Modified phenylalanine dehydrogenase

The modified phenylalanine dehydrogenase with targeted amino acid mutations addresses low substrate specificity and solubility issues, enabling precise phenylalanine measurement and phenylpyruvate production for clinical and dietary applications.

JP7871922B2Active Publication Date: 2026-06-09AJINOMOTO CO INC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2025065143
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-10-11
Filing Date
2025-04-10
Publication Date
2026-06-09
Estimated Expiration
2040-10-09

AI Technical Summary

Technical Problem

Wild-type phenylalanine dehydrogenase exhibits low substrate specificity and solubility, leading to inaccurate phenylalanine measurement due to reactivity with tyrosine and aggregation issues.

Method used

A modified phenylalanine dehydrogenase with specific amino acid residue mutations in motifs (1) to (6) enhances substrate specificity, solubility, and enzyme activity, improving phenylalanine measurement accuracy.

Benefits of technology

The modified enzyme allows for rapid, highly accurate, and sensitive phenylalanine measurement and phenylpyruvate production, suitable for disease diagnosis and food analysis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007871922000016
    Figure 0007871922000016
  • Figure 0007871922000017
    Figure 0007871922000017
  • Figure 0007871922000018
    Figure 0007871922000018
Patent Text Reader

Abstract

To provide means and a method useful for more precise phenylalanine measurement.SOLUTION: The present invention provides a modified phenylalanine dehydrogenase that includes a mutation of at least one amino acid residue so as to improve the characteristics (for example, substrate specificity, solubility, and phenylalanine dehydrogenase activity) of a phenylalanine dehydrogenase related to measurement of phenylalanine; and a method for analyzing phenylalanine, the method comprising measuring phenylalanine contained in a test sample using the modified phenylalanine dehydrogenase.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention relates to a modified phenylalanine dehydrogenase and a method for analyzing phenylalanine using the same. [Background technology]

[0002] Phenylanine, an amino acid, is a biomarker that accumulates in large quantities in the blood and urine of patients with phenylketonuria (a hereditary phenylalanine metabolism disorder), and measuring phenylalanine levels is extremely important for clinical diagnosis. Furthermore, patients with phenylketonuria require dietary restrictions to limit phenylalanine content, making the measurement of phenylalanine content in food also important. As a method for measuring phenylalanine, an enzymatic measurement method using phenylalanine dehydrogenase derived from Thermoactinomyces intermedius (for example, Patent Document 1) is known.

[0003] A known method for measuring phenylalanine is an enzymatic method using phenylalanine dehydrogenase derived from Thermoactinomyces intermedius (for example, Patent Document 1). Furthermore, studies have been conducted on amino acid residues involved in the activity of phenylalanine dehydrogenase (Non-Patent Documents 1-4). [Prior art documents] [Patent Documents]

[0004] [Patent Document 1] Special Publication No. 7-114713 [Non-patent literature]

[0005] [Non-Patent Document 1] J Biochem. 1994 Dec;116(6):1370-1376 [Non-Patent Document 2] Biochemistry 2000, 39, 31, 9174-9187 [Non-Patent Document 3] Journal of Biotechnology Volume 142, Issue 2, 15 June 2009, Pages 127-134 [Non-Patent Document 4] PNAS 2016 113 (47) E7383-E7389 [Overview of the Initiative] [Problems that the invention aims to solve]

[0006] In the phenylalanine measurement using the aforementioned enzymes, it is desirable that the enzyme properties related to phenylalanine measurement (e.g., substrate specificity, solubility, and enzyme activity) are excellent. However, wild-type phenylalanine dehydrogenase has a problem of low substrate specificity due to its reactivity to tyrosine, for example, resulting in low accuracy in phenylalanine measurement. Furthermore, because wild-type phenylalanine dehydrogenase has low water solubility, it is provided in suspension form, and segregation of enzyme usage due to aggregation, etc., raises concerns about its impact on the accuracy of phenylalanine measurement. Therefore, for practical application of more accurate phenylalanine measurement, there is a need for an enzyme with higher substrate specificity, solubility, and enzyme activity.

[0007] The present invention aims to provide a modified phenylalanine dehydrogenase suitable for practical application in more accurate phenylalanine measurement. [Means for solving the problem]

[0008] As a result of diligent research, the inventors conceived the idea that phenylalanine concentration could be measured by using an enzyme with improved properties related to phenylalanine measurement (e.g., substrate specificity, solubility, and enzyme activity). They then succeeded in developing a phenylalanine dehydrogenase with such improved properties, thus completing the present invention.

[0009] In other words, the present invention is as follows: [1] In a phenylalanine dehydrogenase containing at least one motif selected from the group consisting of motifs (1) to (6) (where X represents any amino acid), at least one amino acid residue in the at least one motif selected from the group consisting of motifs (1) to (6) is mutated, It has phenylalanine dehydrogenase activity, and At least one characteristic selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity is higher than that of wild-type phenylalanine dehydrogenase. Modified phenylalanine dehydrogenase: Motif (1): GPALGGXRM (Sequence No. 3) motif; Motif (2): GRFXTGTDMGT (Sequence ID 4) motif; Motif (3): DF motif; Motif (4): GXANN (Sequence ID 5) motif; Motif (5): RH motif; Motif (6): VNXGGLIQV (Sequence ID 6) motif. [2] Modified phenylalanine dehydrogenase of [1], wherein the mutation is one or more substitutions selected from the group below in the amino acid sequence of phenylalanine dehydrogenase: (a) Leucine substitution in the GPALGXRM (SEQ ID NO: 3) motif; (b) Substitution of threonine, the seventh amino acid residue in the GRFXTGTDMGT (SEQ ID NO: 4) motif; (c) Substitution of phenylalanine in the DF motif; (d) Substitution of asparagine, the fourth amino acid residue in the GXANN (SEQ ID NO: 5) motif; (e) Substitution of arginine in the RH motif; (f) Substitution of asparagine in the VNXGGLIQV (Sequence ID 6) motif; (g) Leucine substitution in the VNXGGLIQV (Sequence ID 6) motif; (h) Substitution of glutamine in the VNXGGLIQV (SEQ ID NO: 6) motif; and (i) Substitution of valine, which is the 9th amino acid residue in the VNXGGLIQV (SEQ ID NO: 6) motif. [3] The modified phenylalanine dehydrogenase according to [2], wherein the mutation is one or more substitutions selected from the group consisting of the following in the amino acid sequence of phenylalanine dehydrogenase: (a) Substitution of leucine in the GPALGGXRM (SEQ ID NO: 3) motif with tryptophan, phenylalanine, tyrosine, or methionine; (b) Substitution of threonine, which is the 7th amino acid residue in the GRFXTGTDMGT (SEQ ID NO: 4) motif, with serine; (c) Substitution of phenylalanine in the DF motif with leucine or isoleucine; (d) Substitution of asparagine, which is the 4th amino acid residue in the GXANN (SEQ ID NO: 5) motif, with glycine, glutamine, threonine, lysine, proline, or serine; (e) Substitution of arginine in the RH motif with aspartic acid or glutamic acid; (f) Substitution of asparagine in the VNXGGLIQV (SEQ ID NO: 6) motif with valine, aspartic acid, methionine, glutamine, proline, isoleucine, histidine, alanine, threonine, glycine, or cysteine; (g) Substitution of leucine in the VNXGGLIQV (SEQ ID NO: 6) motif with phenylalanine, glutamine, histidine, asparagine, isoleucine, aspartic acid, glycine, glutamic acid, threonine, or serine; (h) Substitution of glutamine in the VNXGGLIQV (SEQ ID NO: 6) motif with aspartic acid, glutamic acid, lysine, asparagine, serine, or arginine; and (i) Substitution of valine, which is the 9th amino acid residue in the VNXGGLIQV (SEQ ID NO: 6) motif, with tyrosine, tryptophan, glutamic acid, asparagine, threonine, isoleucine, lysine, glycine, serine, leucine, methionine, glutamine, phenylalanine, cysteine, or arginine. [4] Phenylalanine dehydrogenase is any modified phenylalanine dehydrogenase of [1] to [3] that contains all of motifs (1) to (6) in this order. [5] A modified phenylalanine dehydrogenase of any of the following [1] to [4], derived from the genus Thermoactinomyces. [6] Phenylalanine dehydrogenase, (A) Amino acid sequence represented by Sequence ID No. 1, (B) An amino acid sequence represented by Sequence ID No. 1 that includes substitution, deletion, insertion, or addition of one or more amino acid residues, or (C) Amino acid sequence having 90% or more identity with the amino acid sequence represented by Sequence ID No. 1 A modified phenylalanine dehydrogenase containing any of the following [1] to [5]. [7] See below: (A) Amino acid sequence represented by Sequence ID No. 1, (B) An amino acid sequence represented by Sequence ID No. 1 that includes substitution, deletion, insertion, or addition of one or more amino acid residues, or (C) Amino acid sequence having 90% or more identity with the amino acid sequence represented by Sequence ID No. 1 In a phenylalanine dehydrogenase containing any of the following amino acid sequences, the below described: R2, R10, Y11, C19, L41, G42, G43, C44, A50, S51, M66, C70, F77, K90, Y112, T115, D11 6, F124, R129, L137, K139, S140, K144, T147, K173, C200, C210, K216, K220, Q222, N 227, R228, C234, C240, R255, C256, L257, N264, R271, Q277, K278, R279, S280, C282, N290, G293, L294, Q296, V297, R326, K328, N329, N331, C335, R340, K347, and K348 It includes an amino acid residue mutation corresponding to one or more more selected amino acid residues, It has phenylalanine dehydrogenase activity, and One or more properties selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity have been improved. Modified phenylalanine dehydrogenase. [8] A modified phenylalanine dehydrogenase of [7] comprising the substitution of one or more amino acid residues selected from the following: R2D, R2E, R10D, R10E, Y11E, Y11D, C19A, C19S, L41W, L41F, L41Y, L41M, G42A, G43A, C44A, C44S, A50D, A50E, S51D, S51E, M6 6I, M66L, M66V, C70A, C70S, F77L, F77I, F77R, K90E, Y112L, T115S, D116E, F124L, F124I, R129K, L137V, K139E, S140A, K14 4G, T147A, T147S, T147N, K173E, K173D, C200A, C200S, C210S, C210A, K216D, K216E, K220D, K220E, Q222E, Q222D, N227D, N 227E, R228E, R228D, C234A, C234S, C240S, C240A, R255E, R255D, C256A, C256S, L257K, N264G, N264Q, N264T, N264K, N264P , N264S, R271D, R271E, Q277D, K278D, K278E, R279D, R279E, S280D, C282S, C282A, N290V, N290D, N290M, N290Q, N290P, N29 0I, N290H, N290A, N290T, N290G, N290C, G293A, L294F, L294Q, L294H, L294N, L294I, L294D, L294G, L294E, L294T, L294S, Q 296D, Q296E, Q296K, Q296N, Q296S, Q296R, V297Y, V297W, V297E, V297N, V297T, V297I, V297K, V297G, V297S, V297L, V297M, V297Q, V297F, V297C, V297R, R326E, K328E, K328D, N329D, N331E, N331D, C335A, C335S, R340D, R340E, K347D, and K348E. A method for analyzing phenylalanine, comprising measuring the amount of phenylalanine contained in a test sample using one of the modified phenylalanine dehydrogenases described in [9] [1] to [8].

