Collagen production promoters, MMP inhibitors, hyaluronic acid production promoters, and oral preparations

Abstract

To provide a novel external or internal preparation having excellent actions of promoting collagen production, inhibiting MMP and promoting hyaluronic acid production.SOLUTION: The present invention provides a collagen production promoter, an MMP inhibitor, a hyaluronic acid production promoter, or a wrinkle improver, each containing extract from Myrtus communis. The extract from Myrtus communis can be used in not only the beauty field but also in the medical field including inhibiting aging-related hypofunctions and preventing or treating cancer, and can be applied to cosmetics, food, quasi drugs and pharmaceuticals or the like.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a collagen production promoter, a MMP inhibitor, a hyaluronic acid production promoter, and an internal preparation.

Background Art

[0002] The dermis contains fibroblasts and collagen, and type I collagen accounts for 80% of the whole. In addition to type I collagen, the presence of types III, V, XII, and XIV collagen is known. One of the causes of wrinkles and sagging is the decrease in type I collagen. Therefore, it is considered effective in preventing and improving wrinkles and sagging to promote the production of type I collagen. In addition, promoting the production of type I collagen is also effective in improving skin wound healing.

[0003] In addition to ultraviolet rays, the skin is daily exposed to various physical and chemical stresses such as dryness, cold, heat, and drugs. As a result, the skin function declines, and various skin aging phenomena become apparent. One of the skin aging phenomena is wrinkles. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are called fine wrinkles and are temporarily caused by a decrease in the water content in the epidermal keratin due to skin dryness. On the other hand, dermal wrinkles are wrinkles formed by ultraviolet rays contained in sunlight or aging. The formation mechanism includes a decrease in the collagen synthesis ability in dermal fibroblasts due to ultraviolet rays or aging, and an acceleration of collagen degradation due to an increase in matrix metalloproteinase (MMP).

[0004] In the case of epidermal wrinkles and dermal wrinkles caused by dryness, the histological morphology, onset mechanism, and treatment methods are different, and it is difficult to improve dermal wrinkles caused by ultraviolet rays or aging by using cosmetics having a moisturizing effect.

[0005] To date, several agents have been reported for the purpose of improving dermal wrinkles caused by ultraviolet rays, including a skin wrinkle prevention and improvement agent containing hydrolyzed almond as an active ingredient (Patent Document 1), and a wrinkle improvement agent for ultraviolet irradiation containing extracts of Jochokei, Tenki, and Kisenosa as active ingredients (Patent Document 2).

[0006] Furthermore, collagen is a major structural protein that makes up about one-third of mammalian tissues and is an essential component of many matrix tissues such as cartilage, bone, tendons, and skin. When collagen is cleaved at one point by collagenase (MMP-1), which belongs to the MMP group, the collagen molecule, which is normally stable in tissues, denatures into single-chain gelatin, which is then broken down by various other proteases. As a result, the structural integrity of the matrix tissue is lost.

[0007] Materials possessing collagenase inhibitory activity have been proposed, such as cocoa husk extract (Patent Document 3), raspberry extract (Patent Document 4), and lactoferrin (Patent Document 5). Given the increasing concern for skin aging and oral hygiene, there is a growing need to discover materials with excellent collagenase inhibitory effects that are safe, have no side effects, and are highly effective in inhibiting collagenase activity.

[0008] Gelatinase (MMP-2), belonging to the MMP group, is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and breaks down substrates such as collagen, gelatin, and elastin (structural proteins that make up special components of elastic tissues such as arteries, tendons, and skin). Therefore, substances that have inhibitory activity against gelatinase are expected to have an effect of suppressing angiogenesis and cancer metastasis in cancer tissue, and are considered useful in the prevention and treatment of cancer. Furthermore, inhibition of MMP is useful not only for cancer but also for the prevention, treatment, and improvement of various diseases caused by increased MMP activity, such as ulcer formation, rheumatoid arthritis, osteoporosis, and periodontitis.

[0009] Furthermore, fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue, which maintains skin firmness. It is believed that wrinkles and sagging skin occur when this connective tissue loses its contractile and elastic properties.

[0010] Hyaluronic acid, in particular, is known as a high-molecular-weight polysaccharide widely distributed in connective tissue, exhibiting a gel-like form in the dermis and maintaining skin elasticity. Therefore, the alteration or decrease of hyaluronic acid is considered important in skin aging. Furthermore, because hyaluronic acid is a high-molecular-weight substance, there has been a problem in that cosmetics containing it are not easily absorbed when applied directly to the skin. For this reason, there has been a search for topical skin preparations that can promote the production of collagen and hyaluronic acid by activating fibroblasts (Patent Document 6).

