Promoting skeletal muscle regeneration by suppressing HIPPO signaling in the stem cell niche.

Inhibiting the HIPPO pathway in muscle fibers using SAV1-targeting nucleic acids addresses the lack of skeletal muscle regeneration in lower limb ischemia treatments, promoting effective muscle and blood vessel recovery.

JP7880072B2Active Publication Date: 2026-06-25BAYLOR COLLEGE OF MEDICINE +1

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
BAYLOR COLLEGE OF MEDICINE
Filing Date
2021-11-18
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Current treatments for lower limb ischemia, such as endovascular surgery and gene/stem cell therapy, are ineffective in restoring limb viability due to a lack of focus on skeletal muscle regeneration, which is crucial for muscle function recovery, and the capacity for skeletal muscle regeneration declines with aging.

Method used

Inhibiting the HIPPO signaling pathway in muscle fibers using inhibitory nucleic acids targeting Salvador homolog 1 (SAV1) to promote satellite cell proliferation and differentiation, enhancing angiogenesis and neovascularization in skeletal muscle.

Benefits of technology

Enhances skeletal muscle regeneration and neovascularization, improving blood flow and muscle function in ischemic limbs, particularly in elderly subjects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007880072000001
    Figure 0007880072000001
  • Figure 0007880072000002
    Figure 0007880072000002
  • Figure 0007880072000003
    Figure 0007880072000003
Patent Text Reader

Abstract

Suppression of HIPPO signaling in the stem cell niche promotes skeletal muscle regeneration [Solution] Embodiments of the present disclosure include methods for generating skeletal muscle by targeting the HIPPO pathway. In certain embodiments, an individual with a need for skeletal muscle generation is provided with an effective amount of an shRNA molecule that targets the SAV1 gene. Specific shRNA sequences are disclosed.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 116,754, filed November 20, 2020, which is incorporated herein by reference in its entirety.

[0002] (Statement regarding federally funded research or development) This invention was developed with government support under HL127717, granted by the National Institutes of Health (NIH). The government has certain rights in this invention.

[0003] Embodiments of this disclosure relate at least to the fields of cell biology, molecular biology, biochemistry, and medicine. [Background technology]

[0004] While the incidence of lower limb ischemia is increasing in the elderly, current treatments such as endovascular surgery and gene / stem cell therapy are not effective in restoring limb viability (1-3). These current strategies focus on vascular regeneration and neovascularization to re-establish perfusion, but little attention is paid to skeletal muscle regeneration to compensate for damaged muscles and restore muscle function (4). Skeletal muscle constitutes the major mass of the limbs and contains the majority of the blood vessels involved in limb circulation. Therefore, skeletal muscle is vulnerable to vascular damage, and muscle damage is directly correlated with the severity and duration of ischemia (5-6). Thus, muscle regeneration accompanied by the restoration of perfusion is crucial for the successful treatment of lower limb ischemia.

[0005] The gradual decline in skeletal muscle regeneration capacity with aging is a fundamental challenge in skeletal muscle repair (7, 8). One approach to promoting muscle regeneration from adult stem cells is to target local environmental constraints. Regeneration of adult functional skeletal muscle usually depends on the continuous production of myoblasts from activated satellite cells (SCs), which are quiescent skeletal muscle stem cells of adult muscle (9, 10). In response to injury (e.g., ischemia, muscle injury, or injury), SCs are activated, begin to proliferate, self-regenerate, and differentiate into skeletal muscle cells (11). SCs expressing the myogenicity-determining factor PAX7 (a member of the paired box transcription factor family) are protected by muscle fibers in a unique anatomical niche (microenvironment) between the cell membrane and basement membrane of the muscle fiber and are located in close proximity to endothelial cells (ECs) (12). Dynamic interactions between muscle fibers and niche components (muscle fibers, vascular cells, extracellular matrix, diffusive factors, etc.) govern the quiescence, activation, proliferation, and differentiation of sclerosing cells (SCs) (13). Muscle fibers communicate with SCs by secreting signaling molecules that bind to receptors on SCs, thereby directing the fate of SCs (14). The physiological state and intrinsic signaling pathways of muscle fibers can be regulated to influence the activation and expansion of SCs, thereby activating neighboring endocardium cells (ECs) via paracrine and autocrine signaling to promote angiogenesis (15).

[0006] The HIPPO signaling pathway is a highly conserved kinase cascade pathway that inhibits cell proliferation by regulating transcripts of signaling pathways related to tissue growth (16). Core components of the mammalian HIPPO signaling pathway include the Drosophila HIPPO kinase and its orthologous Ste20 kinases Mst1 and Mst2. When Mst kinases conjugate with the Salvador (SAV1 or SAV) scaffold protein, they phosphorylate Large Tumor Suppressor Homolog (Lats) kinases. Mammalian Lats1 and Lats2 are NDR family kinases and are orthologs of Drosophila Warts. Lats kinases then phosphorylate Yap and Taz. Yap and Taz are the most downstream components of the HIPPO signaling pathway and are two related transcriptional coactivators that work in conjunction with transcription factors such as Tead to regulate gene expression. Yap also interacts with β-catenin, an effector of the Wnt signaling pathway, to regulate gene expression. Upon phosphorylation, Yap and Taz are eliminated from the nucleus and their transcription is inactivated. Disruption of the HIPPO pathway has been shown to promote tissue regeneration (17).

[0007] The gradual decline in skeletal muscle regeneration with aging limits the therapeutic capacity for skeletal muscle injury. Skeletal muscle regeneration depends on the activity of commensal stem cells (SCs) that reside adjacent to endothelial cells and are protected by muscle fibers in a unique anatomical niche. Inhibiting the Hippo pathway of myofibrils can alter the composition of the myofibril secretome, enriching the local environment with factors that stimulate and promote SC proliferation and differentiation (myogenesis) and adjacent EC angiogenesis, along with enhanced neovascularization. This strategy has the potential to overcome the current hurdles of functional skeletal muscle regeneration in the elderly population. [Overview of the project]

[0008] The present disclosure addresses a long-felt need in the art and relates to methods and compositions for activating signals for SC proliferation and self-renewal in the muscle stem cell niche by manipulating the Hippo pathway in muscle fibers, promoting myogenesis concurrently with angiogenesis and neovascularization, and providing treatment for skeletal muscle conditions.

[0009] The present disclosure provides, for example, methods for increasing angiogenesis and / or myogenesis in skeletal muscle, regenerating muscle fibers in skeletal muscle, and inducing proliferation and in some embodiments differentiation of satellite cells in skeletal muscle. The method comprises delivering to skeletal muscle cells comprising satellite cells an effective amount of a composition comprising at least one inhibitory nucleic acid, wherein the inhibitory nucleic acid targets salvador homolog 1 (SAV1).

[0010] In some embodiments, the composition is administered to a mammalian subject that needs it. For example, mammalian skeletal muscle can be ischemic or atrophic. In some embodiments, the skeletal muscle has received a traumatic injury. In certain embodiments, the subject has a condition selected from the group consisting of limb ischemia, peripheral vascular disease, and sarcopenia.

[0011] The methods of the present disclosure can also be in vitro or ex vivo methods.

[0012] The present disclosure further provides a method for treating limb ischemia in a mammalian subject, the method comprising delivering to skeletal muscle cells of an ischemic limb in the subject an effective amount of a composition comprising at least one inhibitory nucleic acid, wherein the inhibitory nucleic acid targets SAV1.

[0013] Also provided is an inhibitory nucleic acid targeting SAV1 for use in the methods of the present disclosure.

[0014] In some embodiments, the inhibitory nucleic acid has a sequence that is at least 80% identical to, or encodes by, a nucleotide sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0015] In a particular embodiment, the composition comprises (i) an inhibitory nucleic acid encoded by a sequence having at least 80% identity with SEQ ID NO:2, (ii) an inhibitory nucleic acid encoded by a sequence having at least 80% identity with SEQ ID NO:3, and (iii) an inhibitory nucleic acid encoded by a sequence having at least 80% identity with SEQ ID NO:4.

[0016] In certain embodiments, the inhibitory nucleic acid has or is encoded by a sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0017] In one embodiment, the composition comprises a nucleic acid construct comprising (i) a nucleic acid having the nucleotide sequence described in SEQ ID NO:2, (ii) a nucleic acid having the nucleotide sequence described in SEQ ID NO:3, and (iii) a nucleic acid having the nucleotide sequence described in SEQ ID NO:4, wherein nucleic acids (i) to (iii) are operably linked to a promoter.

[0018] The inhibitory nucleic acid may be, for example, an inhibitory DNA or RNA molecule, such as an antisense DNA oligonucleotide, an antisense RNA oligonucleotide, or a short hairpin RNA or short interfering RNA. In one embodiment, the shRNA is at least 43 nucleotides long. In one embodiment, the shRNA is less than 138 nucleotides long. In one embodiment, the shRNA includes a loop structure between 5 and 19 nucleotides in length, preferably between 4 and 10 nucleotides in length.

[0019] In some embodiments, a nucleotide sequence encoding inhibitory RNA is included in the nucleic acid construct. In such embodiments, the inhibitory RNA is preferably expressed in skeletal muscle cells. Therefore, the nucleotide sequence encoding inhibitory RNA can be operably ligated to a promoter, such as a tissue-specific promoter. In certain embodiments, the promoter is a cardiac troponin T promoter. In some embodiments, the nucleic acid construct includes at least one posttranscriptional regulator, e.g., a woodchuck posttranscriptional regulator. In some embodiments, the nucleic acid construct includes sequences encoding a 3' microRNA-30 sequence and a 5' microRNA-30 sequence. In certain embodiments, the nucleic acid construct comprises 5' and 3' reverse-terminus repeats.

[0020] In a method utilizing multiple inhibitory RNAs, the sequences encoding each inhibitory RNA may reside on the same nucleic acid construct or on different nucleic acid constructs. The transcription of each inhibitory RNA sequence may be controlled by its own promoter, or a single promoter may control the transcription of multiple inhibitory RNA sequences. In one embodiment, the nucleotide sequences encoding multiple inhibitory RNAs are controlled by a single promoter.

[0021] In some embodiments of this disclosure, the vector includes an inhibitory nucleic acid targeting SAV1 or a nucleotide sequence encoding an inhibitory nucleic acid targeting SAV1. The vector may be a viral vector or a non-viral vector. Viral vectors may be derived, for example, from adeno-associated viruses (AAV) or lentiviruses. In some embodiments, the vector is a non-integrating vector, i.e., it is not integrated into the target cell genome.

[0022] Any limitations discussed in relation to one embodiment of this disclosure are particularly intended to apply to any other embodiment of this disclosure. Furthermore, any composition of this disclosure may be used in any method of this disclosure, and any method of this disclosure may be used to manufacture or utilize any composition of this disclosure. Aspects of the embodiments described in the examples may also be embodiments that may be implemented in different embodiments or in the context of embodiments discussed elsewhere in this application, for example, in the brief abstract, detailed description, claims, and brief description of the drawings.

[0023] The preceding paragraphs have provided a rather broad overview of the features and technical advantages of this disclosure so that the detailed explanations that follow may be better understood. Additional features and advantages that form the subject matter of the claims of this specification will be described below. Those skilled in the art will understand that the disclosed concepts and particular embodiments can be readily used as a basis for modifying or designing other structures to accomplish the same objectives of the present design. They will also understand that such equivalent structures will not deviate from the spirit and scope set forth in the appended claims. Novel features that are considered to be features of the designs disclosed herein, along with further objectives and advantages with respect to both organization and operation, will be better understood from the following description when considered in conjunction with the accompanying figures. However, it should be explicitly understood that each figure is provided for illustrative and explanatory purposes only and is not intended to define the limits of this disclosure.

[0024] For a more complete understanding of this disclosure, please refer here to the following description taken with the attached drawings. [Brief explanation of the drawing]

[0025] [Figure 1] This disclosure illustrates an AAV9 Salvador shRNA strategy that replicates a muscle fiber-induced regenerative stem cell niche and simultaneously promotes myogenesis and angiogenesis-angiogenesis for functional recovery of skeletal muscle in ischemic limbs. These muscle fibers release various paracrine elements to (i) activate satellite cells to proliferate and regenerate for myogenesis, and (ii) activate endothelial cells to stimulate angiogenesis and angiogenesis.

[0026] [Figure 2] The cDNA sequence of human SAV1 (SEQ ID NO: 1) is shown. Shaded regions indicate examples of target sequences for inhibitory nucleic acids. Alternating exons are indicated by the presence or absence of double underlines. Protein structural domains are indicated by single underlined sequences: WW domain, WW domain, SARAH domain, in the order from 5' to 3'.

[0027] [Figure 3A-3C] This study demonstrates that siRNAs or shRNAs targeting SAV1 effectively reduce SAV1 mRNA expression. Neonatal cardiomyocytes were transfected with inhibitory RNAs corresponding to SEQ ID NOs: 2, 3, or 4. SAV1 mRNA levels were measured using quantitative RT-PCR. All three siRNAs effectively reduced SAV1 mRNA levels.

[0028] [Figure 4A-4B]This shows that hindlimb ischemia upregulated Hippo pathway core proteins. Figure 4A is a Western blot showing Salvador (SAV1) levels, total YAP levels, and phosphorylated YAP (pYAP) levels in the gastrocnemius muscle of the contralateral non-ischemic leg (CTL) and ischemic leg (ISL) 14 days after induction of unilateral hindlimb ischemia. GAPDH was used as a load control. Figure 4B is a semi-quantitative analysis showing upregulation of SAV1, total YAP, and pYAP in the gastrocnemius muscle of the ISL compared to the CTL. The ratio of pYAP to total YAP did not change. *P<0.05, Mann-Whitney test; n=4 mice. M1~M4: Mouse #1~Mouse #4. Data are mean ± SEM.

[0029] [Figure 5A-5I] This shows that AAV9 SAV1 shRNA downregulated the expression of SAV1, YAP, and pYAP. Figures 5A and 5B are Western blots showing the protein levels of SAV1, total YAP, and pYAP in the gastrocnemius muscle of the contralateral non-ischemic leg (CTL) and ischemic leg (ISL) 7 days after intramuscular injection of AAV9 control shRNA and AAV9 SAV1 shRNA into the ISL. Figures 5C–5F show semi-quantitative analyses showing reduced SAV1 expression, total YAP expression, and pYAP expression in SAV1 shRNA-treated ISL (SAV1 KD) compared to control-treated ISL (control). No significant changes were observed in the pYAP / YAP ratio. *P<0.05, **P<0.01, ***P<0.001, n=5 mice / group, one-way ANOVA with Dunnett's multiple comparison test. Figures 5G and 5H are representative immunofluorescence images showing more extensive myoplastic YAP nuclear localization (white arrows) after SAV1 knockdown (KD) than after control treatment, 14 days after AAV9 administration. Figure 5I shows quantification of YAP nuclear localization in muscle fibers. *P<0.05, nonparametric Mann-Whitney test: n=4 mice / group. Data are mean ± SEM.

