccharide is obtained by reacting 0.5 mg / mL to 5 mg / mL of isolated serotype 15B capsular polysaccharide with 0.2 to 0.3 molar equivalents of periodate at a temperature of 20°C to 25°C.
[0238] In a preferred embodiment, the activated serotype 15B capsular polysaccharide is purified. The activated serotype 15B capsular polysaccharide is purified by methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / diafiltration. For example, the activated capsular polysaccharide is purified by concentration and diafiltration using an ultrafiltration apparatus.
[0239] In preferred embodiments, the degree of oxidation of the activated serotype 15B capsular polysaccharide is 2-20, 2-15, 2-10, 2-5, 5-20, 5-15, 5-10, 10-20, 10-15, or 15-20. In preferred embodiments, the degree of oxidation of the activated serotype 15B capsular polysaccharide is 2-10, 4-8, 4-6, 6-8, 6-12, 8-12, 9-11, 10-16, 12-16, 14-18, 16-20, 16-18, or 18-20.
[0240] In preferred embodiments, the activated serotype 15B capsular polysaccharide has molecular weights of 5 kDa to 500 kDa, 50 kDa to 500 kDa, 50 kDa to 450 kDa, 100 kDa to 400 kDa, and 100 kDa to 350 kDa. In preferred embodiments, the activated serotype 15B capsular polysaccharide has molecular weights of 100 kDa to 350 kDa. In preferred embodiments, the activated serotype 15B capsular polysaccharide has molecular weights of 100 kDa to 300 kDa. In preferred embodiments, the activated serotype 15B capsular polysaccharide has molecular weights of 100 kDa to 250 kDa.
[0241] In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM of acetate per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.5, 0.6, or 0.7 mM of acetate per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.6 mM of acetate per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.7 mM of acetate per mM of serotype 15B capsular polysaccharide.
[0242] In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM of glycerol per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.5, 0.6, or 0.7 mM of glycerol per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.6 mM of glycerol per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.7 mM of glycerol per mM of serotype 15B capsular polysaccharide.
[0243] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa and contains at least 0.6 mM acetate per mM of serotype 15B capsular polysaccharide.
[0244] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa and contains at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide.
[0245] In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate and at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide.
[0246] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa and contains at least 0.6 mM acetate and at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide.
[0247] In one embodiment, the activated serotype 15B capsular polysaccharide is optionally freeze-dried in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melegitose, dextran, mannitol, lactitol, and palatinite. In a preferred embodiment, the sugar is sucrose. The freeze-dried activated capsular polysaccharide is then subjected to a carrier protein. It can be mixed with solutions.
[0248] In another embodiment, the activated serotype 15B capsular polysaccharide is mixed with a carrier protein and optionally freeze-dried in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melegitose, dextran, mannitol, lactitol, and palatinite. In a preferred embodiment, the sugar is sucrose. The simultaneously freeze-dried polysaccharide and carrier protein can then be resuspended in solution and reacted with a reducing agent.
[0249] Activated serotype 15B capsular polysaccharide (a) a step of mixing activated serotype 15B capsular polysaccharide with a carrier protein, and (b) The carrier protein can be conjugated by a process comprising the step of reacting a mixed activated serotype 15B capsular polysaccharide and carrier protein with a reducing agent to form a serotype 15B capsular polysaccharide-carrier protein conjugate.
[0250] Conjugation of activated serotype 15B capsular polysaccharide by reductive amination in dimethyl sulfoxide (DMSO) with a protein carrier is preferable for preserving the O-acetyl content of the polysaccharide compared to, for example, reductive amination in aqueous solution where the level of O-acetylation of the polysaccharide is significantly lower. In preferred embodiments, steps (a) and (b) are carried out in DMSO.
[0251] In a preferred embodiment, step (a) comprises dissolving lyophilized serotype 15B capsular polysaccharide in a solution containing a carrier protein and DMSO. In a preferred embodiment, step (a) comprises dissolving lyophilized serotype 15B capsular polysaccharide and carrier protein simultaneously in DMSO.
[0252] When steps (a) and (b) are performed in an aqueous solution, steps (a) and (b) are preferably performed in a buffer selected from PBS, MES, HEPES, Bis-tris, ADA, PIPES, MOPSO, BES, MOPS, DIPSO, MOBS, HEPPSO, POPSO, TEA, EPPS, Bisine, or HEPB, at a pH of 6.0–8.5, 7.0–8.0, or 7.0–7.5. In a preferred embodiment, the buffer is PBS. In a preferred embodiment, the pH is approximately 7.3. In a preferred embodiment, the concentration of activated serotype 15B capsular polysaccharide in step (b) is 0.1 mg / mL–10 mg / mL, 0.5 mg / mL–5 mg / mL, or 0.5 mg / mL–2 mg / mL. In a preferred embodiment, the concentration of activated serotype 15B capsular polysaccharide in step (b) is approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 mg / mL.
[0253] In preferred embodiments, the initial input ratio (weight / weight) of activated serotype 15B capsular polysaccharide to the carrier protein is 5:1 to 0.1:1, 2:1 to 0.1:1, 2:1 to 1:1, 1.5:1 to 1:1, 0.1:1 to 1:1, 0.3:1 to 1:1, or 0.6:1 to 1:1.
[0254] In a preferred embodiment, the initial input ratio of activated serotype 15B capsular polysaccharide to the carrier protein is about 0.6:1 to 1:1. In another preferred embodiment, the initial input ratio of activated serotype 15B capsular polysaccharide to the carrier protein is about 0.6:1 to 1.5:1. Such initial input ratios are suitable for low levels of free polysaccharide in the glycoconjugate. It is particularly suitable for obtaining polysaccharides.
[0255] In preferred embodiments, the initial input ratio of activated serotype 15B capsular polysaccharide to the carrier protein is approximately 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, or 2:1.
[0256] In one embodiment, the reducing agent is an amine borane such as sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride or zinc borohydride in the presence of Bronsted or Lewis acid, pyridineborane, 2-picolineborane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMeiPrN-BH3, benzylamine-BH3, or 5-ethyl-2-methylpyridineborane (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride. In a preferred embodiment, the reducing agent is sodium 2-picolineborane.
[0257] In a preferred embodiment, the amount of reducing agent used in step (b) is about 0.1 to 10.0 molar equivalents, 0.5 to 5.0 molar equivalents, or 1.0 to 2.0 molar equivalents. In a preferred embodiment, the amount of reducing agent used in step (b) is about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2.0 molar equivalents.
[0258] In a preferred embodiment, the duration of step (b) is 1 to 60 hours, 10 to 50 hours, 40 to 50 hours, or 42 to 46 hours. In a preferred embodiment, the duration of step (b) is approximately 44 hours.
[0259] In a preferred embodiment, the reaction temperature in step (b) is maintained at 10°C to 40°C, 15°C to 30°C, or 20°C to 26°C. In a preferred embodiment, the reaction temperature in step (b) is maintained at approximately 23°C.
[0260] In a preferred embodiment, the process for preparing a glycoconjugate containing Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein further comprises a step (step (c)) of capping (quenching) unreacted aldehydes by adding NaBH4.
[0261] In a preferred embodiment, the amount of NaBH4 used in step (c) is 0.1 to 10 molar equivalents, 0.5 to 5.0 molar equivalents, or 1.0 to 3.0 molar equivalents. In a preferred embodiment, the amount of NaBH4 used in step (c) is about 2 molar equivalents.
[0262] In a preferred embodiment, the duration of step (c) is 0.1 to 10 hours, 0.5 to 5 hours, or 2 to 4 hours. In a preferred embodiment, the duration of step (c) is approximately 3 hours.
[0263] In a preferred embodiment, the reaction temperature in step (c) is maintained at 15°C to 45°C, 15°C to 30°C, or 20°C to 26°C. In a preferred embodiment, the reaction temperature in step (c) is maintained at approximately 23°C.
[0264] In preferred embodiments, the yield of the conjugation step is higher than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%. In the application method, the yield of the conjugation step (step b) is higher than 60%. In a preferred embodiment, the yield of the conjugation step (step b) is higher than 70%. The yield is the amount of serotype 15B polysaccharide in the conjugate x 100 / the amount of activated polysaccharide used in the conjugation step.
[0265] In a preferred embodiment, the process for preparing a glycoconjugate containing Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein is as follows: (a) A step of sizing the serotype 15B polysaccharide purified by high-pressure homogenization; (b) A step of reacting sized serotype 15B polysaccharide with an oxidizing agent; (c) A step of mixing activated serotype 15B polysaccharide with the carrier protein; (d) A step of reacting the mixed activated serotype 15B polysaccharide and carrier protein with a reducing agent to form a serotype 15B polysaccharide-carrier protein conjugate; and (e) Adding NaBH4 to cap (quench) any unreacted aldehydes. Includes.
[0266] In preferred embodiments, the yield of the conjugation step (step d) of the above process is higher than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%. In preferred embodiments, the yield of the conjugation step (step d) is higher than 60%. In preferred embodiments, the yield of the conjugation step (step d) is higher than 70%. The yield is the amount of serotype 15B polysaccharide in the conjugate x 100 / the amount of activated polysaccharide used in the conjugation step.
[0267] Following the conjugation of serotype 15B capsular polysaccharide to a carrier protein, the polysaccharide-protein conjugate can be purified (enriched in terms of the amount of polysaccharide-protein conjugate) by various techniques known to those skilled in the art. These techniques include dialysis, concentration / diafiltration, tangential flow filtration, sedimentation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and deep filtration.
[0268] In one embodiment, the carrier protein is defined in Section 1.1. In one embodiment, the carrier protein is DT (diphtheria toxin), TT (tetanus toxin), CRM 197 The selection is made from a group consisting of other DT variants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof. In one embodiment, the carrier protein is CRM 197 That is the case.
[0269] In some embodiments, the serotype 15B glycoconjugate of the present invention is a carrier protein (e.g., CRM) 197 ) are conjugated and contain sugars having a molecular weight of 5 kDa to 1,500 kDa. In other such embodiments, the sugars have a molecular weight of 10 kDa to 1,500 kDa. In further such embodiments, the sugars have molecular weights of 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 50 kDa to 250 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 kDa to 1,00 It has a molecular weight of 0kDa; 100kDa~750kDa; 100kDa~500kDa; 100kDa~250kDa; 200kDa~1,500kDa; 200kDa~1,250kDa; 200kDa~1,000kDa; 200kDa~750kDa; or 200kDa~500kDa; or 200kDa~400kDa. Any integer within any of the above ranges is intended as an embodiment of the present disclosure. In some embodiments, the serotype 15B glycoconjugate of the present invention has a molecular weight of 50 kDa to 20,000 kDa. In some embodiments, the serotype 15B glycoconjugate of the present invention has a molecular weight of 1,000 kDa to 20,000 kDa. In preferred embodiments, the serotype 15B glycoconjugate of the present invention has a molecular weight of 3,000 kDa to 20,000 kDa, 5,000 kDa to 10,000 kDa, 5,000 kDa to 20,000 kDa, 8,000 kDa to 20,000 kDa, 8,000 kDa to 16,000 kDa, or 10,000 kDa to 16,000 kDa.
[0270] In a further embodiment, the serotype 15B glycoconjugate of the present invention is approximately 1,000 kDa, approximately 1,500 kDa, approximately 2,000 kDa, approximately 2,500 kDa, approximately 3,000 kDa, approximately 3,500 kDa, approximately 4,000 kDa, approximately 4,500 kDa, approximately 5,000 kDa, approximately 5,500 kDa, approximately 6,000 kDa, approximately 6,500 kDa, approximately 7,000 kDa, approximately 7,500 kDa, approximately 8,000 kDa, approximately 8,500 kDa, approximately 9,000 kDa, approximately 9,500 kDa, approximately 10,000 kDa, approximately 1 It has a molecular weight of 0,500 kDa, approximately 11,000 kDa, approximately 11,500 kDa, approximately 12,000 kDa, approximately 12,500 kDa, approximately 13,000 kDa, approximately 13,500 kDa, approximately 14,000 kDa, approximately 14,500 kDa, approximately 15,000 kDa, approximately 15,500 kDa, approximately 16,000 kDa, approximately 16,500 kDa, approximately 17,000 kDa, approximately 17,500 kDa, approximately 18,000 kDa, approximately 18,500 kDa, approximately 19,000 kDa, approximately 19,500 kDa, or approximately 20,000 kDa.
[0271] In a further embodiment, the serotype 15B glycoconjugate of the present invention is 1,000kDa~20,000kDa; 1,000kDa~15,000kDa; 1,000kDa~10,000kDa; 1,000kDa~7,500kDa; 1,000kDa~5,000kDa; 1,000kDa~4,000kDa; 1,000kDa~3,000kDa; 2,000k It has a molecular weight of Da ~ 20,000 kDa; 2,000 kDa ~ 15,000 kDa; 2,000 kDa ~ 12,500 kDa; 2,000 kDa ~ 10,000 kDa; 2,000 kDa ~ 7,500 kDa; 2,000 kDa ~ 6,000 kDa; 2,000 kDa ~ 5,000 kDa; 2,000 kDa ~ 4,000 kDa; or 2,000 kDa ~ 3,000 kDa.
[0272] In a further embodiment, the serotype 15B glycoconjugate of the present invention is 3,000kDa~20,000kDa; 3,000kDa~15,000kDa; 3,000kDa~10,000kDa; 3,000kDa~7,500kDa; 3,000kDa~5,000kDa; 3,000kDa~4,000k It has a molecular weight of Da; 4,000kDa to 20,000kDa; 4,000kDa to 15,000kDa; 4,000kDa to 12,500kDa; 4,000kDa to 10,000kDa; 4,000kDa to 7,500kDa; 4,000kDa to 6,000kDa; or 4,000kDa to 5,000kDa. In a further embodiment, the serotype 15B glycoconjugate of the present invention has a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 12,500 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa.
[0273] The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any integer within any of the above ranges is intended as an embodiment of the present disclosure. In one embodiment, the serotype 15B glycoconjugate is prepared by reductive amination. .
[0274] The serotype 15B glycoconjugate of the present invention can also be characterized by the ratio (weight / weight) of the sugar to the carrier protein. In preferred embodiments, the ratio (weight / weight) of serotype 15B capsular polysaccharide in the conjugate to the carrier protein is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In preferred embodiments, the ratio of serotype 15B capsular polysaccharide in the conjugate to the carrier protein is 0.4 to 2. In preferred embodiments, the ratio of serotype 15B capsular polysaccharide in the conjugate to the carrier protein is 0.5-2.0, 0.5-1.5, 0.5-1.0, 1.0-1.5, or 1.0-2.0. In preferred embodiments, the ratio of serotype 15B capsular polysaccharide in the conjugate to the carrier protein is 0.7-0.9.
[0275] The serotype 15B glycoconjugate and immunogenic composition of the present invention may contain free sugars that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free sugars can be non-covalently associated with the glycoconjugate (i.e., non-covalently bound, adsorbed, or captured in or together with it).
[0276] In preferred embodiments, the serotype 15B glycoconjugate of the present invention contains about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or less than 15% of free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B glycoconjugate of the present invention contains about 25% of free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B glycoconjugate of the present invention contains about 20% of free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B glycoconjugate of the present invention contains about 15% of free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide.
[0277] The molecular size distribution (K) of the serotype 15B glycoconjugate d ) can also be characterized by the following. Using a size exclusion chromatography medium (CL-4B), the relative molecular size distribution of the conjugate can be determined as described above. In a preferred embodiment, at least 20% of the serotype 15B glycoconjugate of the present invention has a Kd of less than or equal to 0.3 in the CL-4B column. In a preferred embodiment, at least 30% of the immunogenic conjugate has a Kd of less than or equal to 0.3 in the CL-4B column. In a preferred embodiment, at least 40% of the serotype 15B glycoconjugate of the present invention has a Kd of less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 15 glycoconjugate of the present invention are present in a CL-4B column with a K level lower than or equal to 0.3. d In a preferred embodiment, at least 60% of the serotype 15B glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. dIn a preferred embodiment, at least 70% of the serotype 15B glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d It has.
[0278] In a preferred embodiment, 40% to 90% of the serotype 15B glycoconjugate is present in the CL-4B column at a K level lower than or equal to 0.3. d It is preferable. In the embodiment, 50% to 90% of the serotype 15B glycoconjugate is present in the CL-4B column at a K level lower than or equal to 0.3. d In a preferred embodiment, 65% to 80% of the serotype 15B glycoconjugate is present in the CL-4B column at a K level lower than or equal to 0.3. d It has.
[0279] In preferred embodiments, the serotype 15B glycoconjugate of the present invention contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate per mM serotype 15B capsular polysaccharide. In preferred embodiments, the glycoconjugate contains at least 0.5, 0.6, or 0.7 mM acetate per mM serotype 15B capsular polysaccharide. In preferred embodiments, the glycoconjugate contains at least 0.6 mM acetate per mM serotype 15B capsular polysaccharide. In preferred embodiments, the glycoconjugate contains at least 0.7 mM acetate per mM serotype 15B capsular polysaccharide. In preferred embodiments, the presence of O-acetyl groups is determined by ion-HPLC analysis.
[0280] In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in isolated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.
[0281] In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in activated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.
[0282] In a preferred embodiment, the serotype 15B glycoconjugate of the present invention contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM glycerol per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the present invention contains at least 0.5, 0.6, or 0.7 mM glycerol per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the present invention contains at least 0.6 mM glycerol per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the present invention contains at least 0.7 mM glycerol per mM serotype 15B capsular polysaccharide.
[0283] Another method for characterizing the serotype 15B glycoconjugate of the present invention is the conjugate Carrier proteins (e.g., CRM) that are conjugated to sugars can be characterized as the extent of gated lysine (degree of conjugation). 197 This is due to the number of lysine residues in the protein. Evidence of lysine modification of the carrier protein due to covalent bonding to polysaccharides can be obtained by amino acid analysis using routine methods known to those skilled in the art. Conjugation is performed using CRM to generate conjugate materials. 197 This results in a reduction in the number of lysine residues recovered compared to protein starting materials.
[0284] In a preferred embodiment, the degree of conjugation of the serotype 15B glycoconjugate of the present invention is 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15, or 10-12. In one embodiment, the degree of conjugation of the serotype 15B glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In a preferred embodiment, the degree of conjugation of the serotype 15B glycoconjugate of the present invention is 2-5.
