Application of cannabidiol in the treatment of coronavirus infection

By using pharmaceutical compositions prepared with cannabidiol, the lack of effective drugs against coronaviruses, especially SARS-CoV-2, has been solved, enabling effective prevention and treatment of diseases such as COVID-19.

JP7893800B2Active Publication Date: 2026-07-22ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
ACADEMY OF MILITARY MEDICAL SCIENCES
Filing Date
2021-07-19
Publication Date
2026-07-22

AI Technical Summary

Technical Problem

Currently, there are no effective antiviral drugs to combat coronaviruses, especially COVID-19 caused by SARS-CoV-2. Existing treatments mainly rely on supportive care, and there is a lack of specific antiviral drugs.

Method used

Cannabidiol and its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates are used to prepare pharmaceutical compositions for the prevention and treatment of diseases caused by coronaviruses, including SARS-CoV-2, by inhibiting viral nucleic acid load and blocking viral replication.

Benefits of technology

Cannabidiol has shown a significant reduction in viral nucleic acid load of SARS-CoV-2, exhibiting highly efficient ability to inhibit viral replication. It is suitable for treating diseases caused by various coronaviruses, including COVID-19, and has a good safety profile.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007893800000018
    Figure 0007893800000018
  • Figure 0007893800000001
    Figure 0007893800000001
  • Figure 0007893800000002
    Figure 0007893800000002
Patent Text Reader

Abstract

The present application relates to the use of cannabidiol in the preparation of a medicament for the treatment of coronavirus infection. In particular, the present invention relates to the use of cannabidiol, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition comprising any one or more of the above ingredients, in the preparation of a medicament for the prevention and / or treatment of a disease or infection caused by a coronavirus.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application is based on and claims priority to China Patent Application No. 202010722697.9, filed on 24 July 2020. The disclosures of this China Patent Application are incorporated in their entirety into this application.

[0002] This application relates to the field of chemicals, and more particularly to the use of cannabidiol (whose structure is shown in formula I), or its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates, or pharmaceutical compositions thereof, in the manufacture of pharmaceuticals for the treatment of diseases or infections caused by coronaviruses, particularly SARS-CoV-2. [Background technology]

[0003] Coronaviruses are enveloped, unsegmented, single-stranded positive-sense RNA viruses with a broad range of animal hosts. Coronaviruses, such as SARS and MERS, which originate from infectious diseases in animals, can cause death in humans. On February 11, 2020, the International Committee on Taxonomy of Viruses (ICTV) announced a new coronavirus, Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). Currently, treatment for COVID-19 is primarily supportive care in clinics, and there are no specific antiviral drugs available yet.

[0004] Cannabidiol (compound of formula I), with the chemical name (-)-2-[(3R,4R)-p-menta-1,8-dien-3β-yl]-5-pentylresorcinol, is a cannabinoid compound with various biological activities. This drug has a significant therapeutic effect on epilepsy, and an antiepileptic drug containing cannabidiol as its active ingredient (Epidiolex) is marketed in the United States.

[0005] Cannabidiol, first isolated from marijuana in 1940, is a non-psychoactive compound that does not induce hallucinations or cause physical dependence. In recent years, cannabidiol has attracted increasing attention from the international community due to its wide range of biological effects. Cannabidiol possesses various pharmacological activities and has certain therapeutic effects on neurological disorders, including anxiety, schizophrenia, addiction, and neurodegenerative diseases. Furthermore, cannabidiol has pharmacological activities such as anticonvulsant, anticonvulsant, antitumor, antiemetic, antidiabetic, and hepatoprotective properties. Drugs, cosmetics, healthcare products, and other products containing cannabidiol as the main active ingredient are marketed overseas, indicating a wide range of potential applications.

[0006] Currently, there is insufficient research on the antiviral activity of cannabidiol and its role in treating viral diseases. [Overview of the project]

[0007] One object of this application is to provide a pharmaceutical agent having inhibitory activity against the coronavirus, particularly SARS-CoV-2, for the treatment of diseases or infections caused by the coronavirus, such as simple infections (e.g., fever, cough, and pharyngitis), pneumonia, acute or severe acute respiratory infections, hypoxic respiratory failure, acute respiratory distress syndrome, sepsis, or septic shock. Studies have shown that cannabidiol can significantly reduce the viral nucleic acid load in cells infected with SARS-CoV-2 and has the function of inhibiting SARS-CoV-2 replication. In some experiments, cannabidiol, at a concentration of 0.62 μM EC2, was effective against SARS-CoV-2 in Vero E6 cells. 50 , 4.10 μM CC 50 It has an SI of 6.61, which indicates that cannabidiol is highly beneficial in treating diseases or infections caused by SARS-CoV-2.