[0030] [Figures 6A-6E]This shows the functional outcomes of hindlimb ischemia after AAV9 shRNA-mediated SAV1 knockdown in the ischemic limb. Figure 6A shows representative laser Doppler perfusion images comparing the time-series study of blood flow recovery to the ischemic limb in AAV9 SAV1 shRNA-treated mice (SAV1 KD) with AAV9 control-treated mice (control). Figure 6B shows that SAV1 KD resulted in significantly improved perfusion from weeks 5 to 9 compared to control-treated mice (n=18 mice / group). Figure 6C shows that more red fluorescent lectin-stained capillaries and arterioles were observed in the gastrocnemius muscle of SAV1 KD mice compared to the gastrocnemius muscle of control mice. Figure 6D shows quantification of lectin + capillaries per muscle fiber (n=4 mice / group). Figure 6E shows that SAV1 KD resulted in significantly greater treadmill endurance by week 7 (n=18 mice / group). Data are mean ± SEM. *P<0.05, **P<0.01, nonparametric Mann-Whitney test.

[0031] [Figure 7A-7C] This shows that AAV9 shRNA-mediated SAV1 knockdown in ischemic limbs promoted cell proliferation. Figure 7A shows a representative immunofluorescence image illustrating more EdU+ cells after SAV1 knockdown in ischemic gastrocnemius muscle than after control treatment. Nuclei were counterstained with DAPI. White immunofluorescence pseudostain was applied to nuclei that incorporated EdU. Figure 7B shows that the mean ratio of EdU-positive nuclei to total nuclei was significantly higher in ischemic gastrocnemius muscle with SAV1 knockdown compared to ischemic gastrocnemius muscle with control treatment. n=4 mice / group. *P<0.05, nonparametric Mann-Whitney test. Figure 7C shows a representative immunofluorescence image of gastrocnemius muscle sections showing the distribution of EdU+ nuclei around muscle fibers in the control and SAV1 knockdown groups. Laminin staining was used to identify the basement membrane. Yellow arrows indicate EdU-labeled nuclei in the interstitial space between muscle fibers, while red arrows indicate EdU-labeled nuclei along the longitudinal periphery of skeletal muscle fibers or between the myofibrous membrane and the basement membrane.

[0032] [Figures 8A-8D] This shows that AAV9 shRNA-mediated SAV1 knockdown promoted the proliferation of satellite and endothelial cells. Figure 8A shows representative immunofluorescence images of quiescent EdU-Pax7+ satellite cells (white arrows) and proliferating EdU+Pax7+ satellite cells (yellow arrows). Figure 8B shows that a significantly higher proportion (percentage) of EdU+Pax7+ nuclei to total EdU+ nuclei was detected in the SAV1 KD group compared to the control group. Figure 8C shows proliferating CD31+ endothelial cells (purple arrows) showing the nuclear localization of EdU+. CD31+EdU+ angiogenesis (green arrows) and CD31+EdU+ collateral vessels (orange arrows) were observed in the SAV1 KD group. White immunofluorescence pseudocolor was applied to nuclei that incorporated EdU. Figure 8D shows the ratio (%) of CD31+EdU+ cells to total CD31+ cells per high-magnification field of view. n=4 mice / group, *P<0.05. A nonparametric Mann-Whitney test was used for pairwise comparisons.

[0033] [Figure 9] Representative immunofluorescence images of quiescent EdU-Pax7+ satellite cells (white arrows) and proliferating EdU+Pax7+ satellite cells (yellow arrows) 14 days after injection of AAV9 control shRNA or AAV9 SAV1 shRNA into the ischemic hind limbs of mice are shown.

[0034] [Figure 10A-10E](This shows that AAV9 SAV1 shRNA promoted skeletal muscle regeneration after muscle injury.) Figure 10A shows representative images of normal muscle that did not receive cardiotoxicity (CTX) injection, as well as muscle containing inflammatory cell infiltration and muscle fiber necrosis 3 days after CTX injection. Figure 10B shows representative images of centrally nucleated muscle fibers 14 days after AAV9 control treatment (control) and AAV9 SAV1 shRNA treatment (SAV1 KD). Figure 10C shows that SAV1 shRNA-treated tibialis anterior muscle had larger diameter regenerated muscle fibers compared to control-treated muscle. n=3 mice / group, *P<0.05, **P<0.01. Figure 10D shows representative immunofluorescence images of cross-sections of tibialis anterior muscle stained with CD31 to visualize capillaries and blood vessels. Figure 10E shows that capillary density was significantly higher in the SAV1 KD group compared to the control group. n=4 mice / group, *P<0.05. A nonparametric Mann-Whitney test was used for pairwise comparisons.

[0035] [Figures 11A-11F] This study demonstrates that AAV9 SAV1 shRNA treatment promoted skeletal muscle regeneration after cardiotoxicity-induced injury in aged mice. Figure 11A shows representative hematoxylin-eosin stained images of the cross-sectional area of ​​regenerating tibial anterior muscle fibers 14 days after treatment with AAV9 control shRNA and AAV9 SAV1 shRNA (SAV1 KD). Figure 11B shows the frequency distribution analysis of regenerating fiber cross-sectional area. n=3 mice / group, *P<0.05, **P<0.01. Figure 11C shows the presence of Pax7+EdU- cells (white arrows) and Pax7+EdU+ cells (yellow arrows). Figure 11D shows that the proportion of Pax7+EdU- cells was significantly higher in the SAV1 KD group compared to the control group. The proportion of EdU-positive nuclei (Figure 11E) and Pax7+EdU+ cells (Figure 11F) were similar 14 days after AAV9 control shRNA treatment and AAV9 SAV1 shRNA treatment. n=4 mice / group, *P<0.05. A nonparametric Mann-Whitney test was used for pairwise comparisons.

[0036] [Figure 12A-12C] Figure 12A shows the tibialis anterior muscle of aged mice stained with Pax7 antibody, 14 days after injection of AAV9 control shRNA or AAV9 SAV1 shRNA following cardiotoxicity-induced myocardial injury. Figure 12A shows the presence of adjacent Pax7+EdU- and Pax7-EdU+ cells (yellow circles). Figure 12B shows EdU and Pax7 double-positive nuclei (yellow arrows) indicating activated satellite cell clusters (two or more nuclei, yellow arrows) in the tibialis anterior muscle treated with SAV1 shRNA; Pax7+EdU- satellite cells (white arrows) were observed in both the control and SAV1 KD groups. Figure 12C shows the mean number of Pax7+EdU+SC clusters (two or more nuclei) per high-magnification field of view (HPF). n=4 mice / group.

[0037] [Figures 13A-13B] This study demonstrates that SAV1 knockdown in CTX-injured tibialis anterior muscle of aged mice promoted angiogenesis. Figure 13A shows a representative immunofluorescence image of a cross-section of the tibialis anterior muscle showing CD31-positive capillaries and vessels. Figure 13B shows that capillary density was significantly higher in the SAV1KD group compared to the control group. n=4 mice / group, *P<0.05. Nonparametric Mann-Whitney test.

[0038] [Figure 14] Representative H&E-stained images of the tibialis anterior muscle show inflammatory infiltration in the widened interstitial space (white arrows), as well as around muscle fibers (yellow arrows) and blood vessels (blue arrows).

[0039] [Figures 15A-15G]This shows that conditioned medium resulting from SAV1 silencing in C2C12 myotubes promoted satellite cell proliferation in vitro. Figure 15A shows RT-qPCR results indicating a significant decrease in the relative expression level of SAV1 mRNA after transfection of C2C12 myotubes with SAV1 siRNA compared to 48 hours of transfection with negative control (NC) siRNA. Unpaired t-tests were used for analysis. Data were obtained from three independent assays. Figure 15B shows representative fluorescence images of EdU uptake into the nucleus of satellite cells after 24 hours of culture in conditioned medium recovered from C2C12 myotubes after SAV1 knockdown (SAV1 siRNA-CM) and in conditioned medium recovered from C2C12 myotubes in the absence of SAV1 knockdown (NC siRNA-CM). Figure 15C shows quantification of EdU uptake in satellite cells growing in NC siRNA-CM and SAV1 siRNA-CM. An unpaired t-test was used. Data were obtained from five independent assays. Figure 15D shows a representative phase-contrast fluorescence image of C2C12 myotubes transduced with AAV9 SAV1 shRNA at day 4. Figure 15E shows RT-qPCR to reveal the relative expression levels of SAV1 mRNA analyzed 7 days after transduction of AAV control shRNA and AAV SAV1 shRNA in C2C12 myotubes. An unpaired t-test was used. Data were obtained from three independent assays. Figure 15F shows a representative image of EdU uptake in satellite cells growing in conditioned medium from C2C12 myotubes containing AAV SAV1 shRNA-induced SAV1 knockdown (AAV SAV1 shRNA-CM) and in conditioned medium from C2C12 myotubes in the absence of AAV control SAV1 knockdown (AAV con-CM). Figure 15G shows that satellite cells growing in AAV SAV1 shRNA-CM exhibited a higher proportion of EdU+ nuclei than satellite cells growing in AAV con-CM. Unpaired t-tests were used. Data were obtained from five independent assays. *P<0.05. **P<0.01. [Modes for carrying out the invention]

[0040] I. Exemplary Definitions In accordance with long-standing patent law practice, the terms “a” and “an,” when used herein in conjunction with the constituent terms, including the claims, mean “one or more.” Some embodiments of the present disclosure may consist of, or be essentially, one or more elements, method steps, and / or methods of the present disclosure. Any method or composition described herein is considered to be implementable in conjunction with any other method or composition described herein. The terms “or” and “and / or” are used to describe multiple components, either in combination with each other or exclusively. For example, “x, y, and / or z” can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.” It is particularly intended that x, y, or z may be specifically excluded from the embodiment. As used herein, the term “about” is used in the plain and common sense sense of the fields of cell biology and molecular biology, and indicates that it includes the standard deviation of errors in the instruments or methods employed to determine the values. The term “comprising” is synonymous with “including,” “containing,” or “characterized by,” and is comprehensive or open-ended, not excluding additional, unreproduced elements or method steps. The expression “consisting of” excludes unspecified elements, steps, or components. The expression “consisting essentially of” limits the scope of the described subject matter to the specified materials or steps and their fundamental and novel properties, without materially affecting them. Embodiments described in the context of the term “comprising” are intended to also be carried out in the context of the terms “consisting of” or “consisting essentially of.”

[0041] References to ranges of values ​​in this specification are merely intended to serve as a way of referring individually to each individual value that falls within that range, unless otherwise specifically indicated herein, and each individual value is incorporated herein as if it were referred to individually herein.

[0042] Throughout this specification, any reference to “one embodiment,” “a certain embodiment,” “a specific embodiment,” “a related embodiment,” “a particular embodiment,” “an additional embodiment,” or “a further embodiment,” or any combination thereof, means that a particular feature, structure, or characteristic described in relation to that embodiment is included in at least one embodiment of the present invention. Therefore, the aforementioned terms appearing in various places throughout this specification do not necessarily all refer to the same embodiment.

[0043] Furthermore, certain features, structures, or characteristics can be combined in any preferred manner in one or more embodiments. All methods described herein can be performed in any preferred order, unless otherwise specifically indicated herein or unless it is clearly inconsistent with the context. Any and all examples or exemplary language provided herein (e.g., "etc.") are intended solely to better illuminate this disclosure and do not, unless otherwise specifically asserted, impose any limitation on the scope of this disclosure. Nothing in this specification should be construed as indicating that an unclaimed element is essential to the implementation of this disclosure.

[0044] As used herein, the terms “nucleotide sequence” or “nucleic acid” refer to polymers of DNA or RNA having a combination of covalent bonds between nucleosides, including purine and pyrimidine bases, sugars, and phosphate groups in phosphodiester bonds. Nucleic acids may be single-stranded or double-stranded and may optionally contain synthetic, unnatural, or altered nucleotide bases that can be incorporated into the DNA or RNA polymer. The term “polynucleotide” is used interchangeably with the term “oligonucleotide.” The term “nucleotide sequence” is interchangeable with the term “nucleic acid sequence” unless otherwise specified.

[0045] In some cases, nucleic acid analogs may have alternative backbones or non-natural nucleoside linkages, consisting of, for example, modified phosphorus-containing backbones and non-phosphorus-containing backbones such as morpholino backbones; siloxane, sulfide, sulfoxide, sulfone, sulfonate, sulfonamide, and sulfamate skeletons; formacetyl and thioformacetyl skeletons; alkene-containing skeletons; methyleneimino and methylenehydrazino skeletons; amide skeletons, and so on. See, for example, U.S. Patent No. 7,410,944. Examples of modified phosphorus-containing backbones include phosphoramides, phosphorothioates, phosphorodithioates, chiral phosphorothioates, O-methylholoamide host creators, aminoalkyl host creators, alkylhostonic acids, thionoalkylhostonic acids, phosphites, phosphamides, thionophosphamides, thionalkyl host creators, borane phosphates, and various salt forms thereof. Examples of the non-phosphate-containing backbones described above are known in the art and are described, for example, in U.S. Patent No. 5,677,439, each of which is incorporated herein by reference. Other analog nucleic acids include those having positive backbones, non-ionic backbones, and non-ribose backbones, including those described in U.S. Patents No. 5,235,033 and No. 5,034,506. Modification of the ribose-phosphate backbone can facilitate the addition of sites such as labels or increase the stability and half-life of such molecules in physiological environments.

[0046] Nucleic acids may contain substituted or modified sugar moieties, such as a 2'-O-methoxyethyl sugar moiety or a carbocyclic sugar. Nucleic acids are also modified nucleosides (nucleoside analogs), i.e., modified purine or pyrimidine bases, such as 5-substituted pyrimidines, 6-azapyrimidines, pyridine-4-one, pyridine-2-one, phenyl, pseudouracil, 2,4,6-trimethoxybenzene, 3-methyluracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidine (e.g., 5-methylcytidine), 5-alkyluridine (e.g., ribothymidine), 5-haloridine (e.g., 5-bromouridine), or 6-azapyrimidines or 6-alkylpyrimidines (e.g., 6-methyluridine), 2-thiouridine, 4-thiouridine, 5-(carboxyhydroxymethyl)uridine, 5'-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, 5-methyl It may contain minomethyluridine, 5-methylcarbonylmethyluridine, 5-methyloxyuridine, 5-methyl-2-thiouridine, 4-acetylcytidine, 3-methylcytidine, propine, quesosine, wybutosine, wybutoxosine, beta-D-galactosylqueosine, N-2-, N-6- and O-substituted purines, inosine, 1-methyladenosine, 1-methylinosine, 2,2-dimethylguanosine, 2-methyladenosine, 2-methylguanosine, N6-methyladenosine, 7-methylguanosine, 2-methylthio-N-6-isopentenyladenosine, beta-D-mannosylqueosine, uridine-5-oxyacetic acid, 2-thiocytidine, and threonine derivatives. For example, see U.S. Patent No. 7,410,944.