[0011] Hyaluronic acid is also present in joints and is known to play a role in cushioning the impact of joint loads and smoothing joint movement. The hyaluronic acid concentration in normal human synovial fluid is approximately 2.3 mg / mL, but in rheumatoid arthritis, the hyaluronic acid concentration in synovial fluid decreases to approximately 1.2 mg / mL, and the viscosity of the synovial fluid also decreases significantly (Non-Patent Literature 1). Furthermore, it is known that a decrease in hyaluronic acid content occurs in septic arthritis and gouty arthritis, similar to the case of rheumatoid arthritis (Non-Patent Literature 2). In the above diseases, increasing the amount of hyaluronic acid in synovial fluid is considered in order to improve lubrication function, cover and protect articular cartilage, suppress pain, and improve pathological synovial fluid. For example, it is known that joint injection of sodium hyaluronate in patients with rheumatoid arthritis improves the above symptoms (Non-Patent Literature 3). However, treatment for the above diseases is long-term. Therefore, there is a need for topical skin preparations, foods, and pharmaceuticals containing hyaluronic acid production promoters that can be easily used for prevention and treatment in daily life.

[0012] Floaters are a condition in which faint shadows resembling threads or mosquitoes appear in the field of vision. They are caused by opacities in the vitreous humor, which fills the inside of the eye, casting shadows on the retina. Floaters can be broadly divided into two types: physiological floaters, which develop due to factors such as aging, ultraviolet radiation, and reactive oxygen species, and pathological floaters, which appear as a symptom of diseases such as retinal detachment, retinal tears, vitreous hemorrhage, and uveitis. Physiological floaters are caused by liquefaction due to a decrease in hyaluronic acid, the main component of the vitreous humor, and the subsequent breakdown of collagen fibers, leading to opacity within the vitreous humor. Treatment options include vitrectomy surgery and laser treatment, but these procedures are not commonly performed in Japan due to safety concerns, and treatment abroad is very expensive. Therefore, there is a need for foods and medicines containing hyaluronic acid production promoters that can be used daily to prevent and improve physiological floaters.

[0013] Myrtus communis (scientific name: Myrtus communis) is an evergreen shrub belonging to the genus Myrtus in the family Myrtaceae. It has been known that extracts of myrtus communis leaves and / or fruits inhibit melanin production and have depigmentation activity (Patent Document 7), that myrtus communis essential oil has the effect of promoting fat accumulation by directly acting on adipose tissue (Patent Document 8), and that myrtus communis extract has a ceramidase inhibitory effect and can be used as a ceramide content modifier (Patent Document 9). However, it was not known that myrtus communis extract has collagen production promoting effects, MMP inhibitory effects, and hyaluronic acid production promoting effects. [Prior art documents] [Patent Documents]

[0014] [Patent Document 1] Japanese Patent Publication No. 2000-119125 [Patent Document 2] Japanese Patent Publication No. 2006-199611 [Patent Document 3] Japanese Patent Application Publication No. 3-44331 [Patent Document 4] Japanese Patent Publication No. 2003-137801

Patent Document 5

Patent Document 6

Patent Document 7

Patent Document 8

Patent Document 9

Non-Patent Document

[0015]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Summary of the Invention

Problems to be Solved by the Invention

[0016] There is a demand for a material that is safe, has excellent stability, and has excellent effects of promoting collagen production, inhibiting MMP, and promoting hyaluronic acid production. However, at present, no material that can fully satisfy these requirements has been provided.

Means for Solving the Problems

[0017] Under such circumstances, as a result of intensive studies by the present inventors, it has been found that the extract of Ginbaikka has excellent effects of promoting collagen production, inhibiting MMP, and promoting hyaluronic acid production, and also has excellent stability. Furthermore, it has been found that an external preparation or an internal preparation containing the extract is safe, stable, has excellent effects of promoting collagen production, inhibiting MMP, and promoting hyaluronic acid production, and can be a multifunctional beauty / health material or a pharmaceutical, and thus the present invention has been completed.

[0018] That is, the present invention includes the following inventions. (1) A collagen production promoter characterized by containing an extract of Myrtus communis. (2) An MMP inhibitor characterized by containing an extract of Myrtus communis. (3) A hyaluronic acid production promoter characterized by containing an extract of Myrtus communis. (4) A wrinkle improver characterized by containing an extract of Myrtus communis. (5) A food composition for preventing and improving various diseases caused by the enhancement of MMP, characterized by containing an extract of Myrtus communis.

