Methods, compositions, and devices for the solid-state synthesis of expandable polymers for use in single-molecule sequencing.

Abstract

To provide methods, compositions, and devices for single-molecule sequencing, particularly methods, compositions, and devices for solid-state synthesis and processing of expandable polymers (e.g., Xpandomers), and methods and compositions for producing new expandable polymer constructs that provide more accurate sequence information when passed through a nanopore sensor.SOLUTION: Provided is a method of synthesizing a copy of a nucleic acid template on a solid support, the method comprising immobilizing a linker on the solid support, attaching an oligonucleotide primer to the linker, performing a primer extension reaction to produce the copy of the nucleic acid template, and performing the primer extension reaction to produce the copy of the nucleic acid template, the solid support being a cyclic olefin copolymer.SELECTED DRAWING: Figure 1C

Description

[Technical Field]

[0001] Description regarding sequence listings The sequence listing relating to this application is provided in text format instead of as a paper copy and is incorporated herein by reference. The name of the text file containing the sequence listing is 870225_424WO_Sequence_Listing_ST25.txt. The text file is 5KB in size, was created on February 20, 2020, and filed electronically using EFS-Web.

[0002] The present invention generally relates to novel methods, compositions, and devices for single-molecule sequencing, and more specifically to expandable polymers (e.g., Xpandomer (Registered trademark) The present invention relates to improved methods and devices for the solid synthesis and processing of ), and further to methods and compositions for generating novel extensible polymer constructs that provide more accurate sequence information when passed through a nanopore sensor. [Background technology]

[0003] The measurement of biomolecules is fundamental to modern medicine and is widely used in medical research, more specifically in diagnosis and treatment, as well as in drug development. Nucleic acids code for the information necessary for living organisms to function and regenerate, and are essentially the blueprints of life. Determining such blueprints is useful in both pure research and applied science. In medicine, sequencing can be used to diagnose and develop therapies for a variety of medical conditions, including cancer, heart disease, autoimmune disorders, multiple sclerosis, and obesity. In industry, sequencing can be used to design improved enzyme processes or synthetic organisms. In biology, this tool can be used, for example, to study the health of ecosystems and thus has broad utility. Similarly, the measurement of proteins and other biomolecules provides markers and understanding of disease and pathogenicity transmission.

[0004] An individual's unique DNA sequence provides valuable information about their susceptibility to specific diseases. It also provides patients with the opportunity to receive screening and / or preventive measures for early detection. Furthermore, considering a patient's individual blueprint allows clinicians to administer personalized treatments to maximize drug efficacy and / or minimize the risk of adverse drug reactions. Similarly, determining the blueprint of pathogenic organisms could lead to new treatments for infectious diseases and more robust pathogen surveillance. Low-cost whole-genome DNA sequencing would provide a foundation for modern medicine. To achieve this goal, sequencing technologies must continue to advance in terms of throughput, accuracy, and read length.

[0005] Over the past decade, numerous next-generation DNA sequencing technologies have become commercially available, dramatically reducing the cost of whole-genome sequencing. These include synthetic sequencing ("SBS") platforms (Illumina, Inc., 454 Life Sciences, Ion Torrent, Pacific Biosciences) and analog-linking-based platforms (Complete Genomics, Life Technologies Corporation). Many other technologies have been developed that utilize a wide variety of sample processing and detection methods. For example, GnuBio, Inc. (Cambridge, Massachusetts) controls millions of inconspicuous probe sequencing reactions using picoliter reaction vessels, while Halcyon Molecular (Redwood City, California) has been attempting to develop a technology for direct DNA measurement using transmission electron microscopy.

[0006] Nanopore-based nucleic acid sequencing is a widely studied and compelling approach. Kasianowicz et al. (Proc. Natl. Acad. Sci. USA 93:13770-13773, 1996) characterized single-stranded polynucleotides electrically translocated via alpha-hemolysin nanopores embedded in lipid bilayers. It was demonstrated that partial occlusion of the nanopore opening during polynucleotide translocation can be measured as a decrease in ionic current. However, polynucleotide sequencing in nanopores is burdensome because it must resolve narrowly spaced bases (0.34 nm) with small signal differences immersed in significant background noise. The single-nucleotide resolution measurement challenge in nanopores becomes more demanding due to the rapid translocation rates observed for polynucleotides, typically on the order of one base per microsecond. To some extent, the translocation rate can be reduced by adjusting operating parameters such as voltage, salt composition, pH, temperature, and viscosity. However, such adjustments were not able to reduce the translocation rate to a level that would enable single-nucleotide resolution.

[0007] Stratos Genomics has developed a method called Sequencing by Expansion ("SBX"), which uses a biochemical process to transfer DNA sequences onto a measurable polymer called "Xpandomer" (Kokoris et al., U.S. Patent No. 7,939,259, "High Throughput Nucleic Acid Sequencing by Expansion"). The transferred sequences are encoded along the Xpandomer backbone in a high-signal-to-noise reporter approximately 10 nm away, designed for high-signal-to-noise, high-differentiation response. These differences provide a significant performance improvement in Xpandomer's sequence read efficiency and accuracy compared to native DNA. Xpandomer can enable several next-generation DNA sequencing detection technologies and is well-suited for nanopore sequencing.

[0008] Xpandomer is generated from a non-native nucleotide analog called XNTP, characterized by long substituents that allow for expansion of the Xpandomer skeleton after synthesis (see brochure of PCT application International Publication 2016 / 081871 by Kokoris et al., the entire brochure is incorporated herein by reference). Due to their atypical structures, polymerization of XNTP into Xpandomer and processing of Xpandomer into expanded forms for nanopore sequencing are inefficient processes, particularly in solution.

[0009] Therefore, it will be understood that novel methods and apparatus for improving the efficiency of synthesis and processing of Xpandomer copies of nucleic acid templates to generate a population of full-length products for nanopore sequencing, as well as strategies for improving the accuracy of sequence information, are of value in the art. The present invention satisfies these needs and further provides related advantages.

[0010] Not all subjects described in the background section are necessarily prior art, and one should not assume they are prior art simply as a result of their description in the background section. Along these lines, any recognition of a prior art problem described in the background section, or related to such subject matter, should not be treated as prior art unless explicitly stated to be prior art. Instead, any discussion of any subject matter in the background section should be treated as part of the inventor's approach to a particular problem, which may itself be inventive. [Overview of the Initiative]

[0011] In short, this disclosure provides a novel method and composition for determining the arrangement of single-molecule nanopores. The disclosure provides, and devices. In certain embodiments, the disclosure provides improved methods, compositions, and devices for the solid synthesis and processing of Xpandomer, as well as methods and compositions for synthesizing Xpandomer that provide more accurate sequence information.

[0012] In one embodiment, the present disclosure provides a method for synthesizing a copy of a nucleic acid template on a solid substrate, comprising: a) immobilizing a linker on a solid support, wherein the linker comprises a first end proximal to the solid support and a second end distal to the solid support, the first end being bound to a maleimide portion and the second end being bound to an alkyne portion, and the maleimide portion being crosslinked to the solid support; b) binding an oligonucleotide primer to the linker, wherein the oligonucleotide primer comprises a nucleic acid sequence complementary to a portion of the 3' end of the nucleic acid template, the 5' end of the oligonucleotide primer is coupled to an azide portion, and the azide portion reacts with an alkyne portion to form a triazole portion; c) providing a reaction mixture comprising a nucleic acid template, a nucleic acid polymerase, a nucleotide substrate or an analog thereof, a suitable buffer, and optionally one or more additives, wherein the nucleic acid template specifically hybridizes to the oligonucleotide primer; and d) performing a primer extension reaction to produce a copy of the nucleic acid template.

[0013] In certain embodiments, the maleimide moiety is crosslinked to a solid substrate by a photoinitiated proton abstraction reaction. In other embodiments, the solid substrate comprises a polyolefin, and in yet another embodiment, the polyolefin may be a cyclic olefin copolymer (COC) or polypropylene. In some embodiments, the nucleic acid template is a DNA template, and copies of the DNA template are expandable polymers, the expandable polymer comprising chains of non-natural nucleotide analogs, each of which is operably linked to an adjacent non-natural nucleotide analog by a phosphoramide ester bond (e.g., Xpandomer). In other embodiments, the linker further comprises a spacer arm interposed between a first end and a second end, the spacer arm comprising one or more monomers of ethylene glycol. In some embodiments, the linker further comprises a cleavable portion. In other embodiments, the solid support is selected from the group consisting of beads, tubes, capillaries, and microfluidic chips.

[0014] In another aspect, the present disclosure provides a method for selectively modifying the 3' end of a copy of a nucleic acid target sequence, comprising the steps of: a) providing a first oligonucleotide having a sequence complementary to a first sequence of the nucleic acid target sequence; and a second oligonucleotide having a sequence complementary to a second sequence of the nucleic acid target sequence, wherein the first sequence of the nucleic acid target sequence is 3' relative to the second sequence of the nucleic acid target sequence; the first oligonucleotide provides an extension primer for nucleic acid polymerase; and the 5' end of the second oligonucleotide is operably ligated to dideoxynucleoside 5' triphosphate, the dideoxynucleoside 5' triphosphate being the base of nucleic acid polymerase The present invention provides a step of providing quality, a) a step of providing a reaction mixture comprising a first oligonucleotide and a second oligonucleotide, a nucleic acid target sequence, a nucleic acid polymerase, a nucleotide substrate or analog thereof, a suitable buffer, and optionally one or more additives, wherein the first oligonucleotide and the second oligonucleotide specifically hybridize to the nucleic acid target sequence, and c) a step of producing a copy of the target sequence by performing a primer extension reaction, wherein the 5' end of the second oligonucleotide is operably ligated to the 3' end of the copy of the nucleic acid target sequence by the nucleic acid polymerase.

[0015] In some embodiments, dideoxynucleoside 5'-triphosphate is operably linked to the 5' end of a second oligonucleotide by a movable linker. Other embodiments In one embodiment, the mobile linker comprises one or more hexyl (C6) monomers. In another embodiment, the second oligonucleotide comprises one or more 2'-methoxyribonucleic acid analogs. In yet another embodiment, the 3' end of the second oligonucleotide is immobilized on a first solid support, and in some embodiments, the method further comprises the step of washing the first solid support to purify a copy of the nucleic acid target operably linked to the second oligonucleotide. In another embodiment, the first oligonucleotide is immobilized on a first solid support, and in some embodiments, the method further comprises the steps of releasing a copy of the nucleic acid target sequence from the first solid support and contacting the copy of the nucleic acid target sequence with a third oligonucleotide, the third oligonucleotide having a sequence complementary to the sequence of the second oligonucleotide, the third oligonucleotide specifically hybridizes with the second oligonucleotide, the 5' end of the third oligonucleotide is immobilized on the second solid support, and in yet another embodiment, the method further comprises washing the second solid support to purify the copy of the nucleic acid target sequence operably linked to the second oligonucleotide at its 3' end. In yet another embodiment, the second oligonucleotide comprises one or more nucleotide analogs that increase the binding affinity of the second oligonucleotide to the nucleic acid target sequence. In yet another embodiment, the second oligonucleotide is complementary to a heterologous nucleic acid sequence operably linked to the 5' end of the nucleic acid target sequence. In some embodiments, the nucleic acid target sequence is single-stranded DNA, and a copy of the target sequence is an expandable polymer, the expandable polymer comprising a chain of non-natural nucleotide analogs, each of which is operably linked to an adjacent non-natural nucleotide analog by a phosphoramide ester bond. In some embodiments, the first and second solid supports are selected from the group consisting of beads, tubes, capillaries, and microfluidic chips.

[0016] In another embodiment, the present disclosure is a method for generating a library of single-stranded DNA template constructs, each of which template constructs comprises two copies of the same strand of a DNA target sequence, and the method is a) DNAa) Providing a group of Y adapters, each comprising a first oligonucleotide and a second oligonucleotide, wherein the 3' region of the first oligonucleotide and the 5' region of the second oligonucleotide form a double-stranded region by sequence complementarity, the 5' region of the first oligonucleotide and the 3' region of the second oligonucleotide are single-stranded and include an oligonucleotide primer binding site, and the ends of the single-stranded regions of the first oligonucleotide and the second oligonucleotide are optionally immobilized on a solid substrate; b) Providing a group of double-stranded DNA molecules, each comprising a first strand and a second strand, wherein the first end of each double-stranded DNA molecule is compatible with the double-stranded end of a Y adapter; c) Providing a group of cap primer adapters, each comprising a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the second oligo The present invention provides a method comprising: d) a step of linking the second end of the second oligonucleotide and the third oligonucleotide of a double-stranded DNA molecule to the 5' end of the first oligonucleotide and the 3' end of the second oligonucleotide by a chemical branching agent, a portion of the sequence of the first oligonucleotide being identical to a portion of the sequence of the third oligonucleotide, a portion of the sequence of the second oligonucleotide being the reverse complement of a portion of the sequences of the first oligonucleotide and the third oligonucleotide, and the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide forming a double-stranded region that fits with the second end of each double-stranded DNA molecule; d) a step of linking the second end of each double-stranded DNA molecule to the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide of one of the cap primer adapters; e) a step of linking the first end of each double-stranded DNA molecule to the double-stranded end of one of the DNA Y adapters; and f) The present invention provides a method comprising: a) extending each of the first oligonucleotides of the linked cap-primer adapters from their 3' ends using DNA polymerase, wherein the first strand of the linked double-stranded DNA molecule provides a template for the DNA polymerase, and the DNA polymerase generates a third strand containing the reverse complement of the sequence of the first strand of the double-stranded DNA molecule and the sequence of the first oligonucleotide of the Y adapter; and g) digesting each of the first oligonucleotides of the linked Y adapters from their 5' ends using exonuclease, wherein the digestion removes the first oligonucleotide, the first strand of the double-stranded DNA molecule, and the second oligonucleotide of the cap-primer adapter to generate a single-stranded template construct, each of which contains two template molecules, each containing the sequence of the second strand of the double-stranded DNA molecule, and the two template molecules are operably linked by the first and third oligonucleotides of the cap-primer adapter.

[0017] In another embodiment, the Disclosure provides a library of single-stranded DNA template constructs, each of which comprises a first copy and a second copy of the same strand of a DNA target sequence, the first and second copies of the target sequence being operably linked, and the library of single-stranded DNA template constructs is produced by the method described above.

[0018] In another embodiment, the present disclosure provides a method for generating a library of mirror-image Xpandomer molecules, each of which Xpandomer molecules comprises two copies of the same strand of a DNA target sequence, wherein the method comprises: a) providing a library of single-stranded DNA template constructs as described in the preceding paragraph; b) providing a population of first elongation oligonucleotides complementary to a single-stranded portion of a first strand of a Y-adapter and a population of second elongation oligonucleotides complementary to a single-stranded portion of a second strand of a Y-adapter, wherein the first or second elongation oligonucleotides are optionally immobilized on a solid substrate; c) specifically hybridizing the library of single-stranded DNA template constructs to the population of first elongation oligonucleotides and the population of second elongation oligonucleotides; and d) providing a population of cap-branched constructs, wherein the cap-branched constructs comprise a second oligonucleotide. The present invention provides a method for generating a library of mirrored Xpandomer molecules, comprising the steps of: providing a first oligonucleotide operably linked to a rheotide, wherein the first and second oligonucleotides contain sequences complementary to the sequences of the first and third oligonucleotides of the cap-primer adapter construct, and the first and second oligonucleotides of the cap-branch construct provide a free 5' nucleoside triphosphate moiety; e) specifically hybridizing a population of cap-branch constructs to a population of single-stranded DNA template constructs; and f) performing a primer extension reaction to generate Xpandomer copies of a first and second copy of a DNA target sequence, wherein the Xpandomer copies are operably linked by the cap-branch construct.

[0019] In another aspect, the present disclosure provides a method for generating a library of tagged double-stranded DNA amplicons on a solid support, comprising: a) providing a population of double-stranded DNA molecules, each of the double-stranded DNA molecules comprising a first strand specifically hybridized to a second strand; b) providing a forward PCR primer and a reverse PCR primer, the forward PCR primer comprising a first 5' heterologous tag sequence operably linked to a 3' sequence complementary to a portion of the 3' end of the second strand of the double-stranded DNA molecule, and the reverse PCR primer comprising a second 5' heterologous tag sequence operably linked to a 3' sequence complementary to a portion of the 3' end of the first strand of the double-stranded DNA molecule; c) performing a first PCR reaction in which the population of double-stranded DNA molecules is amplified to generate a population of first DNA amplicon products, the first DNA amplicon products comprising a first heterologous sequence tag at a first end and a second heterologous sequence tag at a second end; d) providing an immobilized capture oligonucleotide structure on the solid support, the capture oligonucleotide structure comprising a first end and a second end, the first end being covalently bound to the solid support, the second end comprising a capture oligonucleotide comprising a sequence complementary to a portion of the second heterologous sequence tag of the population of first DNA amplicon products, and the capture oligonucleotide structure further comprising a cleavable element intervening between the first end and the capture oligonucleotide; and e) performing a second PCR reaction comprising the population of first DNA amplicon products, a forward primer comprising a sequence complementary to one strand of the first heterologous sequence tag, and a reverse primer comprising a sequence complementary to one strand of the second heterologous sequence tag, wherein the first strand of the population of first DNA amplicon products specifically hybridizes to the capture oligonucleotide, and the second PCR reaction generates a population of immobilized DNA amplicon products, the second strand of the immobilized DNA amplicon products being operably linked to the solid support.

[0020] ​In another embodiment, the present disclosure relates to a method for generating a library of single-stranded DNA template constructs, each of which comprises two copies of the same strand of a DNA target sequence, wherein the method comprises: a) providing a library of DNA amplicon products immobilized on a solid support as described in the preceding paragraph; and b) providing a collection of cap-primer adapters, each of which comprises a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the second oligonucleotide is interposed between the first oligonucleotide and the third oligonucleotide, and the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide are operably linked to the 5' ends of the first oligonucleotide and the 3' end of the second oligonucleotide by a chemical branching agent, wherein a portion of the sequence of the first oligonucleotide is identical to a portion of the sequence of the third oligonucleotide, and a portion of the sequence of the second oligonucleotide is identical to that of the first oligonucleotide and the third oligonucleotide A step of providing a reverse complement of a portion of the sequence of oligonucleotides, wherein the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide form a double-stranded region that fits with the respective free ends of the tagged immobilized DNA amplicon product; a) ligating the respective free ends of the immobilized DNA amplicon product to the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide of the cap primer adapter; d) extending from the respective 3' ends of the first oligonucleotide of the cap primer adapter using DNA polymerase, wherein the second strand of the immobilized DNA amplicon product provides a template for DNA polymerase, and the DNA polymerase generates a third strand, the third strand being a copy of the second strand; and e) cleaving each cleavable element of the captured oligonucleotide structure, wherein cleaving releases the DNA amplicon product from the solid support and generates a free 5' end on the respective second strand of the DNA amplicon product.f) A method for generating a library of single-stranded DNA template constructs, comprising the step of digesting with an exonuclease from the free 5' end of each cleaved second strand of a DNA amplicon product, wherein the digestion removes the second strand of the DNA amplicon product and the second oligonucleotide of the cap-primer adapter to generate a library of single-stranded template constructs, each of which contains two copies of the first strand of the DNA amplicon product operably linked by the first and third oligonucleotides of the cap-primer adapter.

[0021] In another aspect, the Disclosure provides a library of single-stranded DNA template constructs, each of which comprises a first copy and a second copy of the same strand of a DNA target sequence, the first and second copies of the DNA target sequence being operably linked, such that the library of single-stranded DNA template constructs is produced by the method described in the preceding paragraph.

[0022] In another aspect, the present disclosure provides a method for generating a library of mirrored Xpandomer molecules, wherein each Xpandomer molecule comprises two copies of the same strand of a DNA target sequence, the method comprising: a) providing a library of single-stranded DNA template constructs as described in the above paragraph; (b) providing a population of extension oligonucleotides complementary to a second tag of a DNA amplicon product, wherein the extension oligonucleotides are immobilized on a solid substrate; (c) specifically hybridizing the library of single-stranded DNA template constructs to the extension oligonucleotides; (d) providing a population of cap-branched constructs, wherein the cap-branched constructs comprise a first oligonucleotide operably linked to a second oligonucleotide, the first and second oligonucleotides comprising sequences complementary to a portion of the sequences of the first and third oligonucleotides of a cap primer adapter construct, and the first and second oligonucleotides of the cap-branched constructs providing a free 5' nucleoside triphosphate moiety; (e) specifically hybridizing the population of cap-branched constructs to the population of DNA template constructs; and (f) performing a primer extension reaction to generate Xpandomer copies of the first and second copies of the DNA target sequence, wherein the Xpandomer copies are operably linked by the cap-branched constructs. A method for generating a library of mirrored Xpandomer molecules is provided.