[0008] Accordingly, in a first aspect, the present application provides the use of a compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, a solvate or hydrate thereof, or a pharmaceutical composition comprising any one or more of the above components, in the manufacture of a pharmaceutical for the prevention and / or treatment of a disease or infection caused by coronavirus. [ka]

[0009] In a second aspect, the present application provides a pharmaceutical composition comprising a compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, a solvate or hydrate thereof, or one or more of the above components, for use in the prevention and / or treatment of diseases or infections caused by coronavirus. [ka]

[0010] In a third aspect, the present application provides a method for preventing and / or treating a disease or infection caused by coronavirus, comprising the step of administering to a subject in need a pharmaceutical composition comprising an effective amount of a compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, a solvate or hydrate thereof, or one or more of the above components. [ka]

[0011] In a fourth aspect, the application provides the use of a compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition comprising one or more of the above components, in the manufacture of a pharmaceutical for the prevention and / or treatment of respiratory diseases. [ka]

[0012] In a fifth aspect, the present application provides a compound of formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition comprising any one or more of the above components, for use in a medicament for the prevention and / or treatment of respiratory diseases.

Chem.

[0013] In a sixth aspect, the present application provides a method for preventing and / or treating a respiratory disease, the method comprising administering to a subject in need thereof an effective amount of a compound of formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition comprising any one or more of the above components.

Chem.

[0014] In a seventh aspect, the present application provides the use of a compound of formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition comprising any one or more of the above components, in the manufacture of a coronavirus inhibitor.

Chem.

[0015] In an eighth aspect, the present application provides a compound of formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition comprising any one or more of the above components, for use in inhibiting a coronavirus.

Chem.

[0016] In a ninth aspect, the present application provides a method for inhibiting coronavirus, comprising the step of administering to a cell or subject in need thereof an effective amount of a compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, a solvate or hydrate thereof, or a pharmaceutical composition comprising one or more of the above components. [ka]

[0017] In a tenth aspect, the application provides the use of a compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, a solvate or hydrate thereof, or a pharmaceutical composition comprising one or more of the above components, in the manufacture of a pharmacopoeia for inhibiting the replication and / or regeneration of coronavirus in cells. [ka]

[0018] In an eleventh aspect, the present application provides a pharmaceutical composition comprising a compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, a solvate or hydrate thereof, or one or more of the above components, for use in inhibiting the replication and / or regeneration of coronavirus in cells. [ka]

[0019] In a twelfth aspect, the present application provides a method for inhibiting the replication and / or regeneration of coronavirus in cells, comprising the step of contacting the cells with an effective amount of a compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, a solvate or hydrate thereof, or a pharmaceutical composition comprising one or more of the above components. [ka] [Brief explanation of the drawing]

[0020] The description of the drawings herein is provided to further illustrate the invention and constitutes part of this application. Exemplary embodiments and descriptions are intended to illustrate the invention and should not be construed as any inappropriate limitation to the invention. In the drawings, [Figure 1] This figure shows the effect of cannabidiol on viral nucleic acid loading on SARS-CoV-2 infected Vero E6 cells. Cannabidiol was able to inhibit viral RNA loading on cells 48 hours after infection with SARS-CoV-2, and the inhibitory activity was dose-dependent. Here, the left vertical axis represents % inhibition calculated based on the copy number of viral RNA in the sample (corresponding to the dots and their fitted lines in the figure), the right vertical axis represents % toxicity calculated based on cell viability (corresponding to the squares and their fitted lines in the figure), and the horizontal axis represents drug concentration. [Modes for carrying out the invention]

[0021] Clinical studies have shown that the main symptom of SARS-CoV-2 infection is pneumonia, which can be classified into simple infection, mild pneumonia, severe pneumonia, acute respiratory distress syndrome, sepsis, and septic shock, depending on the severity of the disease. Patients with simple infection may have nonspecific symptoms such as fever, cough, pharyngitis, nasal congestion, fatigue, headache, muscle pain, or discomfort, and elderly and immunocompromised individuals may experience atypical symptoms. The main symptoms of mild pneumonia are cough, dyspnea, and shortness of breath. Severe pneumonia is seen in adolescents, adults, or children, and the main symptoms are increased respiratory rate, severe respiratory failure or dyspnea, central cyanosis, lethargy, confusion, or seizures and gasping. Lung imaging in acute respiratory distress syndrome mainly shows bilateral ground-glass opacities that cannot be fully explained by pulmonary edema, effusion, lobar exudation, atelectasis, or lung mass. Patients with sepsis often have fatal organ failure, and septic shock is the most dangerous condition, with a high probability of death.