Effects of the Invention

[0019] According to the present invention, there are provided a collagen production promoter, an MMP inhibitor, and a hyaluronic acid production promoter containing an extract of Myrtus communis as an active ingredient.

Modes for Carrying Out the Invention

[0020] The Myrtus communis (scientific name: Myrtus communis) used in the present invention is an evergreen shrub native to the Mediterranean coast and belongs to the genus Myrtus of the Myrtaceae family. In the present invention, the extract of Myrtus communis refers to an extract of a part of the plant body such as its flowers, fruits, seeds, leaves, branches, roots, etc., or the whole plant body (whole herb), or a mixture thereof. However, in the present invention, the extract raw material preferably used is the whole herb. Also, for extraction, the plant body may be used as it is, or treatments such as drying, pulverizing, and cutting into small pieces may be performed.

[0021] The extraction method is not particularly limited, but can be carried out by using water or hot water, or a mixed solvent of water and an organic solvent, and by stirring or column extraction. Examples of extraction solvents include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Preferably, polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are used, and particularly preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are used. These solvents may be used individually or in mixtures of two or more. Particularly preferred extraction solvents include water, a mixed polar solvent of water and ethanol, or a mixed polar solvent of water and 1,3-butylene glycol. There are no particular limitations on the amount of solvent used; for example, it should be 10 times or more, preferably 20 times or more, relative to the whole myrtle plant (dry weight). However, for convenience in operations such as concentration or isolation after extraction, it is preferable to use 100 times or less. The extraction temperature and time can be appropriately selected depending on the type of solvent used and the pressure during extraction.

[0022] The above extract may be used as is, but if necessary, it may be used after treatment such as concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, etc., to the extent that the effects of the present invention are achieved. Furthermore, the extracted solution may be treated by concentration to dryness, spray drying, freeze-drying, etc., and used as a dried product.

[0023] The present invention may use the above extract as is, or it may contain ingredients used in cosmetics, quasi-drugs, pharmaceuticals, or foods, such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, humectants, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, and acidulants, to the extent that the effects of the extract are not impaired.

[0024] The present invention can be used in cosmetics, quasi-drugs, pharmaceuticals, and foods, and its dosage forms include, for example, lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath products, foundations, powders, lipsticks, ointments, poultices, tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and injectable solutions.

[0025] For external use, the content of the above extract used in this invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, when converted to solid matter. Furthermore, 0.01 to 5% by weight is most preferable. Below 0.0001% by weight, sufficient effect is unlikely to be expected. Above 10% by weight, enhancement of effect is unlikely to be observed, and it is uneconomical.

[0026] When administered internally, the dosage varies depending on age, weight, symptoms, therapeutic effect, administration method, processing time, etc. Generally, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0027] Next, in order to describe the present invention in detail, examples of the production, experimental, and formulation of the extract used in the present invention will be given as examples, but the present invention is not limited thereto. In the production examples, % refers to weight %, and in the formulation examples, parts refer to parts by weight. [Examples]

[0028] Examples of myrtle extract production Extracts of myrtle were prepared as follows. In preparation examples 1 to 4, the whole plant of myrtle was used as the extraction material.

[0029] (Manufacturing Example 1) Preparation of Myrtus communis hot water extract 10 g of dried myrtle was added to 200 mL of water and extracted at 95-100°C for 2 hours. The resulting extract was filtered, the filtrate was concentrated, and freeze-dried to obtain 2.3 g of myrtle hot water extract.

[0030] (Manufacturing Example 2) Preparation of a 50% ethanol extract of Myrtus communis 10 g of dried myrtle was immersed in 200 mL of 50% ethanol aqueous solution at room temperature for 7 days to extract the extract. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 1.2 g of myrtle 50% ethanol extract.

[0031] (Manufacturing Example 3) Preparation of Ethanol Extract of Myrtus communis 10 g of dried myrtle was immersed in 200 mL of ethanol at room temperature for 7 days to extract the extract. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 0.5 g of myrtle ethanol extract.

[0032] (Preparation Example 4) Preparation of 1,3-butylene glycol extract of Myrtus communis 10 g of dried myrtle was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days to extract the material. The resulting extract was filtered to obtain 192 g of myrtle 1,3-butylene glycol extract. [Examples]

[0033] (Example prescription 1) Lotion Formulation Content (per portion) 1. Hot water extract of Myrtus communis (Production example 1) 2.0 2,1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Components 1-6 and 11 and components 7-10 are uniformly dissolved, mixed together, and filtered to obtain the product.