[0047] In the context of nucleic acids, the terms “hybridize,” “bind,” “target,” or variations thereof indicate that a sufficient degree of complementarity or base pairing exists between a complementary or inhibitory nucleic acid sequence and a target DNA or target mRNA, resulting in a stable and specific interaction between them. Specific hybridization occurs when sufficient interaction occurs between the complementary or inhibitory nucleic acid sequence and its intended target nucleic acid under given conditions, preferably biological or physiological conditions, and when there is substantially no nonspecific binding of the complementary or inhibitory nucleotide sequence to a non-target sequence.

[0048] Preferably, specific hybridization results in inhibition, i.e., interference with the normal expression of the gene product encoded by the target DNA or target mRNA. Complete complementarity between the target sequence and the inhibitory RNA is not required. The inhibitory nucleotide sequence, e.g., a single-stranded antisense oligonucleotide, or the antisense sequence of a double-stranded inhibitory RNA, is sufficiently complementary if, under given conditions, it binds to the target sequence and inhibits the expression of the target gene. For example, an antisense nucleotide sequence can be designed to specifically hybridize to a replication regulatory region or transcription regulatory region of the target gene, or to a translation regulatory region (e.g., the translation initiation region and exon / intron junctions), or to the coding region of the target mRNA.

[0049] As used herein, an “antisense” nucleic acid sequence or “antisense” oligonucleotide is a sequence of DNA or RNA that can bind to a target “sense” sequence via base pairing. In some cases, the sense sequence is a nucleic acid that codes for a protein, and consequently, the antisense sequence is complementary to the coding strand of a double-stranded cDNA molecule or to an mRNA sequence. The antisense sequence can be fully or partially complementary to the sense sequence. An antisense nucleotide sequence can be designed to specifically hybridize to a particular region of a desired target protein or target mRNA to interfere with replication, transcription, or translation. The antisense sequence can be complementary to any length of sense sequence, for example, to at least about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.

[0050] The terms “inhibitory nucleic acid” and “inhibitory oligonucleotide” are used interchangeably to refer to molecules that knock down the expression of a target gene by interfering with the translation of the corresponding mRNA. As discussed above, expression is inhibited by the inhibitory nucleic acid binding sequence-specifically to its target. In certain inhibitory RNAs, such as short hairpin RNA (shRNA) and short interfering RNA (siRNA), sequence complementarity is utilized to target mRNA for disruption. When inhibitory RNA is properly targeted to a specific mRNA in a cell via its nucleotide sequence, it specifically represses the expression of the target gene, thereby reducing the cellular level of the corresponding target mRNA and the level of the protein encoded by such mRNA.

[0051] Inhibitory nucleic acids can be single-stranded or double-stranded. Examples of inhibitory nucleic acids include antisense DNA oligonucleotides and antisense RNA oligonucleotides, siRNA, shRNA, and microRNA. As used herein, the terms “knockdown” or “knockdown technique” refer to a gene silencing technique in which the expression of a target gene or gene of interest is reduced compared to the gene expression before the introduction of an inhibitory RNA (e.g., shRNA) that can cause inhibition of the production of the target gene product. For example, expression may be reduced by 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 99%. Gene expression may be reduced by any amount (%) within the intervals such as 2-4, 11-14, 16-19, 21-24, 26-29, 31-34, 36-39, 41-44, 46-49, 51-54, 56-59, 61-64, 66-69, 71-74, 76-79, 81-84, 86-89, 91-94, 96, 97, 98, or 99. A reduction in gene expression can be statistically significant compared to unchanged gene expression or wild-type gene expression, for example, by a Student's T-test or other known statistical methods. Knockdown of gene expression can be achieved by techniques known in the art, such as the use of inhibitory RNA or genome editing, such as CRISPR or TALEN.

[0052] When an antisense nucleic acid sequence has sufficient complementarity to the mRNA target sequence, the antisense sequence will specifically bind to the target region of the polypeptide-coding mRNA and thus inhibit the translation of the target mRNA. Inhibitory antisense sequences typically have only one, two, three, four, five, six, seven, eight, nine, or ten base mismatches with the target sequence. In many cases, it is desirable that the nucleic acid sequence be an exact match, i.e., perfectly complementary to the sequence to which the oligonucleotide specifically binds, and therefore have zero mismatches along the complementary region. Highly complementary sequences typically will bind very specifically to the target sequence region of mRNA and can therefore be very efficient in inhibiting the translation of the target mRNA sequence into a polypeptide product. See, for example, U.S. Patent No. 7,416,849.

[0053] In certain embodiments, a substantially complementary oligonucleotide sequence will have approximately 80 percent or greater complementarity (or "perfect match") with the corresponding mRNA target sequence to which the oligonucleotide specifically binds, and more preferably, approximately 85 percent or greater complementarity. In certain circumstances, it would be desirable to have an even more substantially complementary oligonucleotide sequence for use in the practice of this disclosure. In such cases, the oligonucleotide sequence will have approximately 90 percent or greater complementarity with the corresponding mRNA target sequence to which the oligonucleotide specifically binds, and in certain embodiments, it may have approximately 95 percent or greater complementarity with the corresponding mRNA target sequence to which the oligonucleotide specifically binds, and may even reach perfect match complementarity, including 96%, 97%, 98%, 99%, or even 100% perfect match complementarity with respect to the target mRNA to which the designed oligonucleotide specifically binds. See, for example, U.S. Patent No. 7,416,849. The percentage similarity or percentage complementarity of any nucleic acid sequence can sometimes be determined, for example, by using computer programs known in this art.

[0054] As used herein, the terms “small interfering molecule,” “short interfering RNA,” or “siRNA” refer to RNA duplexes of nucleotides that can be targeted to a desired gene and inhibit the expression of a gene sharing homology. An RNA duplex comprises two complementary single-stranded RNAs of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, each forming 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 base pairs and having a 2-nucleotide 3' overhang. The RNA duplex is formed by complementary pairing between two regions of the RNA molecule. siRNA is “targeted” to a gene in that the nucleotide sequence of the duplex portion of the siRNA is complementary to the nucleotide sequence of the targeted gene. In some embodiments, the length of the siRNA duplex is less than 30 nucleotides. Double-stranded RNA can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides in length. The length of a double-stranded RNA can range from 17 to 25 nucleotides. Double-stranded RNA can be expressed in cells from a single construct.

[0055] As used herein, the term “shRNA” (small hairpin RNA) refers to an RNA double helix (shRNA) in which a portion of the siRNA is part of a hairpin structure. In addition to the double helix portion, the hairpin structure may include a loop portion located between the two sequences forming the double helix. The loop can vary in length. In some embodiments, the loop is 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides in length. The hairpin structure can also include a 3' or 5' overhang. In some aspects, the overhang is a 3' or 5' overhang of 0, 1, 2, 3, 4, or 5 nucleotides in length. In one aspect of this disclosure, a nucleic acid construct encodes a small hairpin RNA comprising a sense region, a loop region, and an antisense region. After expression, the sense region and antisense region form a double helix. For example, this double helix that forms shRNA hybridizes with Salvador (SAV1) mRNA, thereby reducing SAV1 expression.

[0056] A "nucleic acid construct" is a synthetic nucleic acid molecule containing one or more functional nucleotide sequences. A nucleic acid construct may include, for example, coding sequences and / or regulatory sequences, the nucleic acid sequences required to express a gene product in a cell. A "coding sequence" is a nucleotide sequence that codes for a protein or RNA. A coding sequence may also be represented as a cistron. Therefore, a polycistronic nucleic acid construct contains two or more coding sequences. A "regulatory sequence" is a nucleotide sequence that can increase or decrease the expression of a coding sequence. Examples of regulatory sequences include promoters, enhancers, silencers, operators, and untranslated regions (UTRs).

[0057] As used herein, the term “functionally linked” indicates that multiple nucleic acid sequences in a polynucleotide associate so that the function of one of these sequences is influenced by another. For example, if a regulatory DNA sequence is positioned such that it influences the expression of a coding DNA sequence (i.e., the coding sequence or functional RNA is under the transcriptional control of a promoter), then the regulatory DNA sequence is said to be “functionally linked” to an RNA-coding DNA sequence (“RNA coding sequence” or “shRNA coding sequence”) or a polypeptide-coding DNA sequence. A coding sequence can be functionally linked to a regulatory sequence in sense or antisense orientation. An RNA coding sequence represents a nucleic acid that can serve as a template for the synthesis of RNA molecules such as siRNA and shRNA. Preferably, the RNA coding region is a DNA sequence.

[0058] "Regulatory elements" are nucleic acid sequences involved in regulating gene expression, and include promoters, enhancers, silencers, and response elements. As used herein, the term "promoter" refers to a nucleotide sequence, usually upstream (5') of its coding sequence, that guides and / or controls the expression of the coding sequence by providing recognition for RNA polymerase and other factors required for proper transcription. A "promoter" may refer to a minimal promoter, which is a short DNA sequence consisting of a TATA box and other sequences that help specify a transcription start site, to which regulatory elements are added for the control of expression. A "promoter" may also refer to a nucleotide sequence, including minimal promoters and regulatory elements, that can control the expression of a coding sequence or functional RNA. This type of promoter sequence consists of a proximal upstream element and a more distal upstream element, in which case the latter element is often called an enhancer. Thus, an "enhancer" is a DNA sequence that stimulates promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of the promoter. Enhancers can function in both sense and antisense orientations, and can even function when moved to either the upstream or downstream side of the promoter. Both enhancers and other upstream promoter elements bind to sequence-specific DNA-binding proteins that mediate their action. Promoters may be entirely derived from native genes, or they may consist of different elements derived from different promoters found in nature, or they may even consist of synthetic DNA segments. Promoters may also contain DNA sequences involved in the binding of protein factors that regulate the effectiveness of transcription initiation in response to physiological or developmental conditions.

[0059] As used herein, the terms “reporter element” or “marker” mean a polynucleotide that encodes a polypeptide that can be detected in a screening assay. Examples of polypeptides encoded by reporter elements include, but are not limited to, lacZ, GFP, luciferase, and chloramphenicol acetyltransferase. See, for example, U.S. Patent No. 7,416,849. Many reporter element and marker genes are known in the art and are envisioned for use in the compositions and methods of this disclosure.

[0060] The terms “subject” and “individual” are used interchangeably and typically include mammals, and in certain embodiments include humans or non-human primates. While various compositions and methods are described herein with respect to use in humans, they are also suitable for animal use, for example, for veterinary use. Accordingly, certain exemplary organisms include, but are not limited to, humans, non-human primates, dogs, horses, cats, pigs, ungulates, and rabbits. Accordingly, in certain embodiments, the compositions and methods described herein are intended for use with domesticated mammals (e.g., dogs, cats, horses), laboratory mammals (e.g., mice, rats, rabbits, hamsters, guinea pigs), and agricultural mammals (e.g., horses, cattle, pigs, sheep), etc.

[0061] Where used herein, the expressions “subject in need” or “individual in need” refer to a subject or individual that is suffering from or at risk of suffering from a certain symptom, disease, or condition (e.g., having a predisposition (e.g., a genetic predisposition) or being exposed to predisposing environmental conditions).

[0062] The "effective dose" of an active agent, such as an inhibitory RNA, is the amount sufficient to achieve the specifically stated objective, for example, to inhibit SAV1 expression.

[0063] As used herein, the term “pharmaceutical composition” means a compound that, when administered to a subject, is physiologically acceptable and not unacceptably toxic, without any inhibitory effect on the action of the active ingredient. Such a composition may be sterile and may contain a pharmaceutically acceptable carrier. A suitable pharmaceutical composition may contain one or more buffers, surfactants, stabilizers, preservatives, and / or other solubilizers or dispersants.

[0064] Terms such as “treating,” “treatment,” “to treat,” “alleviating,” or “to alleviate” refer to measures that cure, slow, reduce the symptoms of a diagnosed pathological condition or disorder, and / or halt the progression of a diagnosed pathological condition or disorder. Therefore, subjects or individuals requiring treatment include those already suffering from a disorder. In a particular embodiment, if a subject exhibits, for example, overall, partial, or transient relief or elimination of symptoms associated with a disease or disorder, then the subject is successfully “treated” with respect to the disease or disorder in accordance with the methods provided herein.

[0065] The terms “reduce,” “inhibit,” “diminish,” “suppress,” and grammatical equivalents (including “lower,” “smaller,” etc.) refer to a measurable decrease in occurrence or activity, including, in some cases, a statistically significant decrease in occurrence or activity, including complete inhibition of occurrence or activity. For example, “inhibition” may refer to a decrease of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% in activity or occurrence. These terms can be used in reference to a “control” that has not undergone a particular treatment (e.g., the method of this disclosure). In one example, the control may be an untreated sample or subject. In another example, the control may be a sample or subject that has undergone a different treatment than the treated sample or subject. In some embodiments, the “treated” sample or subject is the one subjected to the method of this disclosure.

[0066] As used herein, the term “vector” refers to a viral or non-viral nucleic acid sequence capable of replicating in a host cell (with or without helper sequences, e.g., packaging sequences), including plasmids, cosmids, phages, bacterial vectors, yeast vectors, or binary vectors. Vectors can be double-stranded or single-stranded, linear or circular, and possibly self-transmitting or mobile. Vectors can transform prokaryotic or eukaryotic host cells either by integration into the cellular genome or by extrachromosomal integration (e.g., autonomous replicating plasmids with origins of replication). Various viral vectors are prepared from retroviruses, including, for example, lentiviruses, adenoviruses, adeno-associated viruses, and enveloped pseudotyping viruses. Examples of lentiviral vectors include equine infectious anemia virus (EIAV), human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), Visna / Maedi virus (VMV), canine arthritis / encephalitis virus (CAEV), feline immunodeficiency virus (FIV), and bovine immunodeficiency virus (BIV). The vectors can be complexed with lipids, for example, by encapsulation in liposomes or by association with cationic condensing agents.

[0067] II. General Embodiments The inventors have developed a novel approach to muscle fiber-induced reconstruction of a regenerative microenvironment potentially involved in translation. To create a regenerative environment for inducing a coordinated program of angiogenesis and myogenesis in vivo, the inventors regulated growth-inhibitory Hippo signaling events in muscle fibers, which are key cellular components of the muscle stem cell niche containing SCs. The inventors investigated whether downregulation of the myoplastic Hippo pathway could provide signals for vascular remodeling and SC activation. The inventors found that SAV1 KD in muscle fibers of ischemic mouse muscle promoted endothelial cell proliferation, accelerated perfusion recovery, and improved treadmill exercise endurance in mice. After cardiotoxicity-induced acute injury, the regenerative regions of TA muscle in AAV9 SAV1 KD mice had a larger muscle fiber cross-sectional area and more capillaries than in control mice, reflecting better muscle regenerative capacity after SAV1 KD treatment. Supporting these in vivo findings by the inventors, SCs grown in SAV1 KD-myotube conditioned medium showed a higher rate of EdU uptake than SCs grown in control myotube conditioned medium, indicating a paracrine effect on cell proliferation.