[0285] 1.3.5 Glycoconjugate derived from Streptococcus pneumoniae serotype 12F In the glycoconjugate derived from Streptococcus pneumoniae serotype 12F of the present invention, the sugar is selected from the group consisting of polysaccharides and oligosaccharides, and the carrier protein is selected from any suitable carrier described herein or known to those skilled in the art. In some preferred embodiments, the sugar is a polysaccharide derived from Streptococcus pneumoniae serotype 12F.
[0286] In one embodiment, a glycoconjugate derived from Streptococcus pneumoniae serotype 12F is prepared using CDAP. The polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroboric acid (CDAP) to form a cyanate ester. The activated polysaccharide is then added to a carrier protein (preferably CRM) either directly or via a spacer (linker) group. 197) is coupled to the amino group on the support. For example, a thiolated polysaccharide may be obtained by using cystamine or cysteamine as the spacer, and this thiolated polysaccharide can be coupled to the support via a thioether bond obtained after reaction with a maleimide-activated support protein (e.g., GMBS is used) or a haloacetylated support protein (e.g., iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, a cyanate ester (optionally produced by the CDAP chemical reaction) is coupled to hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivativeized sugars are coupled to a support protein (e.g., CRM) via a carbodiimide (e.g., EDAC or EDC) chemical reaction through a carboxyl group on the protein support. 197 ) Conjugate it.
[0287] Other techniques for conjugation utilize carbodiimide, hydrazide, active ester, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication WO98 / 42721. The conjugation may also involve a carbonyl linker, which can be formed by the reaction of the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979), J. Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by a reaction with a protein to form a carbamate bond. This involves reduction to the primary hydroxyl group at the anomeric terminus, and optionally protection / deprotection of the primary hydroxyl group, and CDI. The reaction may include the reaction of a primary hydroxyl group with CDI to form an I-carbamate intermediate, and the coupling of the CDI-carbamate intermediate with an amino group on a protein.
[0288] In one embodiment, a capsular polysaccharide derived from serotype 12F Streptococcus pneumoniae is conjugated to a carrier protein by reductive amination. Reductive amination comprises two steps: (1) oxidation of the polysaccharide to generate an aldehyde functional group from adjacent diols in individual hexasaccharide units, and (2) reduction of the activated sugars and carrier protein to form a conjugate.
[0289] Before oxidation, the serum type 12F polysaccharide may be hydrolyzed (sized). Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be carried out using acetic acid.
[0290] In one embodiment, the oxidizing agent is a periodate. The term "periodate" includes both periodates and periodic acid (see below).
[0291] In preferred embodiments, the oxidizing agent is 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) free radical and N-chlorosuccinimide (NCS) as a co-oxidizing agent. In such embodiments, a glycoconjugate derived from Streptococcus pneumoniae serotype 12F is prepared using 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) free radical as described in Example 7 and WO2014 / 097099, and the primary alcohol of the sugar is oxidized to an aldehyde using N-chlorosuccinimide (NCS) as a co-oxidizing agent (hereinafter referred to as "TEMPO / NCS oxidation"). Therefore, in one embodiment, a glycoconjugate derived from Streptococcus pneumoniae serotype 12F can be obtained by a method comprising: a) reacting 12F sugars with 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to produce activated sugars; and b) reacting the activated sugars with a carrier protein containing one or more amine groups (hereinafter referred to as "TEMPO / NCS-reductive amination"). In one embodiment, a glycoconjugate derived from Streptococcus pneumoniae serotype 12F can be obtained by the above method. In one embodiment, the degree of oxidation of activated 12F sugars is 1-50, 1-40, 1-30, 1-20, 1-10, 1-5, 3-40, 3-30, 3-20, 3-10, 4-40, 4-30, 4-20, 4-10, 5-30, 5-25, 5-20, 5-10, 6-50, 6-40, 6-30, 6-20, 6-15, 6-14, 6-13, 6- The ranges are 12, 6-11, 6-10, 7-40, 7-30, 7-20, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 8-40, 8-30, 8-20, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 9-40, 9-30, 9-20, 9-15, 10-40, 10-30, 10-20, or 10-15.In a further embodiment, the degree of oxidation of the activated sugar is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40. Preferably, the carrier protein is CRM. 197 That is the case.
[0292] In one embodiment, before step a), the 12F sugars are hydrolyzed to a molecular weight in the range of 100kDa to 400kDa. For example, in one embodiment, the molecular weights are 100kDa to 350kDa, 100kDa to 300kDa, 100kDa to 250kDa, 100kDa to 200kDa, 100kDa to 150kDa, 200kDa to 400kDa, 200kDa to 350kDa, 200kDa to 300kDa, and 200kDa to 250kDa. a) The range is 300kDa to 400kDa, or 300kDa to 350kDa.
[0293] In a further embodiment, the method further comprises a step of purifying the activated polysaccharide before step b). In a further embodiment, the method further comprises a step of adding a reducing agent after step b). In one embodiment, the reducing agent is NaCNBH3. In a further embodiment, the method further comprises a step of adding NaBH4 after the addition of NaCNBH3. In a further embodiment, the method comprises a purification step after the addition of NaBH4.
[0294] In another embodiment, the Disclosure provides a glycoconjugate derived from Streptococcus pneumoniae serotype 12F, which can be produced or obtained by any of the methods disclosed above. For example, in one embodiment, the Disclosure provides a glycoconjugate derived from Streptococcus pneumoniae serotype 12F, which contains a sugar conjugated to a carrier protein, which can be produced or obtained by a method comprising the steps of: a) reacting a sugar with 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to produce an activated sugar; and b) reacting the activated sugar with a carrier protein containing one or more amine groups.
[0295] In one embodiment, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F of the present invention has a molecular weight of about 50 kDa to about 20,000 kDa. In another embodiment, the glycoconjugate has a molecular weight of about 200 kDa to about 10,000 kDa. In yet another embodiment, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F has a molecular weight of about 500 kDa to about 5,000 kDa. In one embodiment, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F has a molecular weight of about 1,000 kDa to about 3,000 kDa. In other embodiments, glycoconjugates derived from Streptococcus pneumoniae serotype 12F have molecular weights of approximately 600 kDa to 2,800 kDa; approximately 700 kDa to 2,700 kDa; approximately 1,000 kDa to 2,000 kDa; approximately 1,800 kDa to 2,500 kDa; approximately 1,100 kDa to 2,200 kDa; approximately 1,900 kDa to 2,700 kDa; approximately 1,200 kDa to 2,400 kDa; approximately 1,700 kDa to 2,600 kDa; approximately 1,300 kDa to 2,600 kDa; and approximately 1,600 kDa to 3,000 kDa.
[0296] In a further embodiment, the serotype 12F glycoconjugate of the present invention is 1,000kDa~20,000kDa; 1,000kDa~15,000kDa; 1,000kDa~10,000kDa; 1,000kDa~7,500kDa; 1,000kDa~5,000kDa; 1,000kDa~4,000kDa; 1,000kDa~3,000kDa; 2,000k The molecular weights are as follows: Da ~ 20,000 kDa; 2,000 kDa ~ 15,000 kDa; 2,000 kDa ~ 12,500 kDa; 2,000 kDa ~ 10,000 kDa; 2,000 kDa ~ 7,500 kDa; 2,000 kDa ~ 6,000 kDa; 2,000 kDa ~ 5,000 kDa; 2,000 kDa ~ 4,000 kDa; or 2,000 kDa ~ 3,000 kDa. Any integer within any of the above ranges is intended as an embodiment of the present disclosure. In some such embodiments, the carrier protein is CRM 197 In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.
[0297] Another way to characterize the serotype 12F glycoconjugate of the present invention is to characterize the range (degree of conjugation) of the conjugated lysine, which is the carrier protein (e.g., CRM) conjugated to the sugar. 197 This is due to the number of lysine residues in the protein.
[0298] In a preferred embodiment, the degree of conjugation of the serotype 12F glycoconjugate of the present invention is 2-20, 4-16, 4-15, 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15, or 10-12. In one embodiment, the degree of conjugation of the serotype 12F glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20.
[0299] The number of lysine residues in a carrier protein conjugated with sugars can also be expressed as a molar ratio. For example, CRM 197 In glycoconjugates in which 4 to 15 lysine residues are covalently linked to sugars, the CRM of the conjugated lysine residues in the glycoconjugate 197 The molar ratio is approximately 10:1 to 40:1. 197 In an immunogenic composition in which 2 to 20 lysine residues are covalently linked to sugars, the CRM of the conjugated lysine in the glycoconjugate 197 The molar ratio to is approximately 5:1 to approximately 50:1. In one embodiment, in the glycoconjugate derived from Streptococcus pneumoniae serotype 12F of the present invention, the molar ratio of conjugated lysine to the carrier protein is approximately 10:1 to approximately 25:1. In some such embodiments, the carrier protein is CRM 197 In some embodiments, CRM 197 This may include approximately 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 lysine residues out of 39 that are covalently linked to the sugar. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.
[0300] In one embodiment, the ratio (w / w) of sugars to carrier proteins is 0.2 to 4 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1. 2, approximately 1.3, approximately 1.4, approximately 1.5, approximately 1.6, approximately 1.7, approximately 1.8, approximately 1.9, approximately 2.0, approximately 2.1, approximately 2.2, approximately 2.3, approximately 2.4, approximately 2.5, approximately 2.6, approximately 2.7, approximately 2.8, approximately 2.9, approximately 3.0, approximately 3.1, approximately 3.2, approximately 3.3, approximately 3.4, approximately 3.5, approximately 3.6, approximately 3.7, approximately 3.8, approximately 3.9, or approximately 4.0). In another embodiment, the ratio of sugars to carrier protein (w / w) is 1.1–1.7 in glycoconjugates derived from Streptococcus pneumoniae serotype 12F. In other embodiments, the ratio (w / w) of sugars to the carrier protein is 0.8–1.8 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, or about 1.8). In some such embodiments, the carrier protein is CRM 197 In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.
[0301] The frequency of sugar chain binding to lysine on the carrier protein is another parameter for characterizing the serotype 12F glycoconjugate of this disclosure. For example, in one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 100 sugar repeat units of the polysaccharide. In one embodiment, there is a carrier chain for every 50 sugar repeat units of the polysaccharide. At least one covalent bond exists between the protein and the polysaccharide. In one embodiment, at least one covalent bond exists between the carrier protein and the polysaccharide for every 25 sugar repeat units of the polysaccharide. In another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 4 sugar repeat units of the polysaccharide. In yet another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 10 sugar repeat units of the polysaccharide. In a further embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 15 sugar repeat units of the polysaccharide. In a common embodiment, the carrier protein is CRM 197 CRM 197 The covalent bond between the polysaccharide and the saccharide exists at least once for every 4, 10, 15, or 25 sugar repeat units of the polysaccharide.
[0302] In other embodiments, the conjugate contains at least one covalent bond between the carrier protein and the sugar for every 5-10 sugar repeat units; every 2-7 sugar repeat units; every 3-8 sugar repeat units; every 4-9 sugar repeat units; every 6-11 sugar repeat units; every 7-12 sugar repeat units; every 8-13 sugar repeat units; every 9-14 sugar repeat units; every 10-15 sugar repeat units; every 2-6 sugar repeat units; every 3-7 sugar repeat units; every 4-8 sugar repeat units; every 6-10 sugar repeat units; every 7-11 sugar repeat units; every 8-12 sugar repeat units; every 9-13 sugar repeat units; every 10-14 sugar repeat units; every 10-20 sugar repeat units; every 4-25 sugar repeat units, or every 2-25 sugar repeat units. In a common embodiment, the carrier protein is CRM 197 That is the case.
[0303] In another embodiment, CRM 197At least one bond between the polysaccharide and the sugar is present for every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 sugar repeat units of the polysaccharide. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.
[0304] In one embodiment, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F of the present invention contains at least one covalent bond between the carrier protein and the polysaccharide for every 25 saccharide repeat units of the polysaccharide. In another embodiment, the covalent bond between the carrier protein and the polysaccharide is present at least once for every 4 saccharide repeat units of the polysaccharide. In yet another embodiment, the covalent bond between the carrier protein and the polysaccharide is present at least once for every 10 saccharide repeat units of the polysaccharide. In a further embodiment, the covalent bond between the carrier protein and the polysaccharide is present at least once for every 15 saccharide repeat units of the polysaccharide. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.
[0305] The serotype 12F glycoconjugate and immunogenic composition of the present invention are not covalently conjugated to a carrier protein, but nevertheless may contain free sugars present in the glycoconjugate composition. Free sugars can be non-covalently associated with the glycoconjugate (i.e., non-covalently bound, adsorbed, or captured in or together with it).
[0306] In some embodiments, the serotype 12F glycoconjugate of the present invention contains about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or less than 5% of the total amount of serotype 12F polysaccharide. In one embodiment, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F contains about 50% of the total amount of serotype 12F polysaccharide. The glycoconjugate contains free serotype 12F polysaccharide. In one embodiment, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F contains less than 45% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In another embodiment, the glycoconjugate contains less than 30% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In yet another embodiment, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F contains less than 20% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In a further embodiment, the glycoconjugate contains less than 10% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In another embodiment, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F contains less than 5% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In some such embodiments, the serotype 12F glycoconjugate is conjugated to a carrier protein by TEMPO / NCS-reductive amination.
[0307] In some embodiments, the serotype 12F glycoconjugate of the present invention comprises sugars having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the sugars have a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the sugars have molecular weights of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 The molecular weights are as follows: kDa~1,000kDa; 100kDa~750kDa; 100kDa~500kDa; 200kDa~2,000kDa; 200kDa~1,750kDa; 200kDa~1,500kDa; 200kDa~1,250kDa; 200kDa~1,000kDa; 200kDa~750kDa; or 200kDa~500kDa; or 200kDa~400kDa. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.
[0308] The molecular size distribution (K) of the serotype 12F glycoconjugate d ) can also be characterized by the following. Using a size exclusion chromatography medium (CL-4B), the relative molecular size distribution of the conjugate can be determined as described above. In a preferred embodiment, at least 35% of the serotype 12F glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 12F glycoconjugate of the present invention are present in a CL-4B column with a K level lower than or equal to 0.3. d In a preferred embodiment, at least 60% of the serotype 12F glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3.d In a preferred embodiment, at least 70% of the serotype 12F glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d It has.
[0309] In a preferred embodiment, 40% to 90% of serotype 12F glycoconjugates have a K value lower than or equal to 0.3 in the CL-4B column. d It has the following characteristics. In a preferred embodiment, 50% to 90% of the serotype 12F glycoconjugate is less than or equal to 0.3 K in the CL-4B column. d It has the following characteristics. In a preferred embodiment, 65% to 80% of the serotype 12F glycoconjugate is less than or equal to 0.3 K in the CL-4B column. d It has.
[0310] 1.3.6 Streptococcus pneumoniae serotypes Glycoconjugate derived from 10A In one embodiment, the serotype 10A glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroboric acid (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled directly to an amino group on a carrier protein or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can then be coupled to a carrier via a thioether bond obtained after a reaction with a maleimide-activated carrier protein (e.g., GMBS) or a haloacetylated carrier protein (e.g., iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, a cyanate ester (which may be prepared by a CDAP chemical reaction) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivativeized sugar is conjugated to a support protein via a carboxyl group on the protein support using a carbodiimide (e.g., EDAC or EDC) chemical reaction. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.
[0311] Other preferred techniques utilize carbodiimides, hydrazides, active esters, norboranes, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication WO98 / 42721. The conjugation may also involve a carbonyl linker, which can be formed by the reaction of the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979), J. Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by a reaction with a protein to form a carbamate bond. This may include reduction of the anomeric terminus to a primary hydroxyl group, optionally protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate with an amino group on the protein.
[0312] In a preferred embodiment, the serotype 10A glycoconjugate of the present invention is prepared by reductive amination. Reductive amination comprises two steps: (1) oxidation of the polysaccharide to generate an aldehyde functional group from the adjacent diol in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.
[0313] Before oxidation, the serum type 10A polysaccharide may be hydrolyzed (sized). Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be carried out using acetic acid.
[0314] In one embodiment, serum polysaccharides are (a) A step of reacting isolated serotype 10A polysaccharide with an oxidizing agent; (b) A step in which the oxidation reaction is quenched by the addition of a quenching agent to obtain activated serum type 10A polysaccharide. It is activated (oxidized) by a process that includes [a certain component].
[0315] In preferred embodiments, the oxidizing agent is a periodate. For the purposes of the present invention, the term "periodate" includes both periodates and periodic acid; this term also includes metaperiodates (IO4). - ) and orthoperiodate (IO6 5- This also includes both of the above and various salts of periodates (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate used for the oxidation of serum type 10A polysaccharide is metaperiodate. In a preferred embodiment, the periodate used for the oxidation of serum type 10A polysaccharide is sodium metaperiodate.
[0316] In one embodiment, the quenching agent is selected from adjacent diols, 1,2-amino alcohols, amino acids, glutathione, sulfites, bisulfites, dithionites, metabisulfites, thiosulfites, phosphates, hypophosphates, or phosphorous acid.
[0317] In one embodiment, the quenching agent is of formula (I):
[0318] [ka] (In the formula, R 1 (Selected from H, methyl, ethyl, propyl, or isopropyl) It is a 1,2-amino alcohol.
[0319] In one embodiment, the quenching agent is selected from sodium and potassium salts of sulfites, bisulfites, dithionites, metabisulfites, thiosulfites, phosphates, hypophosphates, or phosphorous acids.
[0320] In one embodiment, the quenching agent is an amino acid. In such embodiments, the amino acid can be selected from serine, threonine, cysteine, cystine, methionine, proline, hydroxyproline, tryptophan, tyrosine, and histidine.
[0321] In one embodiment, the quenching agent is a sulfite such as a bicarbonate, dithionite, metabisulfite, or thiosulfate.
[0322] In one embodiment, the quenching agent is a compound containing two adjacent hydroxyl groups (adjacent diols), that is, two hydroxyl groups covalently linked to two adjacent carbon atoms.
[0323] Preferably, the quenching agent is of formula (II):
[0324] [ka] (In the formula, R 1 and R 2 (Each of these is independently selected from H, methyl, ethyl, propyl, or isopropyl.) It is a compound of [the compound].
[0325] In preferred embodiments, the quenching agent is glycerol, ethylene glycol, propane-1,2-diol, butane-1,2-diol or butane-2,3-diol, or ascorbic acid. In preferred embodiments, the quenching agent is butane-2,3-diol.