[10] Test sample is nicotinamide adenine dinucleotide (NAD + ) is mixed with modified phenylalanine dehydrogenase and NAD +The method of [9], comprising detecting NADH generated from. A method for producing phenylpyruvate, comprising producing phenylpyruvate from phenylalanine using any of the modified phenylalanine dehydrogenases described in

[11] , [1], to [8].

[12] A polynucleotide encoding any of the modified phenylalanine dehydrogenases described in [1] to [8]. An expression vector containing polynucleotides

[13] and

[12] . A transformant containing an expression unit of a polynucleotide encoding any of the modified phenylalanine dehydrogenases described in

[14] [1] to [8].

[15] A method for producing a modified phenylalanine dehydrogenase, comprising generating a modified phenylalanine dehydrogenase using the transformant of

[14] , wherein at least one amino acid residue is mutated to improve one or more properties selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity. A kit for phenylalanine analysis containing one of the modified phenylalanine dehydrogenases described in

[16] [1] to [8].

[17] Reaction buffer or buffer salt, and nicotinamide adenine dinucleotide (NAD + A phenylalanine analysis kit of

[16] further comprising at least one of the following:

[18] An enzyme sensor for phenylalanine analysis comprising (a) a detection electrode and (b) a modified phenylalanine dehydrogenase of any of [1] to [8] fixed to or positioned on the detection electrode. [Effects of the Invention]

[0010] The modified phenylalanine dehydrogenase of the present invention is useful for rapid, highly accurate, and sensitive measurement of phenylalanine and / or production of phenylpyruvate due to its improved substrate specificity. Furthermore, the modified phenylalanine dehydrogenase of the present invention has improved solubility, preventing segregation of enzyme usage due to aggregation, and is useful for uniform and highly accurate measurement of phenylalanine. The modified phenylalanine dehydrogenase of the present invention also exhibits improved phenylalanine dehydrogenase activity, making it useful for rapid and highly sensitive measurement of phenylalanine and / or production of phenylpyruvate. The modified phenylalanine dehydrogenase of the present invention is particularly useful as a liquid reagent. The analytical method of the present invention is useful, for example, for the diagnosis of diseases such as phenylketonuria and for measuring the phenylalanine content in food. [Brief explanation of the drawing]

[0011] [Figure 1] Figure 1 shows the amino acid sequence alignments near motif (1) (GPALGGXRM (SEQ ID NO: 3) motif) of wild-type phenylalanine dehydrogenase from various species. The arrows indicate representative mutation sites (L41, G42, and G43) for designing modified phenylalanine dehydrogenase. [Figure 2] Figure 2 shows the amino acid sequence alignments near motif (2) (GRFXTGTDMGT (SEQ ID NO: 4) motif) and motif (3) (DF motif) of wild-type phenylalanine dehydrogenase from each species. Arrows indicate representative mutation sites (T115 and F124). [Figure 3] Figure 3 shows the amino acid sequence alignments near motif (4) (GXANN (SEQ ID NO: 5) motif), motif (5) (RH motif), and motif (6) (VNXGGLIQV (SEQ ID NO: 6) motif) of wild-type phenylalanine dehydrogenase from each species. The arrows indicate representative mutation sites (N264, R271, N290, G293, L294, Q296, and V297) for designing modified phenylalanine dehydrogenase. [Modes for carrying out the invention]

[0012] The present invention provides a modified phenylalanine dehydrogenase. The modified phenylalanine dehydrogenase of the present invention may be one in which at least one amino acid residue has been mutated to improve one or more properties related to the measurement of phenylalanine, selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity (hereinafter also simply referred to as "enzyme activity" or "activity").

[0013] Amino acid residue mutations include substitutions, deletions, additions, and insertions, but substitutions are preferred.

[0014] The mutated amino acid residues are the natural L-α-amino acids: L-alanine (A), L-asparagine (N), L-cysteine ​​(C), L-glutamine (Q), L-isoleucine (I), L-leucine (L), L-methionine (M), L-phenylalanine (F), L-proline (P), L-serine (S), L-threonine (T), L-tryptophan (W), L-tyrosine (Y), L-valine (V), L-aspartic acid (D), L-glutamic acid (E), L-arginine (R), L-histidine (H), or L-lysine (K), or glycine (G). If the mutation is a substitution, addition, or insertion, the substituted, added, or inserted amino acid residues are the same as those described above. Hereafter, L and α may be omitted in the notation of amino acids.

[0015] Phenylalanine dehydrogenase (sometimes abbreviated as PheDH) is an oxidoreductase that catalyzes the following reaction (EC 1.4.1.20): L-phenylalanine + NAD + +H2O ←→ Phenylpyruvate + NH4 + +NADH

[0016] The modified phenylalanine dehydrogenase of the present invention can be derived from any organism (e.g., microorganisms such as bacteria, actinomycetes, and fungi, as well as insects, fish, animals, and plants), such as bacteria of the genus Thermoactinomyces (e.g., Thermoactinomyces intermedius, Thermoactinomyces sp.), bacteria of the genus Lihuaxuella (e.g., Lihuaxuella thermophile), bacteria of the genus Baia (e.g., Baia soyae), bacteria of the genus Caldalkalibacillus (e.g., Caldalkalibacillus thermarum), bacteria of the genus Bacillus (e.g., Bacillus badius, Bacillus sp., Bacillus halodurans, Lysinibacillus sphaericus (also called Bacillus sphaericus)), and bacteria of the genus Fictibacillus (e.g., Fictibacillus nanhaiensis). Examples of phenylalanine dehydrogenases derived from bacteria of the genus Lysinibacillus (e.g., Lysinibacillus sphaericus (also called Bacillus sphaericus)), Sporosarcina (e.g., Sporosarcina ureae), Rhodococcus (e.g., Rhodococcus sp.), and related genera include ), etc. Among the aforementioned bacteria, bacteria of the genus Thermoactinomyces are preferred, and Thermoactinomyces intermedius is more preferred. Examples of wild-type phenylalanine dehydrogenases are shown in Table 1 below.

[0017] [Table 1]

[0018] Examples of wild-type phenylalanine dehydrogenase include wild-type phenylalanine dehydrogenase containing at least one motif (e.g., 1, 2, 3, 4, 5, or 6) selected from the group consisting of motifs (1) to (6). Wild-type phenylalanine dehydrogenase may preferably contain multiple motifs (e.g., 2, 3, 4, 5, or 6) selected from the group consisting of motifs (1) to (6) in this order ("order" means the order from the N-terminus to the C-terminus in the amino acid sequence), more preferably contain all of motifs (1) to (6), and even more preferably contain all of motifs (1) to (6) in this order. In the following, motifs are represented by single-letter amino acid sequences, where X represents any amino acid (one of the 20 amino acids that make up proteins: alanine (A), asparagine (N), cysteine ​​(C), glutamine (Q), isoleucine (I), leucine (L), methionine (M), phenylalanine (F), proline (P), serine (S), threonine (T), tryptophan (W), tyrosine (Y), valine (V), aspartic acid (D), glutamic acid (E), arginine (R), histidine (H), lysine (K), and glycine (G)). Motif (1): GPALGGXRM (Sequence No. 3) motif; Motif (2): GRFXTGTDMGT (Sequence ID 4) motif; Motif (3): DF motif; Motif (4): GXANN (Sequence ID 5) motif; Motif (5): RH motif; Motif (6): VNXGGLIQV (Sequence ID 6) motif.

[0019] Motifs (1), (2), (4), and (6) include the following motifs (1a), (2a), (4a), (6a), and (6b) as motifs represented by shorter amino acid sequences. Therefore, wild-type phenylalanine dehydrogenase may be a wild-type phenylalanine dehydrogenase containing, for example, at least one motif (e.g., 1, 2, 3, 4, 5, 6, or 7 motifs) selected from the group consisting of motifs (1a), (2a), (3), (4a), (5), (6a), and (6b), preferably a plurality of motifs (e.g., 2, 3, 4, 5, 6, or 7 motifs) selected from the group consisting of motifs (1a), (2a), (3), (4a), (5), (6a), and (6b) in this order, more preferably all of motifs (1a), (2a), (3), (4a), (5), (6a), and (6b), and even more preferably all of motifs (1a), (2a), (3), (4a), (5), (6a), and (6b) in this order. Motif (1a): The GPALGG (sequence number 7) motif in Motif (1); Motif (2a): The TGTDMGT (sequence number 8) motif in motif (2); Motif (4a): The ANN motif within Motif (4); Motif (6a): The VN motif within motif (6); Motif (6b): The GGLIQV (sequence number 9) motif from Motif (6).

[0020] The modified phenylalanine dehydrogenase of the present invention may be a modified phenylalanine dehydrogenase in which, in the wild-type phenylalanine dehydrogenase described above, at least one amino acid residue in at least one motif selected from the group consisting of motifs (1) to (6) (e.g., at least one amino acid residue in at least one motif selected from the group consisting of motifs (1a), (2a), (3), (4a), (5), (6a), and (6b)) is mutated, and which has phenylalanine dehydrogenase activity, and at least one characteristic selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity is higher than that of the wild-type phenylalanine dehydrogenase.

[0021] In a preferred embodiment, the mutation that improves the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine is the substitution of leucine, glycine as the fifth amino acid residue, or glycine as the sixth amino acid residue in motif (1) (GPALGGXRM(SEQ ID NO: 3) motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (1) consists of nine consecutive amino acid residues of GPALGGXRM(SEQ ID NO: 3) (where X represents any amino acid residue). Alternatively, the amino acid residue to be substituted can be identified as leucine, glycine as the fifth amino acid residue, or glycine as the sixth amino acid residue in motif (1a) (GPALGG(SEQ ID NO: 7) motif), which is represented by a shorter amino acid sequence in motif (1). The position of motif (1) or (1a) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme, but those skilled in the art can appropriately determine the position of motif (1) or (1a) in the amino acid sequence of wild-type phenylalanine dehydrogenase and thus identify the position of the leucine or glycine (fifth or sixth) to be substituted. Typically, in the amino acid sequence of phenylalanine dehydrogenase, motif (1) is located in the amino acid region between positions 38 and 46, motif (1a) is located in the amino acid region between positions 38 and 43, the leucine to be substituted is at position 41, the glycine to be substituted (position 5) is at position 42, and the glycine to be substituted (position 6) is at position 43 (see Table 2 and Figure 1 for example).