[0068] Accumulating clinical data indicates that effective treatment of ischemic limbs requires not only angiogenic factors to stimulate EC angiogenesis, but also myoplastic switches to activate skeletal muscle SCs to promote simultaneous myogenesis. The unique SC niche involves the spatial relationship between muscle fibers and associated SCs and ECs. Muscle fibers provide the signals required to establish a functional niche for activating SCs and stimulating the growth of the surrounding vascular system. Therefore, modulating the intrinsic properties of muscle fibers would provide various signals to reproduce the supporting niche for promoting skeletal muscle regeneration. In fact, we found paracrine interactions between muscle fibers and their associated SCs when we modulated the Hippo signaling pathway in muscle fibers. Extracellular factors secreted from muscle fibers facilitate SC activation and promoted myogenesis.

[0069] Gene therapy for leg ischemia is focused on angioplasty. This approach uses plasmids or adenovirus vectors to release genes encoding various growth factors into the ischemic leg to improve blood flow. Such studies include the use of genes encoding vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), and hypoxia-inducible factor 1-alpha (HIF-1α). 2、40 A meta-analysis of these randomized controlled trials has shown no clear difference in major amputation survival rates or amputation-free survival rates between gene therapy and placebo treatment. 2 Major limitations of this approach include the gene delivery system (carrier), transfection efficiency, and the inefficiency of targeting only one growth factor to compensate for tissue ischemia. Plasmid vectors are inefficient in delivering exogenous genes to cells. Plasmid vectors are non-replicating episomes and cannot achieve sufficient levels and long-term persistence of therapeutic transgene expression. 41 Although growth factors such as VEGF and FGF promote angiogenesis, it is unlikely that a single angiogenic factor could control the complex biological process of new angiogenesis in ischemic tissue. 42、43 Targeting regulatory genes / pathways that coordinate a series of events involved in angiogenesis may be more practical than targeting a single angiogenic growth factor. Furthermore, several issues must be addressed before efficient and robust gene therapy modalities can be implemented to achieve better clinical outcomes for treating leg ischemia. Specifically, suitable carriers must be used to deliver the genetic material to the target region, and the type of cell or tissue to be targeted must be identified.

[0070] Various recombinant AAV vectors infect both dividing and non-dividing cells and persist without directly integrating with the host genome. Because these vectors do not trigger an immune response, they are considered non-pathogenic and safe, and are emerging as an effective, long-term, and tissue-specific gene delivery system in clinical settings. 44、45 In this study, the inventors fused AAV9 with small interfering RNA (siRNA) therapy to target SAV1, a Hippo pathway adapter. Using a novel AAV9 vector with a minimally sized skeletal muscle-specific expression cassette, the inventors adapted its packaging to induce miR30-based pooled shRNA for SAV1 knockdown in mouse muscle fibers. The inventors observed myogenesis, perfusion recovery, and improved skeletal muscle strength in ischemic mouse hindlimbs. This approach overcomes the limitations of low transfection efficiency and tissue specificity in siRNA therapy.

[0071] The inventors used an AAV9 vector delivery system to induce a "Hippo downregulation" state in muscle fibers to create a regenerative microenvironment that ensures SC activation, myogenesis, EC angiogenesis, and angiogenesis. This strategy is illustrated in Figure 1. Specifically, the Hippo pathway adapter, i.e., Salvador, was knocked down using an adeno-associated virus 9 (AAV9) vector that expresses a triple short hairpin RNA (shRNA) based on miR30, regulated by a muscle-specific promoter. The inventors validated the feasibility of this novel approach in both a mouse hindlimb ischemia model and a skeletal muscle regeneration model. In the mouse hindlimb ischemia model, administration of AAV9 Salvador shRNA to ischemic muscle induced nuclear localization of the Hippo effector YAP, accelerated perfusion recovery, and increased exercise endurance. Enhanced angiogenesis was confirmed by intravascular lectin labeling of the vascular system. When DNA from replicating cells was in vivo labeled with 5-ethinyl-2'-deoxyuridine, Salvador knockdown was found to simultaneously increase the proliferation of paired-box transcription factor Pax7+ muscle satellite cells and CD31+ endothelial cells in ischemic muscle.

[0072] In addition to improving angiogenesis, this specification shows that inhibiting the Hippo pathway after acute muscle injury or injury improved muscle function in a mouse model of lower limb ischemia. Two weeks after delivery of AAV9 Salvador shRNA to injured muscle, the distribution of regenerating muscle fibers shifted to larger cross-sectional areas compared to mice receiving AAV9 control shRNA. In a cohort of aged mice (26 months old), AAV9 Salvador shRNA treatment increased the number of regenerating muscle fibers containing larger cross-sectional areas compared to control treatment.

[0073] In summary, this disclosure stipulates that Hippo inhibition in myoplastic cells via SAV1 knockdown promotes cell proliferation, perfusion recovery, and skeletal muscle regeneration in a mouse model of hindlimb ischemia and skeletal muscle injury. Therefore, this disclosure provides a method that could overcome the major impairments in age-related decline in skeletal muscle regeneration and the current limitations of vascular treatment in ischemic muscle regeneration.

[0074] One embodiment revealed herein is a unique, but exemplary, triad of shRNAs that specifically target SAV1, a member of the Hippo pathway. These shRNAs result in a selective reduction in SAV1 mRNA levels, similar to gene knockout, in a mouse model. In specific embodiments, these shRNAs can be delivered using an AAV9 (adeno-associated virus serotype 9) vector. In certain embodiments of this disclosure, shRNA sequences of nucleotides specific to the target SAV1 are intended.

[0075] III. Salvador The inventors inhibited the Hippo pathway by downregulating the adapter protein Salvador (SAV1), because this pathway provides growth-limiting signals that inhibit tissue regeneration. 31 The role of the Salvador-Warts-Hippo (SWH) pathway in regulating cell growth has been widely studied in Drosophila. 32 Activation of the SWH pathway leads to smaller adult disc sizes and reduced cell proliferation. SAV binds to both Warts kinase and Hippo kinase, acting as a scaffolding protein that facilitates downstream phosphorylation events in which SWH pathway activity is upregulated. 32As a positive component for activating the SWH pathway, SAV is also an evolutionarily conserved member of the SWH signaling family. In mammalian cells, SAV1 physically interacts with MST1 / 2 (Hippo in Drosophila) kinases to activate LATS1 / 2 (Warts in Drosophila) by phosphorylation. Active LATS1 / 2 phosphorylates the downstream effector YAP, thereby causing its nuclear exclusion. Thus, Hippo pathway activation inhibits YAP as a transcriptional co-activator for promoting growth-related gene expression. 31、33 The study shows that SAV1 is required for the Hippo kinase cascade-mediated control of organ size. 34 Liver-specific knockout of SAV1 in mice significantly increased liver size and proliferation index. Enhanced cell proliferation was confirmed by increased BrdU nuclear incorporation in vivo. 34 In a conditional knockout model of mice, heart-specific SAV1 knockout resulted in enlarged hearts and decreased YAP phosphorylation. 31 These findings highlight the very important role of SAV1 in regulating Hippo pathway activity.

[0076] This gene may be designated as Salvador homolog 1, Salv, SAV1, SAV, WW45 or WWP4. A representative nucleic acid is provided by GenBank® accession number CR457297.1, and a representative protein sequence is provided by GenBank® accession number Q9H4B6. The cDNA sequence of human Salvador is shown in SEQ ID NO: 1 (Figure 2).

[0077] The gene encodes a protein containing two WW domains (modular protein domains containing two conserved tryptophan residues, which mediate specific interactions with protein ligands) and a coiled-coil region. The protein is ubiquitously expressed in adult tissues. The protein also contains a SARAH (Sav / Rassf / Hpo) domain at its C-terminus (one of three classes of eukaryotic tumor suppressors that give the domain its name). In the Sav (Salvador) and Hpo (Hippo) families, the SARAH domain mediates signaling from Hpo to the downstream component Wts (Warts) via the Sav scaffold protein; phosphorylation of Wts by Hpo triggers cell cycle arrest and apoptosis, by downregulating cyclin E, Diap1, and other targets. The SARAH domain may also be involved in dimerization.

[0078] IV. Inhibitory nucleic acids that target SAV1 The methods of this disclosure utilize one or more inhibitory nucleic acids that target SAV1 and consequently cause a detectable reduction in SAV1 expression. The inhibitory nucleic acid may be DNA or RNA. In specific embodiments, the nucleic acid is inhibitory RNA, such as shRNA. In some embodiments, the inhibitory nucleic acid targets a sequence encoding the N-terminal region of the Sav1 protein, a sequence encoding the central region of the Sav1 protein, or a sequence encoding the C-terminal region of the Sav1 protein. In one embodiment, the inhibitory RNA has or encodes the nucleotide sequence aagtacgtgaagaaggagacg (SEQ ID NO: 2). In one embodiment, the inhibitory RNA has or encodes the nucleotide sequence aagatttaccccttcctcctg (SEQ ID NO: 3). In one embodiment, the inhibitory RNA has or encodes the nucleotide sequence aattcctgactggcttcaggt (SEQ ID NO: 4).

[0079] In one embodiment, the inhibitory RNA is an shRNA having a “hairpin” RNA molecule or stem-loop RNA molecule, comprising a sense region, a loop region, and an antisense region complementary to the sense region. In another embodiment, the inhibitory RNA is an siRNA comprising two different complementary RNA molecules (strands) that non-covalently associate via base pairing to form a double helix. See, for example, U.S. Patent No. 7,195,916.

[0080] In certain cases, the inhibitory RNA is shRNA. shRNA is a single-stranded RNA molecule that forms a stem-loop structure in vivo and can range in length from approximately 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides (nt) to 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, or 140 (nt). The double-stranded portion of the stem-loop structure can be less than 30 nucleotides in length, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides in length (including ranges within these lengths). The complementary RNA sequence that brings the double-stranded stem together by base pairing is preferably 19nt to 29nt in length. The shRNA may further include a protruding region. Such a protruding region may be a 3' protruding region or a 5' protruding region. The protruding region may be, for example, 1, 2, 3, 4, 5, or 6 nucleotides in length. For example, a loop structure containing 4 to 10 nucleotides (i.e., 4, 5, 6, 7, 8, 9, 10) links two complementary RNA sequences that form a stem. In vivo transcription and synthesis of shRNA is guided by the Pol III promoter, and the resulting shRNA is then cleaved by Dicer (RNase III enzyme) to produce mature siRNA. The mature siRNA enters the RISC complex. Therefore, in specific embodiments, the shRNA for inhibiting SAV1 expression according to this disclosure contains both sense and antisense nucleotide sequences.

[0081] In a particular embodiment, the nucleic acid comprises the sequence of SEQ ID NO: 2 (or SEQ ID NO: 3 or SEQ ID NO: 4), and further comprises the antisense sequence of SEQ ID NO: 2 (or SEQ ID NO: 3 or SEQ ID NO: 4, respectively), provided that when this sequence and its antisense sequence hybridize together to form a double-stranded structure, this sequence and its antisense sequence are separated by a loop structure.

[0082] In one embodiment, the nucleic acid construct comprises a polynucleotide sequence encoding an shRNA functionally ligated to a promoter. In one embodiment, the shRNA comprises a first segment, a second segment located immediately 3' to the first segment, and a third segment located immediately 3' to the second segment, wherein the first and third segments may each be less than 30 base pairs in length, and each may be greater than 10 base pairs in length. The first and third segments are complementary to each other with respect to the target sequence, with one containing an antisense sequence and the other containing a sense sequence. The second segment (located immediately 3' to the first segment) encodes a loop structure.

[0083] The inhibitory RNA molecules for use in this disclosure may be substantially identical to the SAV1 sequence and / or to any one of SEQ ID NOs: 2, 3, or 4 (e.g., at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical). In specific embodiments, there are only five mismatches between the inhibitory RNA and the target SAV1 sequence. In specific embodiments, a minimum of 18 bp of homology is utilized for a region of complementarity between the inhibitory RNA sequence and its target. Suitable mismatches can be predicted by known algorithms and / or identified by known assays.

[0084] In some embodiments, the nucleic acid construct includes an inhibitory nucleic acid sequence, such as a sequence encoding inhibitory RNA. In certain embodiments, the nucleic acid construct includes a vector, including a viral vector or a non-viral vector. In specific embodiments, the vector is non-integrated, but in other embodiments, it is integrated. Inhibitory nucleic acids can be made stable and generate if various mechanisms are included to guide the integration of the vector or vector segment into the host cell genome or to ensure the stability of the transcription vector.

[0085] Viral vectors may be derived from, for example, lentiviruses, adenoviruses, adeno-associated viruses, and retroviruses. Non-viral vectors include plasmids. In specific embodiments, inhibitory nucleic acids are contained in the AAV vector. AAV vectors can be of any serotype, including, for example, AAV2, AAV6, AAV7, AAV8, and AAV9 (Piras et al., 2013). In one embodiment, an AAV9 vector is used.

[0086] For the expression of inhibitory RNA, a promoter is functionally ligated to the sequence encoding the inhibitory RNA. The nucleic acid constructs of this disclosure may further include various expression regulatory sequences, such as optional operator sequences for controlling transcription and sequences for controlling transcription termination.

[0087] The promoters used in this disclosure may be constitutive promoters that constitutively induce the expression of a target gene, or inducible promoters that induce the expression of a target gene at a given location and time. Specific examples include the U6 promoter, cytomegalovirus (CMA) promoter, respiratory syncytial virus (RSV) promoter, SV40 promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108:193-199, 1991; and Monahan et al., Gene Therapy, 7:24-30, 2000), CaMV35S promoter (Odell et al., Nature, 313:810-812, 1985), Rsyn7 promoter (US Patent Application No. 08 / 991,601), ubiquitin promoter (Christensen et al., Plant Mol. Biol. 12:619-632, 1989), and ALS promoter (US Patent Application No. 08 / 409,297). Examples of various promoters are disclosed in U.S. Patents 5,608,149, 5,608,144, 5,604,121, 5,569,597, 5,466,785, 5,399,680, 5,268,463, and 5,608,142, among others.

[0088] In certain cases, the promoter can be a tissue-specific or cell-specific promoter, such as a muscle fiber-specific or skeletal muscle-specific promoter. Promoter suitable for use in skeletal muscle include, for example, muscle creatine kinase (MCK), desmin, actin, troponin (e.g., troponin T / I or chicken cardiac troponin T (cTnT)), myosin heavy chain, myosin light chain, myoglobin, promoters derived from NCX1, and hybrids thereof. Specific examples of promoters include a rat ventricle-specific cardiac myosin light chain 2 (MLC-2v) promoter, a cardiac muscle-specific alpha-myosin heavy chain (MHC) gene promoter, and cardiac cell-specific minimal promoters of NCX1 from -137 to +85. In one embodiment, the promoter is a cardiac troponin T promoter.