[0326] In a preferred embodiment, the isolated serotype 10A polysaccharide is subjected to the step of (a) reacting the isolated serotype 10A polysaccharide with periodate; (b) Quenching the oxidation reaction by adding butane-2,3-diol to obtain activated serum type 10A polysaccharide. It is activated by a process that includes this process.
[0327] After the oxidation step of polysaccharides, the polysaccharides are said to be activated and will be referred to as “activated polysaccharides” hereafter in this specification.
[0328] In preferred embodiments, the activated serotype 10A polysaccharide is purified. The activated serotype 10A polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / diafiltration. For example, the activated 10A polysaccharide is purified by concentration and diafiltration using an ultrafiltration apparatus.
[0329] In a preferred embodiment, the degree of oxidation of the activated serotype 10A polysaccharide is 2-30, 2-25, 2-20, 2-15, 2-10, 2-5, 5-30, 5-25, 5-20, 5-15, 5-10, 10-30, 10-25, 10-20, 10-15, 15-30, 15-25, 15-20, 20-30, or 20-25. In a preferred embodiment, the degree of oxidation of the activated serotype 10A polysaccharide is 2-10, 4-8, 4-6, 6-8, 6-12, 8-14, 9-11, 10-16, 12-16, 14-18, 16-20, 16-18, 18-22, or 18-20.
[0330] In preferred embodiments, the activated serotype 10A polysaccharide has a molecular weight of 50kDa to 400kDa, 50kDa to 350kDa, 50kDa to 300kDa, 50kDa to 250kDa, 50kDa to 200kDa, 100kDa to 300kDa, 100kDa to 250kDa, or 100kDa to 200kDa. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 50 kDa to 300 kDa. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa and an oxidation degree of 5 to 20, 5 to 15, 8 to 14, 8 to 12, or 9 to 11. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa and an oxidation degree of 9 to 11.
[0331] Activated polysaccharides and / or carrier proteins can be freeze-dried independently (individually) or together (simultaneously).
[0332] In one embodiment, the activated serotype 10A polysaccharide is freeze-dried, optionally in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melegitose, dextran, mannitol, lactitol, and palatinite. In a preferred embodiment, the sugar is sucrose. In one embodiment, the freeze-dried activated polysaccharide is then mixed with a solution containing a carrier protein.
[0333] In another embodiment, the activated polysaccharide and the carrier protein are freeze-dried simultaneously. In such an embodiment, the activated serotype 10A polysaccharide is mixed with the carrier protein and freeze-dried, optionally, in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melegitose, dextran, mannitol, lactitol, and palatinite. In a preferred embodiment, the sugar is sucrose. The simultaneously freeze-dried polysaccharide and carrier protein can then be resuspended in solution and reacted with a reducing agent.
[0334] The second step in the conjugation process is the reduction (reductive amination) of the activated polysaccharide and carrier protein using a reducing agent to form the conjugate.
[0335] Activated serotype 10A polysaccharide (c) The step of mixing activated serotype 10A polysaccharide with a carrier protein; and (d) A step in which the mixed activated serotype 10A polysaccharide and carrier protein are reacted with a reducing agent to form a serotype 10A polysaccharide-carrier protein conjugate. The carrier protein can be conjugated by a process that includes this method.
[0336] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.
[0337] In one embodiment, the reducing agent is an amine borane such as sodium borohydride, sodium triacetoxyborohydride, sodium borohydride or zinc borohydride, pyridineborane, 2-picolinborane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMeiPrN-BH3, benzylamine-BH3 or 5-ethyl-2-methylpyridineborane (PEMB) in the presence of Bronsted or Lewis acid. In a preferred embodiment, the reducing agent is sodium borohydride.
[0338] Even if unreacted aldehyde groups remain in the conjugate at the end of the reduction reaction These can often be capped using a suitable capping agent. In one embodiment, this capping agent is sodium borohydride (NaBH4).
[0339] Following the conjugation of serotype 10A polysaccharide to a carrier protein, the glycoconjugate can be purified (enriched in terms of the amount of polysaccharide-protein conjugate) by various techniques known to those skilled in the art. These techniques include dialysis, concentration / diafiltration, tangential flow filtration / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and deep filtration.
[0340] In some embodiments, the serotype 10A glycoconjugate of the present invention comprises sugars having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the sugars have a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the sugars have molecular weights of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 They have molecular weights of kDa~1,000kDa; 100kDa~750kDa; 100kDa~500kDa; 200kDa~2,000kDa; 200kDa~1,750kDa; 200kDa~1,500kDa; 200kDa~1,250kDa; 200kDa~1,000kDa; 200kDa~750kDa; or 200kDa~500kDa; or 200kDa~400kDa. In some such embodiments, the serotype 10A glycoconjugate is prepared using reductive amination.
[0341] In some embodiments, the serotype 10A glycoconjugate of the present invention has a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 10A glycoconjugate has a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 10A glycoconjugate has a molecular weight of 500 kDa to 15,000 kDa, 500 kDa to 10,000 kDa, 2,000 kDa to 10,000 kDa, or 3,000 kDa to 8,000 kDa. In other embodiments, the serotype 10A glycoconjugate has a molecular weight of 1,000 kDa to 10,000 kDa. In other embodiments, the serotype 10A glycoconjugate has a molecular weight of 1,000 kDa to 8,000 kDa. In yet another embodiment, the serotype 10A glycoconjugate has a molecular weight of 2,000 kDa to 8,000 kDa or 3,000 kDa to 7,000 kDa.In a further embodiment, the serotype 10A glycoconjugate of the present invention is 200kDa~20,000kDa; 200kDa~15,000kDa; 200kDa~10,000kDa; 200kDa~7,500kDa; 200kDa~5,000kDa; 200kDa~3,000kDa; 200kDa~1,000kDa; 500k Da~20,000kDa;500kDa~15,000kDa;500kDa~12,500kDa;500kDa~10,000kDa;500kDa~7,500k Da;500kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,00 0kDa;500kDa~1,500kDa;500kDa~1,000kDa;750kDa~20,000kDa;750kDa~15,000kDa;750kDa ~12,500kDa;750kDa~10,000kDa;750kDa~7,500kDa;750kDa~6,000kDa;750kDa~5,000kDa;75 0kDa~4,000kDa;750kDa~3,000kDa;750kDa~2,000kDa;750kDa~1,500kDa;1,000kDa~15,000k Da;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000kDa; It has a molecular weight of 1,000kDa to 5,000kDa; 1,000kDa to 4,000kDa; 1,000kDa to 2,500kDa; 2,000kDa to 15,000kDa; 2,000kDa to 12,500kDa; 2,000kDa to 10,000kDa; 2,000kDa to 7,500kDa; 2,000kDa to 6,000kDa; 2,000kDa to 5,000kDa; 2,000kDa to 4,000kDa; or 2,000kDa to 3,000kDa.
[0342] In a further embodiment, the serotype 10A glycoconjugate of the present invention has a molecular weight of 3,000kDa to 20,000kDa; 3,000kDa to 15,000kDa; 3,000kDa to 10,000kDa; 3,000kDa to 7,500kDa; 3,000kDa to 5,000kDa; 4,000kDa to 20,000kDa; 4,000kDa to 15,000kDa; 4,000kDa to 12,500kDa; 4,000kDa to 10,000kDa; 4,000kDa to 7,500kDa; 4,000kDa to 6,000kDa; or 4,000kDa to 5,000kDa. In a further embodiment, the serotype 10A glycoconjugate of the present invention has a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa or 5,000 kDa to 7,500 kDa. In a further embodiment, the serotype 10A glycoconjugate of the present invention has a molecular weight of 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 10,000 kDa or 6,000 kDa to 7,500 kDa. In a further embodiment, the serotype 10A glycoconjugate of the present invention has a molecular weight of 7,000 kDa to 20,000 kDa; 7,000 kDa to 15,000 kDa; 7,000 kDa to 10,000 kDa or 7,000 kDa to 8,000 kDa. In a further embodiment, the serotype 10A glycoconjugate of the present invention has a molecular weight of 8,000 kDa to 20,000 kDa; 8,000 kDa to 15,000 kDa; or 8,000 kDa to 10,000 kDa.
[0343] Any integer within any of the above ranges is intended to be an embodiment of this disclosure. The molecular weight of the glycoconjugate is measured by SEC-MALLS.
[0344] Another way to characterize the serotype 10A glycoconjugate of the present invention is to characterize the range (degree of conjugation) of the conjugated lysine, which is the carrier protein (e.g., CRM) conjugated to the sugar.197 This is due to the number of lysine residues in the protein. Evidence of lysine modification of the carrier protein due to covalent bonding to polysaccharides can be obtained by amino acid analysis using routine methods known to those skilled in the art. Conjugation is performed using CRM, which is used to generate conjugate materials. 197 This results in a reduction in the number of lysine residues recovered compared to protein starting materials.
[0345] In preferred embodiments, the degree of conjugation of the serotype 10A glycoconjugate is 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15, or 10-12. In preferred embodiments, the degree of conjugation of the serotype 10A glycoconjugate is 6-8. In preferred embodiments, the carrier protein is CRM 197 That is the case.
[0346] The serotype 10A glycoconjugate of the present invention can also be characterized by the ratio (w / w) of the sugar to the carrier protein. In some embodiments, the ratio (w / w) of the sugar to the carrier protein is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In preferred embodiments, the ratio of serotype 10A sugars in the conjugate to the carrier protein is 0.5–2.0, 0.5–1.5, 0.5–1.0, 1.0–1.5, or 1.0–2.0. In preferred embodiments, the ratio of serotype 10A polysaccharides in the conjugate to the carrier protein is 0.8–1.4. In preferred embodiments, the ratio of serotype 10A polysaccharides in the conjugate to the carrier protein is 0.8–1.2 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, or about 1.2). In some such embodiments, the carrier protein is CRM 197 That is the case.
[0347] The serotype 10A glycoconjugate and immunogenic composition of the present invention are not covalently conjugated to a carrier protein, but may nevertheless contain free sugars present in the glycoconjugate composition. Free sugars can be non-covalently associated with the glycoconjugate (i.e., non-covalently bound, adsorbed, or captured in or together with it).
[0348] In some embodiments, the serotype 10A glycoconjugate of the present invention contains free sugars at a rate of less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% of the total amount of 10A sugars. Preferably, the serotype 10A glycoconjugate contains less than 15% free sugars, more preferably less than 10%, and even more preferably less than 5% free sugars.
[0349] The molecular size distribution (K) of the serotype 10A glycoconjugate d) can also be characterized by the following. Using a size exclusion chromatography medium (CL-4B), the relative molecular size distribution of the conjugate can be determined as described above. In a preferred embodiment, at least 30% of the serotype 10A glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d In a preferred embodiment, at least 40% of the serotype 10A glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 10A glycoconjugate of the present invention are present in a CL-4B column with a K level lower than or equal to 0.3. d In a preferred embodiment, at least 60% of the serotype 10A glycoconjugate is present in the CL-4B column at a K level lower than or equal to 0.3. d In a preferred embodiment, 50% to 80% of the serotype 10A glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d It has.
[0350] 1.3.7 Glycoconjugate derived from Streptococcus pneumoniae serotype 11A In one embodiment, the serotype 11A glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroboric acid (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled directly to an amino group on a carrier protein or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can then be coupled to a carrier via a thioether bond obtained after a reaction with a maleimide-activated carrier protein (e.g., GMBS) or a haloacetylated carrier protein (e.g., iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, a cyanate ester (which may be prepared by a CDAP chemical reaction) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivativeized sugar is conjugated to the support protein via a carboxyl group on the protein support using a carbodiimide (e.g., EDAC or EDC) chemical reaction. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.
[0351] Other preferred techniques utilize carbodiimides, hydrazides, active esters, norboranes, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication WO98 / 42721. The conjugation may also involve a carbonyl linker, which can be formed by the reaction of the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979), Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by a reaction with a protein to form a carbamate bond. This may include reduction of the anomeric terminus to a primary hydroxyl group, optionally protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate with an amino group on the protein.
[0352] In a preferred embodiment, the serotype 11A glycoconjugate of the present invention is prepared by reductive amination. Reductive amination comprises two steps: (1) oxidation of the polysaccharide to generate an aldehyde functional group from the adjacent diol in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.
[0353] Before oxidation, the serotype 11A polysaccharide is optionally hydrolyzed to reduce its viscosity. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid. Mechanical sizing can be performed using high-pressure homogenization shear.
[0354] The oxidation step may include a reaction with a periodate. For the purposes of this invention, the term "periodate" includes both periodates and periodic acid; this term also includes metaperiodate (IO4). - ) and orthoperiodate (IO6 5-This also includes both of the above and various salts of periodate (e.g., sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide serotype 11A of Streptococcus pneumoniae is oxidized in the presence of metaperiodate, preferably sodium periodate (NaIO4). In another embodiment, the capsular polysaccharide derived from serotype 11A is oxidized in the presence of orthoperiodate, preferably periodic acid.
[0355] After the oxidation step of polysaccharides, the polysaccharides are said to be activated and will be referred to as “activated polysaccharides” hereafter in this specification. Activated polysaccharides can be purified and freeze-dried.
[0356] Activated polysaccharides and carrier proteins can be freeze-dried independently (individual freeze-drying) or together (simultaneous freeze-drying). In one embodiment, the activated polysaccharides and carrier proteins are freeze-dried simultaneously. In another embodiment, the activated polysaccharides and carrier proteins are freeze-dried independently.
[0357] In one embodiment, freeze-drying is carried out in the presence of a non-reducing sugar, and possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melegitose, dextran, mannitol, lactitol, and palatinite.
[0358] The second step of the conjugation process is the reduction (reductive amination) of the activated polysaccharide and carrier protein to form the conjugate using a reducing agent. Preferred reducing agents include cyanoboron hydride such as sodium cyanoborohydride, boran-pyridine, or boron hydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.
[0359] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. DMSO or DMF solvents can be used to restore lyophilized activated polysaccharides and carrier proteins.
[0360] In one embodiment, 0.1 to 3.0, 0.15 to 2.0, 0.2 to 2.0, or 0.5 to 1.5 molar equivalents of sodium cyanoborohydride are used in the reduction reaction. In another embodiment, approximately 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.9, or 3.0 molar equivalents of sodium cyanoborohydride are used in the reduction reaction.
[0361] In one embodiment, the reducing agent is sodium triacetoxyborohydride, and in a further embodiment, 1.0 to 6.0 molar equivalents, 2.0 to 5.0 molar equivalents, or about 3.0 molar equivalents of sodium triacetoxyborohydride are used in the reduction reaction.
[0362] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, and these can be capped using a suitable capping agent. In one embodiment, this capping agent is sodium borohydride (NaBH4). In one embodiment, capping is achieved by mixing the reduction product with 0.5 to 5.0 molar equivalents of NaBH4, for example, about 1, 1.5, 2, 2.5, or 3 molar equivalents of NaBH4.
[0363] After conjugation (reduction reaction and, optionally, capping), the glycoconjugate can be purified. The glycoconjugate can be purified by dialysfiltration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by dialysfiltration, ion exchange chromatography, or size exclusion chromatography.
[0364] In one embodiment, the glycoconjugate is sterile filtered.
[0365] In some embodiments, the serotype 11A glycoconjugate of the present invention is a carrier protein (e.g., CRM 197 ) are conjugated and contain polysaccharides having a molecular weight of 10kDa to 2,000kDa. In other such embodiments, the sugars have a molecular weight of 50kDa to 2,000kDa. In further such embodiments, the sugars have molecular weights of 50kDa to 1,750kDa; 50kDa to 1,500kDa; 50kDa to 1,250kDa; 50kDa to 1,000kDa; 50kDa to 750kDa; 50kDa to 500kDa; 50kDa to 400kDa; 50kDa to 300kDa; 50kDa to 200kDa; 50kDa to 100kDa; 100kDa to 2, 000kDa;100kDa~1,750kDa;100kDa~1,500kDa;100kDa~1,250kDa;100kDa~1,000kDa;100kDa~750kDa; 100kDa~500kDa;100kDa~400kDa;100kDa~300kDa;100kDa~200kDa;200kDa~2,000kDa;200kDa~1,750kDa a; having a molecular weight of 200kDa to 1,500kDa; 200kDa to 1,250kDa; 200kDa to 1,000kDa; 200kDa to 750kDa; or 200kDa to 500kDa; 200kDa to 400kDa or 200kDa to 300kDa.
[0366] In some embodiments, the serotype 11A glycoconjugate of the present invention has a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 11A glycoconjugate has a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 11A glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 11A glycoconjugate has a molecular weight of 200 kDa to 10,000 kDa. In yet another embodiment, the serotype 11A glycoconjugate has a molecular weight of 1,000 kDa to 8,000 kDa or 2,000 kDa to 8,000 kDa.
[0367] In a further embodiment, the serotype 11A glycoconjugate of the present invention is 200kDa~20,000kDa; 200kDa~17,500kDa; 200kDa~15,000kDa; 200kDa~10,000kDa; 200kDa~7,500kDa; 200kDa~5,000kDa; 200kDa~3,000kDa; 200kDa~2,000kDa; 200kDa~1,000kDa; 500kDa~20,000kDa; 500kDa~17,500kDa; 500kDa~15,000kDa; 500kDa~12 ,500kDa;500kDa~10,000kDa;500kDa~7,500kDa;500kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000kDa;5 00kDa~1,500kDa;500kDa~1,000kDa;700kDa~20,000kDa;700kDa~17,500kDa;700kDa~15,000kDa;700kDa~12,500kDa;700kDa~10,000kDa;700kDa~ 7,500kDa;700kDa~6,000kDa;700kDa~5,000kDa;700kDa~4,500kDa;700kDa~4,000kDa;700kDa~3,500kDa;700kDa~3,000kDa;700kDa~2,000kDa;7 00kDa~1,500kDa;1,000kDa~20,000kDa;1,000kDa~17,500kDa;1,000kDa~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,5 00kDa;1,000kDa~6,000kDa;1,000kDa~5,000kDa;1,000kDa~4,000kDa;1,000kDa~2,500kDa;2,000kDa~20,000kDa;2,000kDa~17,500kDa;2,000kDa Da~15,000kDa;2,000kDa~12,500kDa;2,000kDa~10,000kDa;2,000kDa~7,500kDa;2,000kDa~6,000kDa;2,000kDa~5,000kDa;2,000kDa~4,000kDa;Alternatively, it has a molecular weight of 2,000 kDa to 3,000 kDa.