[0023] In some embodiments, the capture oligonucleotide structure and the extension oligonucleotide are immobilized on the same solid support, and the extension oligonucleotide includes a cleavable hairpin structure, which is cleaved during the cleavage step to provide a binding site for the DNA amplicon product. In other embodiments, the capture oligonucleotide structure is immobilized on a first substrate in a first chamber of a microfluidic card, and the extension oligonucleotide is immobilized on a second substrate in a second chamber of a microfluidic card, and the first chamber is configured to generate a population of single-stranded DNA template constructs, and the second chamber is configured to generate a population of Xpandomer copies of the single-stranded DNA template constructs. In yet another embodiment, the capture oligonucleotide structure is immobilized on a bead support, and the extension oligonucleotide is immobilized on a COC chip support, and the bead support is configured to generate a population of single-stranded DNA template constructs, and the COC chip support is configured to generate a population of Xpandomer copies of the DNA template constructs. In another embodiment, the capture oligonucleotide structure and the elongated oligonucleotide are immobilized on a bead support, and the bead support is configured to generate a collection of single-stranded DNA template constructs and a collection of Xpandomer copies of the DNA template constructs. In yet another embodiment, the elongated oligonucleotide is provided by a branched oligonucleotide structure, the branched oligonucleotide structure comprising a first elongated oligonucleotide operably linked to a second elongated oligonucleotide by a chemical branching agent, the first elongated oligonucleotide comprising a leader sequence, a concentrator sequence, and a first cleavable portion interposed between the chemical branching agent and the leader sequence and concentrator sequence, the second elongated oligonucleotide comprising a second cleavable portion.

[0024] The above and additional features of the present invention and the methods for obtaining them are evident, and the present invention will be best understood by referring to the following more detailed description. All references disclosed herein are incorporated herein by reference in whole as if each were incorporated individually.

[0025] This brief summary is provided to introduce certain concepts in a simplified form, which will be explained in more detail in the detailed description below. Unless otherwise specified, this brief summary is not intended to identify any important or essential features of the claimed subject matter. This is not intended to limit the scope of the subject matter claimed in the patent application.

[0026] Details of one or more embodiments are described below. Features illustrated or described in relation to one exemplary embodiment can be combined with features of other embodiments. Thus, further embodiments can be provided by combining any of the various embodiments described herein. The aspects of the embodiments can be modified as needed to provide yet another embodiment using concepts from various patents, applications, and publications identified herein. Other features, purposes, and advantages will become apparent from the description, drawings, and claims. [Brief explanation of the drawing]

[0027] The exemplary features, properties, and various advantages of this disclosure will become apparent from the accompanying drawings and the following detailed description of various embodiments. Non-limiting and non-exclusive embodiments are described with reference to the accompanying drawings, and unless otherwise specified, similar labels or reference numbers throughout the various drawings refer to similar parts. The sizes and relative positions of the elements in the drawings are not necessarily drawn to scale. For example, the shapes of the various elements have been selected, enlarged, and positioned to improve the visibility of the drawing. The specific shapes of the elements depicted have been selected to facilitate recognition in the drawing.

[0028] [Figure 1A] This is a summarized schematic diagram illustrating the key features of generalized XNTPs and their use in Extended Sequence (SBX) sequencing. [Figure 1B]This is a summarized schematic diagram illustrating the key features of generalized XNTPs and their use in Extended Sequence (SBX) sequencing. [Figure 1C] This is a summarized schematic diagram illustrating the key features of generalized XNTPs and their use in Extended Sequence (SBX) sequencing. [Figure 1D] This is a summarized schematic diagram illustrating the key features of generalized XNTPs and their use in Extended Sequence (SBX) sequencing.

[0029] [Figure 2] This is a schematic diagram showing further details of one embodiment of XNTP.

[0030] [Figure 3] This is a schematic diagram showing one embodiment of Xpandomer passing through biological nanopores.

[0031] [Figure 4A] This is a schematic diagram illustrating an exemplary embodiment of surface chemistry for solid-phase Xpandomer synthesis. [Figure 4B] This is a schematic diagram illustrating an exemplary embodiment of surface chemistry for solid-phase Xpandomer synthesis. [Figure 4C] This is a schematic diagram illustrating an exemplary embodiment of surface chemistry for solid-phase Xpandomer synthesis. [Figure 4D] This is a schematic diagram illustrating an exemplary embodiment of surface chemistry for solid-phase Xpandomer synthesis. [Figure 4E] This is a schematic diagram illustrating an exemplary embodiment of surface chemistry for solid-phase Xpandomer synthesis.

[0032] [Figure 5] This is a schematic diagram providing a generalized example of one embodiment of the functionalization of acid-resistant beads and the immobilization of extended oligonucleotide / DNA template complexes onto acid-resistant beads.

[0033] [Figure 6A]This is a schematic diagram providing a generalized example of a terminal capping method.

[0034] [Figure 6B] This is a gel showing the primer extension product.

[0035] [Figure 7A] This is a schematic diagram illustrating the general features of an exemplary embodiment of the end cap. [Figure 7B] This is a schematic diagram illustrating the general features of an exemplary embodiment of the end cap. [Figure 7C] This is a schematic diagram illustrating the general features of an exemplary embodiment of the end cap. [Figure 7D] This is a schematic diagram illustrating the general features of an exemplary embodiment of the end cap.

[0036] [Figure 8-1] This is a schematic diagram summarizing the steps of one embodiment of solid-phase Xpandomer synthesis. [Figure 8-2] This is a schematic diagram summarizing the steps of one embodiment of solid-phase Xpandomer synthesis. [Figure 8-3] This is a schematic diagram summarizing the steps of one embodiment of solid-phase Xpandomer synthesis.

[0037] [Figure 9-1] This is a schematic diagram summarizing the steps of another embodiment of solid-phase Xpandomer synthesis. [Figure 9-2] This is a schematic diagram summarizing the steps of another embodiment of solid-phase Xpandomer synthesis.

[0038] [Figure 10A] This is a schematic diagram illustrating alternative strategies to prevent polymerase "short-circuiting" during terminal capping protocols. [Figure 10B] This is a schematic diagram illustrating alternative strategies to prevent polymerase "short-circuiting" during terminal capping protocols.

[0039] [Figure 11A] This is a schematic diagram summarizing the steps of one embodiment of the use of mirrored library construction and Xpandomer synthesis. [Figure 11B] This is a schematic diagram summarizing the steps of one embodiment of the use of mirrored library construction and Xpandomer synthesis. [Figure 11C] This is a schematic diagram summarizing the steps of one embodiment of the use of mirrored library construction and Xpandomer synthesis.

[0040] [Figure 12] This is a schematic diagram illustrating the general features of one embodiment of a cap adapter structure.

[0041] [Figure 13] This document summarizes one embodiment of a workflow for generating an Xpandomer mirroring library.

[0042] [Figure 14A-1] This is a schematic diagram summarizing the steps of one embodiment for generating an immobilized DNA amplicon library. [Figure 14A-2] This is a schematic diagram summarizing the steps of one embodiment for generating an immobilized DNA amplicon library. [Figure 14B-1] This is a schematic diagram summarizing the steps of one embodiment for generating an immobilized DNA amplicon library. [Figure 14B-2] This is a schematic diagram summarizing the steps of one embodiment for generating an immobilized DNA amplicon library.

[0043] [Figure 15A] This is a schematic diagram summarizing the steps of one embodiment of the solid-state synthesis of a library of enantiomer template constructs for the enantiomer library Xpandomer product. [Figure 15B] This is a schematic diagram summarizing the steps of one embodiment of the solid-state synthesis of a library of enantiomer template constructs for the enantiomer library Xpandomer product.

[0044] [Figure 16A] This is a schematic diagram summarizing the steps of another embodiment of the solid-state synthesis of a library of constructs for the synthesis of the mirrored library Xpandomer. [Figure 16B] This is a schematic diagram summarizing the steps of another embodiment of the solid-state synthesis of a library of constructs for the synthesis of the mirrored library Xpandomer.

[0045] [Figure 17] This summarizes one embodiment of a workflow for generating Xpandomer mirroring libraries using different solid supports.

[0046] [Figure 18] This is a schematic diagram illustrating the generalized characteristics of branched and elongated oligonucleotide structures.

[0047] [Figure 19A] This is a schematic diagram summarizing the steps of one embodiment of the solid-state synthesis of an Xpandomer mirror image library using branched oligonucleotides. [Figure 19B] This is a schematic diagram summarizing the steps of one embodiment of the solid-state synthesis of an Xpandomer mirror image library using branched oligonucleotides.

[0048] [Figure 20] This is a gel showing the primer extension product.

[0049] [Figure 21A] This is a gel showing the primer extension product.

[0050] [Figure 21B] This is a histogram alignment of sequencing reads from nanopores.

[0051] [Figure 22] This is a gel showing primer extension products with terminal capping.

[0052] [Figure 23] This is a gel showing primer extension products with terminal capping.

[0053] [Figure 24A] This is a schematic diagram showing one embodiment of a three-way adapter connected to a library fragment.

[0054] [Figure 24B] This gel shows the connection of a three-pronged adapter to a library fragment.

[0055] [Figure 25A] This is a schematic diagram showing one embodiment of the extension and digestion reaction of the M1 mirroring library construct for generating the M3 mirroring library construct.

[0056] [Figure 25B] This is a gel that shows the products of elongation and digestion reactions.

[0057] [Figure 26A] This is a schematic diagram showing one embodiment of solid-state synthesis of an M1 mirrored library construct.

[0058] [Figure 26B] This is a gel showing the solid-state product of the M1 mirror-image library construct.

[0059] [Figure 27] This is a schematic diagram showing one embodiment of a template for synthesizing the mirroring library Xpandomer.

[0060] [Figure 28] This gel shows the products of various stages in the mirrored library construction.

[0061] [Figure 29] This is a nanopore trace showing a portion of the Xpandomer mirroring library array.

[0062] [Figure 30] This is a gel showing Xpandomer products synthesized on acid-resistant magnetic beads.

[0063] [Figure 31] This gel demonstrates the synthesis and treatment of Xpandomer products on acid-resistant magnetic beads. [Modes for carrying out the invention]

[0064] The present invention may be more readily understood by referring to the following detailed description of preferred embodiments of the invention and examples contained herein. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the invention pertains.

[0065] The implementation of the present invention will, unless otherwise indicated, utilize conventional techniques within the scope of the art, such as molecular biology, microbiology, and recombinant DNA. These techniques are well described in the literature. See, for example, Sambrook, Fritsch, and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition (1989), OLIGONUCLEOTIDES (MJ Gait Ed., 1984), the series METHODS IN ENZYMOLOGY (Academic Press, Inc.), and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (FMAusubel, R. Brent, REKingston, D.D. Moore, JG Siedman, JASmith, and K. Struhl, eds., 1987). All patents, patent applications, and publications mentioned above and below in this specification are incorporated herein by reference.

[0066] 1.Definition As used herein, “nucleic acid,” also called polynucleotide, is a series of covalently linked nucleotides in which the 3' position of the pentose of one nucleotide is linked to the next 5' position by a phosphodiester group. Nucleic acid molecules can be deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or a combination of both. DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are biologically occurring polynucleotides in which nucleotide residues are linked in a specific sequence by phosphodiester bonds. As used herein, the terms “nucleic acid,” “polynucleotide,” or “oligonucleotide” encompass any polymer compound having a linear backbone of nucleotides. Oligonucleotides, also called oligomers, are generally shorter-chain polynucleotides. When nucleic acids are intended for sequencing, they are generally called “target nucleic acid,” “target sequence,” “template,” or “library fragment.”

[0067] The term "template" refers to a strand of DNA that sets the gene sequence for a new strand.

[0068] As used herein, the term “template-dependent process” is intended to refer to a process involving template-dependent extension of a primer molecule (e.g., DNA synthesis by DNA polymerase). The term “template-dependent process” refers to the synthesis of polynucleotides of RNA or DNA, where the sequence of the newly synthesized polynucleotide strand is determined by well known complementary base pairing rules (see, for example, Watson, J. Det. al., In: Molecular Biology of the Gene, 4th Ed., WABenjamin, Inc., Menlo Park, Calif. (1987)).

[0069] As used herein, the term “primer” refers to a short chain of nucleic acid that is complementary to the sequence of another nucleic acid and acts as a starting point for DNA synthesis. Preferably, the primers consist of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, and at least The bases have lengths of 13, at least 14, at least 15, at least 16, at least 18, at least 20, at least 25, at least 30, or more.

[0070] As used herein, the term “chain” refers to a nucleic acid, which consists of nucleotides covalently bonded to one another by phosphodiester bonds. One chain of a nucleic acid does not contain nucleotides that are bonded only via hydrogen bonds, i.e., via base pairing, but that chain can base pair with a complementary chain via hydrogen bonds. When the first and second chains base pair via complementarity, the first chain may be called the “plus” chain, “sense” chain, or “5'-to-3'” chain, and the second chain may be called the “minus” chain, “antisense” chain, or “3'-to-5'” chain (or vice versa).

[0071] As used herein, the term "3' end" refers to the end of a nucleotide chain that has a third carbon hydroxyl group on the deoxyribose sugar ring at that end.

[0072] As used herein, the term “5' end” refers to the end of a nucleotide chain that has a fifth carbon in the deoxyribose sugar ring at that end.

[0073] The term "complementary" refers to base pairings that enable the formation of a double helix, such as between nucleotides or nucleic acids, for example, between the two strands of a double-stranded DNA molecule, or between an oligonucleotide primer and a primer binding site on a single-stranded nucleic acid, or between an oligonucleotide probe and its complementary sequence in a DNA molecule. Complementary nucleotides are generally A and T (or A and U), or C and G. Two single-stranded DNA molecules are said to be substantially complementary if the nucleotides of one strand pair with about 60%, at least 70%, at least 80%, at least 85%, usually at least about 90% to about 95%, and even about 98% to about 100% of the nucleotides of the other strand, and are optimally aligned, compared, and have appropriate nucleotide insertions or deletions. The degree of identity between two nucleotide regions is determined using computer-implemented algorithms and methods widely known to those skilled in the art. The identity between two nucleotide sequences is preferably determined using the BLASTN algorithm (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, Md. 20894, Altschul, S., et al., J., 1990, Mol. Biol. 215: 403-410).

[0074] Hybridization refers to the process by which two single-stranded polynucleotides are non-covalently joined to form a stable double-stranded polynucleotide. Hybridization conditions typically involve a salt concentration of about 1 M or less, more commonly less than about 500 mM, and may be less than about 200 mM. Hybridization buffer is a buffer salt solution such as 5% SSPE, or other such buffers known in the art. Hybridization temperature may be as low as about 5°C, but is typically above 22°C, more commonly above about 30°C, and typically above 37°C. Hybridization is often performed under stringent conditions, i.e., conditions under which the primer will hybridize to its target subsequence but not to other non-complementary sequences. Stringent conditions are sequence-dependent and vary from situation to situation. For example, longer fragments may require higher hybridization temperatures for specific hybridization than shorter fragments. Other factors, including base composition and complementary chain length, the presence of organic solvents, and the degree of base mismatch, can affect the stringency of hybridization; therefore, the combination of parameters is more important than the absolute measure of any single parameter alone. Generally, stringent conditions are selected such that the Tm of a particular sequence is about 5°C lower than the defined ionic strength and pH. Exemplary stringent conditions include a pH of about 7.0 to about 8.3 and a sodium ion concentration (or other salt) of at least 0.01 M to 1 M at a temperature of at least 25°C. The degree can be increased.

[0075] Nucleic acids are "operatably linked" when they are in a functional relationship with one another. Generally, "operatably linked" means that the linked nucleic acid sequences are in close proximity to each other. Linking can be achieved enzymatically, for example, by nucleic acid ligases or polymerases.

[0076] As used herein, the term “double-stranded DNA library” may refer to a library containing both strands of DNA molecules (i.e., sense strand and antisense strand) that are physically linked by one of their ends and can form part of the same molecule. A library of double-stranded DNA molecules may, but are not limited to, genomic DNA (nuclear DNA, mitochondrial DNA, chloroplast DNA, etc.), plasmid DNA, or double-stranded DNA molecules (e.g., DNA, cDNA, mRNA) obtained from single-stranded nucleic acid samples.

[0077] As used herein, “nucleic acid polymerase” generally refers to an enzyme for linking 3'-OH 5'-triphosphate nucleotides, oligomers, and their analogues. Polymerases include DNA-dependent DNA polymerase, DNA-dependent RNA polymerase, RNA-dependent DNA polymerase, RNA-dependent RNA polymerase, T7 DNA polymerase, T3 DNA polymerase, T4 DNA polymerase, T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, DNA polymerase 1, Klenow fragment, Thermophilus aquaticus DNA polymerase, Tth DNA polymerase, Vent® DNA polymerase (New England Biolabs), Deep Examples include Vent® DNA polymerase (New England Biolabs), Bst DNA Polymerase Large Fragment, Stoeffel Fragment, 90 N DNA Polymerase, 90 N DNA polymerase, Pfu DNA Polymerase, Tfl DNA Polymerase, Tth DNA Polymerase, Phi29 Polymerase, Tli DNA polymerase, eukaryotic DNA polymerase beta, telomerase, Therminator® polymerase (New England Biolabs), KOD HiFi® DNA polymerase (Novagen), KOD1 DNA polymerase, Q-beta replicase, terminal transferase, AMV reverse transcriptase, M-MLV reverse transcriptase, Phi6 reverse transcriptase, and HIV-1 reverse transcriptase. The polymerases according to the present invention may be mutants, mutants, or chimeric polymerases.

[0078] As used herein, “DPO4-type DNA polymerase” refers to a DNA polymerase naturally expressed by the archaea, Sulfolobus solfataricus, or related Y-family DNA polymerases, which functions in the replication of damaged DNA by a process commonly known as damage-overcoming synthesis (TLS). Y-family DNA polymerases are homologous to DPO4 polymerase. Examples include the prokaryotic enzymes PolII, PolIV, PolV; the archaeal enzyme Dbh; and the eukaryotic enzymes Rev3p, Rev1p, Polη, REV3, REV1, PolI, and Polκ DNA polymerases, as well as their chimeras.

[0079] As used herein, “DPO4 variant” is a modified recombinant DPO4-type DNA polymerase comprising one or more mutations compared to naturally occurring wild-type DPO4-type DNA polymerase, e.g., one or more mutations that enhance the ability to utilize bulky nucleotide analogs as substrates or other polymerase properties, and additional modifications or alterations to wild-type DPO4-type DNA polymerase, e.g., additional peptides or proteins. The mutations may include one or more deletions, insertions, and / or fusions of the sequence (for example, to immobilize the polymerase on a surface or otherwise tag the polymerase enzyme). Examples of DPO4 mutant polymerases according to the present invention are mutants of Sulfolobus sulfataricus DPO4 described in the published PCT Patent Application International Publication No. 2017 / 087281A1 and PCT Patent Application Nos. PCTUS2018 / 030972 and PCTUS2018 / 64794, which are incorporated herein by reference in their entirety.

[0080] As used herein, “nucleic acid polymerase reaction” refers to an in vitro method for template-dependently constructing a new chain of nucleic acid or extending an existing nucleic acid (e.g., DNA or RNA). The nucleic acid polymerase reaction according to the present invention comprises a primer extension reaction, which results in the incorporation of a nucleotide or nucleotide analog at the 3' end of a primer such that the incorporated nucleotide or nucleotide analog is complementary to the corresponding nucleotide of the target polynucleotide. The primer extension product of the nucleic acid polymerase reaction can be further used for single-molecule sequencing or as a template for synthesizing further nucleic acid molecules.

[0081] As used herein, the term “multiple” means “at least two.”

[0082] "XNTP" is an expandable 5'-triphosphate modified nucleotide substrate compatible with template-dependent enzyme polymerization. XNTP has two distinct functional components: a nucleic acid base 5'-triphosphoramide and a tethering chain attached within each nucleoside triphosphoramide at a position that allows for controlled expansion by intranucleotide cleavage of the phosphoramide bond. 。 Exemplary XNTPs and methods for producing them are described, for example, in Applicant's published PCT application number International Publication No. 2016 / 081871, which is incorporated in its entirety herein by reference.

[0083] The "Xpandomer intermediate" is an intermediate product (also referred to herein as the "daughter strand") collected from XNTPs and formed by polymerase-mediated template-directed assembly of XNTPs using a target nucleic acid template. The newly synthesized Xpandomer intermediate is a constrained Xpandomer. Under the process steps in which the phosphoramide bond provided by the XNTP is cleaved, the constrained Xpandomer is no longer constrained and is an Xpandomer product that elongates as the tethering strand is extended.

[0084] An "Xpandomer" or "Xpandomer product" is a synthetic molecular construct produced by the proliferation of a constrained Xpandomer, which itself is synthesized by a template-directed assembly of XNTP substrates. The Xpandomer extends over the target template from which it was produced. It consists of a linkage of subunits, each subunit being a motif, and each motif being a member of a library containing sequence information, a tethering chain, and optionally, part or all of the substrate, all of which originate from the formable substrate construct. The Xpandomer is designed to extend beyond the target template, thereby reducing the linear density of sequence information of the target template along its length. Furthermore, the Xpandomer optionally provides a platform for increasing the size and abundance of the reporter, which in turn improves the signal-to-noise ratio for detection. Lower linear information density and stronger signals increase resolution and reduce the sensitivity requirements for detecting and compounding the sequence of the template chain.

[0085] A "tie chain" or "tie chain component" refers to a polymer or molecular construct that has nearly linear dimensions and has terminal portions at each of its two opposing ends. It binds to a nucleoside triphosphoramide that has a bond to form XNTP. The bond helps to constrain the tethering chain to a "constrained configuration". The tethering chain has a "constrained configuration" and an "extended configuration". The constrained configuration is found in XNTP and the daughter chain or Xpandomer intermediate. The constrained configuration of the tethering chain is a precursor to the extended configuration, as seen in the Xpandomer product. The transition from the constrained configuration to the extended configuration results in the cleavage of a selectively cleavable phosphoramide bond. The tethering chain contains one or more reporters or reporter constructs along its length that can encode the sequence information of the substrate. The tethering chain provides a means to extend the length of Xpandomer and thereby reduce the linear density of sequence information.