[0089] If a nucleic acid construct contains polycistronic nucleic acids, i.e., nucleic acids encoding two or more inhibitory RNAs, these inhibitory RNAs can be under the control of just one promoter or multiple promoters. In one embodiment, each inhibitory RNA is regulated by a separate promoter. In some cases, the nucleic acid construct contains short reverse repeats separated by a small number of nucleotides (e.g., 3, 4, 5, 6, 7, 8, 9) that lead to the transcription of the inhibitory RNA.

[0090] Therefore, the amount of inhibitory RNA produced in target cells can be regulated by controlling factors such as the nature of the promoter used to guide the transcription of the nucleic acid sequence (i.e., whether the promoter is constitutive or regulated, strong or weak) and the copy number of the nucleic acid sequence encoding the inhibitory RNA present in the cell.

[0091] Nucleic acid constructs for use in this disclosure may include one or more regulatory elements. In specific cases, each inhibitory RNA sequence may be regulated by the same regulatory sequence, or each inhibitory RNA sequence may be regulated by different regulatory sequences. In some embodiments, nucleic acid constructs for use in this disclosure encoding inhibitory RNA include post-transcriptional regulatory elements (PREs). Examples of PREs include the woodchuck hepatitis virus PRE (WPRE), the hepatitis B virus PRE, and intron A of the human cytomegalovirus pre-early gene. For further examples and details, see Sun et al. (2009) and Mariati et al. (2010). In certain embodiments, the PRE is a WPRE.

[0092] In certain embodiments, the nucleic acid construct includes one or more further features, such as a 5' untranslated region (UTR), a 3 UTR, an inverse terminal repeat (ITR), and / or a polyadenylation signal (e.g., a synthesized minimal polyadenylation signal). (See van der Velden et al. (2001).)

[0093] Nucleic acid constructs can contain microRNA (miRNA) sequences, such as the miRNA-30 sequence. This allows triple shRNAs to be processed in target cells by the RNA polymerase type II promoter as miRNAs rather than shRNAs, thereby enhancing shRNA expression efficiency. (See Dow et al. (2012).)

[0094] In one aspect, the method of this disclosure utilizes a number of nucleic acid constructs, each encoding a different inhibitory RNA (e.g., shRNA) that targets a different region of the SAV1 nucleic acid sequence. A single nucleic acid construct can encode a number of inhibitory RNAs that target different regions of the same gene, for example, including two or more SEQ ID NOs: 2, 3, or 4. In another aspect, a single nucleic acid can encode multiple copies of the same inhibitory RNA. In a further aspect, a single nucleic acid construct can encode multiple copies of multiple inhibitory RNAs, for example, multiple copies of SEQ ID NOs: 2, multiple copies of SEQ ID NOs: 3, and / or multiple copies of SEQ ID NOs: 4 in any combination. Each nucleic acid construct can be contained in a different vector.

[0095] A nucleic acid construct may further include one or more marker genes, such as a selection marker, and / or one or more reporter genes. The marker gene or reporter gene provides a method for tracking the expression of one or more linked genes. When expressed in a cell, the marker gene or reporter gene yields a product (usually a protein) that is detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. The gene expression product may also be detected by labeling, whether it originates from the gene of interest, the marker gene, or the reporter gene. Labels envisioned for use in the compositions and methods of this disclosure include, but are not limited to, fluorescent dyes, high electron-density reagents, enzymes (such as those commonly used in ELISA), biotin, digoxigenin, or haptens and proteins that can be detected, for example, by incorporating a radiolabel into a peptide, or that can be used to detect antibodies that are specifically reactive with a peptide. See, for example, U.S. Patent No. 7,419,779.

[0096] In certain embodiments, the method of the present disclosure utilizes a nucleic acid construct comprising (i) an inhibitory nucleic acid having the nucleotide sequence shown in SEQ ID NO: 2, (ii) an inhibitory nucleic acid having the nucleotide sequence shown in SEQ ID NO: 3, and (iii) an inhibitory nucleic acid having the nucleotide sequence shown in SEQ ID NO: 4, wherein the shRNA is functionally linked to at least one promoter. The promoter is preferably a muscle-specific promoter, such as a cardiac troponin T promoter. The nucleic acid construct can be contained in a vector, for example, a viral vector. Specific embodiments include AAV vectors, such as the AAV9 vector.

[0097] The standard recombinant DNA and molecular cloning techniques used in this disclosure are widely known in the art and can be found in the following publications: Sambrook, J., Fritsch, E. and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989); Silhavy, T.J., Bennan, M. and Enquist, L.W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1984); and Ausubel, F. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987).

[0098] V. Synthesis of inhibitory nucleic acids Inhibitory nucleic acids can be prepared by various methods known in the art for synthesizing DNA and RNA molecules. These include techniques widely known in the art for the chemical synthesis of oligodeoxyribonucleotides and oligoribonucleotides, such as solid-phase phosphoramidite chemosynthesis. Alternatively, RNA molecules can be generated by in vitro and in vivo transcription of DNA sequences encoding inhibitory RNA molecules. Such DNA sequences may be incorporated into a wide variety of vectors incorporating suitable RNA polymerase promoters (e.g., T7 polymerase promoter or SP6 polymerase promoter). Alternatively, depending on the promoter used, antisense cDNA constructs that constitutively or inductively synthesize inhibitory RNA can be stably introduced into cell lines.

[0099] Inhibitory RNA molecules can be chemically synthesized using appropriately protected ribonucleoside phosphoramidites and conventional DNA / RNA synthesizers. Contract synthesis services are available from various commercial vendors, such as Ambion (Austin, Tex., USA) and Dharmacon Research (Lafayette, Colo., USA). See, for example, U.S. Patent No. 7,410,944.

[0100] Various well-known modifications to DNA molecules can be introduced as means of increasing intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences of ribonucleotides or deoxynucleotides to the 5' and / or 3' ends of the molecule, or the use of phosphorothioate or 2'O-methyl rather than phosphodiesterase linkage within the oligodeoxyribonucleotide backbone. The antisense nucleic acids of this disclosure can be constructed using chemical synthesis or enzymatic linkage reactions using procedures known in the art. Antisense oligonucleotides can be chemically synthesized using naturally occurring nucleotides or various modified nucleotides designed to increase the biological stability of the molecule or to increase the physical stability of the double helix formed between the antisense nucleic acid and the sense nucleic acid (e.g., phosphorothioate derivatives and acridine-substituted nucleotides can be used).

[0101] The inhibitory RNA molecules for use in the methods of this disclosure may be various modified equivalents of the SAV1 inhibitory RNA disclosed herein. “Modified equivalent” means a modified form of a particular inhibitory RNA molecule that has the same target specificity (i.e., recognizes the same mRNA molecule that complements a particular unmodified inhibitory RNA molecule). Therefore, modified equivalents of unmodified inhibitory RNA molecules may have modified ribonucleotides, i.e., ribonucleotides that contain modifications in the chemical structure of the unmodified nucleotide base, sugar, and / or phosphate (or phosphodiester linkage). See, for example, U.S. Patent No. 7,410,944.

[0102] VI.How to use Some embodiments of this disclosure relate to methods and compositions for regenerating skeletal muscle. Regeneration may include the regeneration of muscle fibers, proliferation and differentiation of satellite cells (myogenesis), and angiogenesis in adjacent endothelial cells, along with enhanced angiogenesis and increased blood flow. Skeletal muscle may require regeneration due to, for example, disease, an underlying genetic condition, age, and / or trauma. In specific embodiments, skeletal muscle may have undergone, for example, injury, atrophy, apoptosis, necrosis, and / or autophagy, such as with ischemia of the lower extremities.

[0103] Ischemia is a decrease or limitation of blood supply to cells or tissues, resulting in hypoxia. Such a lack of blood flow to the lower extremities, for example in peripheral vascular disease (e.g., peripheral artery disease), leads to oxygen and nutrient deficiency in ischemic skeletal muscle, thereby causing dysfunction. There is a lack of treatment options for muscle regeneration in this situation. We demonstrate that by selectively targeting the Hippo pathway in muscle fibers that provide structural support for the muscle stem cell niche, functional muscle recovery in ischemic limbs is facilitated by promoting angiogenesis, neovascularization, and myogenesis. Specifically, inhibiting the Hippo pathway in myoplastic cells alters the composition of the muscle fiber secretome, enriching the local environment with factors that enhance angiogenesis and stimulate and promote the proliferation and differentiation of satellite cells (SCs) (myogenesis), as well as angiogenesis of adjacent endothelial cells.

[0104] Accordingly, in one embodiment, the present disclosure provides a method for treating limb ischemia, particularly lower limb ischemia. Treatment of limb ischemia, for example, chronic or acute limb ischemia, may include, but is not limited to, relief of pain, pallor (paleness of the skin), paresthesia (abnormal sensation), or coldness in the limb; improved distal pulse in the limb; reduced paralysis of the limb; or improved blood flow in the limb. Methods for evaluating limb ischemia and its symptoms may include pulse testing, measurement of local temperature, assessment of skin color, Doppler evaluation, ultrasound, and angiography.

[0105] In certain embodiments, the method of the present disclosure promotes muscle fiber regeneration in aged subjects. "Aged" subjects are individuals whose age is at least 50, 55, 60, 65, 70, or 75 years. Aged subjects requiring muscle fiber regeneration include those having sarcopenia, skeletal muscle injury, atrophy, apoptosis, necrosis, and / or autophagy.

[0106] The method of this disclosure comprises delivering an inhibitory nucleic acid targeting SAV1 to skeletal muscle cells or skeletal muscle tissue. Targeted inhibition of SAV1 by the method of this disclosure can produce several physiological effects. For example, skeletal muscle fibers can activate various signals for SC proliferation and self-regeneration. In addition, in individuals administered the inhibitory nucleic acid, nuclear localization of the Hippo effector YAP is induced in existing skeletal muscle fibers, perfusion recovery is accelerated, and / or exercise endurance is increased. Proliferation of paired-box transcription factor Pax7+ muscle satellite cells and CD31+ endothelial cells may be increased in ischemic muscle. In injured muscle, the distribution of regenerating muscle fibers shifts towards larger cross-sectional areas, and the number of regenerating muscle fibers containing larger cross-sectional areas increases.

[0107] The method of this disclosure can result in an increased volume of affected muscle compared to the state of the affected muscle before administration of at least one inhibitory nucleic acid targeting SAV1. The method of this disclosure can result in the formation of vascular collaterals in the affected muscle compared to the state of the affected muscle before administration of at least one inhibitory nucleic acid targeting SAV1.

[0108] Methods for evaluating myogenesis, skeletal muscle regeneration, and / or muscle mass include, for example, computed tomography, magnetic resonance imaging (MRI), dual-energy X-ray absorptiometry (DXA), bioimpedance analysis, and biopsy and histology. Methods for evaluating angiogenesis, neovascularization, and / or blood flow include, for example, pulse testing and local temperature measurement, skin color assessment, Doppler imaging, ultrasound, angiography, and biopsy and histology.

[0109] Inhibitory nucleic acids can be delivered directly to target cells, for example, in the form of single-stranded RNA or double-stranded RNA. 50、51 Alternatively, the inhibitory RNA can be delivered into target cells using a DNA construct contained in a vector from which the RNA can be transcribed. In specific embodiments, the inhibitory RNA is expressed in target skeletal muscle cells, preferably human skeletal muscle cells. As used herein, “skeletal muscle cells” includes muscle cells and satellite cells.

[0110] Vectors containing inhibitory RNA can be delivered to an individual systemically or locally. Systemic administration is preferably via parenteral routes, such as intraperitoneal, intravenous, or subcutaneous. Local administration is preferably via injection into the desired organ or tissue site, such as muscle tissue (e.g., injured muscle tissue or ischemic muscle tissue).

[0111] Inhibitory nucleic acids can be delivered in pharmaceutical compositions. In addition to the inhibitory nucleic acid, the composition may include pharmaceutically acceptable excipients, carriers, buffers, stabilizers, or other materials. Examples of commonly used carriers include ordinary (isotonic) saline (e.g., 0.9% saline) and dextrose (e.g., 5% dextrose). The composition may be buffered to a pH of, for example, 4–8.

[0112] In some embodiments, inhibitory RNA, or nucleic acid constructs encoding inhibitory RNA against SAV1, are introduced into skeletal muscle cells or skeletal muscle tissue in vitro or ex vivo. Methods for introduction include transfection with calcium chloride, calcium phosphate, or polyethyleneimine; microprojectile impaction, electroporation, PEG-mediated fusion, microinjection, and liposome-mediated methods. If necessary, skeletal muscle cells containing the inhibitory RNA can be introduced into subjects requiring skeletal muscle regeneration, for example, as tissue grafts. The transplanted tissue can be an allograft, an autograft, or an engineered tissue. [Examples]

[0113] The following embodiments are included to illustrate preferred embodiments of the present disclosure. It should be understood by those skilled in the art that the techniques disclosed in the following embodiments represent techniques found by the inventors to function well in carrying out the methods of the present disclosure and can therefore be considered to constitute preferred embodiments for such carrying out. However, it should be understood that many variations can be made in light of the present disclosure in the specific embodiments disclosed, and that many variations can still produce similar or analogous results without departing from the spirit and scope of the present disclosure.

[0114] Example 1 Small hairpin RNA inhibits SAV1 expression in cardiomyocytes. The inventors investigated whether the shRNAs encoded by SEQ ID NOs. 2, 3, and 4 could suppress endogenous SAV1 expression in neonatal cardiomyocytes. Primary neonatal mouse cardiomyocytes were isolated and cultured in 24-well plates to 60%–80% confluence. The cells were then treated with 3 μL of lipofectamine RNAiMAX reagent (ThermoFisher Scientific) and 1 μL of siRNA (10 pmol;C) containing SEQ ID NO. 2. F Cells were transfected with SAV1 (10 μM). Cells were harvested 48 hours after transfection, and SAV1 mRNA levels were measured by quantitative RT-PCR. The results are shown in Figure 3A.

[0115] In another experiment, porcine SK6 cells were cultured in 6-well plates to 70%–90% confluence. The cells were transfected with 1 μg of lentiviral shRNA plasmid (U6-Salv-shmiRNA) containing SEQ ID NO: 3 under the control of the U6 promoter using 3 μL of lipofectamine 3000 reagent (ThermoFisher Scientific). Cells were harvested 48 hours after transfection, and SAV1 mRNA levels were measured by quantitative RT-PCR. The results are shown in Figure 3B.

[0116] In additional experiments, human AC16 cells were cultured in 6-well plates to 70%–90% confluence. The cells were transfected with 1 μg of AAV shRNA plasmid (AAV-cTnT-Salv-shmiR) containing SEQ ID NO: 4 under the control of the cTnT promoter, using 3 μL of lipofectamine 3000 reagent (ThermoFisher Scientific). Cells were harvested 48 hours after transfection, and SAV1 mRNA levels were measured by quantitative RT-PCR. The results are shown in Figure 3C.