[0368] In a further embodiment, the serotype 11A glycoconjugate of the present invention is 3,000kDa~20,000kDa; 3,000kDa~17,500kDa; 3,000kDa~15,000kDa; 3,000kDa~10,000kDa; 3,000kDa~7,500kDa; 3,000kDa~5,000kDa; 4,000k The molecular weights of the serotype 11A glycoconjugates of the present invention are 5,000kDa to 20,000kDa; 5,000kDa to 17,500kDa; 5,000kDa to 15,000kDa; 4,000kDa to 12,500kDa; 4,000kDa to 10,000kDa; 4,000kDa to 7,500kDa; 4,000kDa to 6,000kDa; or 4,000kDa to 5,000kDa. In a further embodiment, the serotype 11A glycoconjugate of the present invention has molecular weights of 5,000kDa to 20,000kDa; 5,000kDa to 17,500kDa; or 5,000kDa to 15,000kDa. a; Having a molecular weight of 5,000 kDa to 10,000 kDa or 5,000 kDa to 7,500 kDa.
[0369] In one embodiment, the serotype 11A glycoconjugate is prepared by reductive amination.
[0370] In a preferred embodiment, the serotype 11A glycoconjugate of the present invention contains at least 0.3, 0.5, 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, 3.0, 3.4, 3.8, 4.2, 4.6, or 5 mM acetate per mM serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate contains at least 1.8, 2.2, or 2.6 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the glycoconjugate contains at least 0.6 mM acetate per mM serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate of the present invention comprises at least 0.6, 1, 1.4, 1.8, 2.2, 2.6, 3, 3.4, 3.8, 4.2, or 4.6 mM acetate per mM serotype 11A polysaccharide and less than about 5 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the serotype 11A glycoconjugate of the present invention comprises at least 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, or 3.0 mM acetate per mM serotype 11A polysaccharide and less than about 3.4 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the serotype 11A glycoconjugate of the present invention comprises at least 0.6, 1, 1.4, 1.8, 2.2, 2.6, or about 3.0 mM of acetate per mM of serotype 11A polysaccharide and less than about 3.3 mM of acetate per mM of serotype 11A polysaccharide. Any of the above numbers are intended as embodiments of the present disclosure.
[0371] In preferred embodiments, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in isolated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the isolated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.
[0372] In a preferred embodiment, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred embodiment, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.
[0373] In a preferred embodiment, the serotype 11A glycoconjugate of the present invention contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6 of serotype 11A polysaccharide per mM. It contains 0.7, 0.8, 0.9, or 1.0 mM of glycerol. In a preferred embodiment, the serotype 11A glycoconjugate contains at least 0.2, 0.3, or 0.4 mM of glycerol per mM of serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate of the present invention contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, or 0.9 mM of glycerol per mM of serotype 11A polysaccharide and less than about 1.0 mM of glycerol per mM of serotype 11A polysaccharide. In preferred embodiments, the serotype 11A glycoconjugate of the present invention contains at least 0.3, 0.4, 0.5, 0.6, or 0.7 mM glycerol per mM serotype 11A polysaccharide and less than approximately 0.8 mM glycerol per mM serotype 11A polysaccharide. Any of the above numbers are intended as embodiments of the present disclosure.
[0374] Another way to characterize the serotype 11A glycoconjugate of the present invention is to characterize the range (degree of conjugation) of the conjugated lysine, which is the carrier protein (e.g., CRM) conjugated to the sugar. 197 This is due to the number of lysine residues in the protein.
[0375] Evidence regarding lysine modification of carrier proteins due to covalent bonding to polysaccharides can be obtained by amino acid analysis using routine methods known to those skilled in the art. Conjugation is performed using CRM, which is used to generate conjugate materials. 197 This results in a reduction in the number of lysine residues recovered compared to protein starting materials.
[0376] In preferred embodiments, the degree of conjugation of the serotype 11A glycoconjugate of the present invention is 1-15, 1-13, 1-10, 1-8, 1-6, 1-5, 1-4, 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 5-15, 5-10, 8-15, 8-12, 10-15, or 10-12. In one embodiment, the degree of conjugation of the serotype 11A glycoconjugate of the present invention is about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In preferred embodiments, the degree of conjugation of the serotype 11A glycoconjugate of the present invention is 1-6 or 2-5. In some such embodiments, the carrier protein is CRM 197 That is the case.
[0377] The serotype 11A glycoconjugate of the present invention can also be characterized by the ratio (weight / weight) of the sugar to the carrier protein. In some embodiments, the ratio (w / w) of sugars to carrier proteins is 0.2 to 4 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the ratio (w / w) of sugars to carrier protein is 0.7–2.5, 0.8–2.0, 0.7–2.0, 0.8–1.5, 0.7–1.5, 0.7–1.4, 0.8–1.4, 0.7–1.45, or 0.8–1.45. In further embodiments, the ratio (w / w) of sugars to carrier protein is 0.8–1.6 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, or about 1.6). In some such embodiments, the carrier protein is CRM 197In one embodiment, the serotype 11A glycoconjugate is prepared using reductive amination.
[0378] The serotype 11A glycoconjugate and immunogenic composition of the present invention are not covalently conjugated to a carrier protein, but nevertheless, the glycoconjugate composition It may contain free sugars present within it. The free sugars can be non-covalently associated with the glycoconjugate (i.e., non-covalently bound, adsorbed, or captured in or together with it).
[0379] In some embodiments, the serotype 11A glycoconjugate of the present invention contains less than 50% free serotype 11A capsular polysaccharide, less than 45% free sugars, less than 40% free sugars, less than 35% free sugars, less than 30% free sugars, less than 25% free sugars, less than 20% free sugars, less than 15% free sugars, less than 10% free sugars, or less than 5% free serotype 11A capsular polysaccharide. Preferably, the serotype 11A glycoconjugate contains less than 15% free sugars, more preferably less than 10% free sugars, and even more preferably less than 5% free sugars.
[0380] The molecular size distribution (K) of the serotype 11A glycoconjugate d ) can also be characterized by the following. Using a size exclusion chromatography medium (CL-4B), the relative molecular size distribution of the conjugate can be determined as described above. In a preferred embodiment, at least 30% of the serotype 11A glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 11A glycoconjugate of the present invention are present in a CL-4B column with a K level lower than or equal to 0.3. dIn a preferred embodiment, at least 60% of the serotype 11A glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d In a preferred embodiment, at least 65% of the serotype 11A glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d It has.
[0381] 1.3.8 Glycoconjugate derived from Streptococcus pneumoniae serotype 8 In one embodiment, the serotype 8 glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroboric acid (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled directly to an amino group on a carrier protein or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can then be coupled to the carrier via a thioether bond obtained after a reaction with a maleimide-activated carrier protein (e.g., GMBS) or a haloacetylated carrier protein (e.g., iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (which may be produced by the CDAP chemical reaction) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivativeized sugar is conjugated to the carrier protein via a carboxyl group on the protein carrier using a carbodiimide (e.g., EDAC or EDC) chemical reaction. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.
[0382] Other preferred techniques include the use of carbodiimide, hydrazide, active ester, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication WO98 / 42721. The conjugation may involve a carbonyl linker, which is the reaction of the free hydroxyl group of the sugar with CDI (Bethell et al. (1979), J. Biol. Chern. 254:2572~2574; Hearn et al. (1981), J. Chromatogr. 218:5 See 09-518), and subsequently, the reaction with a protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate with an amino group on the protein.
[0383] In preferred embodiments, the serotype 8 glycoconjugates of the present invention are prepared by reductive amination. Reductive amination comprises two steps: (1) oxidation of the polysaccharide to generate an aldehyde functional group from the adjacent diol in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.
[0384] Before oxidation, the serum type 8 polysaccharide is optionally hydrolyzed to reduce its viscosity. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be carried out using acetic acid.
[0385] The oxidation step may include a reaction with a periodate. For the purposes of this invention, the term "periodate" includes both periodates and periodic acid; this term also includes metaperiodate (IO4). - ) and orthoperiodate (IO6 5-This also includes both of the above and various salts of periodate (e.g., sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide serotype 8 of Streptococcus pneumoniae is oxidized in the presence of metaperiodate, preferably sodium periodate (NaIO4). In another embodiment, the capsular polysaccharide derived from serotype 8 is oxidized in the presence of orthoperiodate, preferably periodic acid.
[0386] After the oxidation step of polysaccharides, the polysaccharides are said to be activated and will be referred to as “activated polysaccharides” hereafter in this specification. Activated polysaccharides can be purified and freeze-dried.
[0387] Activated polysaccharides and carrier proteins can be freeze-dried independently (individual freeze-drying) or together (simultaneous freeze-drying). In one embodiment, the activated polysaccharides and carrier proteins are freeze-dried simultaneously. In another embodiment, the activated polysaccharides and carrier proteins are freeze-dried independently.
[0388] In one embodiment, freeze-drying is carried out in the presence of a non-reducing sugar, and possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melegitose, dextran, mannitol, lactitol, and palatinite.
[0389] The second step of the conjugation process is the reduction (reductive amination) of the activated polysaccharide and carrier protein to form the conjugate using a reducing agent. Preferred reducing agents include cyanoboron hydride such as sodium cyanoborohydride, boran-pyridine, or boron hydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.
[0390] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.
[0391] In one embodiment, 0.1 to 3.0, 0.15 to 2.0, 0.2 to 1.0, or 0.25 to 0.5 molar equivalents of sodium cyanoborohydride are used in the reduction reaction. In one embodiment, about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.9, or 3.0 molar equivalents of sodium cyanoborohydride are used in the reduction reaction.
[0392] In one embodiment, the reducing agent is sodium triacetoxyborohydride. In further embodiments, 1.0 to 6.0 molar equivalents, 2.0 to 5.0 molar equivalents, or about 3.0 molar equivalents of sodium triacetoxyborohydride are used in the reduction reaction.
[0393] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, and these can be capped using a suitable capping agent. In one embodiment, this capping agent is sodium borohydride (NaBH4). In one embodiment, capping is achieved by mixing the reduction product with 0.5 to 5.0 molar equivalents of NaBH4, for example, about 1.0, 1.5, 2.0, 2.5, or 3.0 molar equivalents of NaBH4.
[0394] After conjugation (reduction reaction and, optionally, capping), the glycoconjugate can be purified. The glycoconjugate can be purified by dialysfiltration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by dialysfiltration, ion exchange chromatography, or size exclusion chromatography.
[0395] In one embodiment, the glycoconjugate is sterile filtered.
[0396] In some embodiments, the serotype 8 glycoconjugate of the present invention is a carrier protein (e.g., CRM 197 ) are conjugated and contain polysaccharides having a molecular weight of 10kDa to 2,000kDa. In other such embodiments, the sugars have a molecular weight of 50kDa to 2,000kDa. In further such embodiments, the sugars have molecular weights of 50kDa to 1,750kDa; 50kDa to 1,500kDa; 50kDa to 1,250kDa; 50kDa to 1,000kDa; 50kDa to 750kDa; 50kDa to 500kDa; 100kDa to 2,000kDa; 100kDa to 1,750kDa; 100kDa to 1,500kDa; 100kDa to 1,250kDa; 100 They have molecular weights of kDa~1,000kDa; 100kDa~750kDa; 100kDa~500kDa; 200kDa~2,000kDa; 200kDa~1,750kDa; 200kDa~1,500kDa; 200kDa~1,250kDa; 200kDa~1,000kDa; 200kDa~750kDa; or 200kDa~500kDa; or 200kDa~400kDa. In one embodiment, the serotype 8 glycoconjugate is prepared using reductive amination.
[0397] In some embodiments, the serotype 8 glycoconjugate of the present invention has a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 8 glycoconjugate has a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 8 glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 8 glycoconjugate has a molecular weight of 200 kDa to 10,000 kDa. In yet another embodiment, the serotype 8 glycoconjugate has a molecular weight of 1,000 kDa to 8,000 kDa or 2,000 kDa to 8,000 kDa.
[0398] In a further embodiment, the serotype 8 glycoconjugate of the present invention is 200 kD a~20,000kDa;200kDa~15,000kDa;200kDa~10,000kDa;200kDa~7,500kDa;200kDa~5,000kDa;200kDa~3,000kDa;200k Da~1,000kDa;500kDa~20,000kDa;500kDa~15,000kDa;500kDa~12,500kDa;500kDa~10,000kDa;500kDa~7,500kDa;500 kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000kDa;500kDa~1,500kDa;500kDa ~1,000kDa;750kDa~20,000kDa;750kDa~15,000kDa;750kDa~12,500kDa;750kDa~10,000kDa;750kDa~7,500kDa;750kDa a~6,000kDa;750kDa~5,000kDa;750kDa~4,000kDa;750kDa~3,000kDa;750kDa~2,000kDa;750kDa~1,500kDa;1,000kDa ~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000kDa;1,000kDa~5,000 It has a molecular weight of kDa; 1,000kDa to 4,000kDa; 1,000kDa to 2,500kDa; 2,000kDa to 15,000kDa; 2,000kDa to 12,500kDa; 2,000kDa to 10,000kDa; 2,000kDa to 7,500kDa; 2,000kDa to 6,000kDa; 2,000kDa to 5,000kDa; 2,000kDa to 4,000kDa; or 2,000kDa to 3,000kDa.
[0399] In a further embodiment, the serotype 8 glycoconjugate of the present invention has a molecular weight of 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In a further embodiment, the serotype 8 glycoconjugate of the present invention has a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa or 5,000 kDa to 7,500 kDa. In a further embodiment, the serotype 8 glycoconjugate of the present invention has a molecular weight of 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 10,000 kDa or 6,000 kDa to 7,500 kDa. In a further embodiment, the serotype 8 glycoconjugate of the present invention has a molecular weight of 7,000 kDa to 20,000 kDa; 7,000 kDa to 15,000 kDa; 7,000 kDa to 10,000 kDa or 7,000 kDa to 8,000 kDa. In a further embodiment, the serotype 8 glycoconjugate of the present invention has a molecular weight of 8,000 kDa to 20,000 kDa; 8,000 kDa to 15,000 kDa; or 8,000 kDa to 10,000 kDa.
[0400] In one embodiment, the serotype 8 glycoconjugate is prepared by reductive amination.
[0401] Another way to characterize the serotype 8 glycoconjugate of the present invention is to characterize the range (degree of conjugation) of the conjugated lysine, which is the carrier protein (e.g., CRM) conjugated to the sugar. 197 This is due to the number of lysine residues in the protein.
[0402] Evidence regarding lysine modification of carrier proteins due to covalent bonding to polysaccharides is presented to those skilled in the art. This can be obtained by amino acid analysis using known, routine methods. In common embodiments, the carrier protein is covalently conjugated to a polysaccharide activated via amine bonding to one or more ε-amino groups of lysine residues on the carrier protein. In some such embodiments, the carrier protein contains 2 to 20 lysine residues covalently conjugated to the sugar. In other such embodiments, the carrier protein contains 4 to 16 or 6 to 14 lysine residues covalently conjugated to the sugar.
[0403] In preferred embodiments, the degree of conjugation of the serotype 8 glycoconjugate of the present invention is 2-20, 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15, or 10-12. In one embodiment, the degree of conjugation of the serotype 8 glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In preferred embodiments, the degree of conjugation of the serotype 8 glycoconjugate of the present invention is 4-16 or 6-14. In some such embodiments, the carrier protein is CRM 197 That is the case.
[0404] In a preferred embodiment, the carrier protein is a CRM containing 39 lysine residues. 197 This includes. In some such embodiments, CRM 197 This may include 4 to 16 or 6 to 14 of the 39 lysine residues covalently linked to the sugars. Another way to express this parameter is approximately 10% to 41% or approximately 15% to 36% CRM 197 This means that lysine is covalently linked to sugars. In another such embodiment, CRM197 This may include 2 to 20 of the 39 lysine residues covalently linked to the sugars. Another way to express this parameter is approximately 5% to 50% CRM 197 This means that lysine is covalently linked to sugars. In some such embodiments, CRM 197 It may contain approximately 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 lysine residues out of 39 covalently linked to the sugar.
[0405] The serotype 8 glycoconjugate of the present invention can also be characterized by the ratio (weight / weight) of the sugar to the carrier protein. In some embodiments, the ratio (w / w) of sugars to carrier proteins is 0.2 to 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the ratio (w / w) of sugars to carrier protein is 0.7 to 2.5. In further embodiments, the ratio (w / w) of sugars to carrier protein is 0.8 to 1.5 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, or about 1.5). In some such embodiments, the carrier protein is CRM 197 In one embodiment, the serotype 8 glycoconjugate is prepared by reductive amination.
[0406] The serotype 8 glycoconjugate and immunogenic composition of the present invention may contain free sugars present in the glycoconjugate composition, even though they are not covalently conjugated to a carrier protein. The free sugars can be non-covalently associated with the glycoconjugate (i.e., non-covalently bound, adsorbed, or captured in or together with it).
[0407] In some embodiments, the serotype 8 glycoconjugate of the present invention contains free sugars at a rate of less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% relative to the total amount of serotype 8 sugars. Preferably, the serotype 8 glycoconjugate contains less than 15% free sugars, more preferably less than 10%, and even more preferably less than 5% free sugars.
[0408] Serotype 8 glycoconjugates, their molecular size distribution (K d It can also be characterized by the following. The relative molecular size distribution of the conjugate can be determined using a size exclusion chromatography medium (CL-4B). Size exclusion chromatography (SEC) is used in a gravity-fed column to profile the molecular size distribution of the conjugate. High molecular weight molecules excluded from the pores in the medium elute more rapidly than low molecular weight molecules. The column eluate is collected using a fractionation device. The fraction is colorimetrically tested by a sugar assay. K d To determine this, the column is calibrated to identify the fraction (V0) and (K) in which the molecule is completely excluded. d =0), fraction representing maximum retention (V i ), (K d Establish a fraction (V) that meets specific sample attributes. e ) is K d =(V e -V0) / (V i According to the formula -V0, K d It is related to this.
[0409] In a preferred embodiment, at least 40% of the serotype 8 glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d In a preferred embodiment, at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 8 glycoconjugate of the present invention are present in a CL-4B column with a K level lower than or equal to 0.3. d In a preferred embodiment, at least 60% of the serotype 8 glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d In a preferred embodiment, at least 70% of the serotype 8 glycoconjugate of the present invention is present in a CL-4B column with a K value lower than or equal to 0.3. d It has.