[0086] A "tie-chain element" or "tie-chain segment" is a polymer having nearly linear dimensions and two ends, where the ends form end links for connecting tie-chain elements. A tie-chain element is a segment of a tie-chain. Such polymers include polyethylene glycol, polyglycol, polypyridine, polyisocyanate, poly(triarylmethyl) methacrylate, polyaldehyde, polypyrrolinone, polyurea, polyglycol phosphodiester, polyacrylate, polymethacrylate, polyacrylamide, polyvinyl ester, polystyrene, polyamide, polyurethane, polycarbonate, polybutyrate, polybutadiene, polybutyrolactone, polypyrrolidinone, polyvinyl phosphonate, polyacetamide, polysaccharides, polyhyaluranate, polyamide, polyimide, polyester, polyethylene, polypropylene, polystyrene, polycarbonate, polyterephthalate, polysilane, polyurethane, polyether, polyamino acid, polyglycine, polyproline, N-substituted polylysine, polypeptide, side-chain N-substituted peptide, poly-N-substituted glycine, peptoid, side-chain carboxy This may include, but is not limited to, substituted peptides, homopeptides, oligonucleotides, ribonucleic acid oligonucleotides, deoxynucleic acid oligonucleotides, oligonucleotides modified to prevent Watson-Crick base pairing, oligonucleotide analogs, polycytidylic acid, polyadenylic acid, polyuridylic acid, polythymidine, polyphosphates, polynucleotides, polyribonucleotides, polyethylene glycol-phosphodiesters, peptide polynucleotide analogs, threosyl-polynucleotide analogs, glycol-polynucleotide analogs, morpholino-polynucleotide analogs, locked nucleotide oligomer analogs, polypeptide analogs, branched polymers, comb polymers, star polymers, dendritic polymers, random, gradient and block copolymers, anionic polymers, cationic polymers, polymers forming base loops, rigid segments and mobile segments.

[0087] A "reporter" consists of one or more reporter elements. Reporters help analyze the genetic information of a target nucleic acid.

[0088] A “reporter construct” comprises one or more reporters capable of generating a detectable signal, which generally contains sequence information. This signal information is called the “reporter code” and is subsequently decoded into genetic sequence data. A reporter construct may also contain other structural components, including tethering segments or polymers, graft copolymers, block copolymers, affinity ligands, oligomers, haptens, aptamers, dendrimers, linking groups, or affinity-binding groups (e.g., biotin).

[0089] The "reporter code" is genetic information derived from the measurement signal of the reporter construct. The reporter code is decoded to provide sequence-specific genetic information data.

[0090] As used herein, the terms “solid support,” “solid state,” “support,” and “substrate” are used interchangeably and refer to a material or group of materials having a rigid or semi-rigid surface. In many embodiments, at least one surface of the solid support will be substantially flat and will be, for example, the surface of a polymer microfluidic card or chip. In some embodiments, it may be desirable to physically separate areas of the card or chip for different reactions with, for example, etched channels, trenches, wells, raised regions, pins, etc. According to other embodiments, the solid support will take the form of insoluble beads, resins, gels, membranes, microspheres, or other geometric arrangements composed of, for example, controlled pore glass (CPG) and / or polystyrene.

[0091] As used herein, the term “immobilized” refers to an association, bond, or bond between a molecule (e.g., a linker, adapter, oligonucleotide) and a support in a manner that provides a stable association under the conditions of extension, amplification, linking, and other processes described herein. Such bonds may be covalent or non-covalent. Non-covalent bonds include electrostatic, hydrophilic, and hydrophobic interactions. Covalent bonds are the formation of a covalent bond characterized by the sharing of electron pairs between atoms. Such covalent bonds may be directly present between the molecule and the support, or may be formed by a crosslinker, or by including a reactive group specific to the support, the molecule, or both. Covalent bonds of a molecule can be achieved using a binding partner such as avidin or streptavidin immobilized on the support, and non-covalent bonds of a biotinylated molecule to avidin or streptavidin. Immobilization may also involve a combination of covalent and non-covalent interactions.

[0092] As used herein, the term “click reaction” is recognized in the art and describes a set of highly reliable and self-directing organic reactions, such as the most well-known copper-catalyzed azido-alkyne [3+2] cycloaddition. Non-limiting examples of click chemistry reactions can be found, for example, in HCOlb, MGFinn, KB Sharpless, Angew. Chem. Int. Ed. 2001, 40, 2004 and EMSletten, CRBertozzi, Angew. Chem. Int. Ed. 2009, 48, 6974, the disclosures thereof, are incorporated herein by reference in their entirety for all purposes.

[0093] An exemplary click chemistry reaction is the azide-alkyne Huisgen addition cycloaddition (e.g., using a copper (Cu) catalyst at room temperature). (Rostovtsev, et al. 2002 Angew. Chemie Int'l Ed. 41(14):2596-2599; Tornoe, et al. 2002 J. Org. Chem. 67(9):3057-3064.) Other examples of click chemistry include the thiol-enclick reaction, the Diels-Alder reaction, and the reverse electron-demand Diels-Alder reaction, as well as the [4+1] cycloaddition between isonitriles (isocyanides) and tetrazines. (For example, see Hoyle, et al. 2010 Angew. Chemie Int'l Ed. 49(9):1540-1573; Blackman, et al. 2008 J.Am. Chem. Soc. 130(41):13518-13519; Devaraj, et al. 2008 Bioconjugate Chem. 19(12):2297-2299; Stockmann, et al. 2011 Org. Biomol. Chem. 9, 7303-7305.)

[0094] The term "alkyne" refers to a hydrocarbon having at least one carbon-carbon triple bond. As used herein, the term "terminal alkyne" refers to an alkyne in which at least one hydrogen atom is bonded to a triple-bonded carbon atom.

[0095] As used herein, the terms "azide" or "azide group" refer to the group of formula (--N3).

[0096] The term "triazole" refers to any heterocyclic compound having the molecular formula C2H3N3, which has a five-membered ring of two carbon atoms and three nitrogen atoms. The triazole moiety is the product of a chemical click reaction between the alkyne moiety and the azide moiety.

[0097] Sequence determination by extension One exemplary primer extension reaction that can be enhanced by solid-state synthesis is the polymerization of a non-native nucleotide analog known as "XNTP," which forms the basis of the "Sequencing by Expansion" (SBX) protocol developed by Stratos Genomics (see, e.g., Kokoris et al., U.S. Patent No. 7,939,259, "High Throughput Nucleic Acid Sequencing by Expansion"). Generally, SBX uses this biochemical polymerization to transfer the DNA template sequence onto a measurable polymer called "Xpandomer." The transferred sequence is encoded along the Xpandomer backbone in a high-signal-versus-noise reporter approximately 10 nm away, designed for high-signal-versus-noise, high-differentiation responses. These differences provide a significant performance improvement in the sequence read efficiency and accuracy of Xpandomer compared to native DNA. A generalized overview of the SBX process is shown in Figures 1A, 1B, 1C, and 1D.

[0098] XNTPs are expandable 5'-triphosphate modified nucleotide substrates compatible with template-dependent enzyme polymerization. A highly simplified XNTP is shown in Figure 1A, which highlights the unique characteristics of these nucleotide analogs. XNTP 100 has two distinct functional regions: a selectively cleavable phosphoramide bond 110 linking the 5'-α-phosphate 115 to the nucleic acid base 105, and a tethering chain 120 bound within the nucleoside triphosphoramide at a position that allows for controlled expansion by intranucleotide cleavage of the phosphoramide bond. The tethering chain of XNTP consists of linker arm portions 125A and 125B separated by the selectively cleavable phosphoramide bond. Each linker is bound to one end of reporter 130 via a linking group (LG), as disclosed in U.S. Patent No. 8,324,360 by Kokoris et al., which is incorporated herein by reference in whole. XNTP 100 is shown in the characteristic "constrained configuration" of the polymerized XNTP substrate and daughter chain. The constrained configuration of polymerized XNTP is a precursor to the extended configuration, as seen in the Xpandomer product. The transition from the constrained configuration to the extended configuration occurs when the P--N bond of the phosphoramidate in the primary backbone of the daughter chain is cleaved.

[0099] The synthesis of Xpandomer is summarized in Figures 1B and 1C. During assembly, the monomer XNTP substrates 145 (XATP, XCTP, XGTP, and XTTP) are polymerized at the elongable ends of the nascent daughter strand 150 by a template-directed polymerization process using a single-stranded template (SEQ ID NO: 1) 140 as a guide. Generally, this process is initiated from the primer and proceeds in the 5' to 3' direction. Generally, the daughter strand is formed using DNA polymerase or other polymerases, and conditions are selected to obtain a complementary copy of the template strand. After the daughter strand is synthesized, the coupled tugboat contains a constrained Xpandomer that further contains the daughter strand. The tugboat in the daughter strand has a "constrained configuration" of the XNTP substrate. The constrained configuration of the tugboat is a precursor to the extended configuration, as seen in the Xpandomer product.

[0100] As shown in Figure 1C, the transition from the constrained configuration 160 to the extended configuration 165 is due to the cleavage of selectively cleavable phosphoramidate bonds (indicated by unshaded ellipses for simplification) within the primary backbone of the daughter strands. In this embodiment, the tethering strands are one or more reporter constructs or reporters specific to the nucleic acid bases to which they are linked. The structure includes constructs 130A, 130C, 130G, or 130T, which thereby encode the sequence information of the template. In this way, the tethering strand provides a means to extend the length of Xpandomer and reduce the linear density of the sequence information of the parent strand.

[0101] Figure 1D shows Xpandomer 165 moving from cis reservoir 175 to trans reservoir 185 through nanopore 180. Upon passing through the nanopore, each of the linearized Xpandomer reporters (labeled "G", "C", and "T" in this figure) generates a distinct and reproducible electronic signal (indicated by superimposed trace 190) specific to the nucleic acid base to which it is linked.

[0102] Figure 2 shows the generalized structure of XNTP in more detail. XNTP 200 consists of a nucleoside triphosphoramide 210 having linker arm portions 220A and 220B separated by selectively cleavable phosphoramide bonds 230. The tethering chain is linked to the nucleoside triphosphoramide by linking groups 250A and 250B, with the first tethering chain end linked to a heterocycle 260 (represented here by cytosine, although the heterocycle may be any one of the four standard nucleoside bases, A, C, G, or T), and the second tethering chain end linked to an alpha-phosphate 270 of the nucleoside backbone. Those skilled in the art will understand that the final XNTP substrate product can be formed using many suitable coupling chemicals known in the art, for example, the tethering chain linkage can be achieved by triazole linkage.

[0103] In this embodiment, the tethering chain 275 consists of several functional elements, including enhancers 280A and 280B, reporter codes 285A and 285B, and translation control elements (TCEs) 290A and 290B. Each of these features plays a unique role in the translocation of Xpandomer through the nanopore and the generation of a unique and reproducible electronic signal. The tethering chain 275 is designed for translocation control by hybridization (TCH). As shown, the TCE can be double-chained to a complementary oligomer (CO) and provides a region for hybridization positioned adjacent to the reporter code. Different reporter codes are sized such that they block ion flow through the nanopore at different measurable levels. Specific reporter codes can be efficiently synthesized using phosphoramidite chemistry, which is typically used in oligonucleotide synthesis. Reporters can be designed by selecting a specific phosphoramidite sequence from a commercially available library. Such libraries include, but are not limited to, polyethylene glycols having a length of 1 to 12 or more ethylene glycol units, aliphatic compounds having a length of 1 to 12 or more carbon units, deoxyadenosine (A), deoxycytosine (C), deoxyguanodine (G), deoxythymine (T), and debase (Q). Since double-chained TCEs associated with reporter codes also contribute to ion current blockade, the combination of a reporter code and a TCE can be called a "reporter." Following the reporter code, in one embodiment, there is an enhancer comprising a spermine polymer.

[0104] Figure 3 shows one embodiment of a cleaved Xpandomer in the process of dislocating an α-hemolysin nanopore. This biological nanopore is embedded in a lipid bilayer membrane that separates and electrically isolates two storage regions of an electrolyte. A typical electrolyte has 1 mole of KCl buffered to pH 7.0. When a small voltage, typically 100 mV, is applied across the bilayer, the nanopore restricts the flow of ionic current and acts as a primary resistance in the circuit. The Xpandomer reporter is designed to provide a specific ionic current cutoff level, and the reporter's array allows for reading the array information by measuring the array of ionic current levels as the nanopore dislocates.

[0105] α-hemolysin nanopores are typically oriented, so translocation occurs by entering from the antral side and exiting from the basal side. As shown in Figure 3, the nanopore is oriented to initially capture the Xpandomer from the basal side. This orientation is advantageous when using the TCH method because it reduces the occlusion artifacts that occur when the Xpandomer first enters the antral side. Unless otherwise specified, the basal side will be the initially assumed translocation direction. Once the Xpandomer has translocated, the reporter enters the basal inlet until its double-stranded TCE is stopped at the basal inlet. Since the double-stranded TCE has a diameter of approximately 2.4 nm and the basal inlet is approximately 2.2 nm, the reporter is held at the basal inlet until the complementary strand 395 of the double-stranded TCE dissociates (is released), after which the translocation proceeds to the next reporter. Since the Xpandomer is still translocated and diffusing from the pore, it is highly undesirable for the free complementary strand to enter the nanopore.

[0106] In one embodiment, each member of the reporter code (following the double chain) is formed by an ordered selection of phosphoramidites, which can be selected from a wide range of commercially available libraries. Each constituent phosphoramidite contributes to the net ionic resistance according to its position within the nanopore (located after the double chain is stopped), its displacement, its charge, its interaction with the nanopore, its chemical and thermal environment, and other factors. The charge on each phosphoramidite is partly due to phosphate ions, which have a nominal charge of -1 but are effectively reduced by counterion shielding. The force pulling the double chain is due to these active charges along the reporter acting on it with a local electric field. Since each reporter can have a different charge distribution, different forces can be exerted on the double chain for a given applied voltage. The force transmitted along the reporter framework also helps to stretch the reporter, giving it a repeatable blocking response.

[0107] For sequencing, protein nanopores are prepared by inserting α-hemolysin into the DPhPE / hexadecane bilayer member in buffer B1 containing 2M NH4Cl and 100mM HEPES (pH 7.4). The cis well is perfused with buffer B2 containing 0.4M NH4Cl, 0.6M GuCl, and 100mM HEPES, pH 7.4. The Xpandomer sample is heated to 70°C for 2 minutes, cooled completely, and then 2 μL of the sample is added to the cis well. A voltage pulse of 90mV / 390mV / 10μs is then applied, and data is acquired using LabVIEW acquisition software.

[0108] Sequence data is analyzed by displaying a histogram of the population of sequence reads from a single SBX reaction. The analysis software aligns each sequence read to a template sequence and trims the range of sequences at the ends of reads that do not align with the correct template sequence.

[0109] 2. Embodiments of the present invention The present invention may utilize specific methods, apparatus, and compositions as described in the following exemplary embodiments.

[0110] A. Solid-state synthesis

[0111] The extended sequencing (SBX) methodology developed by the inventors provides a significant performance improvement in Xpandomer sequence read efficiency and accuracy compared to native DNA. However, samples enriched with high-quality full-length Xpandomer copies of template DNA can be difficult to produce in solution. Advantageously, through trial and error, the inventors have found that the efficiency of synthesizing and / or processing full-length Xpandomer can be increased by adapting various steps in the workflow (e.g., primer extension reaction and / or post-synthesis processing steps) to a solid support. The solid platform has been found to improve the optimization of various reaction conditions.

[0112] Solid synthesis of Xpandomer can be carried out using any suitable support platform known in the art. In certain embodiments, the solid support may be a conventional bead, tube, capillary, or microfluidic chip or card. As further discussed herein, in some embodiments of the present invention, oligonucleotide primers, i.e., extensions, or "E-oligos," are bound to the support to initiate solid Xpandomer synthesis.

[0113] surface chemistry

[0114] Multiple surface chemistry methods can be used to immobilize oligonucleotides or oligonucleotide / template complexes onto solid supports. Specific exemplary embodiments of suitable surface chemistry are shown in Figures 4A to 4E. The embodiment shown in Figure 4A uses conventional streptavidin / biotin interaction chemistry to demonstrate the functionalization of a solid support 400 with a linker containing a terminal biotin moiety 410A. In this embodiment, the 5' end of an oligonucleotide primer 420 is bound to a second linker containing a terminal biotin moiety 410B. Binding of the primer-template complex 425 (in this depiction illustrating polymerase-mediated Xpandomer synthesis) to the support is mediated by the streptavidin moiety 430. The linker moieties disclosed herein may be long enough to link the oligonucleotide to the support so that the support does not significantly interfere with the overall binding and recognition of the oligonucleotide by complementary oligonucleotides or nucleic acid replication enzymes. Thus, the linker may also include a spacer unit. The spacer, for example, separates the oligonucleotide from cleavage sites or labels.

[0115] Alternatively, the embodiment shown in Figure 4B illustrates the immobilization of a primer-template complex 425 onto a solid support (i.e., "substrate") 400 by covalent bonding of the primer and substrate via a click reaction. In this embodiment, the covalent bonding is mediated by a maleimide-PEG-alkyne linker 423 crosslinked to the solid support. The alkyne moiety 429 provided to the substrate by the distal end of the linker can react with an azide group 435 provided by the 5' end of the primer. The ability to utilize simple click chemistry to immobilize nucleic acids on the substrate offers advantages over conventional solid nucleic acid synthesis protocols. For example, nucleic acids can be pre-synthesized (e.g., chemically or enzymatically) and purified before click conjugation. Furthermore, different oligonucleotide combinations can be immobilized on a single support. Multiple arrangements of oligonucleotide structures bound to a solid support are contemplated by the present invention. Figure 4C shows how a dendrimer of the primer-template complex can be formed on the support by click chemistry, as discussed herein.

[0116] Any suitable linker providing a maleimide moiety at a first term and an alkyne moiety at a second term can be used according to the present invention. The chemical chain between the two reactive groups of the linker may be referred to herein as a “spacer arm”. The length of the spacer arm will determine how mobile the conjugate is and can be optimized for a particular application. Typically, the spacer arm comprises a hydrocarbon chain or a polyethylene glycol (PEG) chain. Figure 4D shows an exemplary maleimide-PEG-alkyne linker 423, propargyl-PEG4-maleimide, providing an alkyne moiety 429 and a maleimide moiety 427. Figure 4E shows how an elongated oligonucleotide with a terminal azide moiety linked to the 5' term can be immobilized on a solid support by a click reaction that generates a covalent bond. In this embodiment, the solid support is functionalized by crosslinking the support with a linker containing a terminal maleimide moiety at the proximal end and a terminal alkyne group at the distal end.

[0117] According to the present invention, the maleimide moiety can be converted into a reactive group and then crosslinked to a solid surface, such as a polyolefin surface, by a catalyst-free photochemical (e.g., photoinitiated) proton abstraction reaction. This reaction simplifies the initiation step on which conventional conjugation methodologies rely. Conventional crosslinking techniques teach that the maleimide chemical group is a sulfhydryl-targeted (-SH) functional group. However, the inventors have advantageously discovered that the maleimide group can be crosslinked to a rigid polyolefin substrate after activation by proton abstraction. Importantly, the maleimide-mediated crosslinking has been shown to be stable under acidic conditions and during click reactions. Suitable polyolefin surfaces include, but are not limited to, substrates made from polypropylene or cyclic olefin copolymers (COCs).

[0118] To functionalize a substrate, for example, a COC chip, with an alkyne moiety, an exemplary catalyst-free photochemical proton abstraction reaction may include: 1) priming the chip with an organic solvent such as DMSO or DMF; 2) adding a linker having a maleimide moiety at one end, such as propargylmaleimide, solubilized in DMSO and water; 3) incubating the chip under a UV lamp; 4) washing the chip with a series of solvents, which in a particular embodiment may include a solution of DMSO, DMF, and Na2HPO4, Tween-20, and SDS; and 5) washing the chip with an aqueous solution such as water and / or PBS before the click reaction.

[0119] While these embodiments show a primer ligated to the 5' end of an extended oligonucleotide, i.e., to a support, it should be understood that in alternative embodiments, the surface chemistry can be adapted to ligate the 3' end of the oligonucleotide to the support, for example, to the terminal oligonucleotide of a terminal cap structure as further discussed herein (or to the 5' end of an oligonucleotide having a sequence that is the reverse complement of the terminal oligonucleotide).

[0120] In certain embodiments, the linkage between the oligonucleotide and the solid support is cleavable, allowing the primer extension product to be released from the support after synthesis. Cleavable linkers and methods for cleaving such linkers are known and can be used in methods provided by the knowledge of those skilled in the art. For example, cleavable linkers can be cleaved by enzymes, catalysts, compounds, temperature, electromagnetic radiation, or light. Optionally, cleavable linkers include a moiety hydrolyzable by beta-elimination, a moiety hydrolyzable by acid hydrolysis, an enzymatically cleavable moiety, or a photocleavable moiety. In some embodiments, suitable cleavable moieties are photocleavable (PC) spacers or linker phosphoramidites available from Glen Research.