[0117] All three inhibitory nucleic acid sequences knocked down SAV1 expression by approximately 70%, with Sequence ID No. 4 showing the greatest efficiency.

[0118] Example 2 AAV9-mediated myoplastic SALVADOR knockdown in ischemic limb The inventors first evaluated SAV1 expression and phosphorylation of the serine residue of Hippo signaling downstream effector Yes-related protein 1 (pYAP, Ser127) 14 days after induction of unilateral hindlimb ischemia. Compared to the non-ischemic contralateral calf muscle, the ischemic muscle showed significantly higher levels of SAV1, total YAP, and pYAP protein. The ratio of pYAP to YAP remained unchanged (Figure 4, p<0.05, n=4 mice / group).

[0119] Next, the inventors used a myotropic AAV9 vector containing a myogenesis-specific cassette under the cardiac troponin T promoter to knock down SAV1 in the muscle fibers of the ischemic limb of C57BL / 6J mice by activating shRNA based on miR30. 18 SAV1 harmonizes the Hippo kinase cascade, phosphorylates it, and inhibits YAP activity; therefore, knockdown of SAV1 inhibits YAP activity. ser127 This downregulates the phosphorylation of YAP, thereby inducing YAP activation and nuclear translocation. 18、24After confirming unilateral hindlimb ischemia on day 3 following double ligation, the inventors injected AAV9 SAV1 shRNA or control shRNA (1 × 10¹⁰ viral genome / mouse) into the gastrocnemius muscle of the ischemic hindlimb (n=5 mice / group), and collected the muscle 7 days after AAV9 administration. Western blotting and semi-quantitative analysis of muscle lysates confirmed SAV1 knockdown and decreased total YAP and pYAP expression after SAV1 shRNA treatment (Figures 5A-5E). No significant changes were found in the ratio of pYAP to total YAP between the control group and the SAV1 shRNA group (Figure 5F). Considering that the gastrocnemius muscle contains various cell types other than muscle fibers, the inventors used immunohistochemistry to detect YAP immunoreactivity within gastrocnemius muscle fibers. Microscopic immunofluorescence analysis of gastrocnemius muscle sections 14 days after AAV treatment (n=4 mice / group) revealed that nuclear accumulation of YAP was greater in muscle fibers of the AAV9 SAV1 shRNA group compared to the AAV9 control shRNA group (Figures 5G-5I). These results indicate that SAV1 knockdown mediated the nuclear localization of YAP.

[0120] Example 3 SALVADOR knockdown accelerates perfusion and muscle strength recovery after hind limb ischemia. The inventors investigated the effect of SAV1 knockdown on blood flow recovery in ischemic limbs. Perfusion was evaluated immediately before AAV9 injection into the ischemic limb and then every 7 days for up to 9 weeks (Figure 6A, n=18 mice / group). Before AAV administration, quantification of laser Doppler perfusion images showed that blood perfusion in the ischemic limb was dramatically reduced beyond the reductions seen in the contralateral non-ischemic limbs, and there was no difference in ischemic perfusion reduction between the treatment group and the control group. These results confirmed that ischemia was successfully induced (W0, Figure 6A, Figure 6B).

[0121] Three weeks after AAV injection, mice began to respond to SAV1 shRNA therapy. At week 5, perfusion was significantly better in the SAV1 knockdown group compared to the control group, and this benefit continued until week 9 (Figures 6A and 6B). Nine weeks after AAV9 shRNA delivery, the inventors intravenously injected a vascular endothelial marker (tomato lectin, 100 μg / mouse) into the tail vein 10 minutes before euthanasia (n=4 mice / group). Confocal immunofluorescence imaging showed that the number of red fluorescent tomato lectin-labeled vascular structures (i.e., capillaries and arterioles) was greater in the gastrocnemius muscle of the SAV1 knockdown group compared to the gastrocnemius muscle of the control group (Figures 6C and 6D).

[0122] To evaluate whether the improved perfusion associated with AAV9 SAV1 shRNA therapy simultaneously increases muscle strength and functional capacity, we performed a treadmill fatigue test in the same mouse cohort used to measure blood flow. Seven weeks after AAV9 shRNA injection, mice in the SAV1 knockdown group performed significantly better than control-treated mice (Figure 6E).

[0123] Example 4 SALVADOR knockdown promotes satellite cell activation and endothelial cell proliferation in ischemic hind limbs. To determine whether SAV1 knockdown affects cell proliferation, the inventors pulse-labeled mice with the nucleotide analog EdU (5-ethynyl-2'-deoxyuridine) by intraperitoneal injection to label DNA during replication. The inventors found that the number of EdU+ nuclei significantly increased two weeks after AAV9 SAV1 shRNA injection (Figures 7A, 7B; 6.61±0.54% vs. 2.94±0.33%, SAV1 knockdown vs. control; p<0.05, n=4 mice / group). Subsequently, the inventors evaluated the distribution of EdU+ nuclei around muscle fibers. In the AAV9 control group, most EdU+ nuclei were found in the interstitial region of skeletal muscle (Figure 7C, yellow arrows), whereas in the AAV9 SAV1 shRNA group, more EdU+ nuclei were detected in typical SC anatomical locations (Figure 7C, red arrows). EdU+ nuclei, or Edu+ nuclei, aligned along the grooves surrounding longitudinal skeletal muscle fibers, were located between the myofibrous membrane and the basement membrane of the transverse muscle region. This finding suggests that muscle regeneration is underway in skeletal muscle after SAV1 knockdown.

[0124] SC activation was further investigated by simultaneous nuclear uptake of EdU and expression of the transcription factor Pax7. Pax7 expression is specific to SC and is required for skeletal muscle regeneration. 25、26Activated SCs showed nuclear colocalization of Pax7 and EdU (Figure 8A; Figure 9, yellow arrows): this is the opposite of quiescent Pax7+Edu-SCs (Figure 8A, white arrows). SAV1 knockdown significantly increased the proportion of Pax7+EdU+ in the EdU+ cell population per high-magnification field beyond that seen with the control treatment (Figure 8B; 26.65±3.10% vs. 13.25±0.55%, SAV1 KD vs. control; p<0.05, n=4 mice / group). We used CD31 staining to examine ongoing angiogenesis in ischemic limbs. EdU labeling of CD31+ cells showed endothelial proliferation (Figure 8C, Figure 8D, purple arrows). In the SAV1 knockdown group, EdU+ nuclei were found along capillary vascular buds (Figure 8C, green arrows). In the analysis of collateral vessels, the inventors identified EDU+CD31+ endothelial cells in the endothelium: this indicates that SAV1 knockdown promoted the proliferative activity of collateral vessels (Figure 8C, orange arrow). This further supports the inventors' findings in in vivo lectin-vascular labeling studies and laser Doppler perfusion studies (Figures 6A-6D).

[0125] Example 5 SALVADOR knockdown promotes muscle formation after skeletal muscle injury. The inventors used a mouse model of cardiotoxin-induced muscle injury (mice aged 12 to 15 weeks) to evaluate whether SAV1 knockdown in muscle fibers enhances skeletal muscle regeneration. Three days after cardiotoxin injection, AAV was injected into the transverse abdominal (TA) muscle injury area (Figure 10A). Fourteen days after AAV injection, hematoxylin-eosin staining of TA muscle sections showed that cardiotoxin-induced muscle injury was largely replaced by regenerating muscle fibers with central nuclei (Figure 10B). Morphometric analysis of the cross-sectional area of ​​the regenerating muscle fibers revealed differences in fiber size distribution between the control group and the SAV1 knockdown group (Figure 10C). The control group had a cross-sectional area of ​​1000 μm. 2 The proportion of muscle fibers with a cross-sectional area of ​​less than 500 μm was higher in the SAV1 knockdown group, and the proportion of regenerating fibers was higher in the cross-sectional area of ​​500 μm. 2 ~750μm2 The levels were significantly higher when the values ​​were between (control vs. SAV1 KD; p<0.01). In contrast, SAV1 knockdown resulted in a shift towards larger muscle fiber sizes. 2 When the number of muscle fibers in the SAV1 knockdown group exceeded the number of muscle fibers in the control group, this ratio was defined as having a cross-sectional area of ​​1750 μm². 2 ~2750μm 2 The value was significantly higher when it was within the range between [values].

[0126] During skeletal muscle regeneration, vascularization is crucial for providing oxygen and nutrients for muscle function. Therefore, we stained TA muscle sections with an antibody against the vascular marker CD31 and found that the number of capillaries per unit muscle area in the SAV1 KD group was greater than in the control group (698.30 ± 53.40 / mm², respectively). 2 Ratio: 482.60±18.00 / mm 2 (p<0.05, Figures 10D, 10E).

[0127] In summary, these findings indicate better muscle regeneration within AAV SAV1 shRNA-treated muscles, further supporting the positive effects of SAV1 knockdown on enhancing myogenesis and angiogenesis.

[0128] Aging reduces the muscle-forming ability of sclerosing cells (SCs), resulting in the formation of smaller diameter muscle fibers after muscle injury or damage. 29To investigate whether myoplastic SAV1 knockdown promotes post-injury SC regeneration in aged mice (26 months old), the inventors used a cardiotoxin-induced mouse muscle injury model in which AAV9 treatment as described above was followed. The inventors identified areas of newly regenerated muscle fibers of various sizes in hematoxylin-eosin-stained cross sections of TA muscle treated with AAV9 for 14 days (Figure 11A). When the cross-sectional area was in the range of 250 μm²–500 μm² or 750 μm²–1000 μm², the control group had a significantly higher percentage of regenerating muscle fibers than the SAV1 knockdown group, and the cross-sectional area was 1750 μm². 2 ~2750um 2 Within the specified range, the SAV1 knockdown group had a significantly higher proportion of regenerating muscle fibers than the control group (Figure 11B). Therefore, frequency distribution analysis demonstrated that the number of regenerating fibers with larger cross-sectional areas was greater in the SAV1 knockdown group compared to the control group.

[0129] Two weeks after AAV9 injection, EdU uptake and Pax7 immunoreactivity were quantified within the region filled with newly regenerated muscle fibers. + EdN - SC (Figure 11C, white arrow) was found at a higher rate in the SAV1 KD group than in the control group (3.70±0.36% vs. 2.15±0.16%, p<0.05; Figure 11D). EdU + Nuclear proportion (4.00±0.26% vs. 3.40±0.27%, SAV1 KD vs. control; Figure 11E) and Pax7 + EdN + The cell proportion (0.23±0.042% vs. 0.16±0.060%, SAV1 KD vs. control, see yellow arrow in Figure 11F; Figure 11C) remained similar between the SAV1 KD group and the control group. In addition, the adjacent Pax7 + EdN - :Pax7 - EdN + Cells (Figure 12A, yellow circle) were observed in both the AAV9 control group and the SAV1 shRNA group. However, Pax7+ EdN + SC clusters (containing two or more nuclei) were detected only in the AAV9 SAV1 shRNA group (Figure 12B, yellow arrow). These findings suggest that myoplastic SAV1 knockdown may promote muscle regeneration by affecting SC activation and fate determination.

[0130] Given that angiogenesis is crucial for rebuilding the vascular network during muscle regeneration, we used CD31 staining to identify ECs and counted CD31-positive capillaries per unit muscle area (Figure 13). Capillary density was significantly higher in the SAV1 KD group than in the control group (642.20 ± 45.43 / mm², respectively). 2 Ratio: 338.80±9.76 / mm 2 (P<0.05): This indicates that TA muscle regeneration and angiogenesis were enhanced in the AAV SAV1 shRNA group in aged mice after CTX-induced injury. Despite the clear formation of new muscle fibers by SC, hematoxylin-eosin staining of cardiotoxic-injured TA muscle also showed histopathological features of inflammation and the absence of fully restored tissue structure. Inflammatory infiltrates were present in the interstitial spaces (Figure 14, white arrows) and around muscle fibers and blood vessels (Figure 14, yellow and blue arrows).

[0131] Example 6 Tempered medium from myotubes with SALVADOR knockdown promoted satellite cell proliferation. In addition to myoplastic cells, skeletal muscle contains vascular cells, nerve fibers, and connective tissue. In vivo isolation of muscle fiber-derived paracrine factors from paracrine factors secreted by other cell types that make up skeletal muscle is technically challenging. Therefore, we used two RNA interference methods to target myoplastic SAV1 and to investigate whether conditioned medium recovered from Salvador knockdown in myotubes affects SC proliferation in vitro.

[0132] First, the inventors transfected C2C12 myotubes with short interfering RNA (siRNA) using lipofectamine. Downregulation of SAV1 mRNA was confirmed by RT-qPCR. Compared to transfection with negative control siRNA (NC siRNA), SAV1 siRNA transfection in myotubes resulted in approximately 70% knockdown of SAV1 mRNA (1.005±0.198 vs. 0.308±0.011, NC siRNA vs. SAV1 siRNA, P<0.05; Figure 15A). Acclimatized medium was collected from NC siRNA-transfected myotubes (NC siRNA-CM) and SAV1 siRNA-transfected myotubes (SAV1 siRNA-CM). To evaluate the functional activity of SAV1 siRNA-CM, the inventors maintained SCs for 24 hours in either NC siRNA-CM or SAV1 siRNA-CM. EdU pulse labeling was performed to label SCs entering the cell cycle. The inventors found that the rate of EdU uptake was higher in cells growing with SAV1 siRNA-CM compared to cells growing with NC siRNA-CM (Figure 15B, Figure 15C).

[0133] Next, the inventors performed transduction into C2C12 myotubes using AAV9 control shRNA and AAV9 SAV1 shRNA (1 × 10⁻¹⁰ 5(Viral genome / cell). The inventors analyzed GFP fluorescence daily to track AAV transduction efficiency (Figure 15 D). Cells were collected on day 7. Quantification by RT-real-time PCR confirmed that the relative expression of SAV1 mRNA was significantly lower in myotubes transduced with AAV9 SAV1 shRNA than in myotubes transduced with AAV9 control (1.001±0.030 vs. 0.7336±0.023, AAV9 control vs. AAV9 SAV1 shRNA, p<0.05; Figure 15E). Similar to the approach described above, when cultured in conditioned medium recovered from myotubes transduced with AAV9 SAV1 shRNA (AAV SAV1 shRNA-CM), the SCs had a higher proportion of EdU labeling compared to cells cultured in conditioned medium from myotubes transduced with AAV control (AAV con-CM) (Figure 15F, Figure 15G).

[0134] In summary, these results suggest that paracrine factors secreted from myotubes with downregulated SAV1 positively regulate SC proliferation.

[0135] Example 7 Estimative method Mouse model Unilateral hindlimb ischemia All animal procedures were carried out in accordance with the Texas Heart Institute Animal Welfare Committee guidelines, which are based on the National Institutes of Health guidelines for the management and use of laboratory animals.