[0410] In a preferred embodiment, 40% to 90% of serotype 8 glycoconjugates have a K value lower than or equal to 0.3 in the CL-4B column. d It has the following characteristics. In a preferred embodiment, 50% to 90% of the serotype 8 glycoconjugates have a K value lower than or equal to 0.3 in the CL-4B column. d It has the following characteristics. In a preferred embodiment, 65% to 80% of the serotype 8 glycoconjugates have a K value lower than or equal to 0.3 in the CL-4B column. d It has.
[0411] 1.4 Combinations of glycoconjugates according to the present invention In one embodiment, the immunogenic composition of the present invention comprises any of the glycoconjugates disclosed herein.
[0412] In one embodiment, the immunogenic composition of the present invention is a glycoconjugate derived from Streptococcus pneumoniae serotype 15B (such as the glycoconjugate described in Section 1.3.4 above), a glycoconjugate derived from Streptococcus pneumoniae serotype 22F (such as the glycoconjugate described in Section 1.3.2 above), a glycoconjugate derived from Streptococcus pneumoniae serotype 33F (such as the glycoconjugate described in Section 1.3.3 above), a glycoconjugate derived from Streptococcus pneumoniae serotype 12F (such as the glycoconjugate described in Section 1.3.5 above), and The glycoconjugate comprises at least one selected from the group consisting of glycoconjugates derived from Leptococcus pneumoniae serotype 10A (such as the glycoconjugates described in Section 1.3.6 above), glycoconjugates derived from Streptococcus pneumoniae serotype 11A (such as the glycoconjugates described in Section 1.3.7 above), and glycoconjugates derived from Streptococcus pneumoniae serotype 8 (such as the glycoconjugates described in Section 1.3.8 above).
[0413] In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15B, such as the glycoconjugate described in Section 1.3.4 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 22F, such as the one disclosed in Section 1.3.2 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 33F, such as the one disclosed in Section 1.3.3 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 12F, such as the one disclosed in Section 1.3.5 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 10A, such as that disclosed in Section 1.3.6 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 11A, such as that disclosed in Section 1.3.7 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 8, such as that disclosed in Section 1.3.8 above.
[0414] In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate from two Streptococcus pneumoniae serotypes selected from the group consisting of 15B and 22F, 15B and 33F, 15B and 12F, 15B and 10A, 15B and 11A, 15B and 8, 22F and 33F, 22F and 12F, 22F and 10A, 22F and 11A, 22F and 8, 33F and 12F, 33F and 10A, 33F and 11A, 33F and 8, 12F and 10A, 12F and 11A, 12F and 8, 10A and 11A, 10A and 8, and 11A and 8.
[0415] In one embodiment, the immunogenic composition of the present invention comprises three serotypes of Streptococcus pneumoniae described below: 15B, 22F, and 33F, 15B, 22F, and 12F, 15B, 22F, and 10A, 15B, 22F, and 11A, 15B and 22F and 8, 15B, 33F, and 12F, 15B, 33F, and 10A, 15B, 33F, and 11A, 15B and 33F and 8, 15B, 12F, and 10A, 15B, 12F, and 11A, 15B and 12F and 8, 15B, 10A, and 11A, 15B and 10A and 8, 15B, 11A, and 8, 22F, 33F, and 12F, 22F, 33F, and 10A, 22F, 33F, and 11A, 22F, 33F, and 8, 22F, 12F, and 10A, 22F, 12F, and 11A, 22F, 12F, and 8 22F and 10A and 11A, 22F and 10A and 8, 22F, 11A, and 8, 33F, 12F, and 10A, 33F, 12F, and 11A, 33F, 12F, and 8 33F and 10A and 11A, 33F and 10A and 8, 33F and 11A and 8, 12F, 10A, and 11A, 12F and 10A and 8, 12F and 11A and 8 or It contains at least one glycoconjugate from among 10A, 11A, and 8.
[0416] In one embodiment, the immunogenic compositions of the present invention each contain four of the following Streptococcus pneumoniae serotypes: 15B, 22F, 33F, and 12F, 15B, 22F, 33F, and 10A, 15B, 22F, 33F, and 11A, 15B, 22F, 33F, and 8, 15B, 22F, 12F, and 10A, 15B, 22F, 12F, and 11A, 15B and 22F and 12F and 8, 15B and 22F and 10A and 11A, 15B and 22F and 10A and 8, 15B and 22F and 11A and 8, 15B, 33F, 12F, and 10A, 15B, 33F, 12F, and 11A, 15B and 33F and 12F and 8, 15B and 33F and 10A and 11A, 15B and 33F and 10A and 8, 15B and 33F and 11A and 8, 15B and 12F and 10A and 11A, 15B and 12F and 10A and 8, 15B, 12F, 11A, and 8, 15B, 10A, 11A, and 8, 22F, 33F, 12F, and 10A, 22F, 33F, 12F, and 11A, 22F, 33F, 12F, and 8 22F and 33F and 10A and 11A, 22F, 33F, 10A, and 8, 22F, 33F, 11A, and 8, 22F and 12F and 10A and 11A, 22F, 12F, 10A, and 8, 22F, 12F, 11A, and 8, 22F and 10A and 11A and 8, 33F, 12F, 10A, and 11A, 33F, 12F, 10A, and 8, 33F, 12F, 11A, and 8, 33F and 10A and 11A and 8 or 12F, 10A, 11A, and 8 It contains at least one of the following glycoconjugates.
[0417] In one embodiment, the immunogenic composition of the present invention comprises five serotypes of Streptococcus pneumoniae, as described below: 15B, 22F, 33F, 12F, and 10A, 15B, 22F, 33F, 12F, and 11A, 15B, 22F, 33F, 12F, and 8, 15B, 22F, 33F, 10A, and 11A, 15B, 22F, 33F, 10A, and 8, 15B, 22F, 33F, 11A, and 8, 15B and 22F and 12F and 10A and 11A, 15B and 22F and 12F and 10A and 8, 15B and 22F and 12F and 11A and 8, 15B and 22F and 10A and 11A and 8, 15B, 33F, 12F, 10A, and 11A, 15B and 33F and 12F and 10A and 8, 15B and 33F and 12F and 11A and 8, 15B and 33F and 10A and 11A and 8, 15B and 12F and 10A and 11A and 8, 22F, 33F, 12F, 10A, and 11A, 22F, 33F, 12F, 10A, and 8, 22F, 33F, 12F, 11A, and 8, 22F and 33F and 10A and 11A and 8, 22F and 12F and 10A and 11A and 8 or 33F, 12F, 10A, 11A, and 8 It contains at least one of the following glycoconjugates.
[0418] In one embodiment, the immunogenic compositions of the present invention each contain six of the following Streptococcus pneumoniae serotypes: 15B, 22F, 33F, 12F, 10A, and 11A, 15B, 22F, 33F, 12F, 10A, and 8, 15B, 22F, 33F, 12F, 11A, and 8, 15B, 22F, 33F, 10A, 11A, and 8, 15B and 22F and 12F and 10A and 11A and 8, 15B and 33F and 12F and 10A and 11A and 8 or 22F, 33F, 12F, 10A, 11A, and 8 It contains at least one of the following glycoconjugates.
[0419] In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate from the following seven Streptococcus pneumoniae serotypes: 15B, 22F, 33F, 12F, 10A, 11A, and 8.
[0420] In one embodiment, a glycoconjugate derived from any of the immunogenic compositions defined in this section, specifically from Streptococcus pneumoniae serotypes 15B, 22F, 33F, 12F, 10A, 11A and / or 8, is one of those disclosed in sections 1.3.2 to 1.3.8 above.
[0421] In one embodiment, any of the immunogenic compositions described above further comprises a glycoconjugate derived from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F (such as the glycoconjugate described in Section 1.3.1 above).
[0422] In one embodiment, any of the immunogenic compositions described above further comprises a glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 5, and 7F (such as the glycoconjugate described in Section 1.3.1 above).
[0423] In one embodiment, any of the immunogenic compositions described above further comprises a glycoconjugate derived from Streptococcus pneumoniae serotypes 6A and 19A (such as the glycoconjugate described in Section 1.3.1 above).
[0424] In one embodiment, any of the immunogenic compositions described above further comprises a glycoconjugate derived from Streptococcus pneumoniae serotype 3 (such as the glycoconjugate described in Section 1.3.1 above).
[0425] Preferably, all glycoconjugates of the immunogenic composition described above are individually conjugated to a carrier protein.
[0426] In any one embodiment of the immunogenic composition described above, the glycoconjugate derived from Streptococcus pneumoniae serotype 22F is CRM 197 It is conjugated to. In any one embodiment of the immunogenic composition described above, the glycoconjugate derived from Streptococcus pneumoniae serotype 33F is CRM 197 It is conjugated to. In any one embodiment of the above immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 15B is CRM 197 It is conjugated to. In any one embodiment of the above immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F is CRM 197 It is conjugated to. In any one embodiment of the above immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 10A is CRM 197It is conjugated to. In any one embodiment of the immunogenic composition described above, the glycoconjugate derived from Streptococcus pneumoniae serotype 11A is CRM 197 It is conjugated to. In any one embodiment of the above immunogenic compositions, glycocondyl derived from Streptococcus pneumoniae serotype 8 Shutgate is CRM 197 It is conjugated to. In any one embodiment of the immunogenic composition described above, glycoconjugates derived from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F are CRM 197 It is conjugated to. In any one embodiment of the immunogenic composition described above, glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 5, and 7F are CRM 197 It is conjugated to. In any one embodiment of the above immunogenic composition, glycoconjugates derived from Streptococcus pneumoniae serotypes 6A and 19A are CRM 197 It is conjugated to. In any one embodiment of the immunogenic composition described above, the glycoconjugate derived from Streptococcus pneumoniae serotype 3 is CRM 197 It is conjugated to.
[0427] In one embodiment, all of the glycoconjugates of any of the immunogenic compositions are CRM 197 They are individually conjugated.
[0428] In one embodiment, glycoconjugates derived from any of the above immunogenic compositions of Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are individually conjugated to PD.
[0429] In one embodiment, a glycoconjugate derived from Streptococcus pneumoniae serotype 18C of any of the above immunogenic compositions is conjugated to TT.
[0430] In one embodiment, a glycoconjugate derived from Streptococcus pneumoniae serotype 19F of any of the above immunogenic compositions is conjugated to DT.
[0431] In one embodiment, glycoconjugates derived from any of the above immunogenic compositions of Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are individually conjugated to PD, a glycoconjugate derived from Streptococcus pneumoniae serotype 18C is conjugated to TT, and a glycoconjugate derived from Streptococcus pneumoniae serotype 19F is conjugated to DT.
[0432] In one embodiment, the immunogenic composition comprises 8 to 20 different serotypes of Streptococcus pneumoniae. In another embodiment, the immunogenic composition comprises glycoconjugates derived from 12, 13, 14, 15, 16, 17, 18, 19, or 20 different serotypes.
[0433] In one embodiment, the immunogenic composition comprises glycoconjugates derived from 16 or 20 different serotypes.
[0434] In one embodiment, the immunogenic composition is an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 14, 15, 16, 17, 18, or 19-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 16-valent Streptococcus pneumoniae conjugate composition. One embodiment In this case, the immunogenic composition is a 19-valent Streptococcus pneumoniae conjugate composition.
[0435] 1. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15B, such as the glycoconjugate described in Section 1.3.4 above.
[0436] 2. In another embodiment, the immunogenic composition of the present invention comprises, in addition to point 1 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 22F, such as those disclosed in Section 1.3.2 above.
[0437] 3. In another embodiment, the immunogenic composition of the present invention comprises, in addition to point 1 or 2 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 33F, such as those disclosed in Section 1.3.3 above.
[0438] 4. In another embodiment, the immunogenic composition of the present invention comprises, in addition to points 1, 2, or 3 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 12F, such as those disclosed in Section 1.3.5 above.
[0439] 5. In another embodiment, the immunogenic composition of the present invention comprises, in addition to points 1, 2, 3, or 4 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 10A, such as those disclosed in Section 1.3.6 above.
[0440] 6. In another embodiment, the immunogenic composition of the present invention comprises, in addition to points 1, 2, 3, 4, or 5 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 11A, such as those disclosed in Section 1.3.7 above.
[0441] 7. In another embodiment, the immunogenic composition of the present invention comprises, in addition to points 1, 2, 3, 4, 5, or 6 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 8, such as those disclosed in Section 1.3.8 above.
[0442] 8. In another embodiment, the immunogenic composition of the present invention comprises, in addition to points 1, 2, 3, 4, 5, 6, or 7 above, a glycoconjugate derived from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, such as the glycoconjugate described in Section 1.3.1 above.
[0443] 9. In another embodiment, the immunogenic composition of the present invention comprises, in addition to points 1, 2, 3, 4, 5, 6, 7, or 8 above, a glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 5, and 7F, such as the glycoconjugate described in Section 1.3.1 above.
[0444] 10. In another embodiment, the immunogenic composition of the present invention is, in addition to points 1, 2, 3, 4, 5, 6, 7, 8 or 9 above, the glyco described in Section 1.3.1 above. Conjugates include glycoconjugates derived from Streptococcus pneumoniae serotypes 6A and 19A.
[0445] 11. In another embodiment, the immunogenic composition of the present invention comprises, in addition to points 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 above, a glycoconjugate derived from Streptococcus pneumoniae serotype 3, such as the glycoconjugate described in Section 1.3.1 above.
[0446] In one embodiment, the immunogenic composition of the present invention comprises a glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.
[0447] In one embodiment, the immunogenic composition of the present invention comprises glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.
[0448] In one embodiment, the immunogenic composition of the present invention comprises conjugated Streptococcus pneumoniae sugars derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.
[0449] In one embodiment, the immunogenic composition of the present invention comprises conjugated Streptococcus pneumoniae sugars derived from serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.
[0450] In one embodiment, the glycoconjugate of the immunogenic composition of the present invention consists of glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, the glycoconjugate of the immunogenic composition of the present invention comprises glycoconjugates derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, the glycoconjugate of the immunogenic composition of the present invention comprises glycoconjugates derived from 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.
[0451] Preferably, all glycoconjugates of the immunogenic composition of the present invention (for example, any of points 1 to 11 above) are individually conjugated to a carrier protein.
[0452] In one embodiment, a glycoconjugate derived from any of the Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of points 8 to 11 above is individually conjugated to PD.
[0453] In one embodiment, a glycoconjugate derived from any of the above points 8-11 of Streptococcus pneumoniae serotype 18C is conjugated to TT.
[0454] In one embodiment, a glycoconjugate derived from any of the above points 8-11 of Streptococcus pneumoniae serotype 19F is conjugated to DT.
[0455] In any one embodiment of points 8 to 11 above, glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are individually conjugated to PD, glycoconjugates derived from Streptococcus pneumoniae serotype 18C are conjugated to TT, and glycoconjugates derived from Streptococcus pneumoniae serotype 19F are conjugated to DT.
[0456] In any one embodiment of points 1 to 11 above, the glycoconjugate derived from Streptococcus pneumoniae serotype 22F is CRM 197 It is conjugated to. In any one embodiment of points 2 to 11 above, the glycoconjugate derived from Streptococcus pneumoniae serotype 33F is CRM 197 It is conjugated to. In any one embodiment of points 3 to 11 above, the glycoconjugate derived from Streptococcus pneumoniae serotype 15B is CRM 197 It is conjugated to. In any one embodiment of points 4 to 11 above, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F is CRM 197 It is conjugated to. In any one embodiment of points 5 to 11 above, the glycoconjugate derived from Streptococcus pneumoniae serotype 10A is CRM 197It is conjugated to. In any one embodiment of points 6 to 11 above, the glycoconjugate derived from Streptococcus pneumoniae serotype 11A is CRM 197 It is conjugated to. In any one embodiment of points 7 to 11 above, the glycoconjugate derived from Streptococcus pneumoniae serotype 8 is CRM 197 It is conjugated to. In any one embodiment of points 8 to 11 above, glycoconjugates derived from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F are CRM 197 It is conjugated to. In any one embodiment of points 9 to 11 above, glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 5 and 7F are CRM 197 It is conjugated to. In any one embodiment of points 10 to 11 above, glycoconjugates derived from Streptococcus pneumoniae serotypes 6A and 19A are CRM 197 It is conjugated to. In one embodiment of point 11 above, the glycoconjugate derived from Streptococcus pneumoniae serotype 3 is CRM 197 It is conjugated to.
[0457] In one embodiment, the glycoconjugate of the immunogenic composition described in points 1 to 11 above is CRM 197 They are individually conjugated.
[0458] In one embodiment, the immunogenic composition of the present invention is Streptococcus pneumoniae. It contains 12 to 20 different serotypes of S. pneumoniae. In one embodiment, the immunogenic composition of the present invention contains glycoconjugates derived from 12, 13, 14, 15, 16, 17, 18, 19, or 20 different serotypes. In one embodiment, the immunogenic composition of the present invention contains glycoconjugates derived from 16 or 20 different serotypes.
[0459] In one embodiment, the immunogenic compositions described in points 1 to 11 above are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent pneumococcal conjugate compositions. In one embodiment, the immunogenic compositions described in points 1 to 11 above are 15, 16, 17, 18, or 19-valent pneumococcal conjugate compositions. In one embodiment, the immunogenic compositions described in points 1 to 11 above are 16-valent pneumococcal conjugate compositions. In one embodiment, the immunogenic compositions described in points 1 to 11 above are 19-valent pneumococcal conjugate compositions.
[0460] Following the conjugation of the capsular polysaccharide to the carrier protein, the glycoconjugate is purified by various techniques (enriched in terms of the amount of polysaccharide-protein conjugate). These techniques include concentration / dialysis filtration, sedimentation / elution, column chromatography, and deep filtration (see, for example, U.S. Patent Application Publication No. 2007 / 0184072 or WO2008 / 079653). After purifying the individual glycoconjugates, they are mixed to formulate the immunogenic composition of the present invention.
[0461] 1.5 Further combinations of glycoconjugates of the present invention In one embodiment, any of the immunogenic compositions defined in Section 1.4 above further comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 9V.
[0462] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above further comprises a glycoconjugate of at least one of two Streptococcus pneumoniae serotypes selected from the group consisting of 9V and 4, 9V and 6B, 9V and 14, 9V and 18C, 9V and 19F, and 9V and 23F.