[0121] The inventors have found that, advantageously, solid-state synthesis and processing of Xpandomer allows for the optimization of many steps in the workflow so that nanopore sequence reads exceeding 400 bases are obtained. In certain embodiments, solid-state synthesis can be carried out using acid-resistant magnetic beads as a support. The geometric shape of the bead structure offers several advantages, including preferred template bonding and rapid reaction rates in solution, increased surface area, and magnetic collection. The acid resistance of the beads makes them a particularly suitable support for the Xpandomer processing reaction. One embodiment of a method for preparing acid-resistant magnetic beads for Xpandomer synthesis is shown in Figure 5. Here, acid-resistant magnetic beads 510 (e.g., TurboBeads® Pegamine) are functionalized with a linker 520 to produce functionalized beads 530, which provide terminal alkyne groups. The beads can be functionalized using any form of amine-type coupling or chemical condensation. In one embodiment, the beads can be functionalized by NHS-ester bonds with amines provided by the surface of the beads. By click chemistry, the elongated oligonucleotide ("E-oligo") 540, which provides the 5' azide moiety, covalently bonds to the functionalized bead 530 to generate the support-bound E-oligo 550. The E-oligo bonded to the bead can hybridize to a single-strand template 560, for example, for a primer extension reaction, to generate an Xpandomer copy of the template. Advantageously, subsequent Xpandomer processing steps, including acid-mediated cleavage of the phosphoramide bond, can be carried out on the same bead support.

[0122] End capping

[0123] In this embodiment, a single-stranded copy of a nucleic acid template is operably ligated (e.g., linked or bound) from the 3' to the 5' end of an oligonucleotide "cap" that specifically hybridizes to a portion of the template. The ligation of the single-stranded copy to the oligonucleotide cap is mediated by nucleic acid polymerase when it reaches the 5' end of the oligonucleotide cap during template dependence. The oligonucleotide cap is hereafter referred to herein as an alternative "end cap," "capped blocker oligonucleotide," or "end tag." The end cap functions as a molecular tag for identifying and / or isolating a copy of a nucleic acid template having a defined length from a heterogeneous population of products that may contain copies of undesirable lengths, e.g., incomplete or cleaved products.

[0124] In alternative embodiments, the template nucleic acid may be a DNA or RNA molecule. The end cap may be designed to hybridize to any portion of the template nucleic acid (i.e., to the “end cap target sequence”) to selectively modify, for example, “tag” a copy of the template region having a predetermined or desired length, i.e., the “target sequence”. In some embodiments, the end cap is designed to hybridize to a sequence near the 5' end of the target sequence to “tag” a complete or nearly complete copy of the target sequence. In some embodiments, the end cap target sequence is a portion of the native nucleic acid sequence of the template nucleic acid. In other embodiments, the end cap target sequence is a heterologous sequence (e.g., an adapter or linker) linked to or attached to the template nucleic acid.

[0125] In certain embodiments, a copy of a single-stranded nucleic acid template is an Xpandomer, and its terminal cap is designed to hybridize to the 5' end of a library fragment of the template DNA. Advantageously, a population of Xpandomer products enriched with full-length copies of the library fragment provides improved sequence information or "reads" from the nanopore-based sequencing system of the present invention.

[0126] Figure 6A shows a simplified overview of one embodiment of the end-capping strategy. In this embodiment, end-capping enables selective tagging of Xpandomer copies of a DNA target sequence represented herein by a target sequence template 610. The Xpandomer is synthesized by a primer extension reaction initiated from an oligonucleotide primer 620 (i.e., extension or "E-oligo") hybridized to a single-strand template using a suitable DNA polymerase, an XNTP substrate, and other extension reagents and additives. We have found that a variant of DPO4 polymerase can synthesize Xpandomer in a template-dependent manner using XNTP as a substrate, particularly when the primer extension reaction includes one or more PEM additives (PEM additives are described, for example, in our pending patent application PCT / US18 / 67763, entitled "Enhancement of Nucleic Acid Polymerization by Aromatic Compounds," which is incorporated herein by reference in its entirety. The primer extension product can be visualized by gel electrophoresis if the oligonucleotides incorporated into the extension product are linked to a detectable dye 630.

[0127] A general feature of one embodiment of the end cap structure is shown schematic number 4 in Figure 6A. In this embodiment, the end cap 640 is complementary to the sequence near the 5' end of the target sequence template. The molecule contains a terminal oligonucleotide 645 (which may be referred to herein as a “blocker” oligonucleotide) that specifically hybridizes. The terminal cap also contains a 5' triphosphate group 647 bound to a dideoxyribonucleoside analog (i.e., the “cap”) that can be utilized as a substrate by DNA polymerase. During a primer extension reaction, e.g., an Xpandomer synthesis reaction, DNA polymerase synthesizes the elongating Xpandomer from the bound elongating oligonucleotide in a template-dependent manner. Upon reaching the end of the template, DNA polymerase encounters the terminal cap and ligates the 5' end of the terminal oligonucleotide to the 3' end of the Xpandomer by forming a phosphodiester bond between the triphosphate group of the cap and the 3' end XNMP of the Xpandomer, as shown in the fifth schematic diagram. In contrast, terminal oligonucleotides lacking a free 5' triphosphate group cannot be ligated to the Xpandomer by DNA polymerase, as shown in oligonucleotide 645 in the third schematic diagram of Figure 6A.

[0128] In certain embodiments, the end caps can be linked to a detectable dye 630 to visualize the end-capped copies of the target sequence, for example, by gel electrophoresis. Figure 6B shows an exemplary gel in which Xpandomer copies of a 100mer template are labeled with either end caps (lanes 1-4, corresponding to the fourth schematic diagram in Figure 6A) or primers (lanes 5-8, corresponding to the first schematic diagram in Figure 6A). End capping depends on the availability of the 5' nucleoside triphosphate group bound to the end oligonucleotide, as indicated by the absence of a fluorescence signal when a primer extension reaction is performed using blocker oligonucleotide 645 lacking a free 5' triphosphate group (data not shown, corresponding to the second and third schematic diagrams in Figure 6A).

[0129] In some embodiments, as described in further detail herein, a terminal cap or an oligonucleotide complementary to the terminal oligonucleotide of the terminal cap can be ligated to a solid support to enable isolation or purification (e.g., “capture”) of the full-length Xpandomer product.

[0130] Terminal or "blocker" oligonucleotides are designed to strongly hybridize with the terminal cap target sequence in the template nucleic acid. Characteristics such as the length of the oligonucleotide and / or the chemical structure of one or more nucleotide monomers of the oligonucleotide can be optimized to achieve the desired hybridization strength. Generally speaking, the melting temperature of the terminal oligonucleotide-target sequence template would be at least 37°C for optimal hybridization, although lower melting temperatures are also possible. In certain embodiments, the length of the terminal oligonucleotide is about 10 to about 30 nucleotides. In some embodiments, to increase binding efficiency, nucleotide analogs, such as one or more 2' methoxyribonucleotides, LNAs (i.e., "locked" nucleic acid analogs), or G-clamps are incorporated into the terminal oligonucleotide. In one embodiment, substantially all of the terminal nucleotides in a 2' methoxyribonucleotide.

[0131] Details of specific features of exemplary terminal cap structures are shown in Figures 7A–7D. Figures 7A and 7B show a terminal oligonucleotide (SEQ ID NO: 2) 700, in which the 5' end of the oligonucleotide is linked to a mobile linker 710. The mobile linker includes a terminal azide moiety 720 that provides a substrate for a click reaction enabling covalent bonding to a modified 5' nucleoside triphosphate cap (i.e., the "cap"), as will be further explained with reference to Figure 7C. Exemplary embodiments of mobile linkers 710A and 710B linked to the 5' end of the 23-mer terminal oligonucleotide 700 are shown in Figures 7A and 7B, respectively. The mobile linker may be an inert linear polymer composed of, for example, alkyl and / or PEG moieties of appropriate length. In one embodiment, the mobile linker is formed from a C6 bromohex phosphoramidite. In some embodiments, oligonucleotides The 5' end may contain one or more G-clamp nucleotide analogs.

[0132] In an exemplary method of synthesis, terminal oligonucleotides are synthesized by conventional automated phosphoramidite chemistry, in which the 5'-hydroxyl group of the completed oligonucleotide is coupled to a bromohexyl phosphoramidite (e.g., available from Glen Research). The solid support is treated with sodium azide to convert the bromo group to azide. Finally, as shown in Figure 7B, the oligonucleotide is deprotected and cleaved from the solid support to obtain the azide oligonucleotide.

[0133] Figure 7C shows one embodiment of a modified 5'-nucleoside triphosphate cap 740, referred herein as “ddNTP-O” (represented in this depiction by ddCTP-0). The heterocyclic portion of the cap is modified with a terminal alkyne portion 745 linked via an octadiin lu arm 747 to mediate the binding of the terminal oligonucleotide to the azide via a click reaction. In certain embodiments, the resulting alkynyl nucleoside triphosphate of the terminal cap (i.e., cap 740) can be base-paired with a template at the 5' end of the terminal oligonucleotide. The alkynyl nucleoside triphosphate cap can be synthesized using the method described by Ludwig and Eckstein or other methods of 5'-triphosphate synthesis, see, for example, ARKore, AR, Srinivasan B., Recent Advances in the Syntheses of Nucleoside Triphosphates, Current Organic Synthesis, 10(6), 903-34 (2013), which is incorporated herein by reference in its entirety.

[0134] Figure 7D shows one embodiment of the complete end cap structure 780 formed by a click reaction operably linking the triphosphate cap 740 (i.e., an alkynyl nucleoside triphosphate cap) to the terminal oligonucleotide (SEQ ID NO: 2) 700. Although not bound by theory, it is assumed that the movable linker 710B of the end cap provides sufficient steric flexibility or freedom to the structure so that the triphosphate group 750 can enter the active site of the DNA polymerase and function as a substrate for the formation of a phosphodiester bond between the end cap and the 3' end of Xpandomer during the primer extension reaction. A variant of DPO4 DNA polymerase is particularly well suited to linking the end cap structure to the 3' end of Xpandomer.

[0135] In certain embodiments of the present invention, alternative terminal cap structures and means for attaching terminal oligonucleotides to the 3' end of Xpandomer are considered. In one embodiment, a psoralen crosslinking method is utilized. Briefly, the 5' end of a terminal oligonucleotide is modified to present a psoralen moiety, and when this is exposed to ultraviolet (UVA) irradiation, a mono-adduct and covalent interchain crosslinks (ICLs) can be formed with thymine. Thus, psoralen-modified terminal oligonucleotides can be chemically crosslinked to the 3'-thymine in Xpandomer when exposed to UVA radiation. Advantageously, psoralen crosslinks are resistant to acid cleavage.

[0136] In other embodiments, psoralen-modified terminal oligonucleotides may include other features to enable binding to and release from a solid substrate. For example, the 3' end of the oligonucleotide may include a linker nucleic acid sequence containing a cleavage site for a nuclease enzyme. In some embodiments, the cleavage site is recognized and cleaved by an RNase. Any suitable RNase recognition site may be used, for example, for RNase A, RNase H, or RNase T1. In other embodiments, the cleavage site is recognized and cleaved by a nickel endonuclease or trypsin. Once bound to a solid support via the 3' end of the linker, the terminal oligonucleotide may be selectively released by enzymatic treatment with a suitable nuclease.

[0137] End tagging

[0138] As an alternative strategy to end capping, the inventors have devised compositions and methods for operably linking (e.g., linking or covalently) a leader sequence to the 3' end of an Xpandomer after synthesis. In this way, substantially only the full-length Xpandomer will contain the 3' leader sequence, which is necessary for the Xpandomer to pass through the nanopresensor. In one embodiment, the end-tag structure is essentially a modified Xpandomer in which the reporter code element is replaced by leader and enhancer elements, and the translocation control element is replaced by a poly-G oligomer. Both the phosphoramide bond and the poly-G oligomer element of the end tag are acid-unstable. Therefore, upon acid treatment, the 5' half of the end tag will remain associated with the Xpandomer containing one of the leader and enhancer elements. This allows for nanopore penetration from the 3' end of the Xpandomer.

[0139] In one embodiment, a method for end-tagging Xpandomer may include: 1) synthesizing a solid-state Xpandomer in which the substrate-binding elongation oligonucleotide lacks a leader sequence and an enhancer sequence; 2) carrying out the elongation reaction for a period of time sufficient to provide a population of substantially full-length Xpandomer products; 3) washing the substrate-bound product to remove all elongation reagents; and 4) adding to the substrate other reaction components necessary for the end-tag structure and polymerase-mediated binding of the end-tag to the 3' end of Xpandomer. In some embodiments, the method may include hybridizing a terminal blocker nucleotide to a template before the elongation reaction and removing the terminal blocker nucleotide after elongation and before the washing and end-tagging reactions.

[0140] B. Solid-state synthesis by terminal capping

[0141] The end capping methodology described herein can be integrated into a solid Xpandomer synthesis workflow using any suitable support platform known in the art. In certain embodiments, the solid support may be a conventional bead, tube, capillary, or microfluidic chip. In one embodiment, the solid support is an acid-resistant magnetic bead. As will be further discussed herein, in some embodiments of the invention, an oligonucleotide primer can be bound to the support. In other embodiments, the end oligonucleotide of the end cap or its inverse complement can be bound to the support.

[0142] Xpandomer synthesis workflow away from support (AFS)

[0143] In this embodiment, Xpandomer synthesis begins with a primer-template complex bound to a support, extending away from the support towards a terminal cap structure hybridized to the opposite (i.e., 3') end of the template. The initial configuration of the AFS model is shown in Figure 8A, with each of the three schematic diagrams exhibiting identical features. In this embodiment, the 5' end of the oligonucleotide primer 810 is bound to the solid support 820 by a linker 830. The single-strand template 840 is hybridized to the primer via standard hydrogen bonding. Similarly, the terminal cap oligonucleotide 850 hybridizes to the 5' end of the template via standard hydrogen bonding, providing a free 5' triphosphate group 855. The direction of nucleic acid polymerization (i.e., Xpandomer synthesis) is indicated by arrows.

[0144] Figure 8B shows exemplary products of the Xpandomer synthesis reaction starting from primer 810. The top and middle schematic diagrams show the full-length Xpandomer copy 870 covalently bonded to primer 810 and hybridized to template 840 by hydrogen bonding. The omer product is also covalently bonded to the terminal cap oligonucleotide 850 via a phosphodiester bond. The schematic diagram below depicts an incomplete Xpandomer copy 860 that remains covalently bonded to the primer but, importantly, is not linked to the terminal cap oligonucleotide 850.

[0145] As discussed elsewhere in this specification, after synthesis, the Xpandomer is treated with acid to transition it from the constrained form shown in Figure 8B to the extended linearized form shown in Figure 8C. Here, the template 840 dissociated from the Xpandomer bound to the support is shown. The upper schematic shows the linearized, full-length Xpandomer 875 still covalently bound to the solid support 820 and the terminal cap oligonucleotide 850. The middle schematic shows an alternative result to the acid treatment in which the full-length Xpandomer is cleaved, producing linearized fragments 865A and 869. Fragment 865A remains bound to the solid support, while fragment 869 is released from the support into the solution. The lower schematic shows the linearized Xpandomer fragment 865B similarly bound to the solid support. Figure 8D shows that after washing, the full-length linearized Xpandomer 875 and the linearized fragments 865A and 865B remain bound to the solid support. Importantly, only the full-length Xpandomer875 is ligated to the terminal cap oligonucleotide 850.

[0146] Figure 8E illustrates a method for isolating or "locating" full-length Xpandomer products from a heterogeneous population containing incomplete fragments using terminal cap oligonucleotide 850 as a molecular tag. Xpandomer products remaining bound to the initial support, as shown in Figure 8D, are released from the support by photodegradation. As described elsewhere in this specification, the binding of the oligonucleotide primers to the initial solid support is designed to be photosensitive. Released Xpandomer 865 and 875 remain covalently bound to oligonucleotide primer 810, while full-length Xpandomer 875 remains covalently bound to terminal cap oligonucleotide 850. To isolate full-length Xpandomer, the sample is brought into contact with a second solid support 890 conjugated with oligonucleotide 880, which is the reverse complement of terminal cap oligonucleotide 850. As shown in the figure, only full-length Xpandomer 875 will remain bound to the solid support via hydrogen bonds between oligonucleotides 850 and 880. As shown in Figure 8F, all incomplete Xpandomer products are washed away from the solid support, leaving isolated full-length Xpandomer 875, which can then be eluted from the support and used, for example, for single-molecule nanopore sequencing. In this embodiment, the extended oligonucleotide contains features necessary for nanopore localization and translocation (e.g., leader and concentrater elements).

[0147] In an alternative embodiment, the terminal cap oligonucleotide is modified to include leader and concentrator features for nanopore penetration, while the extended oligonucleotide lacks these features. In this embodiment, only the full-length extended product will be coupled to the leader and concentrator elements. Thus, it can translocate through the nanopore to generate sequence information.

[0148] In another embodiment, the extended oligonucleotide structure is modified to include leader and concentrator features for nanopore penetration, while the terminal capped oligonucleotide lacks these features. In this embodiment, the Xpandomer synthesis and terminal capping reaction may be carried out in solution. After Xpandomer synthesis, the terminal capped product may be purified, for example, by biotin-streptavidin chemistry, by contacting the sample with oligonucleotides immobilized on a bead support, where the oligonucleotides include sequences that are reverse complements of a portion of the sequence of the terminal capped oligonucleotide. In this way, only Xpandomer products containing both the extended oligonucleotide structure (providing leader and concentrator features) and the terminal cap will penetrate the nanopore sensor and provide sequence information.

[0149] Towards a support (TS) Xpandomer synthesis workflow

[0150] In an alternative embodiment of the present invention, the terminal oligonucleotide of the terminal cap structure is covalently bonded to the substrate. In this embodiment, Xpandomer synthesis begins with a primer-template complex that hybridizes to the terminal oligonucleotide of the terminal cap structure, and the orientation of Xpandomer synthesis is toward the support. The initial configuration of the TS model is shown in Figure 9A, where each of the two support-bound terminal caps 980 exhibits identical features. In this embodiment, the 3' end of the terminal oligonucleotide 950 is bonded to the solid support 920 by a photocleavable linker 930. The terminal cap 980 provides free 5' triphosphate 955.

[0151] The sequence of the terminal oligonucleotide of the terminal cap is designed to be the reverse complement of the sequence of the 5' end of the single-stranded target nucleic acid template. Figure 9B shows the association between the 5' end of the target nucleic acid template 940 and the terminal oligonucleotide of the terminal cap by standard base pairing. In this embodiment, the elongated oligonucleotide 910 hybridizes to the complementary sequence of the 3' end of the template. Xpandomer synthesis begins from the 3' end of primer 910 and proceeds toward the support-binding terminal cap. The direction of nucleic acid polymerization (i.e., Xpandomer synthesis) in this model is indicated by arrows.

[0152] Figure 9C shows exemplary products of the Xpandomer synthesis reaction starting from primer 910. The top schematic diagram shows a full-length Xpandomer copy 970 covalently bonded to primer 910 and terminal cap oligonucleotide 950 via a phosphodiester bond. The bottom schematic diagram depicts an incomplete Xpandomer copy 960, which remains covalently bonded to the primer but, importantly, is not linked to the terminal oligonucleotide 950 of the terminal cap.

[0153] As discussed elsewhere in this specification, after synthesis, the Xpandomers are treated with acid to transition them from the constrained form shown in Figure 9C to the expanded linearized form shown in Figure 9D. Here, the template 840 and incomplete Xpandomers 960 are dissociated from the support and washed away from the bound material. The schematic diagram above shows the linearized, full-length Xpandomer 975 covalently bonded to the solid support 920 by the terminal oligonucleotide 950 of the terminal cap. Importantly, only the full-length Xpandomer copies remain bound to the solid support. These are then released by photo-mediated cleavage of the photocleavable moiety 930 and can be used for nanopore sequencing.

[0154] In some situations, for example, if DNA polymerase binds the terminal cap structure to an incomplete copy of the template earlier than usual, cleaved byproducts may be formed during the terminal capping process. This phenomenon is referred to herein as polymerase "short-circuiting." To prevent short-circuiting, we have devised several strategies to delay the incorporation of the terminal cap structure into Xpandomer, thereby promoting the synthesis of a substantially full-length copy of the template. In one embodiment outlined in Figure 10A, blocker nucleotide 1010 hybridizes to a region near the 3' end of the single-stranded template 1020. The blocker oligonucleotide is designed to prevent incorporation into Xpandomer by DNA polymerase during growth. In some embodiments, the 5' end of the blocker oligonucleotide lacks a 5' triphosphate group and therefore ligates to the 3' end of Xpandomer. This is not possible. Therefore, when the polymerase reaches the blocker oligonucleotide, the elongation of oligonucleotide 1030 stops. At this point, the blocker oligonucleotide can be removed from the template, for example by thermal melting, and replaced with a terminal cap oligonucleotide 1040 that can be ligated to substantially full-length Xpandomer 1050 by DNA polymerase. An appropriate melting temperature can be calculated to result in the dissociation of the short blocker oligonucleotide without affecting the hybridization of the longer Xpandomer with the template.

[0155] In another embodiment, as shown in Figure 10B, the blocker oligonucleotide 1015 is designed to provide a 5' phosphate group. As described above, DNA polymerase cannot incorporate the blocker oligonucleotide into the growing Xpandomer, and therefore, synthesis stops when the polymerase encounters the blocker. In this embodiment, the blocker can be removed, for example, by exonuclease-mediated digestion. After exonuclease treatment, the terminal cap oligonucleotide 1040 hybridizes to the template and is ligated to a substantially full-length Xpandomer 1050 by DNA polymerase.