[0136] To induce unilateral hindlimb ischemia, the inventors surgically ligated the left femoral artery in mice (C57BL / 6J, 12-15 weeks old; equal numbers of male and female mice; Jackson Laboratory, Bar Harbor, ME) anesthetized by isoflurane inhalation (2-4% isoflurane in oxygen). Specifically, the inventors positioned two adjacent sutures in the femoral artery just downstream of the bifurcation of the lateral circumflex femoral artery. 19Subsequently, the mice were randomly divided into a control group and a treatment group. Three days after surgery, the inventors administered AAV9 control shRNA or AAV9 SAV1 shRNA (1 × 10⁻¹⁶). 10 The viral genome (mouse) was injected into the calf muscle of mice. The inventors monitored the mice and performed the evaluation tests described in the following section.

[0137] Cardiotoxicity-induced tibialis anterior muscle injury To create a skeletal muscle injury model, the inventors injected cardiotoxicity derived from Naja mossambica mossambica (Sigma-Aldrich, St. Louis, MO) into the tibialis anterior (TA) muscle of the left leg of adult C57BL / 6J mice (10 μmol / mouse, 12-15 weeks old; n=2). Three days after cardiotoxicity injection, the mice were euthanized, and the TA muscle was removed and processed. Cardiotoxicity-induced injury was confirmed by examining hematoxylin-eosin-stained muscle sections. After successfully inducing cardiotoxicity-induced TA injury, the inventors performed the same procedure on cohorts of adult C57BL / 6J mice (12-15 weeks old, n=3 / group, both sexes) and aged mice (26-month-old mice, n=4 / group, male, courtesy of Dr. Darren Woodside). Subsequently, the inventors randomly divided the mice into a control group and a treatment group. Three days after administration of cardiotoxicity, the inventors administered AAV9 control shRNA or AAV9 SAV1 shRNA (1 × 10⁻¹⁶). 10 The viral genome (AAV) was injected into the injured TA muscle in the left leg. Fourteen days after AAV injection, the mice were weighed, and the TA muscle was then removed to obtain its wet weight. The TA muscle was then processed for further analysis.

[0138] AAV9 Vector The construction and production of AAV9 vectors, along with their efficiency in knocking down endogenous SAV1, have been previously described. 18、20In short, AAV9 GFP (AAV9 control) virus and AAV9 SAV1 shRNA virus were produced by the Neuroconnectivity Core at the Intellectual and Developmental Disabilities Research Center, Baylor College of Medicine. The inventors used the pENN.AAV.cTNT, p1967-Q vector as a backbone to create AAV9 control vectors or AAV9 SAV shRNA vectors containing either a GFP sequence alone or a GFP sequence followed by miR30-based SAV1 shRNA under the control of a cardiac troponin T promoter. Both the AAV9 control shRNA vector and the AAV9 SAV shRNA vector were co-transfected into 293T cells with pHelper (Addgene 11 2867) and pAAV2 / 9n (AAV2 Rep, a plasmid expressing AAV9 Cap, Addgene 112865) to produce AAV9 control shRNA and AAV9 SAV shRNA, respectively. 96 to 120 hours after transfection, the culture medium and 293T cells were collected, and the virus was purified by iodixanol gradient ultracentrifugation.

[0139] Laser Doppler perfusion imaging and treadmill fatigue testing Using a laser Doppler imaging system (Perimed AB, Germany), the inventors measured perfusion before ischemia induction, 3 days post-ischemia (immediately before AAV injection), and every 7 days after AAV injection (weekly) (n=18 mice / group). To minimize temperature-induced hemodynamic instability, the inventors placed each mouse on a small animal heating pad at 37°C for 2 minutes before measurement. Perfusion was expressed as the perfusion ratio in the ischemic leg compared to the opposite, unoperated leg.

[0140] Seven weeks after AAV injection, mice were subjected to a treadmill fatigue test.21 The belt was set to 6 meters / min (Eco3 / 6, Columbus Instruments, Columbus, OH), and the treadmill speed was increased by 2 meters every 2 minutes, then kept constant at 10 meters / min. Exhaustion was defined as the point at which the mouse spent more than 10 seconds consecutively on the shock grid without attempting to re-engage on the treadmill three times. The inventors recorded the exercise time and distance.

[0141] In vivolectin labeling and sample processing of the vascular system Mice were placed in a restraint device, and their tails were exposed. Before lectin injection, the tails were immersed in warm water (37°C) for 5-10 minutes to dilate the veins (n=4 mice / group). Tomato lectin (labeled DyLight649, derived from tomato (Lycopersicon esculentum), Vector Laboratories, CA) was injected into the tail vein (0.1 mg / mouse). Ten minutes after lectin injection, the mice were perfused through the left ventricle with 4% paraformaldehyde in phosphate-buffered saline (PBS) (USB, Cleveland, OH) for 5 minutes. The gastrocnemius muscle was dissected from the leg and fixed overnight in 4% paraformaldehyde at 4°C. Tissue samples were transferred to 15% sucrose in PBS over 2 hours, followed by incubation overnight in 30% sucrose in PBS at 4°C. Samples were embedded in Tissue-Tek OCT compound (Sakura, Torrance, CA) in dry ice and cut using a cryostat (Leica CM1950). Frozen muscle sections (10 μm) were fixed with acetone for 5 minutes, washed, and the nuclei were counterstained with DAPI (Vector Laboratories). Fluorescence images were obtained using a confocal laser scanning microscope (Leica TCS SP5II, Buffalo Grove, IL). To quantify the number of lectin-positive capillaries per muscle fiber for each mouse muscle sample, the inventors sampled three sections from each mouse. The inventors counted at least 150 randomly selected muscle fibers from one frozen muscle section at the center of the AAV9 injection site, one frozen muscle section from the proximal region of the injection site, and one frozen muscle section from the distal region of the injection site. The mean was used to represent each mouse for statistical analysis.

[0142] Western blot analysis Calf muscle was dissolved on ice in an ice-cold lysis buffer (10 mM Tris-HCl (pH 7.6), 3 mM MgCl2, 40 mM KCl, 2 mM DTT, 5% glycerol, 0.5% NP40) containing a protease inhibitor cocktail (Roche, Basal, Switzerland). The lysate was sonicated (Bioruptor 300, Diagenode, Belgium) and centrifuged at 12,000 g at 4°C for 10 minutes. The supernatant was collected and the amount of protein was determined (Bio-Rad DC protein assay reagent, Hercules, CA). A total of 30 μg of protein from each sample was fractionated by SDS-PAGE (4-20% gradient gel, Bio-Rad), transferred to an Immun-Blot polyvinylidene fluoride membrane (Bio-Rad), and incubated in a TBS-Tween solution containing 5% skim milk powder at room temperature for 1 hour. Subsequently, the blots were incubated overnight at 4°C with mouse anti-SAV1 antibody (sc-101205, Santa Cruz Biotechnology, Dallas, TX), mouse anti-YAP antibody (sc-101199, Santa Cruz Biotechnology), and rabbit anti-phosphoYAP (Ser127, 4911s, Cell Signaling, Danvers, MA), followed by incubation at room temperature for 45 minutes with horseradish peroxidase (HRP) conjugated goat anti-mouse kappa or HRP conjugated goat anti-rabbit IgG (both secondary antibodies, Southern Biotech, Birmingham, AL).

[0143] Protein signals were detected using an enhanced chemiluminescence system (Thermo Fisher Scientific, Waltham, MA). To verify the equivolute loading of each protein sample, the inventors stripped the membranes and performed reprobing of the membranes with an HRP-conjugated goat antibody against GAPDH (sc-20357, Santa Cruz Biotechnology). Average protein expression levels were measured using the densitometry program in NIH ImageJ software.

[0144] Due to inter-mouse variability in SAV1 and pYAP protein expression under baseline conditions (see Figure 4A, protein expression variations in the non-ischemic contralateral leg of mice 1-4), the inventors performed semi-quantitative analysis according to the following procedure. First, the inventors performed normalization experiments by using an internal control GAPDH to adjust for load variations. Subsequently, the inventors determined the normalized SAV1 protein response, total YAP protein response, and pYAP protein response to ischemia by measuring the multiplier of change in their expression in the ischemic leg compared to the contralateral leg (Figure 4).

[0145] Regarding the semi-qualification of the Western blots in Figure 5, after performing the normalization procedure described above, the inventors determined the normalized SAV1 protein response and pYAP protein response to either AAV9 con shRNA treatment or AAV9 SAV1 shRNA treatment by measuring their expression in the AAV9-treated ischemic leg of the opposite leg. Finally, the relative protein levels in the AAV9 SAV1 shRNA-treated ischemic leg were expressed as the ratio of change in the AAV9 SAV1 shRNA-treated ischemic leg compared to the AAV control shRNA-treated ischemic leg.

[0146] Immunofluorescence and histological analysis To label cell proliferation in vivo, the inventors intraperitoneally injected mice with 5-ethinyl-2'-deoxyuridine (EdU, 500 μg / mouse, Thermo Fisher Scientific) both 3 days and 4 hours before euthanasia. After euthanasia, the gastrocnemius and TA muscles were harvested and processed using the method described herein. 22 Frozen muscle sections (10 μm) were fixed with acetone for 5 minutes and treated with 0.2% triton x-100 in PBS for 15 minutes. EdU staining was performed according to the manufacturer's instructions (Click-iT EdU cell proliferation kit for imaging, Alexa Fluor 647 dye, Thermo Fisher Scientific). Muscle slides were incubated overnight at 4°C with the following primary antibodies: rabbit anti-GFP (ab290, Abcam, Cambridge, UK); rabbit anti-laminin (L9393, Sigma-Aldrich); rabbit anti-YAP1 (NB110-58358, Novus Biologicals, Littleton, CO); mouse anti-Pax7 (DSHB); and rabbit anti-CD31 (ab28364, Abcam), respectively. Subsequently, sections were incubated with the corresponding secondary antibodies: Alexa Fluor-488 donkey anti-rabbit IgG, Alexa Fluor-555 donkey anti-rabbit IgG, and Alexa Fluor-555 donkey anti-mouse IgG (all obtained from Thermo Fisher Scientific). The nuclei were counterstained with DAPI (Vector Laboratories). Fluorescence images of the stained sections were acquired using a confocal laser scanning microscope (Leica TCS SP5II, Buffalo Grove, IL). Image processing and quantitative analysis were performed using ImageJ software. For each mouse tissue sample, the inventors selected a total of three sections for quantification, including one muscle cross section from the center of the AAV9 injection site, one muscle cross section from the proximal region, and one muscle cross section from the distal region. The mean was used to represent each mouse for statistical analysis.

[0147] As previously mentioned 22 Slides (6 μm) of TA muscle were air-dried at room temperature, stained with hematoxylin and eosin (Sigma-Aldrich), and then mounted with a permanent mounting medium (Vector Laboratories). The inventors obtained images using an Olympus microscope (BX-51). The cross-sectional area of ​​each regenerating muscle fiber was measured using ImageJ software. The total area of ​​500 to 600 fibers in each group was measured.

[0148] Preparation of C2C12 myotubular acclimatization medium SAV1 siRNA knockdown Mouse C2C12 myoblasts (ATCC, Manassas, VA, USA) were cultured in 6-well tissue culture plates in a 5% CO2 incubator at 37°C using high-glucose Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS). To induce C2C12 myoblast differentiation into myotubes, the culture medium was replaced with DMEM supplemented with 2% horse serum and 1% PS in a 5% CO2 incubator at 37°C. On day 4 of C2C12 myoblast differentiation into myotubes, myotubes were transfected with silencer-select SAV1 siRNA (assay ID 182232)-lipofectamine RNAiMAX complex or silencer-negative control siRNA (#AM4611)-lipofectamine RNAiMAX complex according to the manufacturer's procedure (Thermo Fisher Scientific). Forty-eight hours after transfection, the supernatant was aspirated. The myotubes were washed once with basal DMEM supplemented with 0.5% FBS and 1% PS, and then maintained in basal DMEM supplemented with 0.5% FBS and 1% PS in a 5% CO2 incubator at 37°C for a further 24 hours. The cell culture supernatant (conditioned medium stock solution) was collected, centrifuged at 2000 rpm for 5 minutes, divided into portions, and stored at -80°C.

[0149] SAV1-mediated knockdown via AAV9 On day 2 of myoblast differentiation, the cells in the 6-well plate were washed once with serum-free DMEM, followed by AAV9 control shRNA or AAV9 SAV1 shRNA (1 × 10⁻¹⁶). 5 Incubation was performed in a 5% CO2 incubator at 37°C in serum-free DMEM containing either viral genome or cells. After 1 hour, wild-type adenovirus (MD Anderson Cancer Center Vector Core) with 100 infection multiplicity (moi) was added to AAV9-infected cells to enhance AAV9 transduction efficiency. One hour after adenovirus infection, 2 mL of DMEM supplemented with 2% horse serum and 1% PS was added to each well, and the myotubes were incubated for 6 days. The culture supernatant was aspirated, and the myotubes were washed once with DMEM supplemented with 0.5% FBS and 1% PS, and then cultured for a further 24 hours in the same medium at 37°C in a 5% CO2 incubator. The cell culture supernatant (conditioned medium stock solution) was collected and centrifuged at 2000 rpm for 5 minutes. The supernatant was divided into smaller portions and stored at -80°C. Images of living cells were captured using an Olympus Ix71 inverted fluorescence and phase-contrast tissue culture microscope.

[0150] RT - Real-time PCR After the processing described above, the myotubes were washed with cold Dulbecco's phosphate-buffered saline and collected for RNA isolation (RNase Plus Micro Kit, Qiagen). Total RNA (2 μg) was reverse transcribed using a large-volume RNA-to-cDNA kit (Invitrogen) and a T100 thermal cycler (Bio-Rad, Hercules, CA). qPCR was performed using TaqMan Gene Expression Master Mix (Invitrogen) and a QuantStudio6 real-time PCR system (Life Technologies, Grand Island, NY, USA). SAV1-specific primers / probes (assay ID Mm01292174_m1) and 18S rRNA endogenous control (VIC / MGB Probe) were purchased from Thermo Fisher Scientific. Relative RNA expression was calculated using QuantStudio real-time PCR software (ΔΔCt method). All experiments were performed in triplicate in three independent experiments.

[0151] Isolation, culture, and labeling of satellite cells with EdU After euthanizing the mice, the gastrocnemius and TA muscles were harvested, chopped, and digested with type II collagenase (Worthington, Lakewood, NJ). The cells were then separated from the digestive tissue fragments using the published method. 23 The cell suspension was passed through a 40 μm cell strainer, and erythrocytes were lysed using 1× lysis buffer (BD Bioscience). The cells were washed and resuspended in PBS containing 0.5% BSA. The cell suspension was incubated at 4°C for 20 minutes with an antibody cocktail from a mouse SC isolation kit (#130-104-268, Miltenyi Biotec). The cells were washed, resuspended, and passed through a 30 μm pre-separation filter to an LS column (Miltenyi Biotec) placed in a magnetic separator. The LS column was then washed three times with PBS containing 0.5% BSA. All pass-through fractions were combined and centrifuged at 1500 rpm for 5 minutes.