[0463] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above further comprises at least one glycoconjugate from the following seven Streptococcus pneumoniae serotypes: 9V, 4, 6B, 14, 18C, 19F, and 23F.
[0464] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above is each one of the following eight Streptococcus pneumoniae serotypes: 9V and 1, 4, 6B and 14, 18C and 19F and 23F, 9V and 4, 5, and 6B and 14, 18C and 19F and 23F, or 9V, 4V, 6B, 7F, 14V, 18C, 19F, and 23F It further includes at least one of the glycoconjugates.
[0465] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above further comprises at least one glycoconjugate from the following 10 Streptococcus pneumoniae serotypes: 9V, 1, 5, 4, 6B, 7F, 14, 18C, 19F, and 23F.
[0466] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above is each one of the following 11 Streptococcus pneumoniae serotypes: 9V and 1, 4, 5, 6A and 6B and 7F and 14, 18C and 19F and 23F or 9V and 1, 4, 5, 6B, 7F, 14, 18C, 19A, 19F, and 23F It further includes at least one of the glycoconjugates.
[0467] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above further comprises at least one glycoconjugate from the following 12 Streptococcus pneumoniae serotypes: 9V, 1, 4, 5, 6A, 6B, 7F, 14, 18C, 19A, 19F, and 23F.
[0468] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above further comprises at least one glycoconjugate from the following 13 Streptococcus pneumoniae serotypes: 9V, 1, 3, 4, 5, 6A, 6B, 7F, 14, 18C, 19A, 19F, and 23F.
[0469] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above further comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 2.
[0470] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above further comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 17F.
[0471] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above further comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 20.
[0472] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above further comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15C.
[0473] In one embodiment, any of the immunogenic compositions defined in Section 1.4 above further comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 9N.
[0474] Preferably, all of the glycoconjugates of the immunogenic composition are individually conjugated to the carrier protein.
[0475] In any one embodiment of the above immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 9V is CRM 197 It is conjugated to. In any one embodiment of the above immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotypes 4, 6B, 14, 18C, 19F and 23F is CRM 197 It is conjugated to. In any one embodiment of the above immunogenic composition, Streptococcus pneumoniae serotype 1, Glycoconjugates derived from 5 and 7F are used in CRM 197 It is conjugated to. In any one embodiment of the above immunogenic composition, glycoconjugates derived from Streptococcus pneumoniae serotypes 6A and 19A are CRM 197It is conjugated to. In any one embodiment of the above immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 3 is CRM 197 It is conjugated to CRM. In any one embodiment of the above immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 2 is CRM 197 It is conjugated to. In any one embodiment of the above immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 17F is CRM 197 It is conjugated to. In any one embodiment of the above immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 20 is CRM 197 It is conjugated to. In any one embodiment of the above immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 15C is CRM 197 It is conjugated to. In any one embodiment of the above immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 9N is CRM 197 It is conjugated to.
[0476] In one embodiment, all of the glycoconjugates of the immunogenic composition are CRM 197 They are individually conjugated.
[0477] In another embodiment, a glycoconjugate derived from any of the above immunogenic compositions of Streptococcus pneumoniae serotype 9V is individually conjugated to PD.
[0478] In one embodiment, glycoconjugates derived from any of the above immunogenic compositions of Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are individually conjugated to PD.
[0479] In one embodiment, a glycoconjugate derived from any of the above immunogenic compositions of Streptococcus pneumoniae serotype 18C is conjugated to TT.
[0480] In one embodiment, a glycoconjugate derived from any of the above immunogenic compositions of Streptococcus pneumoniae serotype 19F is conjugated to DT.
[0481] In one embodiment, glycoconjugates derived from any of the above immunogenic compositions of Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are individually conjugated to PD, a glycoconjugate derived from Streptococcus pneumoniae serotype 18C is conjugated to TT, and a glycoconjugate derived from Streptococcus pneumoniae serotype 19F is conjugated to DT.
[0482] In one embodiment, the immunogenic composition comprises 7 to 25 different serotypes of Streptococcus pneumoniae. The immunogenic composition comprises glycoconjugates derived from 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 different serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates derived from 16 or 20 different serotypes. In one embodiment, the immunogenic composition is an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 14, 15, 16, 17, 18, or 19-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 16-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 19-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 20-valent Streptococcus pneumoniae conjugate composition.
[0483] Following the conjugation of the capsular polysaccharide to the carrier protein, the glycoconjugate is purified by various techniques (enriched in terms of the amount of polysaccharide-protein conjugate). These techniques include concentration / dialysis filtration, sedimentation / elution, column chromatography, and deep filtration (see, for example, U.S. Patent Application Publication No. 2007 / 0184072 or WO2008 / 079653). After purifying the individual glycoconjugates, they are mixed to formulate the immunogenic composition of the present invention.
[0484] 1.6 Specific combinations of glycoconjugates of the present invention In one embodiment, either of the immunogenic compositions defined in Section 1.4 or 1.5 above does not contain capsular sugars derived from Streptococcus pneumoniae serotype 9N.
[0485] In one embodiment, either of the immunogenic compositions defined in Section 1.4 or 1.5 above does not contain capsular sugars derived from Streptococcus pneumoniae serotype 9A.
[0486] In one embodiment, either of the immunogenic compositions defined in Section 1.4 or 1.5 above does not contain capsular sugars derived from Streptococcus pneumoniae serotype 9L.
[0487] In one embodiment, either of the immunogenic compositions defined in Section 1.4 or 1.5 above does not contain capsular sugars derived from Streptococcus pneumoniae serotypes 9N and 9A.
[0488] In one embodiment, either of the immunogenic compositions defined in Section 1.4 or 1.5 above does not contain capsular sugars derived from Streptococcus pneumoniae serotypes 9N and 9L.
[0489] In one embodiment, either of the immunogenic compositions defined in Section 1.4 or 1.5 above does not contain capsular sugars derived from Streptococcus pneumoniae serotypes 9A and 9L.
[0490] In one embodiment, any of the immunogenic compositions defined in Section 1.4 or 1.5 above does not contain capsular sugars derived from Streptococcus pneumoniae serotypes 9N, 9A, and 9L.
[0491] 2. Dosage of immunogenic composition The amount of glycoconjugate in each dose was significantly greater in typical vaccinated individuals. The amount selected is one that induces an immunoprotective response without harmful side effects. Such an amount varies depending on the specific immunogen used and the way it is presented.
[0492] 2.1 Amount of glycoconjugate The amount of a specific glycoconjugate in an immunogenic composition can be calculated based on the total polysaccharides (conjugated and unconjugated) of the conjugate. For example, a glycoconjugate containing 20% free polysaccharides has approximately 80 μg of conjugated polysaccharides and approximately 20 μg of unconjugated polysaccharides in a 100 μg polysaccharide dose. The amount of glycoconjugate may vary depending on the serotype of Streptococcus pneumoniae. The concentration of sugars can be determined by a uronic acid assay.
[0493] The "immunogenic amounts" of various polysaccharide components in the immunogenic composition may differ, and each may contain any specific polysaccharide antigen in amounts of approximately 1 μg, 2 μg, 3 μg, 4 μg, 5 μg, 6 μg, 7 μg, 8 μg, 9 μg, 10 μg, 15 μg, 20 μg, 30 μg, 40 μg, 50 μg, 60 μg, 70 μg, 80 μg, 90 μg, or 100 μg.
[0494] Generally, each dose contains 0.1 μg to 100 μg of polysaccharide for a given serotype, particularly 0.5 μg to 20 μg, more particularly 1.0 μg to 10 μg, and even more preferably 2.0 μg to 5.0 μg. Any integer within any of the above ranges is intended as an embodiment of the present disclosure.
[0495] In one embodiment, each dose contains approximately 1.0 μg, 1.2 μg, 1.4 μg, 1.6 μg, 1.8 μg, 2.0 μg, 2.2 μg, 2.4 μg, 2.6 μg, 2.8 μg, 3.0 μg, 3.2 μg, 3.4 μg, 3.6 μg, 3.8 μg, 4.0 μg, 4.2 μg, 4.4 μg, 4.6 μg, 4.8 μg, 5.0 μg, 5.2 μg, 5.4 μg, 5.6 μg, 5.8 μg, or 6.0 μg of polysaccharide for each specific glycoconjugate.
[0496] In one embodiment, each dose is approximately 1.1 μg for a glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and / or 33F. It contains approximately 1.2 μg, 1.3 μg, 1.4 μg, 1.5 μg, 1.6 μg, 1.7 μg, 1.8 μg, 1.9 μg, 2.0 μg, 2.1 μg, 2.2 μg, 2.3 μg, 2.4 μg, 2.5 μg, 2.6 μg, 2.7 μg, 2.8 μg, 2.9 μg, or 3.0 μg of polysaccharides.
[0497] In one embodiment, each dose contains approximately 1.1 μg, approximately 1.2 μg, approximately 1.3 μg, approximately 1.4 μg, approximately 1.5 μg, approximately 1.6 μg, approximately 1.7 μg, approximately 1.8 μg, approximately 1.9 μg, approximately 2.0 μg, approximately 2.1 μg, approximately 2.2 μg, approximately 2.3 μg, approximately 2.4 μg, approximately 2.5 μg, approximately 2.6 μg, approximately 2.7 μg, approximately 2.8 μg, approximately 2.9 μg, or approximately 3.0 μg of polysaccharides for glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and / or 33F.
[0498] In one embodiment, each dose is approximately 2.0 μg, 2.2 μg, 2.4 μg, 2.6 μg, 2.8 μg, 3.0 μg, and 3.2 μg of glycoconjugate derived from Streptococcus pneumoniae serotype 6B. g contains approximately 3.4 μg, 3.6 μg, 3.8 μg, 4.0 μg, 4.2 μg, 4.4 μg, 4.6 μg, 4.8 μg, 5.0 μg, 5.2 μg, 5.4 μg, 5.6 μg, 5.8 μg, or 6.0 μg of polysaccharides.
[0499] In one embodiment, each dose contains approximately 1.5 μg to 3.0 μg of polysaccharide for each glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and approximately 3.0 μg to 6.0 μg of polysaccharide for the glycoconjugate derived from Streptococcus pneumoniae serotype 6B.
[0500] In one embodiment, each dose contains approximately 2.0 μg to 2.5 μg of polysaccharide for each glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and approximately 4.0 μg to 4.8 μg of polysaccharide for the glycoconjugate derived from Streptococcus pneumoniae serotype 6B.
[0501] In one embodiment, each dose contains approximately 2.2 μg of polysaccharide derived from the respective glycoconjugates from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and approximately 4.4 μg of polysaccharide derived from the glycoconjugate from Streptococcus pneumoniae serotype 6B.
[0502] In one embodiment, each dose contains approximately 1.5 μg to 3.0 μg of polysaccharide for each glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and approximately 3 μg to 6 μg of polysaccharide for the glycoconjugate derived from Streptococcus pneumoniae serotype 6B.
[0503] In one embodiment, each dose contains approximately 2.0 μg to 2.5 μg of polysaccharide for each glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and approximately 4.0 μg to 4.8 μg of polysaccharide for the glycoconjugate derived from Streptococcus pneumoniae serotype 6B.
[0504] In one embodiment, each dose contains approximately 2.2 μg of polysaccharide derived from the respective glycoconjugates from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, as well as approximately 4.4 μg of polysaccharide derived from the glycoconjugate from Streptococcus pneumoniae serotype 6B.
[0505] In one embodiment, each dose contains approximately 1.5 μg to approximately 3.0 μg of polysaccharide for each glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, as well as Streptococcus pneumoniae. The glycoconjugate derived from Leptococcus pneumoniae serotype 6B contains approximately 3.0 μg to 6.0 μg of polysaccharide.
[0506] In one embodiment, each dose contains approximately 2.0 μg to 2.5 μg of polysaccharide for each glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and approximately 4.0 μg to 4.8 μg of polysaccharide for the glycoconjugate derived from Streptococcus pneumoniae serotype 6B.
[0507] In one embodiment, each dose contains approximately 2.2 μg of polysaccharide derived from the respective glycoconjugates from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, as well as approximately 4.4 μg of polysaccharide derived from the glycoconjugate from Streptococcus pneumoniae serotype 6B.
[0508] In one embodiment, each dose contains approximately 1.5 μg to approximately 3.0 μg of polysaccharide for each glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and approximately 3.0 μg to approximately 6.0 μg of polysaccharide for the glycoconjugate derived from Streptococcus pneumoniae serotype 6B.
[0509] In one embodiment, each dose contains approximately 2.0 μg to 2.5 μg of polysaccharide for each glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and approximately 4.0 μg to 4.8 μg of polysaccharide for the glycoconjugate derived from Streptococcus pneumoniae serotype 6B.
[0510] In one embodiment, each dose contains approximately 2.2 μg of polysaccharide derived from the respective glycoconjugates from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, as well as approximately 4.4 μg of polysaccharide derived from the glycoconjugate from Streptococcus pneumoniae serotype 6B.
[0511] 2.2 Amount of carrier Generally, each dose contains 10 μg to 150 μg of carrier protein, particularly 15 μg to 100 μg of carrier protein, more particularly 25 μg to 75 μg of carrier protein, and even more particularly 40 μg to 60 μg of carrier protein. In one embodiment, the carrier protein is CRM 197 That is the case.
[0512] In one embodiment, each dose is approximately 25 μg, 26 μg, 27 μg, 28 μg, 29 μg, 30 μg, 31 μg, 32 μg, 33 μg, 34 μg, 35 μg, 36 μg, 37 μg, 38 μg, 39 μg, 40 μg, 41 μg, 42 μg, 43 μg, 44 μg, 45 μg, 46 μg, 47 μg, 48 μg, 49 μg, 50 μg, 51 μg, 52 μg, 53 μg, 54 μg, 55 μg, 56 μg, 57 μg, 58 μg, 59 μg, 60 μg, 61 μg, The mixture contains approximately 62 μg, 63 μg, 64 μg, 65 μg, 66 μg, 67 μg, 68 μg, 69 μg, 70 μg, 71 μg, 72 μg, 73 μg, 74 μg, or 75 μg of carrier protein. In one embodiment, the carrier protein is CRM 197 That is the case.
[0513] 3. Further antigens The immunogenic compositions of the present invention comprise Streptococcus pneumoniae glycoconjugates. They may further comprise antigens derived from other pathogens, particularly bacteria and / or viruses. Preferred further antigens are selected from diphtheria toxoid (D), tetanus toxoid (T), pertussis antigen (P), typically acellular (Pa), hepatitis B virus (HBV) surface antigen (HBsAg), hepatitis A virus (HAV) antigen, conjugated Haemophilus influenzae type b capsular glycoconjugate (Hib), and inactivated poliovirus vaccine (IPV).
[0514] In one embodiment, the immunogenic composition of the present invention comprises DT-Pa. In one embodiment, the immunogenic composition of the present invention comprises DT-Pa-Hib, DT-Pa-IPV, or DT-Pa-HBsAg. In one embodiment, the immunogenic composition of the present invention comprises DT-Pa-HBsAg-IPV or DT-Pa-HBsAg-Hib. In one embodiment, the immunogenic composition of the present invention comprises DT-Pa-HBsAg-IPV-Hib.
[0515] Pertussis antigen: Bordetella pertussis causes pertussis. Pertussis antigens in vaccines can be cellular (whole cells, in the form of inactivated Bordetella pertussis (B. pertussis) cells) or acellular. The preparation of cellular pertussis antigens is well documented (for example, it can be obtained by thermal inactivation of phase I cultures of Bordetella pertussis (B. pertussis)). However, the present invention preferably uses acellular antigens. When using acellular antigens, it is preferable to use one, two, or (preferably) three of the following antigens: (1) detoxified pertussis toxin (pertussis toxoid, or PT); (2) fibrous hemagglutinin (FHA); (3) pertactin (also known as 69-kilodalton outer membrane protein). FHA and pertactin can be treated with formaldehyde before use according to the present invention. PT is preferably detoxified by treatment with formaldehyde and / or glutaraldehyde. Cellular pertussis antigen is preferably adsorbed onto one or more aluminum salt adjuvants. Alternatively, they may be added in an unadsorbed state. If pertactin is added, it is preferable that it is already adsorbed onto the aluminum hydroxide adjuvant. PT and FHA can be adsorbed onto the aluminum hydroxide adjuvant or aluminum phosphate. Adsorption of all of PT, FHA, and pertactin onto aluminum hydroxide is most preferable.
[0516] Inactivated Poliovirus Vaccine: Poliovirus causes acute poliomyelitis. Rather than using an oral poliovirus vaccine, a preferred embodiment of the present invention uses IPV. Before administration to the patient, the poliovirus needs to be inactivated, which can be achieved by treatment with formaldehyde. Acute poliomyelitis can be caused by one of three types of poliovirus. The three types are similar and cause the same symptoms, but they are antigenically different, and infection with one type does not protect against infection with the others. Therefore, it is preferable in the present invention to use three poliovirus antigens: poliovirus type 1 (e.g., Mahoney strain), poliovirus type 2 (e.g., MEF-1 strain), and poliovirus type 3 (e.g., Saukett strain). These viruses are preferably grown individually, purified, inactivated, and then mixed together with the present invention. Obtain a bulk trivalent mixture for use.
[0517] Diphtheria Toxoid: Corynebacterium diphtheriae causes diphtheria. Diphtheria toxin can be treated (e.g., with formalin or formaldehyde) to remove toxicity while retaining the ability to induce specific antitoxin antibodies after injection. These diphtheria toxoids are used in diphtheria vaccines. Preferred diphtheria toxoids are those prepared by formaldehyde treatment. Diphtheria toxoids can be obtained by growing Corynebacterium diphtheriae in growth medium, then treating with formaldehyde, ultrafiltration, and precipitation. The toxoidized material can then be treated by a process including sterile filtration and / or dialysis. The diphtheria toxoid is preferably adsorbed onto an aluminum hydroxide adjuvant.
[0518] Tetanus toxoid: Clostridium tetani causes tetanus. A protective toxoid can be obtained by treating the tetanus toxin. The toxoid is used in tetanus vaccines. A preferred tetanus toxoid is one prepared by formaldehyde treatment. Tetanus toxoid can be obtained by growing Clostridium tetani in a growth medium, then treating with formaldehyde, ultrafiltration, and precipitation. The material can then be treated by a process including sterile filtration and / or dialysis.
[0519] Hepatitis A virus antigen: Hepatitis A virus (HAV) is one of the known factors that cause viral hepatitis. Preferred HAV components are based on inactivated virus, which can be achieved by formalin treatment.