[0156] A library of mirrored Xpandomer built with C-terminal capping.

[0157] This generalized embodiment describes novel methods and nucleic acid compositions that can be used to prepare a library of template constructs, each of which incorporates two single-stranded copies of the same strand of a nucleic acid target sequence (i.e., a template) linked in tandem by an oligonucleotide-based linker. Such a library of template constructs is referred to herein as a “mirror image library.” The mirror image library provides a template for a novel Xpandomer synthesis protocol using the end-capping strategy disclosed herein. Briefly, a single Xpandomer polymer is synthesized from each of the template constructs to produce an Xpandomer product containing two copies of the same strand of the target operably linked by covalent bonding to a cap branching agent structure. Each of the two copies of the target sequence is linked to the cap branching agent structure during synthesis using the end-capping methodology described herein. Advantageously, Xpandomers synthesized from mirror image library constructs provide two sequence reads of a single target sequence as they pass through a nanopore. Differences between the sequences of the first and second reads indicate potential sequencing errors that can be excluded or used for quality scoring or some method of discrepancy resolution.

[0158] Enantiomer library template constructs are produced by a series of enzymatic reactions, each producing a characteristic precursor construct. Figure 11A shows the basic structural features of one embodiment 1100 of an enantiomer library template construct precursor called "M1". The M1 precursor is formed by the manipulative linkage (i.e., linkage or bonding by the formation of covalent bonds) of a Y adapter construct 1110, a library fragment 1120, and a cap-primer adapter construct (referred to herein as a "tri-pronged" construct) 1130. In this embodiment, the Y adapter 1110 includes a 3' to 5' oligonucleotide chain 1111 and a 5' to 3' oligonucleotide chain 1113, which are conventionally referred to herein as the "minus" and "plus" chains, respectively. The adapter chains 1111 and 1113 specifically hybridize to the library fragment at a portion of the "base" of the Y adapter proximal to the library fragment, while the distal "arm" portion remains single-stranded to the library fragment. A portion of the double-stranded base of the Y adapter can be linked to the library fragment. In this embodiment, the 3' end of adapter chain 1113 has an unpaired nucleotide, here represented by a free "T", which can form a base pair with a free nucleotide provided by a library fragment to facilitate ligation. The arms of the Y adapter are used as binding sites for oligonucleotide primers (i.e., elongated oligos) used in later steps of Xpandomer synthesis. The Y-adapter can be manipulated to provide several useful features to the workflow of enantiomerized libraries, including the position. In some embodiments, the ends of one or both single-stranded regions of the Y-adapter strands provide azide groups that enable immobilization of the Y-adapter to a functionalized solid support via a click reaction, as described herein. In other embodiments, one or both strands of the Y-adapter may include selectively cleavable elements that enable release of the construct from the solid support, for example. In some embodiments, as further described herein, the minus strand 1111 is ligated to the solid support, and the plus strand 1113 provides a 5' nucleotide substrate for exonuclease digestion.

[0159] Library fragment 1120 is, in one embodiment, a double-stranded nucleic acid having 5' phosphate termini and 3' nucleotide overhangs on both strands, which can be prepared by techniques recognized in the art. The library fragment is also referred herein as the “nucleic acid target sequence” and is the target for sequencing by SBX. The library fragment comprises a “positive” strand 1120A and a “negative” strand 1120B. In some embodiments, the 3' end of the negative strand may provide an unpaired nucleotide (represented here by free “A”) that forms a base pair with the unpaired nucleotide at the 3' end of the adapter strand 1113. In other embodiments, the 3' end of the positive strand also provides an unpaired nucleotide (represented here by free “T”) to facilitate ligation to the cap primer adapter 1130. The library fragment may contain known or unknown sequences. For SBX, the length of the library fragment can be up to about 50, 100, 200, 500, or 1000 base pairs. In some embodiments, the length of the library fragment is about 100 to about 200 base pairs.

[0160] The cap-primer adapter construct 1130 comprises three oligonucleotide chains 1131A, 1133, and 1131B operably linked by a chemical branching agent. The sequences of chains 1131B and 1133 are complementary and can hybridize. The sequence of chain 1131A is identical to that of 1131B, and this chain may remain single-stranded within the cap-primer adapter 1130 (or may hybridize to chain 1133). In some embodiments, the 3' end of chain 1131B provides an unpaired nucleotide (represented here by free "A") that forms a base pair with the unpaired nucleotide at the 3' end of the plus chain 1120A of the library fragment.

[0161] The cap-primer adapter can be produced by standard automated phosphoramidite-based oligonucleotide synthesis. In some embodiments, chain 1133 is first synthesized in the 5'-to-3' direction, followed by the incorporation of a symmetric chemical branching agent (e.g., Chemgenes CLP-5215) to enable the simultaneous 5'-to-3' synthesis of chains 1131A and 1131B. In some embodiments, a movable linker is provided by incorporating a standard hydrophilic spacer (e.g., a PEG6 spacer) between the branching agent and the 5' ends of chains 1131A and 1131B, allowing these chains to fold back on chain 1133 to form the characteristic "trifugal" structure of the cap-primer adapter. The length and composition of both the oligonucleotide and branching agent components of the cap-primer adapter can be optimized for specific applications. In certain embodiments, the oligonucleotide is approximately 15-25 nucleotides long, enabling efficient hybridization with the cap-branching construct as described below.

[0162] Enantiomer library template constructs can be formed in solution or on a solid support. In one embodiment, an enantiomer library template construct is formed on a solid support by first generating the M1 precursor according to the following exemplary steps: 1) The Y adapter chain 1111 is immobilized on a functionalized solid support (e.g., a microfluidic chip or bead) using a click reaction, and then the Y adapter chain 1113 is specifically hybridized to the adapter chain 1111. 2) The cap primer adapter 1130 is attached to the plus chain 1120A The library fragment 1120 is bound by enzymatic linkage in solution of the 3' end of the chain 1133 to its 5' end and the 5' end of the minus chain fragment 1131A to its 3' end. 3) The bound library fragment-cap primer adapter structure is then bound to the support by enzymatic linkage to a portion of the double-stranded ends of the Y adapter 1110.

[0163] The M1 enantiomer library template construct precursor 1100 provides a substrate for forming the final enantiomer library template construct, called "M3" 1150, shown in Figure 11B. In one embodiment, the template construct 1150 can be produced by two enzymatic steps: a first DNA polymerization step to generate a complement of the positive strand 1120A, followed by a second exonuclease step to remove this same positive strand. During the first step, the cap-primer adapter strand 1131A is extended from the 3' end in the direction indicated by the arrow using strand 1120A as a template by a DNA polymerase, e.g., a strand-substituted, thermostable polymerase. This generates a triple-stranded structure, referred to herein as the template construct precursor "M2" 1140. The M2 precursor includes a daughter strand 1120C having the same sequence as the negative strand 1120B. During the second step, the central oligonucleotide chain of the M2 precursor is enzymatically removed by exonuclease digestion starting from the 5' end of the Y adapter chain 1113, which provides the 5' phosphate substrate for the exonuclease. Thus, the entire original plus chain 1120A is removed, as well as the cap primer adapter chain 1133. The resulting product is an enantiomer library template construct "M3" 1150 containing two identical copies 1120B and 1120C of the original minus chain of the library fragment, linked by the cap primer adapter chains 1131A and 1131B, which remain linked together. The M3 enantiomer library construct 1150 can be used as a template for synthesizing a single Xpandomer containing two copies of the same chain of library fragment 1120.

[0164] As discussed herein, the M3 constructs serve as templates for the synthesis of Xpandomer, each containing two copies of the same strand of the target sequence for nanopore sequencing, i.e., sequencing by extension (SBX). In some embodiments, SBX of the enantiomer library construct is performed on a solid support using the end-capping protocol described herein. In this embodiment shown in Figure 11C, the 5' ends of the elongated oligonucleotides 1170 and 1180 are ligated to the solid support 1190 by click chemistry as described herein. In these embodiments, the elongated oligonucleotides contain a 5' azide group for mediating the click bond. In other embodiments, only one elongated oligonucleotide is ligated to the support, and the other elongated oligonucleotide contains a leader sequence for penetrating the nanopore. Each elongated oligonucleotide is designed to specifically hybridize with one of the single-stranded portions of the Y adapter element of the M3 template construct. In certain embodiments, the elongated oligonucleotide may include a photocleavable or acidcleavable element interposed between the solid support and the 5' end of the oligonucleotide sequence, enabling photo- or acid-mediated release of the final Xpandomer product from the substrate. The M3 template construct 1150 is hybridized to immobilized elongated oligonucleotides 1170 and 1180 by standard hybridization between complementary sequences in the elongated oligonucleotide and some arms of the Y adapter of the M3 construct. The cap branch construct 1195 hybridizes to the M3 construct. The cap branch construct 1195 is complementary to the 5' ends of both strands of the enantiomer library construct 1150 and contains two identical oligonucleotides 1197A and 1197B that hybridize. The terminal oligonucleotide arms 1197A and 1197B each provide a free 5' triphosphate group. The cap branching agent structure can be synthesized by conventional phosphoramidite chemistry, in which two chains 1197A and 1197B are linked by a chemical branching agent.

[0165] Figure 12 shows further details of the structural features of the cap branching agent. In this embodiment, the cap branching agent 1295 comprises a branching agent structure 1220 and a terminal containing a triazole moiety ("R"). The material comprises oligonucleotide arms 1230A and 1230B, a terminal cap ("ddCTP"), and an oligonucleotide (SEQ ID NO: 3). The cap branching agent is synthesized by standard phosphoramidite chemistry starting from the 3' terminal portion, as exemplified herein by a PEG6 polymer. A symmetric chemical branching agent is added to the 5' end of the terminal portion to enable parallel synthesis of branching agent spacers, as exemplified herein by a PEG6 polymer. In some embodiments, the length and composition of the spacer can be optimized for a particular application. In certain embodiments, the spacer may contain a C2, C6, or PEG3 monomer. The terminal oligonucleotide arms 1230A and 1230B extend from the 5' end of the branching agent arm. The sequence of the terminal oligonucleotide is designed to hybridize to the 5' end of the M3 template construct, and its sequence is provided by the cap primer adapter. In some embodiments, the terminal oligonucleotide is about 15 to about 50 nucleotides long and contains one or more methoxynucleotide analogs. The 5' end of the terminal oligonucleotide is linked to a terminal cap structure, exemplified herein by ddCTP (however, any other nucleic acid base may be substituted in certain embodiments), thereby enabling the binding of nascent Xpandomer to the terminal oligonucleotide by terminal capping. Details of the terminal capping method are discussed herein with reference to Figures 7A–7D. The terminal cap is bound to the terminal oligonucleotide via a triazole moiety ("R"), which is the product of a click reaction between the alkyne moiety provided by the terminal cap and the azide moiety provided by the terminal oligonucleotide. In some embodiments, the cap branching agent is designed to include other linker structures, such as a spermine polymer positioned between the terminal cap and the terminal oligonucleotide, for example, to provide increased steric flexibility and binding to the terminal cap.

[0166] Continuing to refer to Figure 11C, the Xpandomer synthesis reaction is carried out, which begins at the 3' ends of the elongated oligonucleotides 1170 and 1180, proceeds in the same direction (as indicated by the arrows), and ends at the 5' ends of the terminal oligonucleotides 1197A and 1197B of the cap branching agent 1195, whereupon polymerase ligates complete Xpandomer copies 1199A and 1199B to the cap branching agent according to the terminal capping method described herein. In one embodiment, the first elongated oligonucleotide contains a photocleavable linker element, and the second elongated oligonucleotide contains an acid-unstable linker element. Acid treatment of the Xpandomer will simultaneously transition the Xpandomer copies from a "restricted" to an "open" configuration 1000 and cleave the acid-unstable linker in the elongated oligonucleotide. The resulting product, containing the two ligated Xpandomer 1199A and 1199B of the library fragment, can then be removed from the support by photodegradation of the photocleavable linker of the second elongated oligonucleotide. In some embodiments, a final purification step is performed in which the released enantiomer Xpandomer 1000 hybridizes to an oligonucleotide complementary to one of the extended oligonucleotides bound to a second solid support.

[0167] The reaction conditions for generating the M1, M2, and M3 enantiomerized library constructs and SBX for synthesizing Xpandomer can be optimized through trial and error. In some embodiments, these constructs can be generated by the following workflow outlined in Figure 13. In step 1, the M1 precursor is generated by linking a Y adapter, a library insert, and a Trident. The molar ratio of YAD1:YAD2:insert:Trident can be optimized for specific conditions or applications. In some embodiments, the M1 precursor can be generated on a microfluidic chip by first assembling the Y adapters on an alkyne-functionalized chip. In one embodiment, a first Y adapter chain providing terminal azide groups is linked to the functionalized chip by click chemistry according to the following exemplary protocol: 1) 3.0 mM THPTA, 6.0 mM sodium ascorbate, 1 mM CuSO4, 5.0 mM aminoguanidine 1) Prepare a catalyst mixture containing 10% DMF or DMSO, and prepare a substrate mixture containing 10% DMF or DMSO, 25 mM sodium phosphate, pH 7.0, 1 μM azido-Y adapter oligonucleotide chain 1, 2.5 mM MgCl2, 5 mM aminoguanidine, and 6.0 mM sodium ascorbate. 2) Add 11 μl of the catalyst mixture to 44 μl of the substrate mixture, and add 50 μl of this reaction to an alkyne-functionalized microfluidic chip such as a COC chip, and incubate at room temperature for 20 minutes. 3) Wash the chip with 300 μl of solution I0002 (0.3 M sodium phosphate, pH 8.0, 1% Tween 20, 0.5% SDS, 1 mM EDTA) at 37°C for 5 minutes, then wash with buffer A.1 (0.5 M NH4OAc, pH 6.5, 1 M urea, 5% NMS and 2% Wash with 900 μl of PEG8000. Following click binding, hybridize the second Y adapter chain to the substrate-bound first chain by preparing a hybridization mixture containing 100 pmol of the second oligonucleotide in buffer A.1. Incubate the hybridization mixture at 90°C for 15 seconds, then cool to 72°C. Next, add the mixture to a preheated tip and cool the tip to 32°C for 5 minutes using a thermocycler. Then wash the tip with buffer A.1. Next, ligate the library insert and Trident adapter to the bound Y adapter. Denaturate the insert fragment in a buffer containing 100 mM NaCl / 20 mM Tris, pH 8.0 at 90°C for 3 minutes, then cool to 50°C over 5 minutes using a thermocycler. Prepare a ligation mixture in 1× ligation buffer (66 mM Tris, 10 mM MgCl2, 1 mM DTT, and 7.5% PEG6000) containing 20 pmol of double-stranded insert, 50 pmol of Trident adapter, 3 mM ATP, 2 U / μl of T4 PNK, and 200 U / μl of T4 DNA ligase. Perform the ligation reaction at 16°C for 15 minutes, then add the reaction mixture to the tip to which the Y adapter is bound. Incubate the tip at 16°C for 15 minutes. Next, remove the ligation mixture, add 3 μl of 5'-deadenylase (50,000 U / ml) to the ligation mixture, return the ligation mixture to the tip, and incubate the tip at 16°C for 15 minutes. Next, wash the tip with 4 ml of buffer I0002 at 37°C for 5 minutes. Finally, wash the tip with water and store at 4°C in 10 mM Tris.

[0168] In step 2, the M1 precursor is extended to prepare the M2 precursor. In one embodiment, approximately 2.5–10 pmol of tip-bound M1 is used in an extension reaction containing 1.0X polymerase buffer, 0.2 mM each dNTP, 0.28 U / μl DNA polymerase, and 1 mM MgCl2. Suitable DNA polymerases are Vent(exo-)DNA polymerase or KAPA HiFi. The tip is placed in a thermocycler and incubated at 95°C for 1 minute, followed by 20 seconds for 10–40 cycles at 90–98°C, followed by 6 seconds at 76°C. The tip is washed with water to remove excess reagent. The tip is then treated with proteinase K by adding an aqueous solution containing 0.05 U / μl–0.80 U / μl proteinase K to water and incubating at 55°C for 5 minutes, followed by 5 minutes at 95°C. The tip is washed with water.

[0169] In step 3, the M3 template construct is produced by exonuclease digestion. In some embodiments, an exonuclease digestion mixture containing 0.45 U / μl of lambda-type exonuclease in exonuclease buffer is added to the tip and incubated at 37°C for 5 minutes, followed by 75°C for 10 minutes. The tip is washed with buffer 10002, then washed with water, and then stored in a buffer containing 10 mM Tris.

[0170] In step 4, the bonded M3 construct is released by photocutting. In some embodiments, the chip is exposed to UV light (e.g., 365 nm) for 15 seconds using a UV curing lamp (e.g., a Phoseon Technology FireFly lamp). The released M3 construct is recovered by aspirating the liquid from the chip.

[0171] In step 5, an Xpandomer copy of the M3 template construct is generated by the SBX method. In some embodiments, the Xpandomer is generated on a covalently bonded microfluidic chip using click chemistry, as described in step 1, with a first extension oligonucleotide (e.g., "E52" EO). This EO may be referred to herein as a "capture oligo." The capture oligonucleotide is used to assemble the M3 template, the second extension oligonucleotide, and the cap branching agent structure onto the chip by hybridization. The capture chip is washed with buffer A1 (0.5 M NH4OAc, pH 6.5, 1 M urea, 5% NMS, and 2% PEG8000) and incubated at 65°C. Approximately 5 pmol to 30 pmol of the M3 construct, approximately 20 pmol to 80 pmol of the second extension oligonucleotide (e.g., "E6 EO"; the actual amount will be determined by the amount of E52 capture oligo bonded to the chip), and the cap branching agent. Prepare a hybridization mixture containing approximately 20 pmol to 80 pmol (the actual amount will be roughly the same as the amount of EO). Incubate the hybridization mixture at 95°C for 15 seconds, then add it to the chip and incubate at 65°C for 30 seconds, then lower the temperature to 37°C at a rate of 0.1°C / second and hold at this temperature for 5 minutes. The chip incubation temperature is controlled in situ by a standard thermocycler fitted with a hybridization adapter plate.

[0172] For Xpandomer synthesis, buffer P (0.6 mM MnCl2 and 0.18 μg / μl DPO4 DNA polymerase variant) was mixed with buffer X (PP-60.22 80 μM and each XNTP 80 μM), followed by buffer A (50 mM Tris, pH 8.84, 200 mM NH4OAc, pH 6.88, 20% PEG8K, 5% NMS, 0.2 μg / μl SSB, 0.5 M betaine, 0.25 M urea, 1 mM PEM). The extension mixture is prepared by adding AZ-8,8 and 4mM PEM additive. The extension mixture is added to the tip and incubated at 20-45°C for 15-60 minutes. The tip is washed with buffer B (100mM HEPES, 100mM NaHPO4, 5% Triton, and 10% DMF).

[0173] In step 6, Xpandomer is cleaved and eluted in 0-75% ACN. In one embodiment, the captured oligonucleotide includes a photocleavable element. To release Xpandomer from the tip, the tip is exposed to UV light for 15 minutes. The tip is then incubated at 37°C for 2 minutes, and the Xpandomer sample is removed by pipette.

[0174] For nanopore sequencing, one or both of the elongated oligonucleotides include a leader sequence designed to facilitate the penetration of the Xpandomer through the nanopore. Further details of specific embodiments of the leader sequence are disclosed in the applicant's U.S. Patent No. 9,670,526, “Concentrating a Target Molecule for Sensing by a Nanopore,” which is incorporated herein by reference in its entirety. In one embodiment, the sequence of an exemplary elongated oligonucleotide is represented by: RD 10 (PC)L 25Z6[TCATAAGACGAACGGA(SEQ ID NO: 4)] (wherein "R" represents a 5'-azide group that enables binding to a functionalized solid substrate by click chemistry; "D" represents a polyPEG6 spacer; "PC" represents a photocleavable spacer that enables release from the solid substrate; "L" represents a polyC2 spacer that functions as a leader sequence during nanopore translocation; "Z" represents a polyC12 spacer, and TCATAAGACGAACGGA(SEQ ID NO: 4) represents an oligonucleotide that hybridizes to the target sequence and functions as an elongation primer for DNA polymerase. In other embodiments, the PC spacer may be replaced with an acid-unstable spacer, such as [dT p-ethoxy][DMS(O)MT-NH2-C6 or Glenamidite 10-1907]phosphoramidite. Elongation oligonucleotide The number of each phosphoramidite monomer (i.e., "spacers") designed in the system is variable and can be optimized for a particular application. During enantiomer library synthesis, the leader sequence may be contained in one or, in other embodiments, both of the elongated oligonucleotides that initiate Xpandomer synthesis. In certain embodiments, the leader sequence is provided by a first elongated oligonucleotide that is not covalently bound to the substrate, while a second elongated oligonucleotide bound to the substrate lacks the leader sequence. Following Xpandomer synthesis and processing, any cleavage products not bound to the second elongated oligonucleotide can be removed from the substrate by washing. After the release of Xpandomer from the substrate, the cleavage products not bound to the first elongated oligonucleotide lack the leader sequence and, advantageously, cannot penetrate the nanopore to provide sequence data.

[0175] D. Construction and method of a next-generation YAD-free mirroring library.