[0022] [Table 2]

[0023] In a preferred embodiment, the mutation that improves the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine is the substitution of threonine, which is the seventh amino acid residue in motif (2) (GRFXTGTDMGT (SEQ ID NO: 4) motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (2) consists of 11 consecutive amino acid residues of GRFXTGTDMGT (SEQ ID NO: 4) (X represents any amino acid residue). Alternatively, the amino acid residue to be substituted can be identified as threonine, which is the third amino acid residue in motif (2a) (TGTDMGT (SEQ ID NO: 8) motif), which is represented by a shorter amino acid sequence in motif (2). The position of motif (2) or (2a) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme, but those skilled in the art can appropriately determine the position of motif (2) or (2a) in the amino acid sequence of wild-type phenylalanine dehydrogenase and thus identify the position of the threonine to be substituted. Typically, in the amino acid sequence of phenylalanine dehydrogenase, motif (2) is located in the amino acid region between positions 109 and 119, motif (2a) is located in the amino acid region between positions 113 and 119, and the threonine to be substituted is at position 115 (see, for example, Table 3 and Figure 2).

[0024] [Table 3]

[0025] In a preferred embodiment, the mutation that improves the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine is the substitution of phenylalanine in motif (3) (DF motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (3) consists of two consecutive amino acid residues DF. The position of motif (3) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme, but those skilled in the art can appropriately determine the position of motif (3) in the amino acid sequence of wild-type phenylalanine dehydrogenase and thus identify the position of the phenylalanine to be substituted. Typically, in the amino acid sequence of phenylalanine dehydrogenase, motif (3) is located in the amino acid region between positions 123 and 124, and the phenylalanine to be substituted is at position 124 (see, e.g., Table 4, Figure 2).

[0026] [Table 4]

[0027] In a preferred embodiment, the mutation that improves the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine is the substitution of asparagine, which is the fourth amino acid residue in motif (4) (GXANN (SEQ ID NO: 5) motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (4) consists of five consecutive amino acid residues of GXANN (SEQ ID NO: 5) (where X represents any amino acid residue). Alternatively, the amino acid residue to be substituted can be identified as asparagine, which is the second amino acid residue in motif (4a) (ANN motif), indicated by the shorter amino acid sequence in motif (4). The position of motif (4) or (4a) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme, but those skilled in the art can appropriately determine the position of motif (4) or (4a) in the amino acid sequence of wild-type phenylalanine dehydrogenase and thus identify the position of asparagine to be substituted. Typically, in the amino acid sequence of phenylalanine dehydrogenase, motif (4) is located in the amino acid region between positions 261 and 265, motif (4a) is located in the amino acid region between positions 263 and 265, and the asparagine to be substituted is located at position 264 (see, for example, Table 5 and Figure 3).

[0028] [Table 5]

[0029] In a preferred embodiment, the mutation that improves the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine is the substitution of arginine in motif (5) (RH motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (5) consists of two consecutive amino acid residues of RH. The position of motif (5) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme, but those skilled in the art can appropriately determine the position of motif (5) in the amino acid sequence of wild-type phenylalanine dehydrogenase and thus identify the position of the arginine to be substituted. Typically, in the amino acid sequence of phenylalanine dehydrogenase, motif (5) is located in the amino acid region between positions 271 and 272, and the arginine to be substituted is at position 271 (see, for example, Table 6 and Figure 3).

[0030] [Table 6]

[0031] In a preferred embodiment, mutations that improve the properties of phenylalanine dehydrogenase related to the measurement of phenylalanine are substitutions of asparagine, glycine, leucine, glutamine, or valine as the fifth amino acid residue in motif (6) (VNXGGLIQV (SEQ ID NO: 6) motif) of the amino acid sequence of wild-type phenylalanine dehydrogenase. Motif (6) consists of nine consecutive amino acid residues of VNXGGLIQV (SEQ ID NO: 6) (where X represents any amino acid residue). Alternatively, the amino acid residue to be substituted can be identified as asparagine in motif (6a) (VN motif), indicated by a shorter amino acid sequence in motif (6), or as glycine, leucine, glutamine, or valine as the second amino acid residue in motif (6b) (GGLIQV (SEQ ID NO: 9) motif), indicated by a shorter amino acid sequence in motif (6). The positions of motifs (6), (6a), or (6b) in the amino acid sequence of wild-type phenylalanine dehydrogenase may vary depending on the origin of the enzyme. However, those skilled in the art can appropriately determine the positions of motifs (6), (6a), or (6b) in the amino acid sequence of wild-type phenylalanine dehydrogenase, and thus identify the positions of asparagine, glycine, leucine, glutamine, or valine to be substituted. Typically, in the amino acid sequence of phenylalanine dehydrogenase, motif (6) is located in the amino acid region between positions 289 and 297, motif (6a) is located in the amino acid region between positions 289 and 290, motif (6b) is located in the amino acid region between positions 292 and 297, asparagine to be substituted is at position 290, glycine to be substituted is at position 293, leucine to be substituted is at position 294, glutamine to be substituted is at position 296, and valine to be substituted is at position 297 (see, for example, Table 7 and Figure 3).

[0032] [Table 7]

[0033] The modified phenylalanine dehydrogenase of the present invention can be produced by introducing a mutation into a wild-type enzyme having one or more motifs selected from motifs (1) to (6). The wild-type enzyme may have two, three, four, five, or six motifs selected from motifs (1) to (6). Alternatively, the modified phenylalanine dehydrogenase of the present invention can be produced by introducing a mutation into a wild-type enzyme having one or more motifs selected from motifs (1a), (2a), (3), (4a), (5), (6a), and (6b). The wild-type enzyme may have two, three, four, five, six, or seven motifs selected from motifs (1a), (2a), (3), (4a), (5), (6a), and (6b).

[0034] Characteristics of phenylalanine dehydrogenase relevant to the measurement of phenylalanine include substrate specificity, solubility, and enzyme activity. The modified phenylalanine dehydrogenase of the present invention may have only one of the above characteristics, or it may have two or three of the above characteristics.

[0035] The amino acid residues identified in motifs (1) to (6) may also be identified in motifs (1a), (2a), (3), (4a), (5), (6a), and (6b) based on the correspondence described above.

[0036] Regarding the mutations in the six motifs mentioned above, examples of mutations (single mutations or combinations of mutations) that improve at least one of the following properties selected from substrate specificity, solubility, and enzyme activity include: (a) Substitution of leucine in motif (1) with tryptophan, phenylalanine, tyrosine, or methionine; (a+) Substitution of glycine, the fifth amino acid residue in motif (1), with alanine; (a++) Substitution of glycine, the sixth amino acid residue in motif (1), with alanine; (b) Substitution of threonine, the seventh amino acid residue in motif (2), with serine; (c) Substitution of phenylalanine in motif (3) with leucine or isoleucine; (d) Substitution of asparagine, the fourth amino acid residue in motif (4), with glycine, glutamine, threonine, lysine, proline, or serine; (e) Substitution of arginine in motif (5) with aspartic acid or glutamic acid; (f) Substitution of asparagine in motif (6) with valine, aspartic acid, methionine, glutamine, proline, isoleucine, histidine, alanine, threonine, glycine, or cysteine; Substitution of glycine, the fifth amino acid residue in the (g-) motif (6), with alanine; (g) Substitution of leucine in motif (6) with phenylalanine, glutamine, histidine, asparagine, isoleucine, aspartic acid, glycine, glutamic acid, threonine, or serine; (h) Substitution of glutamine in motif (6) with aspartic acid, glutamic acid, lysine, asparagine, serine, or arginine; and (i) Substitution of valine, the 9th amino acid residue in motif (6), with tyrosine, tryptophan, glutamic acid, asparagine, threonine, isoleucine, lysine, glycine, serine, leucine, methionine, glutamine, phenylalanine, cysteine, or arginine.

[0037] If the modified phenylalanine dehydrogenase of the present invention is obtained by mutating two or more amino acid residues of the above-mentioned phenylalanine dehydrogenase, at least one, preferably at least two, of the amino acid residue mutations may be selected from the above-mentioned amino acid residue mutations. More preferably, all of the amino acid residue mutations may be selected from the above-mentioned amino acid residue mutations.

[0038] If the modified phenylalanine dehydrogenase contains two or more mutations, it is preferable that it contains one or more mutations selected from the following: (a) Substitution of leucine in motif (1); (b) Substitution of threonine, the seventh amino acid residue in motif (2); (c) Substitution of phenylalanine in motif (3); (e) Substitution of arginine in motif (5); (f) Substitution of asparagine in motif (6); (g) Substitution of leucine in motif (6); (h) Substitution of glutamine in motif (6); and (i) Substitution of valine, the 9th amino acid residue in motif (6). If the modified phenylalanine dehydrogenase contains two or more mutations, it is preferable that it contains one or more combinations of mutations selected from the following: (1)(f) Substitution of asparagine in motif (6), (b) Substitution of threonine, the seventh amino acid residue in motif (2), (c) Substitution of phenylalanine in motif (3), (e) substitution of arginine in motif (5), (h) Substitution of glutamine in motif (6), or (i) Substitution of valine, the 9th amino acid residue in motif (6) A combination; (2)(c) Substitution of phenylalanine in motif (3) and (b) Substitution of threonine, the seventh amino acid residue in motif (2), (g) Leucine substitution in motif (6), (h) Substitution of glutamine in motif (6), or (i) Substitution of valine, the 9th amino acid residue in motif (6) A combination; (3)(b) Substitution of threonine, which is the seventh amino acid residue in motif (2), (g) Substitution of leucine in motif (6), or (h) Substitution of glutamine in motif (6) A combination; (4)(h) Substitution of glutamine in motif (6) and (i) A combination of valine substitutions at the 9th amino acid residue in motif (6).

[0039] If the modified phenylalanine dehydrogenase contains two or more mutations, it is more preferable that it contains one or more mutations selected from the following: (a) Substitution of leucine with tryptophan in motif (1); (b) Substitution of threonine, the seventh amino acid residue in motif (2), with serine; (c) Substitution of phenylalanine in motif (3) with leucine or isoleucine; (e) Substitution of arginine with aspartic acid in motif (5); (f) Substitution of asparagine in motif (6) with aspartic acid, methionine, glutamine, or cysteine; (g) Substitution of leucine in motif (6) with glutamine or asparagine; (h) Substitution of glutamine with aspartic acid in motif (6); and (i) Substitution of valine, the 9th amino acid residue in motif (6), with glycine, phenylalanine, or arginine. If the modified phenylalanine dehydrogenase contains two or more mutations, it is more preferable that it contains one or more combinations of mutations selected from the following: (1)(f) Substitution of asparagine in motif (6) with aspartic acid, methionine, glutamine, or cysteine, (b) Substitution of threonine, the seventh amino acid residue in motif (2), with serine. (c) Substitution of phenylalanine with leucine or isoleucine in motif (3), (e) Substitution of arginine with aspartic acid in motif (5), (h) Substitution of glutamine with aspartic acid in motif (6), or (i) Substitution of valine, the 9th amino acid residue in motif (6), with glycine, phenylalanine, or arginine. A combination; (2)(c) Substitution of phenylalanine in motif (3) with leucine or isoleucine, (b) Substitution of threonine, the seventh amino acid residue in motif (2), with serine. (g) Substitution of leucine with glutamine or asparagine in motif (6), (h) Substitution of glutamine with aspartic acid in motif (6), or (i) Substitution of valine, the 9th amino acid residue in motif (6), with glycine, phenylalanine, or arginine. A combination; (3)(b) Substitution of threonine, the seventh amino acid residue in motif (2), with serine, (g) Substitution of leucine in motif (6) with glutamine or asparagine, (h) Substitution of glutamine with aspartate in motif (6) A combination; (4)(h) Substitution of glutamine to aspartic acid in motif (6), (i) A combination of substitutions of valine, the 9th amino acid residue in motif (6), with glycine, phenylalanine, or arginine.