[0520] Hepatitis B virus (HBV) is one of the known causes of viral hepatitis. The main component of the capsid is a protein known as the HBV surface antigen, or more commonly, HBsAg, which is a polypeptide of 226 amino acids, typically with a molecular weight of about 24 kDa. All existing hepatitis B vaccines contain HBsAg, and when this antigen is administered to a healthy vaccinated person, it stimulates the production of anti-HBsAg antibodies that protect against HBV infection.
[0521] For vaccine production, HBsAg has been produced in two ways: purification of particulate antigen from the plasma of chronic hepatitis B carriers or expression of the protein by recombinant DNA method (e.g., recombinant expression in yeast cells). Unlike natural HBsAg (i.e., as a plasma purified product), HBsAg expressed by yeast is generally not glycosylated, which is the most preferred form of HBsAg for use in the present invention.
[0522] Conjugated Haemophilus influenzae type b antigen: Haemophilus influenzae type b (Hib) causes bacterial meningitis. Hib vaccines are typically based on capsular sugar antigens, and their preparation is well documented. Conjugating Hib sugars to carrier proteins can enhance their immunogenicity, particularly in children. Typical carrier proteins include tetanus toxoid, diphtheria toxoid, and CRM. 197 The conjugate is an outer membrane protein complex derived from Haemophilus influenzae (H. influenzae) protein D and serogroup B serogroup meningococcus. The sugar portion of the conjugate may contain full-length polyribosylribitol phosphate (PRP) and / or fragments of full-length PRP prepared from Hib bacteria. The Hib conjugate may or may not be adsorbed onto an aluminum salt adjuvant.
[0523] In one embodiment, the immunogenic composition of the present invention further comprises conjugated Neisseria meningitidis serogroup Y capsular saccharide (MenY) and / or conjugated Neisseria meningitidis serogroup C capsular saccharide (MenC).
[0524] In one embodiment, the immunogenic composition of the present invention further comprises conjugated Neisseria meningitidis serogroup A capsular saccharide (MenA), conjugated Neisseria meningitidis serogroup W135 capsular saccharide (MenW135), conjugated Neisseria meningitidis serogroup Y capsular saccharide (MenY), and / or conjugated Neisseria meningitidis serogroup C capsular saccharide (MenC).
[0525] In one embodiment, the immunogenic composition of the present invention further comprises conjugated Neisseria meningitidis serogroup W135 capsular saccharide (MenW135), conjugated Neisseria meningitidis serogroup Y capsular saccharide (MenY), and / or conjugated Neisseria meningitidis serogroup C capsular saccharide (MenC).
[0526] 4. Adjuvants In some embodiments, the immunogenic compositions disclosed herein may further comprise at least one, two, or three adjuvants. The term “adjuvant” refers to a compound or mixture that enhances the immune response to an antigen. The antigen may have potent characteristics of acting primarily as a delivery system, primarily as an immunomodulator, or both. Suitable adjuvants include those suitable for use in mammals, including humans.
[0527] Known suitable delivery-type adjuvants that can be used in humans include, but are not limited to, alum (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions such as MF59 (4.3% w / v squalene, 0.5% w / v polysorbate 80 (Tween 80), 0.5% w / v sorbitan trioleate (Span 85)), water-in-oil emulsions such as montanide, and poly(D,L-lactide-co-glycolide) (PLG) microparticles or nanoparticles.
[0528] In one embodiment, the immunogenic composition disclosed herein comprises an aluminum salt (alum) (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide) as an adjuvant. In a preferred embodiment, the immunogenic composition disclosed herein comprises aluminum phosphate or aluminum hydroxide as an adjuvant. In one embodiment, the immunogenic composition disclosed herein comprises 0.1 mg / mL to 1 mg / mL or 0.2 mg / mL to 0.3 mg / mL of elemental aluminum in the form of aluminum phosphate. In one embodiment, the immunogenic composition disclosed herein comprises about 0.25 mg / mL of elemental aluminum in the form of aluminum phosphate.
[0529] Examples of known and suitable immunomodulatory adjuvants that can be used in humans include, but are not limited to, saponin extracts derived from the bark of the Aquilla tree (QS21, QuilA), MPL (monophosphoryl lipid A), and 3DMPL (3 Examples include TLR4 agonists such as -O-deacylated MPL or GLA-AQ, LT / CT variants, various interleukins (e.g., IL-2, IL-12), or cytokines such as GM-CSF, among others.
[0530] Known and preferred immunomodulatory adjuvants that feature both delivery and immunomodulation and can be used in humans include, but are not limited to, ISCOMS (see, for example, Sjolander et al. (1998) J. Leukocyte Biol. 64:713; see WO90 / 03184, WO96 / 11711, WO00 / 48630, WO98 / 36772, WO00 / 41720, WO2006 / 134423 and WO2007 / 026190) or GLA-EM, which is a combination of a TLR4 agonist and oil-in-water emulsion.
[0531] While not limited to these, for veterinary applications such as animal experiments, those skilled in the art may use complete Freund adjuvant (CFA), Freund incomplete adjuvant (IFA), Emulsigen, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-normuramyl-L-alanyl-D-isoglutamine (CGP11637, also called nor-MDP), N-acetylmuramyl-L-alanyl RIBI can be used, which contains lanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP19835A, also known as MTP-PE), as well as three components extracted from bacteria in a 2% squalene / Tween80 emulsion: monophosphoryl lipid A, trehalose dimycolic acid, and cell wall skeleton (MPL+TDM+CWS).
[0532] Further exemplary adjuvants for enhancing the efficacy of the pneumococcal vaccines disclosed herein include, but are not limited to, (1) for example, (a) SAF containing 10% squalane, 0.4% Tween80, 5% Pluronic Block Polymer L121, and thr-MDP, microfluidized or vortexed in a submicron emulsion to produce an emulsion of larger particle sizes, and (b) 2% squalene, 0.(2) Oil-in-water emulsion formulations such as RIBI® adjuvant systems (RAS) (Ribi Immunochem, Hamilton, MT) (containing or not containing other specific immunostimulants such as muramyl peptide (see below) or bacterial cell wall components), which may contain 2% Tween80, as well as one or more bacterial cell wall components such as monophosphoryl lipid A (MPL), trehalose dimycolic acid (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (DETOX®); (2) QS21, STIMULON® (Cambridge Bioscience, Worcester, MA), ABISCO® (Isconova, Sweden), or ISCOMATRIX® (Commonwealth Serum) which may be used. (3) Saponin adjuvants such as ISCOM (immunostimulatory complex) which does not necessarily contain further surfactants (e.g., WO00 / 07621), such as particles produced therefrom; (4) Complete Freund adjuvants (CFAs) and incomplete Freund adjuvants (IFAs); (5) Interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (e.g., WO99 / 44636)), interferons (e.g., gamma interferons), macrophage colony-stimulating factors (M- Cytokines such as CSF, tumor necrosis factor (TNF); (5) Monophosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL) in the substantial absence of alum, when used in conjunction with pneumococcal sugars (see, for example, WO00 / 56358) (see, for example, GB-2220221, EP0689454); (6) 3dMPL in combination with, for example, QS21 and / or oil-in-water emulsion (see, for example, EP0835318, EP0735898, EP0761231); (7) Polyoxyethylene ether, also. (8) Polyoxyethylene esters (see, for example, WO99 / 52549); (9) Polyoxyethylene sorbitan ester surfactants in combination with octoxynol (see, for example, WO01 / 21207) or polyoxyethylene alkyl ethers or ester surfactants in combination with at least one further nonionic surfactant such as octoxynol (see, for example, WO01 / 21152); (10) Saponins and immunostimulatory oligonucleotides ( For example, CpG oligonucleotides) (e.g., WO00 / 62800); (10) particles of immunostimulants and metal salts (see e.g., WO00 / 23105); (11) saponins and oil-in-water emulsions (e.g., WO99 / 11241); (12) saponins (e.g., QS21) + 3dMPL + IM2 (optionally + sterols) (e.g., WO98 / 57659); (13) other substances that act as immunostimulants to enhance the efficacy of a composition. Examples of muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25-acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), and N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE).
[0533] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises a CpG oligonucleotide as an adjuvant. As used herein, CpG oligonucleotides refer to immunostimulated CpG oligodeoxynucleotides (CpG ODNs), and therefore these terms are used interchangeably unless otherwise noted. An immunostimulated CpG oligodeoxynucleotide contains one or more immunostimulated CpG motifs, which are unmethylated cytosine-guanine dinucleotides, in the context of certain preferred bases. The methylation state of a CpG immunostimulated motif generally refers to a cytosine residue in the dinucleotide. An immunostimulated oligonucleotide containing at least one unmethylated CpG dinucleotide contains a 5'-unmethylated cytosine linked to 3'-guanine by a phosphate bond, and is an oligonucleotide that activates the immune system by binding to Toll-like receptor 9 (TLR-9). In another embodiment, the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides, which activate the immune system by TLR9, though not as strongly as when the CpG motif is not methylated. The CpG immunostimulatory oligonucleotide may, in turn, contain one or more palindromes which may contain CpG dinucleotides. CpG oligonucleotides are described in several published patents, published patent applications, and other publications, e.g., U.S. Patents No. 6,194,388; No. 6,207,646; No. 6,214,806; No. 6,218,371; No. 6,239,116; and No. 6,339,068.
[0534] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises any CpG oligonucleotide described on pages 3, line 22 to page 12, line 36 of WO2010 / 125480.
[0535] Different classes of CpG immunostimulatory oligonucleotides have been identified. These are referred to as classes A, B, C, and P, and are described in more detail on pages 3, lines 22-12, line 36 of WO2010 / 125480. The methods of the present invention encompass the use of these different classes of CpG immunostimulatory oligonucleotides.
[0536] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises a class A CpG oligonucleotide. Preferably, the "class A" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'GGGGACGACGTCGTGGGGGGG3' (SEQ ID NO: 1). Some non-limiting examples of class A oligonucleotides include 5'G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G* One example is G*G*G3' (SEQ ID NO: 2) (where "*" indicates a phosphorothioate bond and "_" indicates a phosphodiester bond).
[0537] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises a B-class CpG oligonucleotide. In one embodiment, the CpG oligonucleotide for use in the present invention is a B-class CpG oligonucleotide represented by at least the formula: 5'X1X2CGX3X43' (wherein X1, X2, X3, and X4 are nucleotides). In one embodiment, X2 is adenine, guanine, or thymine. In another embodiment, X3 is cytosine, adenine, or thymine.
[0538] The B-class CpG oligonucleotide sequences of the present invention are those broadly described above, as well as those disclosed in WO96 / 02555, WO98 / 18810 and U.S. Patents 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068. Illustrative sequences, though not limited to those disclosed in these latter applications and patents, are also included.
[0539] In one embodiment, the "Class B" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'TCGTCGTTTTTCGGTGCTTTT3' (Sequence ID 3), or 5'TCGTCGTTTTTCGGTCGTTTT3' (Sequence ID 4), or 5'TCGTCGTTTTGTCGTTTTGTCGTT3' (Sequence ID 5), or 5'TCGTCGTTTCGTCGTTTTGTCGTT3' (SEQ ID NO: 6), or 5'TCGTCGTTTTGTCGTTTTTTTCGA3' (SEQ ID NO: 7) It has.
[0540] In any of these sequences, all bonds may be phosphorothioate bonds. In another embodiment, in any of these sequences, one or more bonds may preferably be phosphodiesters between the "C" and "G" of a CpG motif forming a semi-soft CpG oligonucleotide. In any of these sequences, ethyluridine or halogen may be replaced at 5'T; examples of halogen substitutions include, but are not limited to, bromouridine or iodouridine substitutions.
[0541] Some non-limiting examples of Class B oligonucleotides include: 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T3'(Sequence No. 8), or 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T3'(Sequence Index 9), or 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T3'(Sequence Index 10), or 5'T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T3'(Sequence Index 11), or 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A3' (Sequence number 12) (In the formula, "*" refers to a phosphorothioate bond.)
[0542] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises a C-class CpG oligonucleotide. In one embodiment, the "C-class" of the present invention The CpG oligonucleotide has the following nucleic acid sequence: 5'TCGCGTCGTTCGGCGCGCGCCG3' (Sequence ID 13), or 5'TCGTCGACGTTCGGCGCGCGCCG3' (Sequence ID 14), or 5'TCGGACGTTCGGCGCGCGCCG3' (Sequence ID 15), or 5'TCGGACGTTCGGCGCGCCG3' (Sequence ID 16), or 5'TCGCGTCGTTCGGCGCGCCG3' (Sequence ID 17), or 5'TCGACGTTCGGCGCGCGCCG3' (Sequence ID 18), or 5'TCGACGTTCGGCGCGCCG3' (Sequence ID 19), or 5'TCGCGTCGTTCGGCGCCG3' (Sequence ID 20), or 5'TCGCGACGTTCGGCGCGCGCCG3' (Sequence ID 21), or 5'TCGTCGTTTTCGGCGCGCGCCG3' (Sequence ID 22), or 5'TCGTCGTTTTCGGCGGCCGCCG3' (Sequence ID 23), or 5'TCGTCGTTTTACGGCGCCGTGCCG3' (Sequence ID 24), or 5'TCGTCGTTTTCGGCGCGCGCCGT3' (Sequence ID 25) It has.
[0543] In any of these sequences, all bonds may be phosphorothioate bonds. In another embodiment, in any of these sequences, one or more bonds may preferably be phosphodiesters between the "C" and "G" of a CpG motif that make up a semi-soft CpG oligonucleotide.
[0544] Some non-limiting examples of C-class alkyl groups include: 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G3'(Sequence No. 26), or 5'T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G3'(Sequence No. 27), or 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G3'(Sequence No. 28), or 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G3'(Sequence No. 29), or 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*G*C*C*G3'(Sequence No. 30), or 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G3'(Sequence No. 31), or 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G3'(Sequence No. 32), or 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*C*G3'(Sequence No. 33), or 5'T*C_G*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G3'(Sequence No. 34), or 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*C*G*C*G3'(Sequence No. 35), or 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*C*C*G*C*G3'(Sequence No. 36), or 5'T*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G3'(Sequence No. 37), or 5'T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T3' (Sequence number 38) Examples include (wherein "*" indicates a phosphorothioate bond and "_" indicates a phosphodiester bond). In any of these sequences, ethyluridine or halogen may be replaced with 5'T; examples of halogen substitutions are not limited to, Examples include bromo-uridine or iodo-uridine substitutions.
[0545] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises a P-class CpG oligonucleotide. In one embodiment, the CpG oligonucleotide for use in the present invention is a P-class CpG oligonucleotide comprising a 5'TLR activating domain and at least two palindromic regions, wherein one of the palindromic regions is a 5'-palindromic region of at least 6 nucleotides in length and comprises at least one YpR dinucleotide, which is attached directly or via a spacer to a 3'-palindromic region of at least 8 nucleotides in length. In one embodiment, the oligonucleotide is not T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G*C*G (SEQ ID NO: 27). In one embodiment, the P-class CpG oligonucleotide comprises at least one unmethylated CpG dinucleotide. In another embodiment, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT. In yet another embodiment, the TLR activation domain is located within the 5' palindromic region. In yet another embodiment, the TLR activation domain is located immediately 5' to the 5' side of the 5' palindromic region.
[0546] In one embodiment, the "P-class" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'TCGTCGACGATCGGCGCGCGCCG3' (SEQ ID NO: 39).
[0547] In the above sequences, all bonds may be phosphorothioate bonds. In another embodiment, one or more bonds may preferably be phosphodiesters between the "C" and "G" of the CpG motif forming a semi-soft CpG oligonucleotide. In any of these sequences, ethyluridine or halogen may be replaced at 5'T; examples of halogen substitutions include, but are not limited to, bromouridine or iodouridine substitutions.
[0548] Non-limiting examples of P-class oligonucleotides include: 5'T*C_G*T*C_G*A*C_G*A*T*C_G*G*C*G*C_G*C*G*C*C*G3' (Sequence number 40) (In the formula, "*" refers to a phosphorothioate bond and "_" refers to a phosphodiester bond.)
[0549] In one embodiment, the oligonucleotide contains at least one phosphorothioate bond. In another embodiment, all internucleotide bonds of the oligonucleotide are phosphorothioate bonds. In another embodiment, the oligonucleotide contains at least one phosphodiester-like bond. In another embodiment, the phosphodiester-like bond is a phosphodiester bond. In another embodiment, a lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.
[0550] In one embodiment, all internucleotide bonds in the CpG oligonucleotides disclosed herein are phosphodiester bonds ("soft" oligonucleotides as described in WO2007 / 026190). In another embodiment, the CpG oligonucleotides of the present invention are made resistant to degradation (e.g., stabilized). A "stabilized oligonucleotide" refers to an oligonucleotide that is relatively resistant to degradation in vivo (e.g., by exo or endonucleases). Nucleic acid stabilization can be achieved by skeletal modification. Oligonucleotides having phosphorothioate bonds are the most It generates high activity and protects oligonucleotides from degradation by intracellular exo and endonucleases.
[0551] Immunostimulating oligonucleotides may have a chimeric skeleton having a combination of phosphodiester bonds and phosphorothioate bonds. For the purposes of the present invention, a chimeric skeleton means a partially stabilized skeleton in which at least one internucleotide bond is a phosphodiester or phosphodiester-like bond, at least one other internucleotide bond is a stabilized internucleotide bond, and at least one phosphodiester or phosphodiester-like bond is different from at least one stabilized bond. When the phosphodiester bond is preferentially located within a CpG motif, such a molecule is referred to as “semi-soft” as described in WO2007 / 026190.
[0552] Other modified oligonucleotides include combinations of phosphodiesters, phosphorothioates, methylphosphonates, methylphosphorothioates, phosphorodithioates, and / or p-ethoxy bonds.
[0553] Mixed-skeleton modified ODNs can be synthesized as described in WO2007 / 026190. The size of the CpG oligonucleotide (i.e., the number of nucleotide residues along the length of the oligonucleotide) can also contribute to the stimulating activity of the oligonucleotide. To facilitate uptake into cells, the CpG oligonucleotides of the present invention preferably have a minimum length of 6 nucleotide residues. Since larger oligonucleotides are degraded in cells, any oligonucleotide of a size greater than 6 nucleotides (even many kb lengths) can induce an immune response if a sufficient immunostimulatory motif is present. In certain embodiments, the CpG oligonucleotides are 6 to 100 nucleotides long, preferably 8 to 30 nucleotides long. In important embodiments, the nucleic acids and oligonucleotides of the present invention are not plasmids or expression vectors.