[0176] Some features of the enantiomer library workflow described herein are suitable for modification and / or optimization to provide advantages to specific experimental requirements. In the embodiments shown in Figures 11A–11C, the binding site for the Xpandomer elongated oligonucleotide and the functional groups for solid-phase bonding are provided by a Y adapter ligated to the library fragment by enzymatic ligation. In alternative “next-generation” embodiments, the binding site for the elongated oligonucleotide is instead provided by oligonucleotide primers ligated to the library fragment via PCR. This approach allows for both amplification of the target sequence and elimination of the ligation step of ligating the YAD to the library fragment. After the primer sequences are incorporated into the library fragment, the resulting PCR product is referred to as a “tailed” or “tagged” library fragment (or “tagged target sequence”). In some embodiments, the functionalized end groups for solid-phase bonding are provided by a separate oligonucleotide structure containing an oligonucleotide sequence referred to herein as a “capture oligo” designed to specifically hybridize with the library tag after PCR amplification. Generally speaking, these embodiments are referred to herein as “YAD-free” enantiomer library constructs.

[0177] Figure 14 shows one embodiment of a library fragment, i.e., YAD-free tagging and capture of a DNA target sequence. In this embodiment, the library fragment is exemplified by a double-stranded 100mer 1410 having a positive strand (SEQ ID NO: 5) 1410A and a negative strand (SEQ ID NO: 6) 1410B. Forward and reverse PCR primers are designed to contain oligonucleotide sequences complementary to the target sequence, ligated to heterologous sequences at their 5' ends. In one embodiment, primer (SEQ ID NO: 7) 1420 includes a 3' oligonucleotide sequence that specifically hybridizes to the complementary sequence in the positive strand 1410A of the library fragment, and a 5' heterologous sequence that introduces a tag into the PCR product, enabling capture of the tagged library fragment. In this embodiment, the 5' heterologous sequence is referred to as "UP38" and is the same sequence present in both the capture oligonucleotide structure and the Xpandomer extension oligonucleotide. In some embodiments, primer (SEQ ID NO: 8) 1425 includes a 3' oligonucleotide sequence that specifically hybridizes with the complementary sequence of the minus strand 1410B of the target sequence, and a 5' heterologous sequence that provides a binding site for a cap adapter structure incorporated during Xpandomer synthesis. Figure 14A shows PCR primers hybridized to a single-stranded positive strand 1410A (SEQ ID NO: 5) and a minus strand 1410B (SEQ ID NO: 6). PCR amplification of the library fragment generates a tagged fragment 1430 (positive strand (SEQ ID NO: 9) 1430A and minus strand (SEQ ID NO: 10) 1430B) containing a first tag (SEQ ID NO: 11) 1438 and a second tag (nucleotides 1-22 of SEQ ID NO: 9) 1439, which are sequenced by the heterologous sequence tail of the PCR primer. When designing primers 1420 and 1425, standard primer design principles well established in the art are followed.

[0178] For the capture of tagged library fragments, the capture oligonucleotide structure is covalently bonded to a solid support, for example, by click chemistry as described herein. One embodiment of the generalized capture oligonucleotide structure can be represented as follows: [azide]D n Ln Z n (SCL)(CO), where azide provides a means for covalent bonding (i.e., immobilization) to a functionalized solid support (e.g., functionalized with azide groups or double biotin groups). D represents PEG6, L represents C2, and Z represents C6, and polymers of D, L, and Z can form a mobile linker structure. (SLC) represents a selectively cleavable linker, which in this embodiment is a polymer of uracil residues. (CO) is an oligonucleotide sequence of the capture oligo. In this embodiment, the CO sequence is the same sequence as the UP38 heterologous sequence (SEQ ID NO: 11) and specifically hybridizes to the tag sequence on the plus-chain of the library fragment. In some embodiments, the mobile linker is a PEG6 monomer, e.g., D 16 Formed solely from these materials, they offer advantages when performing PCR reactions on beads or microfluidic chips, as discussed herein.

[0179] A second PCR reaction is performed to capture the tagged library fragment, and this second PCR reaction is carried out on a solid support providing the capture oligonucleotide. A simplified representation of the library fragment capture is shown in Figure 14B, where the capture oligonucleotide structure 1440 is immobilized on the solid support 1445. The capture oligonucleotide structure contains a 3' oligonucleotide sequence identical to the sequence of the tag (SEQ ID NO: 11) 1438 in the minus strand 1430B of the library fragment. When the double-stranded library fragment is denatured, the plus strand 1430A specifically hybridizes to the capture oligonucleotide. The capture oligonucleotide provides a primer for synthesizing a complementary copy of the plus strand 1430A, represented here by 1430C (SEQ ID NO: 10). A suitable number of PCR cycles produce the double-stranded library fragment 1450 immobilized on the solid support.

[0180] Following the tagging of library fragments in solution, the reaction conditions for on-chip capture of the tagged amplicon product can be optimized through trial and error. In one embodiment, the in-solution PCR tagging reaction can be carried out as follows: Prepare a reaction mixture containing 1-15 amol of synthetic template DNA (or, in other embodiments, sheared natural library DNA), 2 μM of each primer, 350 μM of dNTPs, 1 × KOD buffer (120 mM Tris, pH 8.0, 20 mM KCl, 6 mM NH4SO4, 1.5 mM MgSO4, and 1% Triton X100), and 0.05 U / μl KOD polymerase. The reaction is cycled at 95°C for 2 minutes, followed by 30 cycles of 10 seconds at 95°C / 8 seconds at 68°C / 8 seconds at 72°C, and one 3' extension at 72°C. The final yield of tagged amplicons, approximately 25 pmol, can be purified, for example, by a QIAquick column (available from QIAGEN).

[0181] In one embodiment, the capture tip can be prepared as follows: 100 pmol of UP38 capture oligonucleotides are covalently bonded to an alkyne-functionalized tip by a click reaction containing 10% DMF, 3 mM THPTA, 25 mM Na3PO4, 5 mM aminoguanidine, 6 mM NaAsc, and 1 mM CuSO4. The reaction is carried out at room temperature for 20 minutes, after which the tip is washed and subsequently passivated with BSA (10 mg / ml of unacetylated BSA in PBS at room temperature for about 1 hour).

[0182] In one embodiment, an on-chip PCR reaction can be performed as follows: A chip containing approximately 100 pmol of UP38 capture oligonucleotides is mixed with approximately 1 × 10¹⁶ of oligonucleotides. 6 Add the tagged amplicon product, 200 pmol of UP39 primer, and 5 pmol of UP38 primer. KAPA HiFi HS U+, 1X ReadyMix buffer (2.5 mM Mg), 0.1 μg / ml unacetylated BSA, 1M PCR containing betaine, 2% DMSO, 1% PEG, and 0.5% Tween Add the mixture. The PCR cycling conditions are as follows: 35 cycles of 98°C for 2 minutes, 100°C for 1 minute, 48°C for 12 seconds, 67°C for 30 seconds, and 80°C for 2 minutes, followed by 80°C for the last 2 minutes; then wash the tips in a buffer containing 1M NaCl and 10mM Tris (pH 8.0).

[0183] Tagged library fragments captured on a solid support provide a substrate for generating M3 enantiomerized library template constructs, which provide templates for Xpandomer synthesis, as discussed herein. Several alternative workflows for M3 and Xpandomer products are contemplated by the present invention. The following is a non-limiting description of specific embodiments of alternative “next-generation” enantiomerized library workflows.

[0184] Fabrication of a single-support mirror-image library using bystander extended oligonucleotides.

[0185] In this embodiment, both the M3 enantiomerized library template construct and the Xpandomer are synthesized on the same solid support, e.g., beads or microfluidic chips. Both the capture oligonucleotide for M3 generation and the extension oligonucleotide for Xpandomer synthesis are immobilized on the support. In some embodiments, the extension oligonucleotide is designed to form a hairpin structure that prevents hybridization with the library fragment during PCR-based capture and is therefore referred to herein as a "bystander" oligonucleotide. The bystander oligonucleotide can be selectively converted to a functional extension oligonucleotide after capture of the tagged library fragment, as will be further discussed below.

[0186] Figures 15A and 15B show the basic features of single support synthesis using a bis - stander extension oligonucleotide. In Figure 15A, the tagged library fragment 1510 is shown immobilized on the solid support 1505. Tagging of the library fragment based on PCR and ligation to the solid support by the capture oligonucleotide structure 1515 are performed as described herein and in reference to Figure 14. In one embodiment, the capture oligonucleotide structure may have the following sequence. 5’[azide]D 16 (UUUUU)(UP38)3’ (where the azide group mediates the attachment to the solid support, “D” represents a PEG6 linker, “U” represents deoxyuracil, and “UP38” represents the capture oligonucleotide sequence). The U5 sequence can be selectively cleaved, for example, by USER® (Uracil - Specific Excision Reagent) available from NEB, which generates a single nucleotide gap at the position of the uracil residue and cleaves the resulting abasic site. The bis - stander extension oligonucleotides 1520A and 1520B are also immobilized on the support. The sequence of the bis - stander oligonucleotide is designed to form a double - stranded hairpin structure that prevents hybridization with the library fragment during PCR. In one embodiment, the bis - stander oligonucleotide may have the following sequence. 5’[azide]D n L n Z n [TCATAAGACGAACGGAGAUUTCCGTTCG (SEQ ID NO: 12)]X 3’, where the “D”, “L”, and “Z” portions form a polymer that serves a specific function in SBX as further discussed herein. On the other hand, the 3’ - terminal TCCGTTCG sequence folds into a base pair with the internal CGAACGGA sequence, thus forming a hairpin structure in which the intervening GAUU sequence remains single - stranded. The single - stranded uracil - containing sequence can be cleaved with USER®. The terminal “X” portion of the bis - stander oligonucleotide represents a “blocker” (e.g., a PEG or C3 spacer blocker) that prevents extension from the oligonucleotide during PCR.

[0187] To form the M1 precursor construct 1530, a three-pronged adapter 1525 is connected to the immobilized library fragment. In some embodiments, this may be achieved by first attaching an "A" tail to the free 3' end of the library fragment, which is Trident The construct provides a free 3' "T" that forms a base pair. An exemplary A-tailing reaction comprises 10 pmol PCR amplicon, 1× MolTaq buffer, 1 mM dATP, and 2.5 U MolTaq, and can be carried out at 72°C for 30 minutes. An exemplary ligation reaction comprises 40 pmol of a three-strand construct, 1× ligation buffer, 3 mM ATP, 2 U / μl T4 PNK, and 30 U / μl T4 DNA ligase, and can be carried out at room temperature for 20 minutes, followed by the addition of 150 U of 5' derdenylase and incubation for 10 minutes. The M1 precursor is then extended to form a triple-stranded M2 construct with DNA polymerase, as described herein and with reference to Figure 11B.

[0188] Figure 15B shows the M2 precursor construct 1540, which has a bystander elongated oligonucleotide and a selectively cleavable uracil moiety in the captured oligonucleotide designated by the letter "U". To prepare the M3 template construct 1550, the M2 precursor is cleaved with USER® to introduce a nick into the uracil moiety. This results in 1) cleavage of the hairpin structure in the elongated oligonucleotide and 2) cleavage of the captured oligonucleotide, generating a free 5' end in the intermediate chain of the M2 construct. Simultaneously, the M2 precursor is subjected to exonuclease treatment to 1) digest the terminal TCCGTTGC sequence of the bystander oligonucleotide to expose the elongated oligonucleotide sequence and 2) digest the intermediate chain of the M2 complex from the 5' end to the 3' end. The exposed elongated oligonucleotide then specifically hybridizes with the complementary sequence provided by the 3' end of the M3 template construct. In some embodiments, the Nicking and exonuclease digestion reaction may be carried out by treating the M2 precursor with a reaction mixture containing 1x lambda exobuffer (67 mM glycine-KOH, 2.5 mM MgCl2 and 50 μg / ml BSA), 20% PEG8000, 0.15 U / μl USER®, and 0.4 U / μl lambda exonuclease at 37°C for 15 minutes. Following the Nicking and exonuclease digestion reaction, a subsequent phosphatase reaction is performed to remove the 3' phosphate remaining after USER® cleavage of the bystander oligonucleotide, thereby converting it into a functionally extended oligonucleotide for Xpandomer synthesis. In some embodiments, the phosphatase reaction may be carried out at 37°C for 5 minutes using a reaction mixture containing 1×CutSmart buffer (50 mM potassium acetate, 20 mM Tris acetate, 10 mM magnesium acetate, 100 μg / mL BSA) and 0.1 U / μL of Quick bovine intestinal alkaline phosphatase (CIP), followed by thermal inactivation at 80°C for 2 minutes.

[0189] The M3 construct provides a template for Xpandomer synthesis, which can be carried out as described herein and with reference to Figure 11C. The extended oligonucleotide may, in some embodiments, provide further features for selective release from the support and nanopore translocation, as described throughout this disclosure.

[0190] On-card 2-zone mirroring library generation

[0191] In this embodiment, the microfluidic chip, or card, is designed to have two physically separate zones for the mirrored library workflow, including a first zone for capturing library fragments and generating M3 template constructs, and a second zone for Xpandomer synthesis. Separating the workflow into two zones in this way offers several advantages, such as eliminating the need for bystander extension oligonucleotides.

[0192] Figure 16A shows one embodiment of a two-zone card configuration. Here, card 1600 is divided into physically separate compartments 1610 and 1620, called "Zone 1" and "Zone 2," respectively. Zone 1610 is dedicated to the generation of M3 template constructs, and Zone 2620 is dedicated to Xpandomer synthesis, such as the UP38 primer described herein. The capture oligonucleotide structure is immobilized on the surface of Zone 1, for example, by click chemistry. Similarly, the elongated oligonucleotide for Xpandomer synthesis is immobilized on the surface of Zone 2. In some embodiments, the elongated oligonucleotide may include photocleavable, acidcleavable, or enzymatically cleavable elements for selective release of the Xpandomer product. The generation of the M3 template construct is carried out in Zone 1 as described herein. Briefly, the tagged library fragment and PCR mixture are added to Zone 1, and on-chip PCR is performed to ligate the tagged library fragment to the capture oligonucleotide. The M1 precursor is formed by A-tailing the library fragment and then ligating a trident adapter. The trident adapter is elongated by DNA polymerase to generate the M2 precursor. The M2 precursor construct is subjected to uracil cleavage and then exonuclease digestion to cleave the capture oligonucleotide and remove the intermediate chain, thereby generating the M3 template construct 1615.

[0193] Figure 16B shows the transfer of the M3 template precursor from zone 1 to zone 2 of the card, which then specifically hybridizes with the elongated oligonucleotides 1625A and 1625B. The cap adapter structure 1630 specifically hybridizes with the M3 template construct, and Xpandomer synthesis is initiated from the elongated oligonucleotide in the direction indicated by the arrow. Details of the cap adapter structure and reaction conditions for Xpandomer synthesis are described throughout this disclosure.

[0194] In another embodiment, the capture oligonucleotide bound to zone 1 is designed to include a photocleavable element instead of a uracil residue. In this embodiment, treatment of the M2 precursor with UV light cleaves the capture oligonucleotide, providing a 5' substrate for exonuclease digestion to produce the M3 template construct. During photocleavage, the zone 2 compartment may be protected from exposure by a UV-blocking interface. An exemplary capture oligonucleotide containing a photocleavable element may have the following structure: [azide]D10 _L 30 In the formula _Z6_PC_UP038, the D, L, and Z parts of the polymer, for example, “Spacer” form a movable linker, “PC” represents a photocleavable element, and UP038 represents an oligonucleotide having the sequence 5'TCATAAGACGAACGGAGACT 3' (SEQ ID NO: 13) designed to hybridize with the tag sequence of the library fragment.

[0195] Bead-based mirroring library generation

[0196] This embodiment describes a workflow in which an M3 template construct is generated by a series of steps performed on a bead-based support. In this embodiment, various constructs are conjugated to beads by streptavidin-biotin linkage, as discussed with reference to Figure 4A. Beads offer specific advantages as solid substrates; for example, they are suitable for PCR conditions, highly scalable, and therefore provide higher product yields than other substrates.

[0197] One embodiment of the bead-based workflow is summarized in Figure 17. Advantageously, the beads can be washed between steps to remove excess reagent. Step 1 involves tagging library fragments by in-solution PCR, as described herein and with reference to Figure 14A. Step 2 involves performing on-bead PCR to generate library fragments tagged on capture oligonucleotides. In this embodiment, the capture oligonucleotides include a biotin moiety for binding to SA beads. Any suitable SA bead substrate, e.g., Dynabeads® MyOneC1 SA available from ThermoFisher Scientific, can be used. A 35-cycle PCR reaction using KAPA HiFi Uracil+ polymerase can be performed up to 10 6 From the copy input, generate up to 1-20 pmol of bead-bound amplicons. Following step 2, the beads are processed. The samples are treated with Nase K at 55°C for 5 minutes, followed by a post-PCR wash (1M NaCl, 10mM Tris, 0.1% Tween-20). In another embodiment, in-solution PCR can be performed using biotinylated capture oligonucleotides, followed by PCR purification based on a spin column. The purified biotinylated amplicons can then be ligated to t0SA beads. In step 3, the 3'A "tail" is added to the library fragment, followed by ligation of the Trident adapter containing the 5'T overhang. An exemplary A-tailing reaction involves 2.5U of MolTaq enzyme and 1mM of dATP and is incubated at 65°C for 30 minutes. An exemplary ligation reaction involves the Trident adapter construct (with the "T" overhang), 30U / μl T4 DNA ligase, 2U / μl T4 PNK, and 3U / μl 5' deadenylate and is incubated at room temperature for 20 minutes. In step 4, the Trident adapter is extended to generate the M2 precursor. An exemplary extension reaction involves KAPA HiFi U+ polymerase in 1×ReadyMix, commercially available from Roche. Following step 4, the beads are again treated with proteinase K and washed. In step 5, the M3 template construct is produced by nicking the uracil moiety in the M2 precursor to generate a free 5' end in the intermediate chain of the construct, followed by exonuclease digestion of this chain. The exemplary nicking / digestion reaction involves 0.1 U / μl of USER® and 0.3 U / μl of lambda exonuclease and is incubated at 37°C for 15 minutes. The exonuclease can then be inactivated by incubating the beads at 75°C for 10 minutes. In step 6, the free M3 template precursor and cap adapter construct are added to a microfluidic chip containing covalently bonded extension oligonucleotides. The M3 construct specifically hybridizes with the extension oligonucleotides and cap adapter. In step 7, the Xpandomer synthesis and processing reactions are carried out as described throughout this disclosure. The final Xpandomer product can be released from the chip by photocleavage.In an alternative embodiment, steps 6 and 7 may also be performed on a bead-based support.

[0198] Solid-state Xpandomer synthesis using branched extension oligonucleotides

[0199] As discussed herein, the extended sequencing (SBX) protocol developed by the inventors utilizes an extended oligonucleotide (EO) for Xpandomer synthesis, which includes several features that perform specific functions during Xpandomer synthesis, processing, and nanopore translocation. For example, in certain embodiments, the 5' end of the EO provides a “leader” sequence that initiates threading of the final Xpandomer product via the nanopore. The leader sequence is a polymer of C2 (represented herein as “L”), for example, L 25 This may include. In some situations, it would be desirable to generate a collection of mirror-image Xpandomers penetrating the nanopore and generating sequence information using only full-length copies. To achieve this objective, we have designed a branched extension oligonucleotide comprising first and second extension oligonucleotides linked by a chemical branching agent. In this embodiment, only one of the EOs contains the leader sequence, and each EO contains a unique selectively cleavable element. One embodiment of the branched EO is shown in Figure 18.

[0200] Figure 18 shows branched EO1800, which includes a first EO1810 and a second EO1820 linked by branching agent 1815. Branched EO1800 can be synthesized by conventional phosphoramidite chemistry using an asymmetric chemical branching agent. In this embodiment, only the first EO1810 contains a leader sequence represented by a polymer of "L" units ("L" representing a C2 spacer). Similarly, only the first EO contains a polymer of "Z" units ("Z" representing a C12 spacer). The Z-unit polymer also plays a role in nanopore translocation. In this embodiment, the first EO contains a polymer of uracil ("U") residues that enable selective cleavage of the EO via, for example, USER®, and the second EO is The EO includes a photocleavable element ("PC-spacer") for UV-mediated cleavage. The sequence of the 3' oligonucleotide primer (SEQ ID NO: 14) of each EO is identical and is designed to hybridize with the M3 template construct. In some embodiments, the oligonucleotide primer is synthesized using one or more 2'-OMe base analogs. The inventors have advantageously found that variants of the DPO4 polymerase used in Xpandomer synthesis can utilize 2'-OMe analogs as substrates. The branched EO includes a 5' terminal azide group for click binding to the substrate. The lengths of the L, Z, D, and U polymers shown in this exemplary embodiment are not intended to be limiting. The invention is understood to intend a variety of suitable polymer lengths and branched EO structures.

[0201] Figures 19A and 19B illustrate how branched EOs enable the generation and isolation of a population of full-length Xpandomers for nanopore sequencing. In step 1, an M3 template construct 1910 is hybridized to a branched EO 1920 bound to a support 1930. Only one EO of the branched structure contains the leader sequence 1925. In step 2, a cap adapter structure 1940 is hybridized to the M3 template construct. In step 3, Xpandomer copies 1950A and 1950B are synthesized by extension from oligonucleotide primers 1927A and 1927B. The 3' end of the Xpandomer is ligated to the free end of the cap primer construct by end capping, as described herein. In step 4, the Xpandomer is subjected to a USER® treatment to selectively cleave the first extension oligonucleotide and expose the leader sequence 1925. In step 5, the Xpandomer is processed to cleave and transition from a “constrained” configuration to an “extended” configuration. This step allows for the washing away of incomplete or cleaved Xpandomer byproducts. In step 6, the Xpandomer is released from the substrate by photocleavage of a second extended oligonucleotide. Advantageously, only the full-length Xpandomer 1950 contains the leader sequence 1925, which penetrates the nanopore and provides sequence information.