[0040] If the modified phenylalanine dehydrogenase of the present invention is obtained by mutating three or more amino acid residues of the above-mentioned phenylalanine dehydrogenase, then at least one, preferably at least two, and more preferably at least three of the amino acid residue mutations may be selected from the above-mentioned amino acid residue mutations. Even more preferably, all of the amino acid residue mutations may be selected from the above-mentioned amino acid residue mutations.

[0041] If the modified phenylalanine dehydrogenase contains three or more mutations, it is preferable that it contains one or more mutations selected from the following: (a) Substitution of leucine in motif (1); (b) Substitution of threonine, the seventh amino acid residue in motif (2); (c) Substitution of phenylalanine in motif (3); (e) Substitution of arginine in motif (5); (f) Substitution of asparagine in motif (6); and (i) Substitution of valine, the 9th amino acid residue in motif (6). If the modified phenylalanine dehydrogenase contains three or more mutations, it is preferable that it contains the following combinations of mutations: (f) Substitution of asparagine in motif (6), (b) Substitution of threonine, the seventh amino acid residue in motif (2), (c) Substitution of phenylalanine in motif (3), or (e) Substitution of arginine in motif (5) A combination.

[0042] If the modified phenylalanine dehydrogenase contains three or more mutations, it is more preferable that it contains one or more mutations selected from the following: (a) Substitution of leucine with tryptophan in motif (1); (b) Substitution of threonine, the seventh amino acid residue in motif (2), with serine; (c) Substitution of phenylalanine with isoleucine in motif (3); (e) Substitution of arginine with aspartic acid in motif (5); (f) Substitution of asparagine in motif (6) with aspartic acid or methionine; and (i) Substitution of valine, the 9th amino acid residue in motif (6), with phenylalanine. If the modified phenylalanine dehydrogenase contains three or more mutations, it is more preferable that it contains the following combinations of mutations: (f) Substitution of asparagine in motif (6) with aspartic acid or methionine, (b) Substitution of threonine, the seventh amino acid residue in motif (2), with serine. (c) Substitution of phenylalanine with isoleucine in motif (3), or (e) Substitution of arginine with aspartic acid in motif (5) A combination.

[0043] If the modified phenylalanine dehydrogenase of the present invention is obtained by mutating four or more amino acid residues of the above-mentioned phenylalanine dehydrogenase, then at least one, preferably at least two, more preferably at least three, and even more preferably at least four of the amino acid residue mutations may be selected from the above-mentioned amino acid residue mutations. Even more preferably, all of the amino acid residue mutations may be selected from the above-mentioned amino acid residue mutations.

[0044] If the modified phenylalanine dehydrogenase contains four or more mutations, it is preferable that it contains one or more mutations selected from the following: (b) Substitution of threonine, the seventh amino acid residue in motif (2); (c) Substitution of phenylalanine in motif (3); (e) substitution of arginine in motif (5); and (f) Substitution of asparagine in motif (6). If the modified phenylalanine dehydrogenase contains four or more mutations, it is preferable that it contains the following combinations of mutations: (f) Substitution of asparagine in motif (6), (b) Substitution of threonine, the seventh amino acid residue in motif (2), (c) Substitution of phenylalanine in motif (3), or (e) Substitution of arginine in motif (5) A combination.

[0045] If the modified phenylalanine dehydrogenase contains four or more mutations, it is more preferable that it contains one or more mutations selected from the following: (b) Substitution of threonine, the seventh amino acid residue in motif (2), with serine; (c) Substitution of phenylalanine with isoleucine in motif (3); (e) Substitution of arginine with aspartic acid in motif (5); (f) Substitution of asparagine to aspartic acid in motif (6). If the modified phenylalanine dehydrogenase contains four or more mutations, it is more preferable that it contains the following combinations of mutations: (f) Substitution of asparagine to aspartic acid in motif (6), (b) Substitution of threonine, the seventh amino acid residue in motif (2), with serine. (c) Substitution of phenylalanine with isoleucine in motif (3), or (e) Substitution of arginine with aspartic acid in motif (5) A combination.

[0046] The phenylalanine dehydrogenase before the mutation may be a phenylalanine dehydrogenase containing any of the following amino acid sequences (A) to (C). (A) Amino acid sequence represented by Sequence ID No. 1, (B) An amino acid sequence represented by Sequence ID No. 1 that includes substitution, deletion, insertion, or addition of one or more amino acid residues, or (C) An amino acid sequence having 90% or more identity with the amino acid sequence represented by Sequence ID No. 1.

[0047] The amino acid sequence represented by Sequence ID No. 1 is wild-type phenylalanine dehydrogenase (TiPheDH(wt)) from Thermoactinomyces intermedius, and is encoded, for example, by the codon-optimized nucleotide sequence of TiPheDH(wt) (Sequence ID No. 2).

[0048] In the present invention, the amino acid residues that are the target of mutations such as substitution, deletion, insertion, and addition are typically natural L-α-amino acids: L-alanine (A), L-asparagine (N), L-cysteine ​​(C), L-glutamine (Q), L-isoleucine (I), L-leucine (L), L-methionine (M), L-phenylalanine (F), L-proline (P), L-serine (S), L-threonine (T), L-tryptophan (W), L-tyrosine (Y), L-valine (V), L-aspartic acid (D), L-glutamic acid (E), L-arginine (R), L-histidine (H), or L-lysine (K), or glycine (G). When the mutation is a substitution, addition, or insertion, the amino acid residue to be substituted, added, or inserted is the same as the mutated amino acid residue described above. In this specification, the letters L and α may be omitted when referring to amino acids.

[0049] The amino acid sequence in (B) above may contain mutations (e.g., substitutions, deletions, insertions, and additions) of one or more amino acid residues. The number of mutations is, for example, 1 to 50, preferably 1 to 45, 1 to 40, 1 to 35, 1 to 30, or 1 to 25, more preferably 1 to 20, even more preferably 1 to 15, and most preferably 1 to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10).

[0050] The amino acid sequence of (C) above may have at least 90% amino acid sequence identity with respect to the amino acid sequence represented by Sequence ID No. 1. The percentage of amino acid sequence identity may preferably be 91% or more, 92% or more, 93% or more or 94% or more, more preferably 95% or more or 96% or more, even more preferably 97% or more, and most preferably 98% or more or 99% or more.

[0051] The proteins identified by the amino acid sequences of (B) and (C) preferably have an activity of 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the phenylalanine dehydrogenase activity of the protein having the amino acid sequence of (A) above, when measured under the same conditions.

[0052] In this specification, amino acid sequence identity can be determined using algorithms such as BLAST by Karlin and Altschul (Pro.Natl.Acad.Sci.USA,90,5873(1993)) or FASTA by Pearson (MethodsEnzymol.,183,63(1990)). Based on the BLAST algorithm, a program called BLASTP has been developed (see http: / / www.ncbi.nlm.nih.gov), and amino acid sequence identity may be calculated using these programs with default settings. Alternatively, for example, the numerical value obtained by calculating similarity as a percentage using the full length of the polypeptide portion encoded in the ORF, with the setting "Gaps are NOT taken into account" or Unit Size to Compare=2, may be used as the amino acid sequence identity. The lowest value among the values ​​derived from these calculations may be adopted as the amino acid sequence identity.

[0053] (B) In order to prepare an amino acid sequence in which one or more amino acid residues are substituted, deleted, inserted, or added in the amino acid sequence represented by SEQ ID NO: 1, and (C) an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 1, if an amino acid residue mutation is introduced into the amino acid sequence represented by SEQ ID NO: 1 and the mutation is a substitution, such an amino acid residue substitution may be a conservative substitution. In this specification, the term "conservative substitution" means substituting a given amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are well known in the art. For example, such families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with nonpolar side chains (e.g., glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine), amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine), amino acids with hydroxyl group (e.g., alcoholic, phenolic)-containing side chains (e.g., serine, threonine, tyrosine), and amino acids with sulfur-containing side chains (e.g., cysteine, methionine). Amino acids having uncharged polar side chains and amino acids having nonpolar side chains are sometimes collectively referred to as neutral amino acids. Preferably, the conservative substitution of amino acids may be a substitution between aspartic acid and glutamic acid, a substitution between arginine, lysine and histidine, a substitution between tryptophan and phenylalanine, a substitution between phenylalanine and valine, a substitution between leucine, isoleucine and alanine, and a substitution between glycine and alanine.

[0054] If the phenylalanine dehydrogenase before the mutation is a phenylalanine dehydrogenase containing any of (A) to (C) described above, the modified phenylalanine dehydrogenase of the present invention is preferably as follows: R2, R10, Y11, C19, L41, G42, G43, C44, A50, S51, M66, C70, F77, K90, Y112, T115, D11 6, F124, R129, L137, K139, S140, K144, T147, K173, C200, C210, K216, K220, Q222, N 227, R228, C234, C240, R255, C256, L257, N264, R271, Q277, K278, R279, S280, C282, N290, G293, L294, Q296, V297, R326, K328, N329, N331, C335, R340, K347, and K348 A modified phenylalanine dehydrogenase may be one that contains mutations in amino acid residues corresponding to one or more selected amino acid residues, has enzymatic activity, and has improved one or more properties selected from the group consisting of substrate specificity, solubility, and enzymatic activity.