[0152] The cell pellet was resuspended, counted, and cultured in a culture dish (60 × 15 mm) in growth medium (DMEM containing 20% ​​FBS, 1% chicken embryo extract, and 1% PS) until 80% confluence was reached. The cells were subcultured for 24 hours in 4-well Nunc Lab Tek chamber slides (Nalge Nunc International, Naperville, IL). The cell culture supernatant was aspirated, the cells were washed once with basal DMEM, and incubated in fresh acclimatization medium (prepared by mixing a 40% (v / v) acclimatization medium stock solution with 60% growth medium) in a 5% CO2 incubator at 37°C for 24 hours. EdU was added to the culture medium (final concentration, 10 μM).

[0153] After 4 hours, the culture supernatant was aspirated, the cells were washed twice with PBS, and then fixed with 4% paraformaldehyde. EdU staining of the cells was performed according to the manufacturer's instructions (Click-iT EdU cell proliferation kit for imaging, Alexa Fluor 488 dye, Thermo Fisher Scientific). Fluorescence images were acquired using a confocal laser scanning microscope (Leica TCS SP5II, Buffalo Grove, IL) and an Olympus Ix71 inverted fluorescence and phase-contrast tissue culture microscope. Quantitative analysis was performed using ImageJ software. All experiments were performed in triplicate in five independent experiments.

[0154] statistical analysis Data were expressed as mean ± standard error of the mean (SEM). Nonparametric Mann-Whitney tests or unpaired t-tests were used to determine statistical significance between two groups at the same time point. For Western blot analyses of more than two groups (Figures 5C and 5D), the inventors used one-way ANOVA with Dunnett's multiple comparison test (Graph Pad Prism7). A P value less than 0.05 was considered statistically significant.

[0155] While the present disclosure and its merits have been described in detail, it will be understood that various changes, substitutions, and modifications can be made herein without departing from the spirit and scope of the design as defined by the appended claims. Furthermore, the scope of this application is not intended to be limited to specific embodiments of the processes, machines, manufactures, material compositions, means, methods, and steps described herein. As will be readily apparent to those skilled in the art from this disclosure, existing or subsequently developed processes, machines, manufactures, material compositions, means, methods, or steps that perform substantially the same functions or achieve substantially the same results as the corresponding embodiments described herein can be utilized in accordance with this disclosure. Accordingly, the appended claims are intended to include within their scope such processes, machines, manufactures, material compositions, means, methods, or steps. (References) REFERENCES 1. Hirsch AT, Duval S. The global pandemic of peripheral artery disease. Lancet. 2013;382(9901):1312-1314. 2.Hammer A, Steiner S. Gene therapy for therapeutic angiogenesis in peripheral arterial disease - a systematic review and meta-analysis of randomized, controlled trials. Vasa. 2013;42(5):331-339. 3.Frangogiannis NG. Cell therapy for peripheral artery disease. Curr Opin Pharmacol. 2018;39:27-34. 4.Inampudi C, Akintoye E, Ando T, et al. Angiogenesis in peripheral arterial disease. Curr Opin Pharmacol. 2018;39:60-67. 5.Pipinos, II, Judge AR, Selsby JT, et al. The myopathy of peripheral arterial occlusive disease: part 1. Functional and histomorphological changes and evidence for mitochondrial dysfunction. Vasc Endovascular Surg. 2007;41(6):481-489. 6.McDermott MM. Lower extremity manifestations of peripheral artery disease: the pathophysiologic and functional implications of leg ischemia. Circ Res. 2015;116(9):1540-1550. 7.Brack AS, Conboy MJ, Roy S, et al. Increased Wnt signaling during aging alters muscle stem cell fate and increases fibrosis. Science. 2007;317(5839):807-810. 8.Almada AE, Wagers AJ. Molecular circuitry of stem cell fate in skeletal muscle regeneration, ageing and disease. Nat Rev Mol Cell Biol. 2016;17(5):267-279. 9.Wosczyna MN, Rando TA. A muscle stem cell support group: Coordinated cellular responses in muscle regeneration. Dev Cell. 2018;46(2):135-143. 10.Charge SB, Rudnicki MA. Cellular and molecular regulation of muscle regeneration. Physiol Rev. 2004;84(1):209-238. 11.Montarras D, Morgan J, Collins C, et al. Direct isolation of satellite cells for skeletal muscle regeneration. Science. 2005;309(5743):2064-2067. 12.Yin H, Price F, Rudnicki MA. Satellite cells and the muscle stem cell niche. Physiol Rev. 2013;93(1):23-67. 13.Bentzinger CF, Wang YX, Dumont NA, et al. Cellular dynamics in the muscle satellite cell niche. EMBO Rep. 2013;14(12):1062-1072. 14.Snijders T, Nederveen JP, McKay BR, et al. Satellite cells in human skeletal muscle plasticity. Front Physiol. 2015;6:283. 15.Christov C, Chretien F, Abou-Khalil R, et al. Muscle satellite cells and endothelial cells: close neighbors and privileged partners. Mol Biol Cell. 2007;18(4):1397-1409. 16.Wang Y, Yu A, Yu FX. The Hippo pathway in tissue homeostasis and regeneration. Protein Cell. 2017;8(5):349-359. 17.Zhang L, Yue T, Jiang J. Hippo signaling pathway and organ size control. Fly (Austin). 2009;3(1):68-73. 18.Leach JP, Heallen T, Zhang M, et al. Hippo pathway deficiency reverses systolic heart failure after infarction. Nature. 2017;550(7675):260-264. 19.Kochi T, Imai Y, Takeda A, et al. Characterization of the arterial anatomy of the murine hindlimb: functional role in the design and understanding of ischemia models. PloS One. 2013;8(12):e84047. 20.Morikawa Y, Heallen T, Leach J, et al. Dystrophin-glycoprotein complex sequesters Yap to inhibit cardiomyocyte proliferation. Nature. 2017;547(7662):227-231. 21.Deng Y, Yang Z, Terry T, et al. Prostacyclin-producing human mesenchymal cells target H19 lncRNA to augment endogenous progenitor function in hindlimb ischaemia. Nat Commun. 2016;7:11276. 22.Guardiola O, Andolfi G, Tirone M, et al. Induction of acute skeletal muscle regeneration by cardiotoxin injection. J Vis Exp. 2017(119). 23.Motohashi N, Asakura Y, Asakura A. Isolation, culture, and transplantation of muscle satellite cells [in eng]. J Vis Exp. JoVE 2014(86). 24.Liu S, Martin JF. The regulation and function of the Hippo pathway in heart regeneration. Wiley Interdiscip Rev Dev Biol. 2019;8(1):e335. 25.von Maltzahn J, Jones AE, Parks RJ et al. Pax7 is critical for the normal function of satellite cells in adult skeletal muscle [in eng]. Proc. Natl Acad. Sci. U.S.A. 2013;110(41):16474-16479. 26.Lepper C, Partridge TA, Fan CM. An absolute requirement for Pax7-positive satellite cells in acute injury-induced skeletal muscle regeneration [in eng]. Development (Cambridge, England) 2011;138(17):3639-3646. 27.van der Ven PF, Schaart G, Jap PH et al. Differentiation of human skeletal muscle cells in culture: maturation as indicated by titin and desmin striation [in eng]. CellTissue Res. 1992;270(1):189-198. 28.Vaittinen S, Lukka R, Sahlgren C et al. The expression of intermediate filament protein nestin as related to vimentin and desmin in regenerating skeletal muscle [in eng]. J. Neuropathol. Exp. Neurol. 2001;60(6):588-597. 29.Conboy IM, Conboy MJ, Wagers AJ, et al. Rejuvenation of aged progenitor cells by exposure to a young systemic environment. Nature. 2005;433(7027):760-764. 30.Bobadilla M, Sainz N, Abizanda G et al. The CXCR4 / SDF1 axis improves muscle regeneration through MMP-10 activity [in eng]. Stem Cells Devel. 2014;23(12):1417-1427. 31.Heallen T, Zhang M, Wang J, et al. Hippo pathway inhibits Wnt signaling to restrain cardiomyocyte proliferation and heart size. Science. 2011;332(6028):458-461. 32.Harvey K, Tapon N. The Salvador-Warts-Hippo pathway - an emerging tumour-suppressor network. Nat Rev Cancer. 2007;7(3):182-191. 33.Pan D. The hippo signaling pathway in development and cancer. Dev Cell. 2010;19(4):491-505. 34.Lu L, Li Y, Kim SM, et al. Hippo signaling is a potent in vivo growth and tumor suppressor pathway in the mammalian liver. Proc Natl Acad Sci U S A. 2010;107(4):1437-1442. 35.Watt KI, Harvey KF, Gregorevic P. Regulation of tissue growth by the mammalian Hippo signaling pathway. Front Physiol. 2017;8:942. 36.Yang Z, Nakagawa K, Sarkar A, et al. Screening with a novel cell-based assay for TAZ activators identifies a compound that enhances myogenesis in C2C12 cells and facilitates muscle repair in a muscle injury model. Mol Cell Biol. 2014;34(9):1607-1621. 37.Watt KI, Turner BJ, Hagg A, et al. The Hippo pathway effector YAP is a critical regulator of skeletal muscle fibre size. Nat Commun. 2015;6:6048. 38.Goodman CA, Dietz JM, Jacobs BL, et al. Yes-Associated Protein is up-regulated by mechanical overload and is sufficient to induce skeletal muscle hypertrophy. FEBS Lett. 2015;589(13):1491-1497. 39.Wei B, Dui W, Liu D, et al. MST1, a key player, in enhancing fast skeletal muscle atrophy. BMC Biol. 2013;11:12. 40.Forster R, Liew A, Bhattacharya V, et al. Gene therapy for peripheral arterial disease. Cochrane Database Syst Rev. 2018;10:Cd012058. 41.Hardee CL, Arevalo-Soliz LM, Hornstein BD, et al. Advances in non-viral DNA vectors for gene therapy. Genes (Basel). 2017;8(2). 42.Gorenoi V, Brehm MU, Koch A, et al. Growth factors for angiogenesis in peripheral arterial disease. Cochrane Database Syst Rev. 2017;6:Cd011741. 43.Sanada F, Taniyama Y, Muratsu J, et al. Gene-therapeutic strategies targeting angiogenesis in peripheral artery disease. Medicines (Basel). 2018;5(2). 44.Wang D, Tai PWL, Gao G. Adeno-associated virus vector as a platform for gene therapy delivery. Nat Rev Drug Discov. 2019;18(5):358-378. 45.Pattali R, Mou Y, Li XJ. AAV9 Vector: a Novel modality in gene therapy for spinal muscular atrophy. Gene Ther. 2019;26(7-8):287-295. 46.Al-Zaidy SA, Mendell JR. From clinical trials to clinical practice: Practical considerations for gene replacement therapy in SMA Type 1. Pediatr Neurol. 2019;100:3-11. 47.McHugh D, Gil J. Senescence and aging: Causes, consequences, and therapeutic avenues. J Cell Biol. 2018;217(1):65-77. 48.Xie Q, Chen J, Feng H, et al. YAP / TEAD-mediated transcription controls cellular senescence. Cancer Res. 2013;73(12):3615-3624. 49.Shao D, Zhai P, Del Re DP, et al. A functional interaction between Hippo-YAP signalling and FoxO1 mediates the oxidative stress response. Nat Commun. 2014;5:3315-3315. 50.O’Keefe E, siRNAs and shRNAs: Tools for Protein Knockdown by Gene Silencing. Mater. Methods 2013; 3:197. 51.Chery J, RNA therapeutics: RNAi and antisense mechanisms in clinical applications. Postdoc J. 2016: 4(7):35-50.

Claims

1. A composition comprising at least one inhibitory nucleic acid targeting Salvador, for use in a method for increasing angiogenesis in skeletal muscle, wherein the inhibitory nucleic acid has or is encoded by a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:

4.

2. A composition comprising at least one inhibitory nucleic acid targeting Salvador for use in a method for regenerating muscle fibers in skeletal muscle, wherein the inhibitory nucleic acid has or is encoded by a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:

4.

3. A composition comprising at least one inhibitory nucleic acid targeting Salvador for use in a method for inducing the proliferation of satellite cells in skeletal muscle, wherein the inhibitory nucleic acid has or is encoded by a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:

4.

4. A composition for use in a method of treating limb ischemia in mammals, comprising at least one inhibitory nucleic acid targeting Salvador, wherein the inhibitory nucleic acid has or is encoded by a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:

4.

5. The composition according to any one of claims 1 to 4, wherein the composition comprises (i) an inhibitory nucleic acid having or encoded by SEQ ID NO: 2, (ii) an inhibitory nucleic acid having or encoded by SEQ ID NO: 3, and (iii) an inhibitory nucleic acid having or encoded by SEQ ID NO:

4.

6. A composition according to any one of claims 1 to 4, wherein the inhibitory nucleic acid is an antisense DNA molecule or RNA.

7. The composition according to claim 6, wherein the inhibitory nucleic acid is short hairpin RNA (shRNA).

8. The composition according to claim 7, wherein the nucleotide sequence encoding the shRNA is incorporated into a nucleic acid construct, and the shRNA is expressed in skeletal muscle cells.

9. The composition according to claim 8, wherein the nucleotide sequence encoding the shRNA is operably linked to a tissue-specific promoter.

10. The composition according to claim 5, wherein the nucleotide sequence encoding the inhibitory nucleic acid is contained in a single nucleic acid construct, and the nucleotide sequence is expressed in skeletal muscle cells or satellite cells.

11. The composition according to claim 10, wherein the nucleotide sequence encoding the inhibitory nucleic acid is controlled by a single promoter.

12. The composition according to claim 11, wherein the promoter is a cardiac troponin T promoter.

13. The composition according to claim 12, wherein the nucleic acid construct comprises one or more of the following: (i) sequences encoding a 3' microRNA-30 sequence and a 5' microRNA-30 sequence; (ii) a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE); and (iii) one or more 5' and 3' reverse terminal repeats.

14. The composition according to claim 12 or 13, wherein the nucleic acid construct is contained in an adeno-associated virus (AAV) vector or a lentiviral vector.

15. The composition according to claim 14, wherein the inhibitory nucleic acid is shRNA.

16. The composition according to any one of claims 1 to 4, wherein the composition is administerable to the skeletal muscle of a mammalian subject.

17. The composition according to claim 16, wherein the skeletal muscle is ischemic atrophy or has suffered traumatic injury.

18. The composition according to claim 16, wherein the mammalian subject is in a condition selected from the group consisting of limb ischemia, peripheral vascular disease, and sarcopenia.