[0202] All documents disclosed herein, including patent and non-patent documents, are incorporated herein by reference in their entirety, as if each were incorporated individually.

[0203] It should be understood that the terms used herein are merely for the purpose of describing specific embodiments and are not intended to be limiting. Furthermore, unless specifically defined herein, terms used herein should be given their conventional meanings as known in the relevant art.

[0204] Throughout this specification, any reference to “one embodiment” or “embodiment” means that a particular feature, structure, or characteristic described in relation to an embodiment is included in at least one embodiment. Therefore, occurrences of the phrase “in one embodiment” or “in an embodiment” in various places throughout this specification do not necessarily all refer to the same embodiment. Furthermore, a particular feature, structure, or characteristic can be combined in any suitable manner in one or more embodiments.

[0205] As used herein and in the appended claims, the singular forms “a,” “an,” and “the” refer to multiple objects, i.e., one or more, unless the content and context explicitly indicate otherwise. Furthermore, the conjunctions “and” and “or” are generally used in their broadest sense to include “and / or” unless the content and context explicitly indicate inclusiveness or exclusivity. Therefore, the use of alternative forms (e.g., “or”) should be understood to mean either, both, or any combination thereof. Additionally, where “and / or” is written herein, “and” and “also” refer to “and / or” in this specification. The configuration of "ha" is intended to encompass embodiments that include all relevant items or ideas, and one or more other alternative embodiments that include all fewer relevant items or ideas.

[0206] Unless the context requires a different interpretation, the word “comprise,” as well as its synonyms and variations such as “have” and “include,” and its variations such as “comprises” and “comprising,” should be interpreted throughout the specification and claims as having an open and comprehensive meaning, for example, “includes, but not limited.” The term “essentially,” limits the claims to any particular material or process, or to any fundamental and novel feature of the claimed invention, that does not substantially affect the claim.

[0207] The abbreviation “e.g., (eg)” derives from the Latin “exempli gratia” and is used herein to indicate a non-limiting example. Therefore, the abbreviation “e.g., (eg)” is synonymous with the term “for example.” Where used herein and in the appended claims, the singular forms “a,” “an,” and “the” include references to the plural unless the context clearly indicates otherwise; the term “X and / or Y” means “X” or “Y” or both “X” and “Y”; and the letter “s” following a noun indicates both the singular and plural forms of that noun. Furthermore, where any feature or aspect of the Invention is described in relation to a group of Markush members, the Invention also encompasses, is intended to encompass, and will be described in relation to any individual member of a group of Markush members and any subgroup of a member, as will be recognized by those skilled in the art; and the applicant reserves the right to modify this application or the claims to specifically refer to any individual member of a group of Markush members or any subgroup of a member.

[0208] Any headings used within this document are provided solely to facilitate the reader's consideration and should not be construed as limiting the scope of the invention or the claims. Accordingly, the headings and summaries of disclosures provided herein are for convenience only and do not constitute any interpretation of the scope or meaning of the embodiments.

[0209] Where a range of values ​​is provided herein, unless the context otherwise expressly indicates, each intermediate value between the upper and lower limits of that range, up to one-tenth of the lower limit, and any other stated or intermediate values ​​within that stated range are understood to be included in the invention. The fact that these smaller upper and lower limits may independently be included in smaller ranges is also included in this disclosure, subject to any particularly excluded limits within the stated range. If the stated range includes one or both of the limitations, the range excluding one or both of the included limitations is also included in the invention.

[0210] For example, any concentration range, percentage range, ratio range, or integer range provided herein should be understood to include any integer within the listed range, and, where appropriate, fractions thereof (such as one-tenth and one-hundredth of an integer), unless otherwise specified. Similarly, any number range listed herein relating to any physical characteristics such as polymer subunits, size, or thickness should be understood to include any integer within the listed range, unless otherwise specified. Where used herein, the term “approximately” means ±20% of the indicated range, value, or structure, unless otherwise specified.

[0211] All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent publications mentioned herein and / or listed in application data sheets are incorporated herein by reference in their entirety. Such documents include, for example, materials and methods described in publications that may be used in connection with the inventions described herein. For the purpose of explaining and disclosing the argument, it may be incorporated by reference. The publications described above and throughout this text are provided only for disclosure prior to the filing date of this application. Nothing in this specification should be construed as an acknowledgment that this disclosure does not have prior rights to such publications by prior invention.

[0212] All patents, publications, scientific papers, websites, and other documents and materials referenced or mentioned herein represent the level of skill of those skilled in the art to which the present invention relates, and each such referenced document and material is incorporated by reference either individually in whole or in whole to the same extent as is described herein. The applicant reserves the right to physically incorporate into this specification any and all materials and information from such patents, publications, scientific papers, websites, electronically available information, and other referenced materials or documents.

[0213] In general, the terms used in the following claims should not be interpreted as limiting the claims to specific embodiments disclosed in the specification and claims, but rather as encompassing all possible embodiments, along with the entire scope of equivalents for which such claims are entitled. Therefore, the claims are not limited by this disclosure.

[0214] Furthermore, the descriptive portion of this patent includes all claims. Moreover, all claims, including all original claims and all claims from any and all priority documents, are incorporated in their entirety by reference into the descriptive portion of this specification, and the applicant reserves the right to physically incorporate any and all such claims into the specification or any other portion of this application. Thus, for example, the patent will not be construed as failing to provide a description of the claims in response to a claim that the exact wording of the claims is not contained in the verba of the specification portion of the patent under any circumstances.

[0215] The claims shall be interpreted in accordance with the law. However, notwithstanding any claim or part thereof being asserted or recognized as being easy or difficult to interpret, under no circumstances shall any adjustment or modification of the claim or part thereof in an application or in the course of execution of such application leading to this patent be construed as a waiver of any equivalent thereof that does not form part of the prior art.

[0216] Other non-limiting embodiments are within the scope of the following claims. The Patent shall not be construed as being limited to any specific example or non-limiting embodiment or method specifically and / or expressly disclosed herein. Under no circumstances shall the Patent be construed as being limited by any statement made by any examiner or other officer or employee of the Patent and Trademark Office, except in cases where such statement is specific and expressly adopted in the applicant's written response.

[0217] The present invention is broadly and generally described herein. Each of the narrower groups of species and subgenera included in the general disclosure also forms part of the present invention. This includes the general description of the invention with any condition or negative limitation of removing any subject matter from a genus, whether or not the excised material is specifically described herein. [Examples]

[0218] Example 1 Solid Xpandomer synthesis - Direct conjugation of oligonucleotides into microfluidic chips This example describes the solid-state synthesis of Xpandomer, an extensible copy of a single-stranded polynucleotide template composed of XNTP nucleotide analogs, possessing unique features for improved nanopore sequencing. Solid-state Xpandomer synthesis was performed on a microfluidic chip substrate functionalized by covalent bonding of extension oligonucleotides ("E-oligo") to the chip. Polymerase-mediated extension of the bound E-oligo by XNTP results in an Xpandomer product that remains bound to the chip and can be washed, processed, and released in an efficient and controlled manner.

[0219] The E-oligonucleotide ("E52 SIMA PC azide") used in this experiment contained the following features: a polymer of PEG-6 monomer followed by a 5' azide group, a photocleavable spacer, a "leader" polymer sequence, a "concentrator" polymer sequence, a fluorescently labeled nucleotide, and an oligonucleotide primer. The leader polymer and concentrator polymer functioned, for example, to improve the efficiency of Xpandomer translocation via a nanopore sensor, and are described in further detail in U.S. Patent No. 9,670,526 by the applicant, entitled "Concentrating a target molecule for sensing by a nanopore," which is incorporated herein by reference in its entirety.

[0220] A. Functionalization of the chip

[0221] A commercially available continuous flow PCR chip made from Zeonor (cycloolefin thermoplastic polymer) was used as the solid support in this experiment. The chip was functionalized with an alkyne moiety using direct conjugation according to the photoabstraction protocol described herein. Briefly, the chip was primed with 350 μL of 80% DMS. Then, 60 μL of 10 mM propargylmaleimide was added to 80% DMSO, and the chip was incubated under a 20 W UV lamp for 20 minutes. The chip was then incubated with 80% DMSO The tips were sequentially washed with a solution of 300 μL of 100% DMF, 300 μL of water, 300 μL of 300 mM Na2HPO4, 1% Tween-20, and 0.5% SDS, and incubated at 37°C for 5 minutes. The tips were finally washed with 300 μL of water, followed by 300 μL of 3×PBS.

[0222] B. Click response

[0223] The solution for the click reaction was prepared as follows: 1) A catalyst mixture was prepared by mixing 5.0 μL of water, 1.5 μL of 100 mM THPTA, 1.5 μL of 100 mM sodium ascorbate, 0.5 μL of 10 mM CuSO4, 0.5 μL of 100 mM aminoguanidine, and 1.0 μL of 100% DMF, and incubated at room temperature for 5 to 15 minutes. 2) A substrate mixture was prepared by mixing 29.22 μL of water, 4.00 μL of 100% DMF, 1.25 μL of 1000 mM sodium phosphate, pH 7.0, 0.78 μL of 25.6 μM elongated oligonucleotide (20 pmol of E52 SIMA PC azide), 1.25 μL of 100 mM MgCl2, 2.0 μL of 100 mM aminoguanidine, and 1.5 μL of 100 mM sodium ascorbate. 3) The substrate mixture was added to the catalyst mixture and vortexed. The functionalization chip was washed with 300 μL of water, 50 μL of the click reaction mixture was added, and the mixture was incubated at room temperature for 20 minutes.

[0224] C. Stretching response

[0225] For the extension reaction, a ratio of 20 pmol:20 pmol of DNA template to E-oligo was used. The template was a single-stranded 100-mer sequence derived from the HIV2 genome. The primer sequence was 5'TCATAAGACGAACGGA 3' (SEQ ID NO: 4). Single-stranded DNA template molecules were hybridized to support-bound E-oligos by incubation with 20 pmol template and a tip at 37°C for 5 minutes, followed by washing with 300 μL of MEB buffer.

[0226] The extension reaction included the following reagents: 4 nmol XNTP, 0.08 mM polyphosphate, 0.6 mM MnCl2, 0.5 M betaine, 0.25 M urea, 10 μg single-strand binding protein (SSB), 9 μg DNA polymerase protein (C4760), and 1.4 mM PEM combo (AZ8-8 and AZ43-43). The final reaction volume was diluted to 50 μL with 5% NMS, and extension was performed at 42°C.

[0227] After extension, the tip was treated and washed to remove the extension reagent, and the bound Xpandomer product was released from the tip by photocleavage (treatment with a Firefly UV curing lamp for 15 minutes). The cleaved Xpandomer product was eluted from the tip with 60 μL of 40% acetonitrile. The Xpandomer product was analyzed by gel electrophoresis by running approximately 0.75 pmol of product per lane in a 2.5% Nusieve gel containing 1×TAE buffer. A representative gel is shown in Figure 20, with the product from solid Xpandomer synthesis shown in lane 3, and the full-length product indicated by an arrow. For reference, the product from the Xpandomer synthesis reaction performed in solution using the same template is shown in lane 1. The narrowness of the band observed in lane 3 suggests that solid Xpandomer synthesis may improve the distribution, with a reduction in partial or cleaved products (the apparent larger size of the blurred band in lane 1 reflects the difference in the composition of the E-oligo used in the solution-based extension reaction). Lane 2 is a negative control where the template used does not hybridize to the E-oligo, and Lane 4 is a positive control showing the product of solid extension performed under different reaction conditions. These results demonstrate a proof of concept for the sol synthesis of Xpandomer.

[0228] Example 2 Solid-state Xpandomer synthesis (SBX) for sequencing by extension This example describes the solid-state synthesis and processing of a 222mer template Xpandomer copy, followed by sequencing of the product using a nanopore sensor system. All steps of the pre-sequencing workflow were performed using the Xpandomer intermediate and the final product bound to the substrate. This protocol offers many advantages over solution-based workflows, such as the ability to sequentially add pure reagents for each reaction in reduced volumes. In this experiment, the Xpandomer extension reaction was performed on a microfluidic chip substrate primed by direct covalent bonding of E-oligonucleotides. Chip functionalization and E-oligonucleotide click bonding were performed as described in Example 1.

[0229] A. Stretching response

[0230] The extension reaction was performed with a molar ratio of 10 pmol:20 pmol of DNA template to E-oligo. The template used was a single-stranded 222-mer sequence derived from the HIV2 genome, and the E-oligo used was the E52 oligo described in Example 1. The single-stranded DNA template molecule was hybridized to the bound E-oligo by incubating 10 pmol of template with the chip in a solution of 500 mM NH4OAc, 5% NMS, 1 M urea, and 2% PEG8K at 37°C for 5 minutes, followed by washing with 300 μL of MEB buffer. Prior to the extension reaction, the chip was washed with 300 μL of a solution of 50 mM TrisCl, 200 mM NH4OAc, 5% NMS, 10% PEG8K, and 1 M urea.

[0231] The extension reaction included the following reagents: 4 nmol XNTP, 0.08 mM polyphosphate, 0.6 mM MnCl2, 0.5 M betaine, 0.25 M urea, single-chain binding. The reaction consisted of 10 μg of protein (SSB), 9 μg of DNA polymerase protein (C4760), and 1.0 mM AZ-8,8 and 4 mM AZ-43,43 PEM additives. The final reaction volume was 50 μL using a buffer consisting of 5% NMS and 50 mM Tris HCl, pH 8.84, 200 mM NH4OAc, pH 6.73, and 20% PEG. The extension reaction was carried out at 42°C for 30 minutes.

[0232] After stretching, the tips were washed three times with 300 μL of a washing solution containing 100 mM HEPES, pH 8.0, 100 mM Na2HPO4, 1% Tween 20, 3% SDS, 15% DMF, and 5 mM EDTA in D2O.

[0233] B.Xpandomer Processing

[0234] The combined extension products were first treated with acid to cleave the phosphoramidite bonds in the Xpandomer to linearize the molecules, as shown, for example, in Figure 1C. Acid-mediated cleavage was achieved by adding 200 μL of a 7.5 M DCl solution in D2O to the chip and incubating at room temperature for 30 minutes. The bound products were then neutralized and washed by adding 900 μL of a D2O solution of 100 mM, pH 8.0, 100 mM Na2HPO4, pH 8.0, 1% Tween-20, 3% SDS, 15% DMF and 5 mM EDTA. Then, while adding 200 μmol of succinic anhydride (loaded separately in a syringe) directly to the chip, 300 μL of a D2O solution of 100 mM HEPES, pH 8.0, 100 mM Na2HPO4, pH 8.0, 1% Tween 20, 3% SDS, 15% DMF, 5 mM EDTA was added and the bound products were modified by subsequent incubation at 23 °C for 5 minutes. The modified products were then washed with 500 μL of a solution of 15% ACN and 5% DMSO in H2O.

[0235] C. Release of Xpandomer from the chip

[0236] The bound Xpandomer products were released from the chip substrate by photocleavage. After adding 60 μL of an H2O solution of 15% ACN and 5% DMSO to the chip, it was irradiated for 15 minutes using a UV curing lamp. The released Xpandomer eluted from the chip using a solution of 5% DMS and 15% acetonitrile. First, as shown in Figure 21A, the eluted material was analyzed by gel electrophoresis. 15% of the sample was run in lane 3 of a gel (2.5% NuSieve agarose in 0.5×TBE) containing the full-length Xpandomer product indicated by the arrow. For reference, the products of a solution-based Xpandomer synthesis reaction using the same template are shown in lanes 1 and 2. As can be seen from the figure, solid-phase synthesis produces a narrower band compared to solution-based synthesis, indicating a greater proportion of full-length products in the sample.

[0237] Nanopore sequencing

[0238] For array determination, protein nanopores are prepared by inserting α-hemolysin into DPhPE / heptadecane bilayer members in buffer B1 containing 2 M NH4Cl and 100 mM HEPES (pH 7.4). シス The wells are perfused with buffer B2 containing 0.4 M NH4Cl, 0.6 M GuCl, and 100 mM HEPES, pH 7.4. The Xpandomer sample is heated to 70 °C for 2 minutes, cooled completely, and then 2 μL of the sample is added to the cis well. Then, a voltage pulse of 90 mV / 390 mV / 10 μs is applied, and data is acquired using Labview acquisition software.

[0239] The sequence data is analyzed by histogram display of the population of sequence reads from a single SBX reaction. The analysis software aligns each sequence read to the template sequence and trims the range of sequences at the ends of the reads that do not align to the correct template sequence. A representative histogram of nanopore sequencing of the 222mer template is shown in Figure 21B. In particular, solid-phase synthesis and processing produced Xpandomer products that generate very accurate sequence reads over the full length of the 222mer molecule when read by a nanopore sensor. Example 3

[0240] Example 3 Xpandomer Synthesis by Terminal Capping This example describes an attempt to optimize the process of end capping of the Xpandomer product during synthesis and using different reaction additives. The template used in the following experiment was a 121-mer sequence derived from the HIV2 genome, and the E-oligonucleotide ("EO") used was E52 EO with the following features: a leader polymer, a concentrator polymer, and a 5'SIMA (fluorescent tag) with an oligonucleotide primer having the sequence 5'TCATAAGACGAACGGA 3' (SEQ ID NO: 4). The end cap contained a end oligonucleotide having the following sequence, 5'K[GCGTTAGGTCCCAGTGTTTAC (SEQ ID NO: 15)]X 3', where K represents the G clamp and X represents the PEG3 portion. The end oligonucleotide is complementary to and hybridizes with the 5' end of the template. The 5' end of the end oligonucleotide is linked to the ddCTP cap via a linker shown in feature 710A of Figure 7A, forming a complete end cap structure.

[0241] In this experiment, five extension reactions were performed, each containing the following reagents: 1:1 molar ratio of template to E-oligo, 2 mM AZ-8, 8 and 10 mM AZ-43, 43 PEM additive, 5% NMS, 1.8 μg DNA polymerase, 0.08 mM XNTP, 0.08 mM polyphosphate, and 0.6 mM MnCl2. Reactions 2-5 contained a 2x molar excess of end caps relative to the template and EO, while reaction 1 did not contain end caps. The reactions also contained various additives as follows: Reaction 1: 0.5 M betaine, 0.25 M urea, and 2 μg single-chain binding protein (SSB); Reaction 2: 0.5 M betaine, 0.25 M urea, and 2 μg SSB; Reaction 3: 0.25 M urea; Reaction 4: 0.5 M betaine and 0.25 M urea; Reaction 5: 0.25 M urea and 2 μg SSB. The final reaction volume for each was 10 μL, and the reactions were carried out at 42°C.

[0242] The products of the extension reaction were analyzed by gel electrophoresis, as shown in Figure 22. Lane 1 shows the product of reaction 1 without a terminal cap. In this reaction, the SIMA dye is linked to the EO, and the extension product is a 121-mer Xpandomer. Lanes 2-5 show the products of reactions 2-5, respectively, which include terminal caps. In these reactions, in contrast to reaction 1, the SIMA dye is linked to the terminal cap. As can be seen from the figure, in each of reactions 2-5, the terminal cap is successfully linked to the Xpandomer by DNA polymerase, indicating that the Xpandomer represents a complete copy of the DNA template. By incorporating the terminal oligonucleotide of the terminal cap into the extension product, the products of reactions 2-5 are 100-mer Xpandomers, which migrate more rapidly on the gel than the 121-mer of reaction 1. These results show a remarkably dense Xpandomer band on the gel, indicating that the terminal capping reaction is highly efficient under the experimental conditions tested. Importantly, end capping provides a means for tagging and capturing full-length Xpandomers, for example, for nanopore sequencing.

[0243] Example 4 Solid-state Xpandomer synthesis using end capping This example describes the solid-state synthesis of a 222-mer Xpandomer combined with end capping of the full-length product. On a microfluidic chip substrate functionalized by covalent bonding of an extended oligonucleotide ("E-oligo") to the substrate, as described in Example 1. Solid-state synthesis was performed. Once the full-length copy of the template was complete, the DNA polymerase encountered a hybridized end cap at the 5' end of the template, and the 5' end of the end cap bound to the 3' end of Xpandomer. The fluorescent dye bound to the end cap allowed for visualization of the full-length copy of the template by gel electrophoresis.

[0244] A. Elongation and end capping reactions.

[0245] The template used in the following experiment was a 243-mer sequence derived from the Streptococcus pneumoniae genome, and the E-oligonucleotide ("EO") used was E52 EO, which contained a photocleavable linker and an oligonucleotide primer with the sequence 5'TCATAAGACGAACGGA 3' (SEQ ID NO: 4). The terminal cap contained a terminal oligonucleotide with the following sequence, 5'K[GCGTTAGGTCCCAGTGTTTAC (SEQ ID NO: 15)] 3', where K represents a G-clamp. The terminal oligonucleotide is complementary to the 5' end of the template and hybridizes. The 5' end of the terminal oligonucleotide is linked to the ddCTP cap via the linker shown in feature 710A of Figure 7A, forming a complete terminal cap structure.