[0055] If the phenylalanine dehydrogenase before the mutation is a phenylalanine dehydrogenase comprising any of (A) to (C) described above, the modified phenylalanine dehydrogenase of the present invention is more preferably the following: R2D, R2E, R10D, R10E, Y11E, Y11D, C19A, C19S, L41W, L41F, L41Y, L41M, G42A, G43A, C44A, C44S, A50D, A50E, S51D, S51E, M 66I, M66L, M66V, C70A, C70S, F77L, F77I, F77R, K90E, Y112L, T115S, D116E, F124L, F124I, R129K, L137V, K139E, S140A, K1 44G, T147A, T147S, T147N, K173E, K173D, C200A, C200S, C210S, C210A, K216D, K216E, K220D, K220E, Q222E, Q222D, N227D, N227E, R228E, R228D, C234A, C234S, C240S, C240A, R255E, R255D, C256A, C256S, L257K, N264G, N264Q, N264T, N264K, N264 P, N264S, R271D, R271E, Q277D, K278D, K278E, R279D, R279E, S280D, C282S, C282A, N290V, N290D, N290M, N290Q, N290P, N2 90I, N290H, N290A, N290T, N290G, N290C, G293A, L294F, L294Q, L294H, L294N, L294I, L294D, L294G, L294E, L294T, L294S, Q296D, Q296E, Q296K, Q296N, Q296S, Q296R, V297Y, V297W, V297E, V297N, V297T, V297I, V297K, V297G, V297S, V297L, V297M, V297Q, V297F, V297C, V297R, R326E, K328E, K328D, N329D, N331E, N331D, C335A, C335S, R340D, R340E, K347D, and K348E The modified phenylalanine dehydrogenase may include substitutions of amino acid residues corresponding to one or more selected amino acid residues, possess enzymatic activity, and have improved one or more properties selected from the group consisting of substrate specificity, solubility, and enzymatic activity.

[0056] In one embodiment, the substrate specificity (substrate specificity of phenylalanine dehydrogenase to phenylalanine) is improved as a characteristic of phenylalanine dehydrogenase related to the measurement of phenylalanine. Improved substrate specificity of phenylalanine dehydrogenase to phenylalanine means that the reactivity of the modified phenylalanine dehydrogenase to phenylalanine is higher than that of the wild-type enzyme. In other words, it means that the reactivity of the modified phenylalanine dehydrogenase to amino acids other than phenylalanine is reduced. Examples of amino acids other than phenylalanine include L-α-amino acids other than phenylalanine. Specifically, examples of L-α-amino acids other than phenylalanine include the 19 L-α-amino acids other than phenylalanine that make up proteins, as well as cystine, taurine, citrulline, ornithine, and α-aminobutyric acid. Substrate specificity is measured using the lower reactivity (relative activity) of phenylalanine dehydrogenase to amino acids other than phenylalanine (e.g., tyrosine) compared to its reactivity to phenylalanine. The reactivity of phenylalanine dehydrogenase may be measured based on the amount of NADH produced in the enzymatic reaction. The degree of improvement in substrate specificity of the modified phenylalanine dehydrogenase compared to the wild-type enzyme is preferably greater than 1, with the wild-type characteristic set to 1, and more preferably greater than 1.01, 1.03, 1.04, 1.05, 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, or 12.0, respectively.

[0057] Mutations suitable for improving substrate specificity include, preferably, the following: (I) A mutation (e.g., substitution) of at least one amino acid residue in at least one motif selected from the group consisting of motifs (1) to (6); (II) One or more substitutions selected from the group consisting of the following: (a) Substitution of leucine in motif (1); (b) Substitution of threonine, the seventh amino acid residue in motif (2); (c) Substitution of phenylalanine in motif (3); (d) Substitution of asparagine, the fourth amino acid residue in motif (4); (e) Substitution of arginine in motif (5); (f) Substitution of asparagine in motif (6); (g) Substitution of leucine in motif (6); (h) Substitution of glutamine in motif (6); and (i) Substitution of valine, the 9th amino acid residue in motif (6). (III) Mutations (e.g., substitutions) of amino acid residues corresponding to one or more amino acid residues selected from the following: R10, Y11, C19, L41, G42, G43, C44, M66, C70, F77, Y112, T115, D116, F124, R129, L137, K139, S140, K144, T147, K173, C200, C210, Q222, R228, C234, C240, R255, C256, N264, R271, K278, C282, N290, G293, L294, Q296, V297, and C335.

[0058] More preferably, the following mutations are suitable for improving substrate specificity: (I) One or more substitutions selected from the group consisting of the following: (a) Substitution of leucine in motif (1) with tryptophan, phenylalanine, tyrosine, or methionine; (b) Substitution of threonine, the seventh amino acid residue in motif (2), with serine; (c) Substitution of phenylalanine in motif (3) with leucine or isoleucine; (d) Substitution of asparagine, the fourth amino acid residue in motif (4), with glycine, glutamine, threonine, lysine, proline, or serine; (e) Substitution of arginine with aspartic acid in motif (5); (f) Substitution of asparagine in motif (6) with valine, aspartic acid, methionine, glutamine, proline, isoleucine, histidine, alanine, threonine, glycine, or cysteine; (g) Substitution of leucine in motif (6) with phenylalanine, glutamine, histidine, asparagine, isoleucine, aspartic acid, glycine, glutamic acid, threonine, or serine; (h) Substitution of glutamine in motif (6) with aspartic acid, glutamic acid, lysine, asparagine, serine, or arginine; and (i) Substitution of valine, the 9th amino acid residue in motif (6), with tyrosine, tryptophan, glutamic acid, asparagine, threonine, isoleucine, lysine, glycine, serine, leucine, methionine, glutamine, phenylalanine, cysteine, or arginine. (II) Mutations (e.g., substitutions) of amino acid residues corresponding to one or more amino acid residues selected from the following: R10D, Y11E, C19A, C19S, L41W, L41F, L41Y, L41M, G42A, G43A, C44A, C44S, M66I, M66L, M66 V, C70A, C70S, F77L, F77I, F77R, Y112L, T115S, D116E, F124L, F124I, R129K, L137V, K139E , S140A, K144G, T147A, T147S, T147N, K173E, C200A, C210S, C210A, Q222D, R228E, C234A, C234S, C240S, C240A, R255E, C256A, C256S, N264G, N264Q, N264T, N264K, N264P, N264S, R2 71D, K278D, C282S, C282A, N290V, N290D, N290M, N290Q, N290P, N290I, N290H, N290A, N29 0T, N290G, N290C, G293A, L294F, L294Q, L294H, L294N, L294I, L294D, L294G, L294E, L294T L294S, Q296D, Q296E, Q296K, Q296N, Q296S, Q296R, V297Y, V297W, V297E, V297N, V297T, V297I, V297K, V297G, V297S, V297L, V297M, V297Q, V297F, V297C, V297R, C335A, and C335S.

[0059] In another embodiment, the solubility of phenylalanine dehydrogenase is improved as a characteristic of phenylalanine dehydrogenase related to the measurement of phenylalanine. Improved solubility of phenylalanine dehydrogenase means that the solubility of the modified phenylalanine dehydrogenase is greater than that of the wild-type enzyme. Specifically, the solubility of phenylalanine dehydrogenase can be measured, for example, by the concentration of the supernatant when an aqueous solution of phenylalanine dehydrogenase is concentrated until it aggregates. The degree of improvement in the solubility of the modified phenylalanine dehydrogenase compared to the wild-type enzyme is preferably greater than 1, with the wild-type characteristic set to 1, and more preferably greater than 1.01, 1.03, 1.04, 1.05, 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, or 12.0, respectively.

[0060] Mutations that are suitable for improving solubility include, preferably, the following: (I) A mutation (e.g., substitution) of at least one amino acid residue in at least one motif selected from the group consisting of motifs (1) to (3), (5), and (6); (II) One or more substitutions selected from the group consisting of the following: (a) Substitution of leucine in motif (1); (b) Substitution of threonine, the seventh amino acid residue in motif (2); (c) Substitution of phenylalanine in motif (3); (e) Substitution of arginine in motif (5); (f) Substitution of asparagine in motif (6); and (i) Substitution of valine, the 9th amino acid residue in motif (6). (III) Mutations (e.g., substitutions) of amino acid residues corresponding to one or more amino acid residues selected from the following: R2, R10, Y11, C19, L41, C44, A50, S51, C70, K90, T115, F124, K173, C200, C210, K216, K220, Q222, N227, R228, C240, R255, C256, L257, R271, Q277, K278, R279, C282, N290, V297, R326, N329, N331, C335, R340, and K348.

[0061] More preferably, the following mutations are suitable for improving solubility: (I) One or more substitutions selected from the group consisting of the following: (a) Substitution of leucine with tryptophan in motif (1); (b) Substitution of threonine, the seventh amino acid residue in motif (2), with serine; (c) Substitution of phenylalanine with isoleucine in motif (3); (e) Substitution of arginine in motif (5) with aspartic acid or glutamic acid; (f) Substitution of asparagine in motif (6) with aspartic acid or methionine; and (i) Substitution of valine, the 9th amino acid residue in motif (6), with phenylalanine. (II) Mutations (e.g., substitutions) of amino acid residues corresponding to one or more amino acid residues selected from the following: R2D, R2E, R10D, R10E, Y11E, Y11D, C19A, C19S, L41W, C44A, C44S, A50D, A50E, S51D, S51E, C70A, C70S, K90E , T115S, F124I, K173E, K173D, C200A, C200S, C210S, C210A, K216D, K216E, K220D, K220E, Q222E, Q222D, N2 27D, N227E, R228E, R228D, C240S, C240A, R255E, R255D, C256A, L257K, R271D, R271E, Q277D, K278D, K278E, R279E, C282S, C282A, N290D, N290M, V297F, R326E, N329D, N331E, N331D, C335A, C335S, R340D, and K348E.

[0062] In yet another embodiment, a characteristic of phenylalanine dehydrogenase related to the measurement of phenylalanine is its activity toward phenylalanine, which is improved. Improved activity toward phenylalanine means that the activity of the modified phenylalanine dehydrogenase toward phenylalanine is greater than that of the wild-type enzyme. Specifically, this improvement in activity toward phenylalanine can be achieved when the activity of the modified phenylalanine dehydrogenase toward phenylalanine at a given concentration (e.g., low or high concentration) is set to 100, and the activity of the wild-type phenylalanine dehydrogenase toward phenylalanine at the same concentration is greater than 100. Such a modified phenylalanine dehydrogenase enables rapid and highly sensitive measurement of phenylalanine, and is therefore useful for the measurement of phenylalanine. The degree of improvement in the activity of the modified phenylalanine dehydrogenase compared to the wild-type enzyme is preferably greater than 1 when the wild-type characteristic is set to 1, and more preferably greater than 1.01, 1.03, 1.04, 1.05, 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, or 12.0, respectively.

[0063] Mutations suitable for improving activity are preferably the following: (I) A mutation (e.g., substitution) of at least one amino acid residue in at least one motif selected from the group consisting of motifs (3), (5), and (6); (II) One or more substitutions selected from the group consisting of the following: (c) Substitution of phenylalanine in motif (3); (e) Substitution of arginine in motif (5); (f) Substitution of asparagine in motif (6); (g) Substitution of leucine in motif (6); (h) Substitution of glutamine in motif (6); and (i) Substitution of valine, the 9th amino acid residue in motif (6). (III) Mutations (e.g., substitutions) of amino acid residues corresponding to one or more amino acid residues selected from the following: R10, Y11, C19, F77, F124, T147, K173, C200, C210, K216, K220, Q222, N227, R228, C234, C240, R255, C256, R271, K278, R279, S280, C282, N290, L294, Q296, V297, K328, N329, N331, C335, R340, and K347.