[0022] In some embodiments, the disease or infection of any aspect described herein is a respiratory disease or infection.

[0023] In some embodiments, the disease or infection in any embodiment described herein is a simple infection, pneumonia, acute or severe acute respiratory infection, hypoxic respiratory failure, acute respiratory distress syndrome, sepsis, septic shock, or severe acute respiratory syndrome (SARS). In some embodiments, a simple infection is a fever, cough, or pharyngitis, etc.

[0024] In some embodiments, the disease or infection of any embodiment described herein is selected from the group consisting of simple infections, pneumonia, acute or severe acute respiratory infections, hypoxic respiratory failure, acute respiratory distress syndrome, sepsis, septic shock, and severe acute respiratory syndrome. In some embodiments, simple infections include fever, cough, or pharyngitis.

[0025] In some embodiments, the disease or infection of any aspect as described herein is COVID-19.

[0026] In some embodiments, the cells of any aspect described herein are mammalian cells. In some embodiments, the mammal is selected from the group consisting of cattle, horses, sheep, pigs, dogs, cats, rodents, and primates. In some embodiments, the mammal is human, cat, pig, or dog. In some embodiments, the mammal is human.

[0027] In some embodiments, the coronavirus of any embodiment described herein is selected from the group consisting of HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV, and SARS-CoV-2.

[0028] In some embodiments, the coronavirus in any embodiment described herein is SARS-CoV-2.

[0029] In some embodiments, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates in the pharmaceutical composition is the sole active pharmaceutical ingredient.

[0030] In some embodiments, the pharmaceutical composition further comprises additional antiviral active ingredients.

[0031] In some embodiments, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates, or pharmaceutical compositions thereof, are administered in combination with additional antiviral active ingredients. In some embodiments, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates, are present within the same formulation unit as the additional antiviral active ingredient.

[0032] In some embodiments, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates, and additional antiviral active ingredients are present within different formulation units.

[0033] In some embodiments, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates, is administered individually or sequentially, simultaneously with additional antiviral active ingredients.

[0034] In some embodiments, the additional antiviral active ingredient is one or more selected from the group consisting of amantadine, rimantadine, enfuvirtide, maraviroc, acyclovir, ganciclovir, valacyclovir, famciclovir, foscarnet sodium, lamivudine, zidovudine, emtricitabine, tenofovir, adefovir dipivoxil, efavirenz, nevirapine, saquinavir, oseltamivir, zanamivir, ribavirin, and interferon.

[0035] In some embodiments, the pharmaceutical composition may further include pharmaceutically acceptable carriers or excipients. A carrier refers to a substance used to improve the selectivity, efficacy, and / or safety of a drug during delivery. Carriers are primarily used to control drug release and can also be used to improve the pharmacokinetic properties of a drug, particularly its bioavailability. Excipients refer to substances other than the active ingredient in a pharmaceutical formulation and are primarily used for long-term stability, filling solid preparations (and thus often used to refer specifically to "fillers"), or enhancing the efficacy of a product (e.g., promoting absorption, reducing viscosity, or increasing solubility). Depending on the route of administration or form of administration, those skilled in the art can select suitable carriers and excipients based on known theory and experience.

[0036] The pharmaceutical compositions described herein can be prepared in various forms according to different routes of administration.

[0037] According to the present invention, the pharmaceutical composition can be administered by any of the following methods: oral administration, spray inhalation, rectal administration, nasal administration, oral administration, vaginal administration, topical administration, parenteral administration (e.g., subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal, and intracranial injection or infusion), or via an explanted reservoir. Of these, oral, intraperitoneal, or intravenous administration is preferred.

[0038] For oral administration, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates, can be made into any orally acceptable preparation, including but not limited to tablets, capsules, aqueous solutions, or suspensions. Common carriers for tablets include lactose and corn starch, and lubricants such as magnesium stearate may be added. Common diluents for capsule preparations include lactose and dried corn starch. Aqueous suspensions are usually prepared by mixing the active ingredient with suitable emulsifiers and suspending agents. Additionally, several sweeteners, flavorings, or colorants may be added to the oral preparations as needed.

[0039] For rectal administration, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates, can generally be prepared in the form of suppositories by mixing the drug with a suitable non-irritating excipient. The excipient is solid at room temperature but melts at rectal temperature to release the drug. Examples of such excipients include cocoa butter, beeswax, and polyethylene glycol.