[0246] In this experiment, four on-chip extension reactions were performed using the same template, primers, and end caps. Reaction 1 contained the following reagents: template: EO:16:20:32 end cap molar ratio, 0.08 mM XNTP, 1 mM AZ-8, 8 and 4 mM AZ-43, 43 PEM, 9 μg DNA polymerase (DPO4 variant C4760), 10 μg SSB, 0.6 mM MnCl2, 0.08 mM polyphosphate, 50 mM Tris HCl, pH 8.84, 200 mM NH4OAc, pH 6.73, 20% PEG, 5% NMS, 0.25 M urea, 0.5 M betaine. A 50 μL reaction was carried out at 42°C. Reaction 2 contained the following reagents: Template: EO:6:10:12 end cap molar ratio, 0.08 mM XNTP, 1 mM AZ-8, 8 and 4 mM AZ-43, 43 PEM, 9 μg DNA polymerase (C4760), 10 μg SSB, 0.6 mM MnCl2, 0.08 mM polyphosphate, 50 mM Tris HCl, pH 8.84, 200 mM NH4OAc, pH 6.73, 20% PEG, 5% NMS, 0.25 M urea, 0.5 M betaine. A 20 μL reaction was carried out at 37°C. Reaction 3 contained the following reagents: Template: EO:6:10:12 end-cap molar ratio, 0.08 mM XNTP, 1 mM AZ-8, 8 and 4 mM AZ-43, 43 PEM, 9 μg DNA polymerase (C4760), 10 μg SSB, 0.6 mM MnCl2, 0.08 mM polyphosphate, 50 mM Tris HCl, pH 8.84, 200 mM NH4OAc, pH 6.73, 20% PEG, 5% nm, 0.25 M urea, 0.5 M betaine. A 25 μL reaction was carried out at 42°C. Reaction 4 contained the following reagents. Template: EO:10:10:20 end cap molar ratio, 0.08 mM XNTP, 1 mM AZ-8, 8 and 4 mM AZ-43, 43 PEM, 9 μg DNA polymerase (C4760), 10 μg SSB, 0.6 mM MnCl2, 0.08 mM polyphosphate, 50 mM Tris HCl, pH 8.84, 200 mM NH4OAc, pH 6.73, 20% PEG, 5% NMS, 0.25 M urea, 0.5 M betaine. A 25 μL reaction was carried out at 42°C.

[0247] The products of the extension reaction were analyzed by gel electrophoresis on a 2.5% NuSieve agarose gel, as shown in Figure 23. Lanes 1-4 show the products of reactions 1-4, each containing end caps. In these reactions, the SIMA dye is ligated to the end caps. As can be seen from the figure, in each reaction, the end caps are successfully ligated to the Xpandomer by DNA polymerase, indicating that the Xpandomer represents a complete copy of the DNA template. These results show a remarkably dense Xpandomer band on the gel, indicating that the end capping reaction is also very efficient during solid-state synthesis. Interestingly, the efficiency of extension and capping appears to be influenced by the properties of the additives present during the reaction. These results suggest that the solid-state synthesis of Xpandomer can be optimized through trial and error.

[0248] Example 5 Mirror Image Library Construct - Linking of Trident Adapter to Library Insert This embodiment describes the first step in generating a mirror image library construct of the present invention, in which a trident adapter is linked to a library fragment of double-stranded DNA. Figure 24A shows the basic structural features of the construct used in this experiment. The library fragment is a double-stranded 60-mer sequence derived from the HIV2 genome, and the "minus" strand (corresponding to the top strand in the figure) and the "plus" strand (corresponding to the bottom strand in the figure) incorporate a 3' single-nucleotide overhang. The polarity of the library strands is indicated by the number "5'" in the figure. The trident adapter consists of three DNA strands, as shown in Figure 24A, and the polarity of each strand is indicated by the number "3'". The top and bottom strands of the trident are 24-mer oligonucleotides with identical sequences, but the sequence of the oligonucleotide including the intermediate strand is the reverse complement of the top and bottom strand sequences. The top and bottom strands also have a 3' single-nucleotide overhang that allows for directional linking to the library fragment. The 5' ends of the three strands are joined together by a chemical branching agent to form a three-pronged adapter, with the intermediate and bottom strands forming a double-stranded hybrid, while the top strand remains single-stranded.

[0249] In this experiment, the ligation reaction was performed in solution using a 5:1 molar ratio of a three-pronged adapter to a library fragment. The final reaction volume of 15 μL contained the following reagents: ligase reaction buffer, 3 mM ATP, 6% glycerol, 6% 1,2-propanediol, 0.1 μM library fragment, 0.5 μM three-pronged adapter, 1 U / μL PNK, and 120 U / μL DNA ligase. The reaction was carried out at 15°C for 5 minutes, and the ligated product was analyzed and visualized by gel electrophoresis in a SYBR-stained 6% TBE-U gel. A representative gel is shown in Figure 24B, with unligated three-pronged adapters and library reference fragments flowing in lane 1, and the ligation reaction product flowing in lane 2. As can be seen from the figure, the ligated three-pronged adapter / library fragment product is clearly distinguishable from the unligated product. Notably, the band corresponding to the unligated library fragment is very faint in lane 2, indicating that the majority of the library fragment was converted to three-pronged adapter / library ligation.

[0250] Example 6 Mirror Image Library Construct - Three-way adapter and extension from exonuclease digestion for generating mirror image library constructs This embodiment describes the extension and digestion steps for generating a mirror-image library construct, which is simplified and shown in Figure 25A. In the extension step, the single-stranded top strand of the three-pronged adapter of the M1 construct is used as an extension primer by DNA polymerase, and a new strand of DNA is synthesized using the library fragment as a template. The extension of the M1 construct produces the M2 construct in the figure. Next, for the digestion step, the original template strand of M2 (shown in 5' notation) is removed by exonuclease treatment to produce the M3 construct. M3 contains two identical single-stranded copies of the library fragment "plus" strand and is called a "mirror-image library construct".

[0251] The elongation reaction was carried out using the following reagents. In Thermo Pol reaction buffer, 0.3 pmol of M1 ligation product, 0.2 mM dNTPs, and 0.4 U / μL of DNA polymerase (Vent® (exo-)). Based on the absence of exonuclease activity and strong strand displacement activity, Vent® (exo-) was selected as the DNA polymerase for the elongation reaction. The elongation reaction (total volume 5 μL) was subjected to an initial denaturation step at 95 °C for 2 minutes, followed by 25 cycles at 95 °C for 15 seconds and 72 °C for 6 seconds. After the denaturation / elongation cycle, the reaction was quenched, denatured, and run on a gel to visualize the elongation products.

[0252] For the digestion reaction, 0.3 pmol of the M2 elongation product was treated with lambda exonuclease (1 U / μL) in lambda exonuclease reaction buffer. After exo addition, the digestion reaction (total volume 10 μL) was carried out for 5 minutes. The digestion products were analyzed by gel electrophoresis as described above. The results of a representative experiment are shown in Figure 25B. Lane 1 of the gel shows the M1 reference product (0.2 pmol product / lane), and lanes 2 and 3 show the products of the elongation and digestion reactions respectively. The large band in lane 2 demonstrates the successful conversion of the M1 ligation product to the larger M2 elongation product, while the smaller band in lane 3 demonstrates the successful conversion of the M2 elongation product to the M3 digestion product.

[0253] Example 7 Solid-phase synthesis of the M1 mirror-image library construct This example describes a workflow for constructing the M1 construct on a solid support. The workflow is simplified and shown in Figure 26A. In the following experiment, the Y adapter ("YAD") was first covalently attached to the support using click chemistry. Then, the library fragment and the three-way adapter were ligated to the conjugated YAD to generate the M1 construct on the support. The M1 was finally released from the support by cleavage of the photosensitive bond between the YAD and the support.

[0254] A. Click ligation of YAD to the solid support

[0255] A commercially available continuous flow PCR chip made from Zeonor (cycloolefin thermoplastic polymer) was used as the solid support in this experiment. The assay was carried out as described in Example 1. The copper click reaction was performed as follows: 60 μL of catalyst mixture was prepared by mixing 3 mM THPTA, 6 mM sodium ascorbate, 1 mM CuSO4, 5 mM aminoguanidine, and 10% DMF. 120 μL of substrate mixture was prepared by mixing 10% DMF, 25 mM sodium phosphate, pH 7.0, a 50 mol E6 oligonucleotide arm of YAD (linked to the azide portion), 2.5 mM MgCl2, 5 mM aminoguanidine, and 6 mM sodium ascorbate. Next, 30 μL of the catalyst mixture was added to the substrate mixture, and 75 μL of this click mixture was added to the chip, followed by incubation at room temperature for 30 minutes.

[0256] B.M1 Structure Extension

[0257] After the click reaction, the tips were washed with water and solution "10002" (300 mM sodium phosphate, pH 8.0, 1% Tween-20, 0.5% SDS, and 1 mM EDTA). 50 μL of E52 YAD mixture (containing the second oligonucleotide arm of the Y adapter) was prepared by mixing 25 μL of solution "CHB002" (500 mM NH4OAc, 2% PEG8K, 1 M urea, and 5% NMS) with 100 pmol E52 oligonucleotide and applied to the tips. The tips were incubated at 30°C for 20 minutes to hybridize the E52 oligonucleotide to E6 oligonucleotide. The tips were then washed three times with 300 μL of CHB002.

[0258] To link the library fragment and the three-pronged adapter to the substrate-binding YAD, a 50 μL linkage reaction mixture was prepared by combining 15 pmol library insert (HIV2 60 mer), 50 pmol three-pronged adapter, 11 mM ATP, 1 U / μL T4 PNK, and a blunt-end / T4 ligase master mixture (available from NEB). The linked mixture was added to the chip and incubated at 16°C for 15 minutes. The linked mixture was then removed from the chip and 5 μL of 5'-deadenylase (50,000 U / mL) was added. The linked mixture was then returned to the chip and incubated at 16°C for 15 minutes. The chip was then washed twice with 300 μL of CHB002 and then with 300 μL of water. 300 μL of 10002 was added and the chip was incubated at 37°C for 5 minutes. The chip was then washed three times with 300 μL of CHB002 and then with 300 μL of water. All liquid was then removed from the chip and 75 μL of water was added.

[0259] To release the conjugated product from the chip, the photosensitive linkage of YAD to the chip was cleaved by exposing the chip to UV light for 15 minutes using a FireFly curing lamp. The released product was eluted from the chip, and 1% of the recovered material was analyzed by gel electrophoresis. A representative gel is shown in Figure 26B. The sample in lane 1 corresponds to 1% of the material recovered from the chip by photocleavage, while the samples in lanes 2-5 are control titrations of purified, uncleaved M1 synthesized in solution. As can be seen from the figure, the solid-state synthesis protocol successfully produces a completely collected M1 enantiomerized library product.

[0260] Example 8 Sequence determination by extending the mirroring library construct. This example demonstrates a proof of concept for enantiomer library sequencing by extension (SBX). The starting material in this experiment was the M1 product constructed around the HIV2 60mer library fragment described in Example 7. The extension conditions for generating the M2 product were as follows: approximately 7.5 pmol of M1 product, 0.2 mM dNTPs, and 0.16 U / μL Vent polymerase in Thermopol reaction buffer. 37.3 μL of the reaction mixture was incubated at 95°C for 2 minutes, followed by 25 cycles of 15 seconds at 95°C and 6 seconds at 72°C. The M2 digestion conditions for generating the M3 product were as follows: 36.68 μL of the extension reaction mixture was treated with 0.26 U / μL lambda exonuclease in lambda exo buffer. The reaction was carried out at 37°C for 5 minutes, followed by thermal inactivation to generate the M3 enantiomer library construct.

[0261] Xpandomer copies of the M3 product were synthesized by solid-state synthesis. As a first step, the M3 digest product was hybridized to a microfluidic chip, as shown in Figure 27. In this experiment, the chip was primed by click bonding of an E52 oligonucleotide designed to hybridize to the top arm of the M3 YAD. The E52 oligonucleotide provides a primer for synthesizing copies of the top chain of the M3 construct, as indicated by the arrows in Figure 27. To hybridize the M3 digest product to a chip and prepare a template for Xpandomer extension, 42.75 μL of the digest product was mixed with 10 pmol E6 oligonucleotide (designed to hybridize to the bottom chain arm of YAD and provide a primer for synthesizing a copy of the bottom chain of the M3 construct) and 10 pmol cap oligonucleotide (designed to hybridize to the M3 three-pronged adapter and provide free 5' triphosphate for end capping of each copy of the M3 library fragment). 50 μL of the hybridization reaction was incubated at 95°C for 15 seconds and then added to a chip warmed to 65°C. The chip was then cooled to 37°C and incubated for 5 minutes.

[0262] Figure 28 shows a representative gel representing samples from the mirror-image library workflow. Lanes 1-3 of the gel show reference samples of purified M1 products (0.5, 0.1, and 0.15 pmol of M1, respectively). Lane 4 represents 1.3% of the extension reaction producing the M2 product, and lane 5 represents 1.2% of the digestion reaction producing the M3 product. Lane 6 shows the hive This represents 5% of the M3 material retained on the chip after redylation. Importantly, despite the presence of secondary products during the digestion reaction, only the complete M3 product was retained on the chip.

[0263] For sequencing by propagation, all steps of Xpandomer synthesis and processing were performed on a microfluidic chip. The Xpandomer extension conditions were as follows: 6% NMP, AZ in a 1:4 molar ratio, 8-8 to AZ, 43-43 PEM, 0.25 M urea, 0.5 M betaine, 80 μM XNTP, 10 μg SSB, and C4760 polymerase were incubated at 42°C for 30 minutes. After extension, the chip was washed. Xpandomer was then cleaved by treating the chip with 200 μL of 7.5 M DCl at 23°C for 30 minutes. The chip was then neutralized and washed. Xpandomer was then modified by adding 300 μL of 125 mM succinic anhydride and incubating at 23°C for 5 minutes. After washing, Xpandomer was photocut from the chip (UV treatment for 15 seconds) and eluted with 100 μL of a solution containing 100 μM NaPO4, 15% ACN, and 5% DMSO. Nanopore sequencing of the Xpandomer product was performed as described in Example 2. A representative nanopore trace from this sample is shown in Figure 29. The trace shows portions of two identical sequence reads, “Read 1” and “Read 2”, which reflect the sequence of the HIV2 library fragment (SEQ ID NO: 16). The reads are separated by a signal generated by a cap oligo structure, which is referred to as “Mirror” in the figure.

[0264] Example 9 Solid-state Xpandomer synthesis using end capping on acid-resistant magnetic beads This example demonstrates that solid-state synthesis of Xpandomer on beads is at least as efficient as synthesis in solution. Four different Xpandomer synthesis reactions were performed: 1) synthesis in solution (fluorescent SIMA dye on extended oligonucleotide); 2) synthesis on beads without end capping (dye on extended oligonucleotide); 3) on-bead synthesis with end capping (dye on end-capped oligonucleotide); 4) on-bead synthesis using blocker oligonucleotide instead of end capping. The extended oligonucleotide used in this experiment had the following sequence: 5'[azide]D 10 [PC Spacer] L25 Z6[TCATAAGACGAACGGA(SEQ ID NO: 4)]3', (wherein "PC" represents a photocleavable spacer; "D" represents a PEG6 spacer; "L" represents a C2 spacer; "Z" represents a C12 spacer). As discussed herein and with reference to Figure 5, the beads were functionalized with alkyne groups and covalently bonded to the elongated oligonucleotide. 4 pmol of on-bead elongated oligonucleotides were hybridized to 4 pmol of 100-mer template DNA+ / - terminal cap oligonucleotides. The terminal caps in reaction 3 had the following sequence: 3' ddCTPRK[GCGTTAGGTCCCAGTTTTAC(SEQ ID NO: 17)]W 5' and the blocker oligonucleotides in reaction 4 had the following sequences: 3'RK[GCGTTAGGTCCCAGTGTTTTAC(SEQ ID NO: 18)]×5', where "R" represents amidite, "K" represents G-clamp, "W" represents SIMA dye, and "X" represents PEG3. A 2x molar excess of cap or blocker oligo was used relative to the template DNA. All extension reactions included: 50 mM Tris-HCl, 200 mM NH4OAc, 20% PEG, 1 M urea (0.25 M for reaction 4), 5% NMS, 10 mM PEM, 0.26 μg / ul DPO4 polymerase variant, 1.6 mM MnCl2, 100 μM dXTP, and 300 μM polyphosphate. Reactions 3 and 4 also included 0.02% Tween, and reaction 4 also included 0.5 M betaine. The extension reaction was carried out at 37°C for 60 minutes, and the extension product was analyzed by gel electrophoresis as shown in Figure 30. As can be seen from the figure, on-bead extension (lane 2) is as efficient as extension in solution (lane 1). Furthermore, end-capping on beads (lane 3, dye on end caps) is also very efficient.

[0265] Example 10 Synthesis and processing of solid Xpandomer on acid-resistant magnetic beads This example demonstrates the efficient on-bead synthesis and processing of Xpandomer. After the primer extension reaction, the Xpandomer product was treated with acid to cleave the phosphoramide bond and generate an expanded polymer. The expanded product was released from the beads by photocleavage and analyzed by gel electrophoresis.

[0266] Bead functionalization and elongation oligonucleotide linkage were carried out as described in Example 9. Template DNA was hybridized to elongation oligonucleotides in a 1:1 molar ratio (4 pmol each). The elongation reaction consisted of: 50 mM Tris-HCl, 200 mM NH4OAc, 50 mM TMACl, 50 mM GuCl, 20% PEG, 0.1 M urea, 6% NMP, 15 mM PEM, 0.26 μg / µl DPO4 polymerase variant, 1.4 mM MnCl2, 100 μM dXTP, 0.05 μg / µl Kod single-strand binding protein, 0.02% SDS, and 300 μM polyphosphate. The elongation reaction was carried out at 37°C for 60 minutes. Next, the sample was washed with buffer B (100 mM HEPES, 100 mM NaHPO4, 5% Triton, and 15% DMF), treated with proteinase K at 55°C for 5 minutes, and washed again with buffer B. As shown in Figure 31, the sample was acid-cleaved with 7.5 M DCl / 1% Triton, neutralized with buffer B, and modified with succinic anhydride in buffer B. The sample was then washed with buffer E (40% ACN), followed by photocleavage (1' exposure to UV light), the released Xpandomer product was recovered, and analyzed by gel electrophoresis. Lane 1 represents the Xpandomer product synthesized and processed in solution, and lanes 2-4 represent the Xpandomer product synthesized and processed on acid-resistant magnetic beads containing different additives in the elution buffers (100 mM PI in lane 2; 100 mM GuHCl in lane 3; 100 mM HEPES in lane 4). As can be observed, the on-beads workflow shows improved results compared to the in-solution workflow, as the Xpandomer band is denser, indicating that the sample is concentrated for the full-length product.

[0267] All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent publications mentioned herein and / or listed in the application data sheets, including but not limited to U.S. Provisional Patent Application No. 62 / 808,768 filed on 21 February 2019 and U.S. Provisional Patent Application No. 62 / 826,805 filed on 29 March 2019, are incorporated herein by reference in their entirety. Such documents may be incorporated by reference, for example, for the purpose of explaining and disclosing materials and methodologies described in publications that may be used in connection with the inventions described herein.

Claims

1. A method for synthesizing copies of nucleic acid templates on a solid support, (a) A step of immobilizing a linker on the solid support, wherein the linker includes a first end proximal to the solid support and a second end distal to the solid support, the first end being bonded to a maleimide portion and the second end being bonded to an alkyne portion, and the maleimide portion being crosslinked to the solid support, (b) A step of binding an oligonucleotide primer to the linker, wherein the oligonucleotide primer contains a nucleic acid sequence complementary to a portion of the 3' end of the nucleic acid template, the 5' end of the oligonucleotide primer is coupled to the azide portion, and the azide portion reacts with the alkyne portion to form a triazole portion; (c) A step of providing a reaction mixture comprising a nucleic acid template, a nucleic acid polymerase, a nucleotide substrate, and a suitable buffer, wherein the nucleic acid template specifically hybridizes with the oligonucleotide primer. (d) A step of performing a primer extension reaction to generate a copy of the nucleic acid template, The nucleic acid template is a DNA template, a copy of the DNA template is an expandable polymer, the expandable polymer comprises a chain of non-natural nucleotide analogs, each of which is operably linked to an adjacent non-natural nucleotide analog by a phosphoramide ester bond, and the expandable polymer is an Xpandomer. The nucleotide substrate in (c) is XNTP, and the XNTP has a nucleic acid base 5'-triphosphoramide and a tethering chain that is attached to each nucleoside triphosphoramide at a position that allows for controlled expansion by cleavage of the phosphoramide bond, The solid support is composed of a polyolefin, and the polyolefin is a cyclic olefin copolymer (COC). The aforementioned method.

2. The method according to claim 1, wherein the reaction mixture in (c) further comprises one or more additives.

3. The maleimide portion is crosslinked to the solid support by a photoinitiated proton abstraction reaction. The method according to claim 1 or 2.

4. The method according to any one of claims 1 to 3, wherein the linker further includes a spacer arm interposed between the first end and the second end, and the spacer arm comprises one or more monomers of ethylene glycol.

5. The method according to any one of claims 1 to 4, wherein the linker further includes a severable portion.

6. The method according to any one of claims 1 to 5, wherein the solid support is selected from the group consisting of beads, tubes, capillaries, and microfluidic chips.

Images