[0064] More preferably, the following mutations are suitable for improving activity: (I) One or more substitutions selected from the group consisting of the following: (c) Substitution of phenylalanine with isoleucine in motif (3); (e) Substitution of arginine in motif (5) with aspartic acid or glutamic acid; (f) Substitution of asparagine in motif (6) with aspartic acid, threonine, or cysteine; (g) Substitution of leucine with glutamine in motif (6); (h) Substitution of glutamine in motif (6) with aspartic acid or glutamic acid; and (i) Substitution of valine, the 9th amino acid residue in motif (6), with threonine or glycine. (II) Mutations (e.g., substitutions) of amino acid residues corresponding to one or more amino acid residues selected from the following: R10D, Y11E, C19S, F77L, F124I, T147S, K173E, K173D, C200A, C200S, C210S, K216D, K216E, K220D, K220E, Q222E, Q222D, N227D, N227E, R228E, R228D, C234A, C234S, C240S, C240A, R25 5E, R255D, C256A, R271D, R271E, K278D, R279D, R279E, S280D, C282S, N290D, N290T, N290C, L294Q, Q296D, Q296E, V297T, V297G, K328E, K328D, N329D, N331D, C335A, R340E, and K347D.

[0065] The modified phenylalanine dehydrogenase of the present invention may contain an amino acid sequence having at least 90% amino acid sequence identity with the amino acid sequence of the pre-mutation (wild-type) phenylalanine dehydrogenase, either by having the above-described mutation alone or by having both the above-described mutation and additional mutations. The percentage of amino acid sequence identity may preferably be 92% or more, more preferably 95% or more, even more preferably 97% or more, and most preferably 98% or more or 99% or more.

[0066] The modified phenylalanine dehydrogenase of the present invention may also have other peptide components (e.g., tag portions) at its C-terminus or N-terminus. Other peptide components that can be added to the modified phenylalanine dehydrogenase of the present invention include, for example, peptide components that facilitate the purification of the target protein (e.g., tag portions such as histidine tag and Strep-tag II; proteins commonly used for the purification of target proteins such as glutathione-S-transferase and maltose-binding proteins), peptide components that improve the solubility of the target protein (e.g., Nus-tag), peptide components that act as chaperones (e.g., trigger factors), and peptide components that have other functions, such as protein domains or linkers connecting them.

[0067] The identity of amino acid sequences can be determined using algorithms such as BLAST by Karlin and Altschul (Pro.Natl.Acad.Sci.USA,90,5873(1993)) or FASTA by Pearson (MethodsEnzymol.,183,63(1990)). Based on the BLAST algorithm, a program called BLASTP has been developed (see http: / / www.ncbi.nlm.nih.gov), and the identity of amino acid sequences can be calculated using these programs with default settings. Alternatively, the similarity can be calculated using the percentage obtained by using GENETYX Ver7.0.9 software from Genetics Co., Ltd., which employs the Lipman-Pearson method, with the full length of the polypeptide portion encoded in the ORF and the Unit Size to Compare=2 setting. The lowest value among the values ​​derived from these calculations can be adopted as the identity of the amino acid sequences.

[0068] The locations of amino acid residues in the amino acid sequence where additional mutations can be introduced are obvious to those skilled in the art, and additional mutations can be introduced, for example, by referring to the alignment of the amino acid sequence. Specifically, those skilled in the art can 1) compare the amino acid sequences of multiple homologs (e.g., the amino acid sequence represented by SEQ ID NO: 1 and the amino acid sequences of other homologs), 2) identify relatively conserved and relatively unconserved regions, and then 3) predict from the relatively conserved and relatively unconserved regions which regions may play an important role in function and which may not, thus recognizing the correlation between structure and function. Furthermore, as mentioned above, the results of the analysis of the three-dimensional structure of phenylalanine dehydrogenase have been reported, so those skilled in the art can introduce additional mutations based on the results of the analysis of the three-dimensional structure in a way that allows for the preservation of the above-mentioned characteristics. The sites where additional mutations are introduced may be amino acid residues other than those mentioned above.

[0069] When an additional mutation in an amino acid residue is a substitution, such a substitution of an amino acid residue may be a conservative substitution. The term "conservative substitution" refers to the substitution of a given amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains are well known in this field. For example, such families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with nonpolar side chains (e.g., glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine), amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine), amino acids with hydroxyl group (e.g., alcoholic, phenolic)-containing side chains (e.g., serine, threonine, tyrosine), and amino acids with sulfur-containing side chains (e.g., cysteine, methionine). Preferably, the conservative amino acid substitutions may be substitutions between aspartic acid and glutamic acid, between arginine, lysine and histidine, between tryptophan and phenylalanine, between phenylalanine and valine, between leucine, isoleucine and alanine, and between glycine and alanine.

[0070] The present invention also provides a polynucleotide encoding a modified phenylalanine dehydrogenase. The polynucleotide of the present invention may be DNA or RNA, but is preferably DNA.

[0071] The modified phenylalanine dehydrogenase of the present invention can be prepared using a transformant of the present invention expressing the modified phenylalanine dehydrogenase of the present invention, or using a cell-free system, etc. The transformant of the present invention can be prepared, for example, by preparing an expression vector of the present invention and then introducing this expression vector into a host.

[0072] The present invention provides an expression vector. The expression vector of the present invention comprises a polynucleotide of the present invention, or a polynucleotide encoding a modified phenylalanine dehydrogenase of the present invention.

[0073] The expression vector of the present invention comprises the polynucleotide (e.g., DNA, RNA) of the present invention encoding the modified phenylalanine dehydrogenase of the present invention. The expression vector of the present invention may further include, in addition to the polynucleotide of the present invention, regions such as a promoter, terminator, and a region encoding a drug (e.g., tetracycline, ampicillin, kanamycin, hygromycin, phosphinothricin) resistance gene. The expression vector of the present invention may be a plasmid or an integrative vector. The expression vector of the present invention may also be a viral vector or a cell-free vector. The expression vector of the present invention may further include a polynucleotide encoding another peptide component that can be added to the modified phenylalanine dehydrogenase of the present invention at the 3' or 5' end of the polynucleotide of the present invention. Examples of polynucleotides encoding other peptide components include a polynucleotide encoding a peptide component that facilitates the purification of the target protein as described above, a polynucleotide encoding a peptide component that improves the solubility of the target protein as described above, a polynucleotide encoding a peptide component that acts as a chaperone, and a polynucleotide encoding a peptide component that has other functions, or a protein domain or linker connecting them. Various expression vectors containing polynucleotides encoding other peptide components are available. Therefore, such expression vectors may be used to prepare the expression vectors of the present invention. For example, expression vectors containing polynucleotides encoding peptide components that facilitate the purification of the target protein (e.g., pET-15b, pET-51b, pET-41a, pMAL-p5G), expression vectors containing polynucleotides encoding peptide components that improve the solubility of the target protein (e.g., pET-50b), expression vectors containing polynucleotides encoding peptide components that act as chaperones (e.g., pCold TF), and expression vectors containing polynucleotides encoding proteins or protein domains with other functions or peptide components that act as linkers connecting them can be used.To enable the cleavage of the modified phenylalanine dehydrogenase and other peptide components attached thereto after protein expression, the expression vector of the present invention may include a region encoding the protease cleavage site between the polynucleotide encoding the modified phenylalanine dehydrogenase and the polynucleotide encoding the other peptide component.

[0074] Various prokaryotic cells can be used as hosts for expressing the modified phenylalanine dehydrogenase of the present invention, including Escherichia bacteria such as Escherichia coli, Corynebacterium bacteria (e.g., Corynebacterium glutamicum), and Bacillus bacteria (e.g., Bacillus subtilis), as well as various eukaryotic cells including Saccharomyces bacteria (e.g., Saccharomyces cerevisiae), Pichia bacteria (e.g., Pichia stipitis), and Aspergillus bacteria (e.g., Aspergillus oryzae). A strain lacking a specific gene may also be used as the host. Examples of transformants include transformants that possess an expression vector in the cytoplasm, and transformants in which the target gene has been introduced into the genome.

[0075] The transformant of the present invention is a host cell capable of producing the modified phenylalanine dehydrogenase of the present invention, or a host cell capable of producing the modified phenylalanine dehydrogenase by expressing the polynucleotide of the present invention. Specifically, the transformant of the present invention is a host cell containing an expression unit comprising the polynucleotide of the present invention. Examples of host cells containing an expression unit comprising the polynucleotide of the present invention include a host cell into which the expression vector of the present invention has been introduced as a whole, and a host cell into which the expression unit in the expression vector of the present invention has been introduced into its genome. The host cell is not particularly limited as long as it can express the modified phenylalanine dehydrogenase of the present invention. The host cell may be homogeneous or heterogeneous with respect to the modified phenylalanine dehydrogenase of the present invention and the polynucleotide of the present invention, but heterogeneous is preferred. The host cell may also be homogeneous or heterogeneous with respect to the promoter, but heterogeneous is preferred. Examples of host cells include animal cells, plant cells, insect cells, and microorganisms, but microorganisms are preferred. More preferably, the host cell used in the present invention is a bacterium or fungus. The bacterium may be a Gram-positive bacterium or a Gram-negative bacterium.

[0076] The transformants of the present invention can be cultured in a culture medium having, for example, the composition described below, using a predetermined culture apparatus (e.g., test tubes, flasks, jar fermenters). Culture conditions can be set as appropriate. Specifically, the culture temperature may be 10°C to 37°C, the pH may be 6.5 to 7.5, and the culture time may be 1h to 100h. Culture may also be carried out while controlling the dissolved oxygen concentration. In this case, the dissolved oxygen concentration (DO value) in the culture medium may be used as a control indicator. The aeration and stirring conditions can be controlled so that the relative dissolved oxygen concentration (DO value), assuming an atmospheric oxygen concentration of 21%, does not fall below, for example, 1 to 10%, preferably 3% to 8%. Furthermore, the culture may be performed by batch culture or fed-batch culture. In the case of fed-batch culture, the culture can be continued by continuously or discontinuously adding a solution that serves as a sugar source or a solution containing phosphate to the culture medium.

[0077] As mentioned above, the host organism to be transformed is Escherichia coli. Specifically, for Escherichia coli, it can be selected from the Escherichia coli K12 subspecies, including strains JM109, DH5α, HB101, and BL21(DE3). Methods for performing transformation and selecting transformants are described in publications such as *Molecular Cloning: A Laboratory Manual*, 3rd edition, Cold Spring Harbor press (2001 / 01 / 15). Below, a more detailed example will be provided of how to prepare transformed Escherichia coli and use it to produce a specific enzyme.

[0078] As promoters for expressing the polynucleotides of the present invention, promoters commonly used for heterologous protein production in E. coli can be used. Examples of strong promoters include PhoA, PhoC, T7 promoter, lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, and T5 promoter, with PhoA, PhoC, and lac being preferred. As vectors, for example, pUC (e.g., pUC19, pUC18), pSTV, pBR (e.g., pBR322), pHSG (e.g., pHSG299, pHSG298, pHSG399, pHSG398), RSF (e.g., RSF1010), pACYC (e.g., pACYC177, pACYC184), pMW (e.g., pMW119, pMW118, pMW219, pMW218), pQE (e.g., pQE30), and their derivatives may be used. Other vectors may include phage DNA vectors. Furthermore, expression vectors containing a promoter and capable of expressing the inserted DNA sequence may be used. Preferably, the vectors may be pUC, pSTV, or pMW.