[0040] In the case of topical administration, particularly when treating affected surfaces or organs that are easily accessible by topical administration, such as diseases of the eyes, skin, or lower enteric nervous system, the compound of Formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates, may be used to prepare different topical preparations depending on the affected surface or organ. Specific instructions are as follows:

[0041] For topical administration to the eye, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates, can be formulated in the form of a finely powdered suspension or solution. The carrier used is an isotonic sterile physiological saline solution of a specific pH, which may or may not contain preservatives such as benzyl alkoxide chloride. Furthermore, for ophthalmic use, the compound can be formulated in the form of an ointment such as petrolatum ointment.

[0042] For topical administration to the skin, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates, can be made into suitable ointments, lotions, or creams in which the active ingredient is suspended or dissolved in one or more carriers. Carriers that can be used in ointments include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax, and water. Carriers that can be used in lotions or creams include, but are not limited to, mineral oil, sorbitan monostearate, Tween® 60, cetyl ester wax, cetenylaryl alcohol, 2-octyldodecanol, benzyl alcohol, and water.

[0043] For local administration to the lower intestinal tract, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates can be used in a preferred form of the rectal suppository preparation or enema preparation described above. Furthermore, a topical transdermal patch may also be used.

[0044] Compounds of formula I, or their geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates, may also be administered in the form of sterile aqueous or oil suspensions for injection, or sterile injection preparations containing sterile injection solutions. Among these, usable carriers and solvents are water, Ringer's solution, and isotonic sodium chloride solution. Furthermore, sterile non-volatile oils such as monoglycerides or diglycerides may also be used as solvents or suspension media.

[0045] Any one of the above dosage forms of the pharmaceutical product can be prepared according to conventional methods in the pharmaceutical field.

[0046] In some embodiments, the pharmaceutical composition is a solid preparation or a liquid preparation. In some embodiments, the pharmaceutical composition is a tablet, an injection, or a spray. In some embodiments, the pharmaceutical composition is an injection.

[0047] In this application, unless otherwise indicated, the scientific and technical terms used herein have meanings that are generally understood by those skilled in the art. Furthermore, the experimental procedures for cell culture, molecular genetics, nucleic acid chemistry, and immunology used herein are all conventional and widely used in their respective fields. On the other hand, to better understand the present invention, definitions and explanations of relevant terms are provided below.

[0048] As used herein, the term “pharmaceutically acceptable salt” includes inorganic or organic acid salts, and inorganic or organic base salts, such as sodium salts, potassium salts, calcium salts, lithium salts, meglumine salts, hydrochloride salts, hydrobromide salts, hydroiodide salts, nitrates, sulfates, phosphates, hydrogen phosphates, acetates, propionates, butyrates, oxalates, trimethyl acetate, adipates, alginates, lactates, citrates, tartrates, succinates, maleates, fumarates, picrates, aspartates, glucons, benzoates, methanesulfonates, ethanesulfonates, benzenesulfonates, p-toluenesulfonates, or pamoates.

[0049] As used herein, the term “geometric isomer” refers to stereoisomers resulting from different spatial arrangements in molecules having a double bond or ring structure, such as cis / trans isomers, due to an obstruction of the free rotation of atoms or groups of atoms connected to the double bond or ring.

[0050] The compounds of formula I in this disclosure may exist in the form of solvates (preferably hydrates) and may contain a polar solvent, particularly water, methanol, or ethanol, as structural elements of the lattice. The amount of polar solvent may be stoichiometric or non-stoichiometric. Solvates of the compounds of formula I used for the treatment of diseases or infections as defined in this application may have different properties (including pharmacokinetic properties), but since the compound of formula I is obtained when absorbed by the subject, the use of the compounds of formula I includes the use of any solvate of the compound of formula I.

[0051] In this application, the formal classification name for the term "2019 novel coronavirus (2019-nCoV)" is Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2).

[0052] In this application, the term "disease caused by the novel coronavirus (2019-nCoV)" is formally referred to as COVID-19.

[0053] In this application, the terms “therapeutic dose” or “preventive dose” refer to a dose that is sufficient to treat or prevent a patient’s disease, but low enough to avoid serious side effects (a reasonable benefit-to-risk ratio), within the bounds of reasonable medical judgment. The therapeutic dose of a compound may vary based on factors including (for example, considering the potency, effectiveness and half-life of the compound) the specific compound selected, the selected route of administration, the disease being treated, the severity of the disease being treated, the age, build, weight and medical conditions of the patient being treated, the patient’s medical history, the duration of treatment, the nature of the combination therapy, and the desired therapeutic effect, but can still be conventionally determined by those skilled in the art.