[0034] (Comparative formulation example 1) Conventional lotion In Formula Example 1, the hot water extract of myrtle was replaced with purified water, and this was used as the conventional lotion.

[0035] (Prescription example 2) Cream Formulation Content (per portion) 1. 50% ethanol extract of Myrtus communis (Production Example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene glycol 8.5 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-9, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1 and 11-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. Add component 10 at 45°C, and further cool to 30°C to obtain the final product.

[0036] (Comparative formulation example 2) Conventional cream In Formula Example 2, the conventional cream was created by replacing the 50% ethanol extract of myrtle with purified water.

[0037] (Prescription example 3) Emulsion Formulation Content (per portion) 1. Ethanol extract of Myrtus communis (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 1-8, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 10-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. At 45°C, add component 9, and further cool to 30°C to obtain the final product.

[0038] (Prescription example 4) Gel Formulation Content (per portion) 1. 1,3-butylene glycol extract from Myrtus communis (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60 E.O.) 0.1 5.Fragrance (appropriate amount) 6.1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve components 2-5 and components 1 and 6-11 uniformly, then mix them together to obtain the product.

[0039] (Prescription example 5) Pack Formulation Content (per portion) 1. Hot water extract of Myrtus communis (Production example 1) 1.0 2. 1,3-butylene glycol extract of Myrtus communis (Production Example 4) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5.1,3-Butylene glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20 E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-11 uniformly to form the product.

[0040] (Prescription example 6) Foundation Formulation Content (per portion) 1. 50% ethanol extract of Myrtus communis (Production Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0 4. Polyoxyethylene cetyl ether (20 E.O.) 2.0 5. Cetanol 1.0 6. Liquid lanolin 2.0 7. Liquid paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengara 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-8, maintain at 80°C to form the oil phase. Swell component 9 thoroughly in component 19, then add components 1 and 10-13 and mix uniformly. Add components 14-17, which have been crushed and mixed in a pulverizer, and stir with a homomixer, maintaining at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase while stirring and emulsify. Then, cool, add component 18 at 45°C, and cool to 30°C while stirring to obtain the product.

[0041] (Example prescription 7) Bath additive Formulation Content (per portion) 1. Ethanol extract of Myrtus communis (Production Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to bring the total volume to 100. [Manufacturing Method] Mix ingredients 1-5 uniformly to form the product.

[0042] (Prescription example 8) Ointment Formulation Content (per portion) 1. Hot water extract of Myrtus communis (Production Example 1) 5.0 2. 1,3-butylene glycol extract of Myrtus communis (Production Example 4) 1.0 3. Polyoxyethylene cetyl ether (30 E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene glycol 10.0 9. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 3-6, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1, 2 and 7-9, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool to 30°C while stirring to obtain the final product.

[0043] (Prescription example 9) Powder Formulation Content (per portion) 1. Hot water extract of Myrtus communis (Production example 1) 1.0 2. Dried corn starch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1-3 and prepare as a powder.

[0044] (Prescription example 10) Tablets Formulation Content (per portion) 1. Ethanol extract of Myrtus communis (Production Example 3) 5.0 2. Dried corn starch 25.0 3. Carboxymethylcellulose calcium 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Mix ingredients 1-4, then add an aqueous solution of ingredient 5 as a binder and form into granules. Add ingredient 6 to the formed granules and compress into tablets. Each tablet should weigh 0.52g.

[0045] (Prescription example 11) Tablet confectionery Formulation Content (per portion) 1. Ethanol extract of Myrtus communis (Production Example 3) 2.0 2. Dried cornstarch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing Method] Mix ingredients 1-4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet should weigh 1.0g.

[0046] (Prescription example 12) Beverages Formulation Content (per portion) 1. Hot water extract of Myrtus communis (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-3 in a small amount of water. Then add ingredients 4 and 5 and mix.