[0079] Furthermore, a terminator, which is a transcription termination sequence, may be ligated downstream of the polynucleotide of the present invention. Examples of such terminators include the T7 terminator, the fd phage terminator, the T4 terminator, the tetracycline resistance gene terminator, and the E. coli trpA gene terminator.

[0080] The vector for introducing the polynucleotide of the present invention into E. coli is preferably a so-called multicopy type, and examples include plasmids having a replication origin site derived from ColE1, such as pUC plasmids or pBR322 plasmids or their derivatives. Here, "derivative" means a plasmid that has been modified by base substitution, deletion, insertion and / or addition.

[0081] Furthermore, it is preferable that the vector contains markers such as ampicillin resistance genes in order to select transformants. Such plasmids, expression vectors with strong promoters, are commercially available [e.g., pUC series (Takara Bio Inc.), pPROK series (Clonetech Inc.), pKK233-2 (Clonetech Inc.)].

[0082] By transforming Escherichia coli using the obtained expression vector of the present invention and culturing this Escherichia coli, the modified phenylalanine dehydrogenase of the present invention can be obtained.

[0083] As the culture medium, you may use a medium commonly used for culturing E. coli, such as M9-casamino acid medium or LB medium. The medium may contain a specified carbon source, nitrogen source, and coenzyme (e.g., pyridoxine hydrochloride). Specifically, you may use peptone, yeast extract, NaCl, glucose, MgSO4, ammonium sulfate, potassium dihydrogen phosphate, ferric sulfate, manganese sulfate, etc. Furthermore, the culture conditions and production induction conditions should be appropriately selected according to the type of vector marker, promoter, host bacteria, etc. used.

[0084] The modified phenylalanine dehydrogenase of the present invention can be recovered by the following methods. The modified phenylalanine dehydrogenase of the present invention can be obtained as a lysate and lysate by recovering the transformant of the present invention and then disrupting (e.g., sonication, homogenization) or lysating (e.g., lysozyme treatment) the bacterial cells. The modified phenylalanine dehydrogenase of the present invention can be obtained by subjecting such lysates and lysates to extraction, precipitation, filtration, column chromatography, or other methods.

[0085] The present invention provides a method for analyzing phenylalanine. The analytical method of the present invention may include measuring the amount of phenylalanine contained in a test sample using a modified phenylalanine dehydrogenase of the present invention.

[0086] The test sample is not particularly limited as long as it is a sample suspected to contain phenylalanine, and examples include biological samples (e.g., blood, urine, saliva, tears, etc.) and food and beverage products (e.g., nutritional drinks, amino acid drinks, etc.). The phenylalanine in the test sample may be at a low concentration (e.g., less than 1 mM, such as 1 μM or more and less than 1 mM) or a high concentration (e.g., 1 mM or more and less than 1 M, such as 1 mM or more and less than 1 M).

[0087] The analytical method of the present invention is not particularly limited as long as phenylalanine can be measured using the modified phenylalanine dehydrogenase of the present invention, but for example, under alkaline or neutral conditions, preferably in an alkaline buffer, the test sample is prepared using nicotinamide adenine dinucleotide (NAD + ) is mixed with the mixture, and then subjected to an enzymatic reaction using the modified phenylalanine dehydrogenase of the present invention, and finally, NAD is produced by the action of the modified phenylalanine dehydrogenase of the present invention. + Phenylalanine is measured by detecting NADH produced from nicotinamide adenine dinucleotide (NAD). Specifically, nicotinamide adenine dinucleotide (NAD) +In the presence of [substance in (0)], by allowing modified phenylalanine dehydrogenase to act on a test sample in an alkaline buffer solution, the amino group of the substrate contained in the biological sample is oxidatively deaminated, and nicotinamide adenine dinucleotide (NAD + ) is reduced to reduced form (NADH). Therefore, by detecting NADH using absorbance (340 nm) or the like, phenylalanine can be quantified. A method for measuring an amino acid by such a methodology is known (see, for example, Ueatrongchit T, Asano Y, Anal Biochem. 2011 Mar 1;410(1):44-56). Also, by reducing a dye with the generated NADH and detecting the color development of the reduced dye as absorbance or the like, phenylalanine can be measured. Furthermore, detection of NADH by an electrochemical method is also possible. For example, under alkaline or neutral conditions, in addition to electrochemically oxidizing NADH generated by allowing modified phenylalanine dehydrogenase to act on a test sample and measuring the oxidation current, phenylalanine can be measured by reducing a coexisting electron mediator with the generated NADH and measuring the electrochemical oxidation current of the reduced electron mediator. A catalyst may be involved in the electron transfer between NADH and the electron mediator. The measurement of phenylalanine is preferably performed by the rate method (initial velocity method).

[0088] The modified phenylalanine dehydrogenase of the present invention does not react with amino acids other than phenylalanine or has low reactivity thereto. Therefore, even when the test sample contains not only phenylalanine but also other amino acids, the amount of phenylalanine in the test sample can be evaluated by using the modified phenylalanine dehydrogenase of the present invention.

[0089] Furthermore, the present invention includes a kit for phenylalanine analysis containing the modified phenylalanine dehydrogenase of the present invention. The kit of the present invention contains a buffer solution or buffer salt for reaction, and nicotinamide adenine dinucleotide (NAD +) may further include at least one of the following.

[0090] A reaction buffer or buffer salt is used to maintain the pH of the reaction mixture at a value suitable for the desired enzymatic reaction. The reaction buffer or buffer salt is, for example, alkaline or neutral, and preferably alkaline.

[0091] The kit of the present invention is nicotinamide adenine dinucleotide (NAD + If it contains ), the kit of the present invention may further contain a dye that is reduced by NADH. In this case, the action of the modified phenylalanine dehydrogenase of the present invention reduces NAD + The dye is reduced by NADH generated from the substance, and the resulting color change of the reducing dye can be detected by absorbance or other means. Substances acting as electron mediators may also be involved in the reduction of the dye.

[0092] The present invention also provides an enzyme sensor for phenylalanine analysis, comprising (a) a detection electrode and (b) a modified phenylalanine dehydrogenase of the present invention immobilized or positioned on the detection electrode. The modified phenylalanine dehydrogenase of the present invention is immobilized or positioned directly or indirectly on the electrode.

[0093] As the detection electrode, for example, a product or by-product (NH3 + NADH + H) produced from phenylalanine by the modified phenylalanine dehydrogenase of the present invention. + It is possible to use a biosensor that directly or indirectly detects ), more specifically the modified phenylalanine dehydrogenase and nicotinamide adenine dinucleotide (NAD) of the present invention. + Examples include detection electrodes that utilize ). For example, those described in International Publication No. 2005 / 075970 and International Publication No. 00 / 57166 can be used as such detection electrodes. [Examples]

[0094] The present invention will be described in more detail by the following examples, but the present invention is not limited to these examples.

[0095] [Example 1] Construction of a plasmid for PheDH (wild-type) expression A recombinant expression system for PheDH was constructed using Escherichia coli. First, a plasmid for recombinant expression was constructed. As an insertion sequence for pET-24a (Merck), a DNA fragment (SEQ ID NO: 112) was created by chemical synthesis by adding a nucleotide sequence containing an NdeI site + start codon + His-tag coding sequence (CATATGCATCACCATCACCACCAC, SEQ ID NO: 113) to the 5' end and a nucleotide sequence containing a stop codon + BamHI site (TAATGAGGATCC, SEQ ID NO: 114) to the 3' end of a nucleotide sequence encoding the amino acid sequence of wild-type PheDH from Thermoactinomyces intermedius (SEQ ID NO: 1) (codon-optimized PheDH, SEQ ID NO: 2). This fragment was then incorporated into the NdeI and BamHI restriction enzyme sites of pET-24a to obtain a PheDH (wild-type) expression plasmid. Using this plasmid as a template, insertion of the target gene into the plasmid was confirmed using standard DNA sequencing methods. Transformants of Escherichia coli BL21 (DE3) were obtained according to standard methods.

[0096] Hereafter, the plasmid containing a PheDH sequence with a His-tag added to the N-terminus (amino acid sequence is SEQ ID NO: 111, nucleotide sequence is SEQ ID NO: 112) (PheDH expression plasmid) will be called pET24a-PheDH, and the BL21(DE3) transformant produced by pET24a-PheDH will be called pET24a-PheDH-BL21(DE3).

[0097] [Example 2] Construction of a plasmid for PheDH mutant expression PheDH mutants were prepared as follows: Using KAPA HiFi HS ReadyMix (Kapa Biosystems), pET24a-PheDH was used as a template to introduce mutations into the PheDH gene according to standard procedures. When introducing multiple mutations, the plasmid containing the mutations was used as a template to sequentially introduce additional mutations. The introduction of the target mutation into each expression plasmid was confirmed using standard DNA sequencing methods. Transformants of E. coli BL21(DE3) were obtained according to standard procedures.

[0098] [Example 3] Preparation of PheDH (Preparation of PheDH for substrate specificity evaluation) PheDH for substrate specificity evaluation was prepared as follows. First, glycerol stocks of various Escherichia coli BL21(DE3) transformants obtained in Example 1 and Example 2 were inoculated into LB plates containing 25 μg / mL kanamycin and incubated at 37°C overnight. 2 mL of LB liquid medium containing 25 μg / mL kanamycin was placed in a 14 mL tube, single colonies from the LB plate were inoculated, and incubated at 37°C overnight with reciprocating shaking. 50 μL of culture solution was added to 4 mL of LB liquid medium containing 25 μg / mL kanamycin and incubated at 37°C with reciprocating shaking until the OD600 value was approximately 0.9. After standing at 30°C for 30 minutes, IPTG was added to a final concentration of 0.5 mM, incubated overnight at 30°C with reciprocating shaking, and then collected in a 2 mL tube.

[0099] The bacterial cells were suspended in a disruption buffer (200 mM Tris-HCl, pH 8.0) and disrupted using an ultrasonic disruptor (BIORUPTOR, Cosmo Bio Co., Ltd.). The disrupted solution was centrifuged at 6,000 × g for 10 minutes, and the target protein, PheDH, was collected as the supernatant.

[0100] (Preparation of PheDH for solubility and activity evaluation) PheDH for solubility and activity evaluation was prepared as follows. First, glycerol stocks of various Escherichia coli BL21(DE3) transformants obtained in Example 1 and Example 2 were inoculated into LB plates containing 25 μg / mL kanamycin and incubated at 37°C overnight. 2 mL of LB liquid medium containing 25 μg / mL kanamycin was placed in a 14 mL tube, single colonies from the LB plate were inoculated, and incubated at 37°C overnight with reciprocating shaking. 300 μL of culture solution was added to 30 mL of LB liquid medium containing 25 μg / mL kanamycin and incubated at 37°C with reciprocating shaking until the OD600 value was approximately 0.9. After standing at 30°C for 30 minutes, IPTG was added to a final concentration of 0.5 mM, incubated overnight at 30°C with reciprocating shaking, and then collected in a 50 mL tube.