[0554] In one embodiment, the CpG oligonucleotides disclosed herein include substitutions or modifications in bases and / or sugars, as described in paragraphs 134-147 of WO2007 / 026190.
[0555] In one embodiment, the CpG oligonucleotide of the present invention is chemically modified. Examples of chemical modifications are known to those skilled in the art and are described, for example, in Uhlmann et al. (1990) Chem. Rev. 90:543; S. Agrawal (ed.), Humana Press, Totowa, USA 1993; Crooke et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36:107~129; and Hunziker et al. (1995) Mod. Synth. Methods 7:331~417. The oligonucleotide according to the present invention may have one or more modifications, where each modification is located at a specific phosphodiester nucleoside crosslink and / or a specific β-D-ribose unit and / or a specific native nucleoside base position compared to an oligonucleotide of the same sequence composed of native DNA or RNA.
[0556] In some embodiments of the present invention, CpG-containing nucleic acids can be simply mixed with an immunogenic carrier according to methods known to those skilled in the art (see, for example, WO03 / 024480).
[0557] In certain embodiments of the present invention, any immunogenic composition disclosed herein is 2 μg to 100 mg of CpG oligonucleotide, preferably 0.1 mg to 50 mg of CpG oligonucleotide, preferably 0.2 mg to 10 mg of CpG oligonucleotide, preferably 0.3 mg to 5 mg of CpG oligonucleotide, preferably 0. The composition contains 3 mg to 5 mg of CpG oligonucleotides, more preferably 0.5 to 2 mg of CpG oligonucleotides, and even more preferably 0.75 to 1.5 mg of CpG oligonucleotides. In preferred embodiments, any immunogenic composition disclosed herein contains about 1 mg of CpG oligonucleotides.
[0558] 5. Formulations The immunogenic composition of the present invention can be formulated in liquid form (i.e., solution or suspension) or lyophilized form. Liquid formulations are advantageous because they can be administered directly from their packaged form and therefore do not require reconstitution in an aqueous medium, as is required separately for the lyophilized composition of the present invention, making them ideal for injection.
[0559] Formulations of the immunogenic compositions of the present invention can be achieved using methods recognized in the art. For example, individual pneumococcal conjugates can be formulated with a physiologically acceptable vehicle to prepare the composition. Examples of such vehicles, but not limited to, include water, buffered saline solution, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and dextrose solution.
[0560] This disclosure provides immunogenic compositions comprising any combination of the glycoconjugates disclosed herein and pharmaceutically acceptable excipients, carriers, or diluents.
[0561] In one embodiment, the immunogenic composition of the present invention is in liquid form, preferably in aqueous liquid form.
[0562] The immunogenic compositions of this disclosure may include one or more of the following, or any combination thereof: buffers, salts, divalent cations, nonionic surfactants, antifreeze agents such as sugars, and antioxidants such as free radical scavengers or chelating agents.
[0563] In one embodiment, the immunogenic composition of the present invention comprises a buffer. In one embodiment, the buffer has a pKa of about 3.5 to about 7.5. In some embodiments, the buffer is phosphoric acid, succinic acid, histidine, or citrate. In a particular embodiment, the buffer is succinic acid at a final concentration of 1 mM to 10 mM. In one particular embodiment, the final concentration of the succinic acid buffer is about 5 mM.
[0564] In one embodiment, the immunogenic composition of the present invention comprises a salt. In some embodiments, the salt is selected from the group consisting of magnesium chloride, potassium chloride, sodium chloride, and combinations thereof. In one particular embodiment, the salt is sodium chloride. In one particular embodiment, the immunogenic composition of the present invention comprises 150 mM sodium chloride.
[0565] In one embodiment, the immunogenic composition of the present invention comprises a surfactant. In one embodiment, the surfactant is selected from the group consisting of polysorbate 20 (TWEEN® 20), polysorbate 40 (TWEEN® 40), polysorbate 60 (TWEEN® 60), polysorbate 65 (TWEEN® 65), polysorbate 80 (TWEEN® 80), polysorbate 85 (TWEEN® 85), TRITON® N-101, TRITON® X-100, oxtoxynol 40, nonoxynol-9, triethanolamine, triethanolamine polypeptide oleate, polyoxyethylene-660 hydroxystearate (PEG-15, Solutol H15), polyoxyethylene-35-ricinoleate (CREMOPHOR® EL), soy lecithin, and poloxamer. In one particular embodiment, the surfactant is polysorbate 80. In some of the embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.0001% to 10% w / w of polysorbate 80. In some of the embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% w / w of polysorbate 80. In some of the embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.01% to 1% w / w of polysorbate 80. In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% w / w of polysorbate 80. In another embodiment, the final concentration of polysorbate 80 in the formulation is 1% (w / w) of polysorbate 80.
[0566] In certain embodiments, the immunogenic composition of the present invention has a pH of 5.5 to 7.5, more preferably 5.6 to 7.0, and even more preferably 5.8 to 6.0.
[0567] In one embodiment, the present invention provides a container filled with any of the immunogenic compositions disclosed herein. In one embodiment, the container is selected from the group consisting of vials, syringes, flasks, fermenters, bioreactors, bags, jars, ampoules, cartridges, and disposable pens. In a particular embodiment, the container is silicone-treated.
[0568] In one embodiment, the container of the present invention is made from glass, metal (e.g., steel, stainless steel, aluminum, etc.) and / or polymer (e.g., thermoplastic material, elastomer, thermoplastic elastomer). In one embodiment, the container of the present invention is made from glass.
[0569] In one embodiment, the present invention provides a syringe filled with any of the immunogenic compositions disclosed herein. In a particular embodiment, the syringe is silicon-treated and / or made of glass.
[0570] Typical doses of the immunogenic composition of the present invention for injection are 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL, and even more preferably about 0.5 mL.
[0571] Therefore, the container or syringe defined above is filled with any immunogenic composition as defined herein in a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL, and even more preferably about 0.5 mL.
[0572] 6. Use of the immunogenic composition of the present invention In one embodiment, the immunogenic compositions disclosed herein are intended for use as pharmaceuticals.
[0573] The immunogenic compositions described herein can be used in a variety of therapeutic or prophylactic methods for preventing, treating, or improving bacterial infections, diseases, or conditions in a subject. In particular, the immunogenic compositions described herein can be used to prevent, treat, or improve Streptococcus pneumoniae infections, diseases, or conditions in a subject.
[0574] Thus, in one embodiment, the present invention relates to a method for preventing, treating, or improving an infection, disease, or condition associated with Streptococcus pneumoniae in a subject, comprising: an immunologically effective amount of the immunogenic composition of the present invention in the subject. The present invention provides a method including the administration of [a substance].
[0575] In some such embodiments, the infection, disease, or condition is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess.
[0576] In one embodiment, the present invention provides a method for inducing an immune response to Streptococcus pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of the immunogenic composition of the present invention.
[0577] In one embodiment, the immunogenic composition disclosed herein is for use as a vaccine. In such embodiments, the immunogenic composition described herein can be used to prevent infection with Streptococcus pneumoniae in a subject. Thus, in one embodiment, the present invention provides a method for preventing infection with Streptococcus pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of the immunogenic composition of the present invention. In some such embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess. In one embodiment, the subject to be vaccinated is a mammal such as a human, cat, sheep, pig, horse, cattle, or dog.
[0578] In one embodiment, the immunogenic compositions disclosed herein are for use in methods of preventing, treating, or improving infections, diseases, or conditions associated with Streptococcus pneumoniae in a subject. In some such embodiments, the infections, diseases, or conditions are selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infections, and brain abscesses.
[0579] In one embodiment, the immunogenic composition disclosed herein is for use as a vaccine. In such embodiments, the immunogenic composition described herein can be used to prevent infection by Streptococcus pneumoniae in a subject. Thus, in one embodiment, the immunogenic composition disclosed herein is for use in a method of preventing infection by Streptococcus pneumoniae in a subject. In some such embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess. In one embodiment, the subject to be vaccinated is a mammal such as a human, cat, sheep, pig, horse, cattle, or dog.
[0580] The immunogenic compositions of the present invention can be used to prevent or treat pneumococcal infection in humans susceptible to the disease by administering the immunogenic compositions via systemic or mucosal routes. In one embodiment, the immunogenic compositions disclosed herein are administered via intramuscular, intraperitoneal, intradermal, or subcutaneous routes. In one embodiment, the immunogenic compositions disclosed herein are administered by intramuscular, intraperitoneal, intradermal, or subcutaneous injection. In one embodiment, the immunogenic compositions disclosed herein are administered by intramuscular or subcutaneous injection.
[0581] In one embodiment, when administered to a subject, the immunogenic composition of this disclosure, comprising at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15B (such as the glycoconjugate described in Section 1.3.4 above), can induce the formation of antibodies capable of binding to Streptococcus pneumoniae serotypes 15B, 15A, and / or 15C, as measured by a standard ELISA assay.
[0582] In ELISA (enzyme-linked immunosorbent assay), antibodies derived from the serum of a vaccinated subject are incubated with polysaccharides adsorbed onto a solid support. The bound antibodies are then detected using an enzyme-conjugated secondary detection antibody.
[0583] In one embodiment, the standard ELISA assay is the standardized (WHO) ELISA assay as defined by the WHO in the "Training manual for Enzyme-linked immunosorbent assay for the quantitation of Streptococcus pneumoniae serotype specific IgG (PnPS ELISA)" (accessible at http: / / www.vaccine.uab.edu / ELISA%20protocol.pdf; accessed March 31, 2014).
[0584] ELISA is used to measure type-specific IgG anti-Streptococcus pneumoniae (S. pneumoniae) capsular polysaccharide (PS) antibodies present in human serum. When a diluted human serum is added to a type-specific capsular PS-coated microtiter plate, antibodies specific to that PS bind to the microtiter plate. The antibodies bound to the plate are detected using goat anti-human IgG alkaline phosphatase-labeled antibody, followed by a p-nitrophenyl phosphate substrate. The light density of the colored final product is proportional to the amount of anti-capsular PS antibody present in the serum.
[0585] In one embodiment, an immunogenic composition of the present disclosure comprising at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15B (such as the glycoconjugate described in Section 1.3.4 above) can induce IgG antibodies in humans that can bind to Streptococcus pneumoniae serotype 15B polysaccharide at concentrations of at least 0.05, 0.1, 0.2, 0.3, 0.35, 0.4, or 0.5 μg / ml, as determined by an ELISA assay.
[0586] In one embodiment, an immunogenic composition of the present disclosure comprising at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15B (such as the glycoconjugate described in Section 1.3.4 above) can induce IgG antibodies in humans that can bind to Streptococcus pneumoniae serotype 15C polysaccharide at concentrations of at least 0.05, 0.1, 0.2, 0.3, 0.35, 0.4, or 0.5 μg / ml, as determined by an ELISA assay.
[0587] In one embodiment, an immunogenic composition of the present disclosure comprising at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15B (such as the glycoconjugate described in Section 1.3.4 above) can induce IgG antibodies in humans that can bind to Streptococcus pneumoniae serotype 15B and 15C polysaccharides at concentrations of at least 0.05, 0.1, 0.2, 0.3, 0.35, 0.4, or 0.5 μg / ml, as determined by an ELISA assay.
[0588] In one embodiment, when administered to a subject, the immunogenic composition of this disclosure comprising at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15B (such as the glycoconjugate described in Section 1.3.4 above) can induce the formation of an antibody capable of killing Streptococcus pneumoniae serotype 15B in an opsonin phagocytosis assay as disclosed herein.
[0589] In one embodiment, the immunogenic composition of this disclosure comprising at least one ...
Claims
1. An immunogenic composition comprising a glycoconjugate derived from Streptococcus pneumoniae serotype 11A, The serotype 11A glycoconjugate comprises sugars having a molecular weight of 100 kDa to 400 kDa. The serotype 11A glycoconjugate has a molecular weight of 500 kDa to 17,500 kDa. The serotype 11A glycoconjugate contains at least 0.6 mM glycerol per 1 mM serotype 11A capsular polysaccharide, and contains less than 1.0 mM glycerol per 1 mM serotype 11A capsular polysaccharide. The ratio (weight / weight) of serotype 11A capsular polysaccharide to the carrier protein in the serotype 11A glycoconjugate is 0.5 to 1.5, and, The carrier protein of the aforementioned serotype 11A glycoconjugate is CRM 197. The immunogenic composition.
2. The immunogenic composition according to claim 1, wherein the ratio (w / w) of serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to the carrier protein is 0.8 to 1.
45.
3. The immunogenic composition according to any one of claims 1-2, wherein the serotype 11A glycoconjugate comprises at least 1.8 mM acetate per 1 mM serotype 11A capsular polysaccharide.
4. The immunogenic composition according to any one of claims 1 to 3, wherein the serotype 11A glycoconjugate comprises at least 2.6 mM acetate per mM serotype 11A capsular polysaccharide, and less than 3.3 mM acetate per mM serotype 11A capsular polysaccharide.
5. The immunogenic composition according to any one of claims 1-4, wherein the degree of conjugation of the serotype 11A glycoconjugate is 1 to 15.
6. The immunogenic composition according to any one of claims 1-4, wherein the degree of conjugation of the serotype 11A glycoconjugate is 2 to 5.
7. The immunogenic composition according to any one of claims 1 to 6, wherein the serotype 11A glycoconjugate is prepared by reductive amination.
8. The immunogenic composition according to any one of claims 1 to 6, wherein the serotype 11A glycoconjugate is prepared by reductive amination in an aqueous solvent.
9. The immunogenic composition according to any one of claims 1 to 8, further comprising a glycoconjugate derived from Streptococcus pneumoniae serotype 22F.
10. The immunogenic composition according to any one of claims 1 to 9, further comprising a glycoconjugate derived from Streptococcus pneumoniae serotype 15B.
11. The immunogenic composition according to any one of claims 1 to 10, further comprising a glycoconjugate derived from Streptococcus pneumoniae serotype 33F.
12. The immunogenic composition according to any one of claims 1 to 11, further comprising a glycoconjugate derived from Streptococcus pneumoniae serotype 12F.
13. The immunogenic composition according to any one of claims 1 to 12, further comprising a glycoconjugate derived from Streptococcus pneumoniae serotype 10A.
14. The immunogenic composition according to any one of claims 1 to 13, further comprising a glycoconjugate derived from Streptococcus pneumoniae serotype 8.
15. The immunogenic composition according to any one of claims 1 to 8, further comprising a glycoconjugate derived from Streptococcus pneumoniae serotype 15B, a glycoconjugate derived from Streptococcus pneumoniae serotype 22F, a glycoconjugate derived from Streptococcus pneumoniae serotype 33F, a glycoconjugate derived from Streptococcus pneumoniae serotype 12F, a glycoconjugate derived from Streptococcus pneumoniae serotype 10A, and a glycoconjugate derived from Streptococcus pneumoniae serotype 8.
16. The immunogenic composition according to any one of claims 1 to 15, further comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F.
17. The immunogenic composition according to any one of claims 1 to 16, further comprising glycoconjugates derived from serotypes 1, 5, and 7F of Streptococcus pneumoniae.
18. The immunogenic composition according to any one of claims 1 to 17, further comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 6A and 19A.
19. The immunogenic composition according to any one of claims 1 to 18, further comprising at least one glycoconjugate derived from Streptococcus pneumoniae serotype 3.
20. The immunogenic composition according to any one of claims 1 to 19, which is a conjugate composition of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20-valent Streptococcus pneumoniae.
21. The immunogenic composition according to any one of claims 1 to 19, which is a 20-valent Streptococcus pneumoniae conjugate composition.
22. The aforementioned glycoconjugate is CRM 197 An immunogenic composition according to any one of claims 1-21, which is individually conjugated to the immunogenic composition.
23. All glycoconjugates are CRM 197 An immunogenic composition according to any one of claims 1-22, which is individually conjugated to the immunogenic composition.
24. The immunogenic composition according to any one of claims 1 to 23, comprising polysaccharides of each serotype in doses of 1 to 10 μg each.
25. The immunogenic composition according to any one of claims 1 to 24, wherein each dose contains 10 μg to 150 μg of carrier protein.
26. Each dose is 25μg, 26μg, 27μg, 28μg, 29μg, 30μg, 31μg, 32μg, 33μg, 34μg, 35μg, 36μg, 37μg, 38μg , 39μg, 40μg, 41μg, 42μg, 43μg, 44μg, 45μg, 46μg, 47μg, 48μg, 49μg, 50μg, 51μg, 52μg, 53μg The immunogenic composition according to any one of claims 1 to 25, comprising 54 μg, 55 μg, 56 μg, 57 μg, 58 μg, 59 μg, 60 μg, 61 μg, 62 μg, 63 μg, 64 μg, 65 μg, 66 μg, 67 μg, 68 μg, 69 μg, 70 μg, 71 μg, 72 μg, 73 μg, 74 μg, or 75 μg of carrier protein.
27. An immunogenic composition according to any one of claims 1 to 26, further comprising at least one adjuvant.
28. The immunogenic composition according to any one of claims 1 to 27, further comprising at least one adjuvant selected from the group consisting of aluminum phosphate, aluminum sulfate, and aluminum hydroxide.
29. An immunogenic composition according to any one of claims 1 to 28, comprising one or more of a buffer, a salt, a divalent cation, a nonionic surfactant, an antifreeze, and an antioxidant, or any combination thereof.
30. An immunogenic composition according to any one of claims 1 to 29, comprising a buffer solution.
31. An immunogenic composition according to any one of claims 1 to 30, comprising a salt.
32. An immunogenic composition according to any one of claims 1 to 31, comprising a surfactant.
33. An immunogenic composition according to any one of claims 1-31 for use as a pharmaceutical agent.
34. An immunogenic composition according to any one of claims 1-31 for use as a vaccine.
35. An immunogenic composition according to any one of claims 1 to 31 for use in a method for preventing, treating, or improving a bacterial infection, disease, or condition in a subject.
36. An immunogenic composition according to any one of claims 1 to 31 for use in a method for preventing bacterial infection, disease or condition in a subject.
37. The immunogenic composition according to any one of claims 1-31 for use in a method for protecting against or treating pneumococcal infection by administering the immunogenic composition via a systemic route or a mucosal route.