[0047] Next, to explain the effects of the present invention in detail, experimental examples will be given. [Examples]

[0048] Experimental Example 1: Measurement of mRNA expression levels of type I collagen (COL1A1), MMP-1, MMP-2, and hyaluronic acid synthase 2 (HAS2) COL1A1, MMP-1, MMP-2, and HAS2 mRNA expression levels were measured. Human dermal fibroblasts were placed in a 60 mm dish at a rate of 1 × 10⁶. 5Cells were seeded and cultured in DMEM culture medium containing 10% FBS at 37°C and 5% CO2. Once confluent, each sample was cultured for 24 hours in DMEM(-) culture medium to final concentrations of 1 and 10 μg / mL, and then total RNA was extracted. Total RNA extraction from cells was performed using RNAiso Plus (Takara Bio), and the total RNA amount was determined by the absorbance at 260 nm using a spectrophotometer (Nanodrop). mRNA expression levels were measured using real-time RT-PCR based on the total RNA extracted from cells. High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Life Technologies) were used for real-time RT-PCR. Specifically, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures followed the prescribed method, and the expression levels of COL1A1, MMP-1, MMP-2, and HAS2 mRNA were determined as a percentage of the expression level of the internal standard, GAPDH mRNA. The COL1A1 expression enhancement rate was calculated as the ratio of the COL1A1 mRNA expression level in the sample-added group to the COL1A1 mRNA expression level in the control (no sample added) group. The MMP-1 expression suppression rate, MMP-2 expression suppression rate, and HAS2 expression enhancement rate were calculated similarly. The primers used to measure the expression levels of each gene are as follows.

[0049] Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT(Sequence ID 1) TTGCAGTGGTAGGTGATGTTCTG(Sequence ID 2) Primer set for MMP-1 GGGAGATCATCGGGACAACTC (Sequence ID 3) TGAGCATCCCCTCCAATACC(Sequence ID 4) Primer set for MMP-2 CCGTCGCCCATCATCAA (Sequence ID 5) CTTCTGCATCTTCTTTAGTGTGTCCTT(Sequence No. 6) Primer set for HAS2 TGGATGACCTACGAAGCGATTA(Sequence ID 7) GCTGGATTACTGTGGCAATGAG(Sequence No. 8) Primer set for GAPDH TGCACCACCAACTGCTTAGC (Sequence ID 9) TCTTCTGGGTGGCAGTGATG (Sequence ID 10)

[0050] The results of these experiments are shown in Tables 1-4. As a result, the myrtle extract of the present invention showed excellent COL1A1 expression promoting effect (collagen production promoting effect), MMP-1 expression suppressing effect (MMP-1 inhibitory effect), MMP-2 expression suppressing effect (MMP-2 inhibitory effect), and HAS2 expression promoting effect (hyaluronic acid production promoting effect). Production Example 4 also showed similar effects. In particular, the COL1A1 expression promoting effect of the myrtle ethanol extract (Production Example 3) and the MMP-1 expression suppressing effect of the 50% myrtle ethanol extract (Production Example 2) were remarkably effective.

[0051] [Table 1]

[0052] [Table 2]

[0053] [Table 3]

[0054] [Table 4]

[0055] Experimental Example 2: Usage Test A one-month usage trial was conducted on seven individuals (ages 25-68) with wrinkles and sagging skin, using the cream from prescription example 2 and the conventional cream from comparative prescription example 2. After use, the degree of wrinkles and sagging skin was assessed using a questionnaire.

[0056] As a result, the cream containing the extract of the present invention reduced wrinkles and sagging. Furthermore, no skin problems occurred in any participant during the testing period, and there were no safety concerns. There were also no issues with the degradation of the formulation ingredients.

[0057] Furthermore, a similar usage test was conducted using the lotion from Formulation Example 1 and the conventional lotion from Comparative Formulation Example 1. As a result, a reduction in wrinkles and sagging was observed with the lotion containing the extract of the present invention. [Industrial applicability]

[0058] Based on the above, the myrtle extract of the present invention possesses excellent collagen production promoting, MMP inhibitory, and hyaluronic acid production promoting effects, as well as excellent stability. Therefore, the myrtle extract of the present invention can be used not only in the field of beauty, such as for skin aging, but also in the field of medicine, such as for suppressing functional decline due to aging, and for cancer prevention and treatment, and is expected to be applied to cosmetics, foods, quasi-drugs, and pharmaceuticals.

Claims

1. A collagen production promoter for improving dermal wrinkles, characterized by containing an extract of myrtle obtained by extraction with water, aqueous ethanol, or ethanol.

2. A hyaluronic acid production promoter for improving dermal wrinkles, characterized by containing an extract of myrtle obtained by extraction with water or ethanol.

3. A food composition for preventing and improving dermal wrinkles caused by increased MMP, characterized by containing an extract of myrtle obtained by extraction with water, aqueous ethanol, or ethanol.

Images