[0101] The bacterial cells were suspended in a wash buffer (50 mM HEPES, 500 mM NaCl, 50 mM imidazole, pH 7.5) and disrupted using an ultrasonic disruptor (BIORUPTOR, Cosmo Bio). The disrupted solution was centrifuged at 14,000 × g for 10 minutes, and the supernatant was collected. This supernatant was then added to Ni Sepharose 6 Fast Flow (GE Healthcare Japan), which had been equilibrated with the wash buffer. After gentle inversion mixing at room temperature for 5 minutes, the solution was removed by gravity using an EconoSpin® empty column (Gene Design). Subsequently, the solution was washed with the wash buffer, and the target protein, PheDH, was eluted with an elution buffer (50 mM HEPES, 500 mM NaCl, 500 mM imidazole, pH 7.5). The PheDH solution was replaced with stock buffer (100 mM Tris-HCl, pH 8.0) by ultrafiltration.

[0102] [Example 4] Evaluation of substrate specificity of PheDH The substrate specificity of each enzyme prepared in Example 3 was evaluated using the following procedure: PheDH was prepared to a concentration of 0.5 mg / mL, and 20 μL of PheDH was mixed with 100 μL of 200 mM Glycine-KCl-KOH, pH 10.0, and 50 mM NAD. +The absorbance over time at a wavelength of 340 nm was measured for 5 minutes using a microplate reader (SpectraMax M2e, Molecular Devices Corporation) for a solution containing 4 μL of (Fujifilm Wako Pure Chemical Industries, Ltd.), 20 μL of 10 mM L-phenylalanine aqueous solution or 10 mM L-tyrosine aqueous solution, and 56 μL of ultrapure water. The relative activity of the L-tyrosine aqueous solution measurement, with the absorbance value at 5 minutes set to 100% for the L-phenylalanine aqueous solution measurement, is shown in Tables 8 and 9, respectively, for both wild-type and mutant PheDH. The results in Tables 8 and 9 were calculated from the average values ​​obtained from two experiments performed on the same sample. The WT value used was the average value of the results of 16 preparations and substrate specificity evaluations of wild-type PheDH. When indicating a mutant PheDH with multiple introduced mutations, the introduced mutations are separated by a slash ( / ) and listed consecutively. For example, C19S / N290D means a mutant PheDH with two mutations, C19S and N290D. WT means wild type.

[0103] The results in Table 8 show that the responsiveness of PheDH to L-tyrosine can be suppressed by introducing the mutations shown in Table 8. Furthermore, the results in Table 9 show that the responsiveness of PheDH to L-tyrosine can be suppressed by introducing multiple mutations shown in Table 9.

[0104] [Table 8]

[0105] [Table 9-1]

[0106] [Table 9-2]

[0107] [Example 5] Evaluation of the solubility of PheDH The solubility of each enzyme prepared in Example 3 was evaluated using the following procedure. PheDH, which had been solvent-substituted in stock buffer, was concentrated by ultrafiltration until it aggregated. 30 μL of PheDH was placed in a 1.5 mL tube and centrifuged at 18,500 × g for 60 minutes, and the supernatant was collected. The concentrations of the recovered wild-type and mutant supernatants after centrifugation were defined as the solubility. The results compared with the solubility of wild-type PheDH are shown in Tables 10 and 11.

[0108] The results in Table 10 show that the solubility of PheDH increases with the introduction of the mutations shown in Table 10. Furthermore, the results in Table 11 show that the solubility of PheDH increases with the introduction of multiple mutations shown in Table 11.

[0109] [Table 10]

[0110] [Table 11-1]

[0111] [Table 11-2]

[0112] [Example 6] Evaluation of PheDH enzyme activity The activity of each enzyme prepared in Example 3 was evaluated using the following procedure. PheDH was prepared in stock buffer by solvent substitution to a concentration of 0.1 mg / mL. 20 μL of PheDH was mixed with 100 μL of 200 mM Glycine-KCl-KOH, pH 10.0, and 50 mM NAD. +The absorbance over time at a wavelength of 340 nm was measured for 5 minutes using a microplate reader (SpectraMax M2e, Molecular Devices Corporation) for a solution containing 4 μL of (Fujifilm Wako Pure Chemical Industries, Ltd.), 20 μL of 10 mM L-phenylalanine aqueous solution, and 56 μL of ultrapure water. The relative activity compared to wild-type PheDH values ​​(used as a control) is shown in Tables 12 and 13. The results in Tables 12 and 13 were calculated from the average values ​​obtained from two experiments performed on the same sample.

[0113] The results in Table 12 show that the reactivity of PheDH to L-phenylalanine can be improved by introducing the mutations shown in Table 12. Furthermore, the results in Table 13 show that the reactivity of PheDH to L-phenylalanine can be improved by introducing multiple mutations shown in Table 13.

[0114] [Table 12]

[0115] [Table 13] [Industrial applicability]

[0116] The modified phenylalanine dehydrogenase of the present invention is useful for the rapid, highly accurate, and sensitive measurement of phenylalanine and / or the production of phenylpyruvate. The modified phenylalanine dehydrogenase of the present invention is also useful as a liquid reagent. The modified phenylalanine dehydrogenase of the present invention is particularly useful as a liquid reagent. The analytical method of the present invention is useful, for example, for the diagnosis of diseases such as phenylketonuria and for measuring the phenylalanine content in food. [Sequence Listing Free Text]

[0117] Sequence ID 1 shows the amino acid sequence of Thermoactinomyces intermedius phenylalanine dehydrogenase (PheDH). Sequence ID 2 shows a codon-optimized nucleotide sequence that encodes the amino acid sequence of Thermoactinomyces intermedius PheDH (Sequence ID 1). Sequence IDs 3-6 show the amino acid sequences of each motif in PheDH. Sequence IDs 7-9 show the amino acid sequences of each motif represented by the shorter amino acid sequences in PheDH. Sequence IDs 10-12 show the amino acid sequences near each motif in Thermoactinomyces intermedius PheDH. Sequence IDs 13-15 show the consensus amino acid sequences (highly common amino acid sequences) near each motif in PheDH. Sequence IDs 16, 26, 35, 44, 54, 62, 70, 79, 88, 97, and 106 show the amino acid sequences of PheDH from each species. Sequence numbers 17-22, 27-31, 36-40, 45-50, 55-58, 63-66, 71-75, 80-84, 89-93, 98-102, and 107 show the amino acid sequences of the conserved regions corresponding to each motif in PheDH derived from each species. Sequence numbers 23-25, 32-34, 41-43, 51-53, 59-61, 67-69, 76-78, 85-87, 94-96, 103-105, and 108-110 show the amino acid sequences near each motif in PheDH derived from each species. Sequence ID 111 shows the amino acid sequence of Thermoactinomyces intermedius PheDH with a His-tag attached to the N-terminus. Sequence ID 112 shows a codon-optimized nucleotide sequence encoding the amino acid sequence (Sequence ID 111) of Thermoactinomyces intermedius PheDH with a His-tag added to the N-terminus. Sequence ID 113 shows a linker nucleotide sequence (NdeI site + start codon + His-tag coding sequence) added to the 5' end of the nucleotide sequence of Sequence ID 2 in order to form a DNA fragment consisting of the nucleotide sequence of Sequence ID 112. Sequence ID 114 shows a linker nucleotide sequence (stop codon + BamHI site) added to the 3' end of the nucleotide sequence of Sequence ID 2 in order to form a DNA fragment consisting of the nucleotide sequence of Sequence ID 112.

Claims

1. the below described: (A) The amino acid sequence represented by Sequence ID No. 1, (B) An amino acid sequence represented by Sequence ID No. 1, which includes substitution, deletion, insertion, or addition of 1 to 35 amino acid residues, or (C) Amino acid sequence having 90% or more identity with the amino acid sequence represented by Sequence ID No. 1 In a phenylalanine dehydrogenase containing any of the following amino acid sequences, the below described: (1) The combination of Y11E and Q222D; (2) The combination of Y11E and R228E; (3) Combination of Y11E and N290D; (4) The combination of Q222D and R228E; (5) The combination of Q222D and N290D; and (6) The combination of R228E and N290D; (Here, the positions of the amino acid residues in Y11E, Q222D, R228E, and N290D indicate their positions when the first methionine residue is counted as 1 in the amino acid sequence represented by Sequence ID No. 1.) It includes mutations in amino acid residues corresponding to two or more more selected amino acid residues, It has phenylalanine dehydrogenase activity, and One or more properties selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity have been improved. A modified phenylalanine dehydrogenase, The modified phenylalanine dehydrogenase is a modified phenylalanine dehydrogenase that contains an amino acid sequence having at least 90% amino acid sequence identity with the amino acid sequence represented by Sequence ID No.

1.

2. A method for analyzing phenylalanine, comprising measuring the amount of phenylalanine contained in a test sample using the modified phenylalanine dehydrogenase described in claim 1.

3. The method according to claim 2, comprising mixing a test sample with nicotinamide adenine dinucleotide (NAD+) and detecting NADH produced from NAD+ by the action of a modified phenylalanine dehydrogenase.

4. A method for producing phenylpyruvate, comprising generating phenylpyruvate from phenylalanine using the modified phenylalanine dehydrogenase described in claim 1.

5. A polynucleotide encoding the modified phenylalanine dehydrogenase described in claim 1.

6. An expression vector comprising the polynucleotide described in claim 5.

7. A transformant comprising an expression unit of a polynucleotide encoding the modified phenylalanine dehydrogenase described in claim 1.

8. A method for producing a modified phenylalanine dehydrogenase, comprising generating a modified phenylalanine dehydrogenase using the transformant described in claim 7, wherein at least one amino acid residue is mutated to improve one or more properties selected from the group consisting of substrate specificity, solubility, and phenylalanine dehydrogenase activity.

9. A kit for phenylalanine analysis comprising the modified phenylalanine dehydrogenase described in claim 1.

10. The phenylalanine analysis kit according to claim 9, further comprising a reaction buffer or buffer salt, and at least one nicotinamide adenine dinucleotide (NAD+).

11. An enzyme sensor for phenylalanine analysis comprising (a) a detection electrode and (b) a modified phenylalanine dehydrogenase according to claim 1, fixed to or positioned on the detection electrode.

Citation Information

Patent Citations

  • Amino acid dehydrogenase mutant and preparation method and application thereof

    CN108795893A

  • Thin film magnetic head and its production

    JP1995114713A

  • Function-modified phenylalanine dehydrogenase, and method for analysis of amino acid in biological sample using the enzyme

    WO2008029921A1