[0054] Furthermore, it should be noted that the specific dosage and route of administration of the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates, are determined by many factors, including the patient's age, weight, sex, health status, nutritional status, drug potency, timing of administration, metabolic rate, severity of the disease, and the physician's subjective judgment. The preferred dose is 0.001 to 1000 mg / kg body weight / day.

[0055] A specific model for implementing the invention The technical solutions of embodiments of the present invention are described more clearly and completely in the following examples and drawings. Obviously, these are only some examples, not all. At least one of the following examples is for illustrative purposes only and should not be understood as any limitation to the present invention, or its applications and uses. Furthermore, all other embodiments made by those skilled in the art without creative work in light of the present invention are also included within the scope of protection of the present invention. [Examples]

[0056] Example 1: Experiment on the reduction of viral nucleic acid load in SARS-CoV-2 infected cells using cannabidiol. (1) Drug treatment of virus-infected cells Vero E6 cells (purchased from ATCC, catalog number 1586) were placed in a 24-well plate and incubated for 24 hours before viral infection. Specifically, SARS-CoV-2 (2019-nCoV) virus (nCoV-2019BetaCoV / Wuhan / WIV04 / 2019 strain, provided by the Wuhan Institute of Virology, Chinese Academy of Sciences) was diluted to the corresponding concentration in a 2% cell maintenance solution (formulated by adding FBS (purchased from Gibco, catalog number 16000044) to MEM (purchased from Gibco, product number: 10370021) in a 2% volume ratio, thereby obtaining a 2% cell maintenance solution), and then each well was filled with 100 TCID. 50 The viral load was added to 24-well plates. Next, cannabidiol (purchased from Selleck Chemicals, product number: S7975) was diluted to the corresponding concentration in 2% cell maintenance solution and added to the corresponding wells so that the final drug concentrations were 100 μM, 33 μM, 11 μM, 3.7 μM, 1.23 μM, 0.41 μM, and 0.14 μM, respectively. The plates were then placed in a 37°C, 5% CO2 incubator and incubated continuously for 48 hours. The cell vehicle control group contained no test drugs and was only supplied with 2% cell maintenance solution.

[0057] (2) RNA extraction The RNA extraction kit was purchased from Qiagen (product number: 74106). All consumables (spin column, RNase-free 2ml collection tube, etc.) and reagents (RLT, RW1, RPE, RNase-free water, etc.) involved in the following RNA extraction steps were included in the kit. The following extraction procedure followed the instructions provided in the kit. 1) 100 μL of supernatant was collected from the test plate, added to a nuclease-free EP tube, 350 μL of Buffer RLT was added, and the mixture was completely dissolved using a transfer liquid gun. The supernatant was then collected after centrifugation. 2) An equal volume of 70% ethanol was added to the supernatant obtained in step 1) and mixed thoroughly. 3) The mixed solution obtained in step 2) was transferred to an RNase-free spin column, centrifuged at 12000 rpm for 15 seconds, and the waste liquid was discarded. 4) 700 μL of Buffer RW1 was added to the spin column, and the spin column was washed by centrifugation at 12000 rpm for 15 seconds, after which the waste liquid was discarded. 5) 500 μL of Buffer RPE was added to the spin column, and the spin column was washed by centrifugation at 12000 rpm for 15 seconds, after which the waste liquid was discarded. 6) 500 μL of Buffer RPE was added to the spin column, and the spin column was washed by centrifugation at 12000 rpm for 2 minutes, after which the waste liquid was discarded. 7) Place the spin column into a new RNase-free 2 ml collection tube, centrifuge at 12000 rpm for 1 minute to dry the spin column, and then transfer the entire spin column to the 1.5 ml collection tube from step 8). 8) The spin column dried in step 7) was placed in a new 1.5 ml collection tube, 30 μl of RNase-free water was added, and the column was centrifuged at 12000 rpm for 2 minutes. The resulting eluent contained the corresponding RNA, to which an RNase inhibitor (purchased from NEB, product number: M0314L) was added, and the concentration of each RNA was determined by detection using Nano Drop (purchased from Thermo Scientific, Nano Drop One).

[0058] (3) RNA reverse transcription In the experiment, a reverse transcription kit from TaKaRa Company (PrimeScript® RT reagent kit with gDNA Eraser, catalog number RR047Q) was used for RNA reverse transcription. The steps were as follows: 1) Removal of gDNA: RNA samples were collected from each experimental group, and 1 μg was taken from each sample for reverse transcription. First, 2 μl of 5× gDNA Eraser Buffer was added to the RNA sample from each experimental group, RNase-free water was added to the reaction system up to 10 μl, and the mixture was thoroughly mixed. The system was then subjected to a 42°C water bath for 2 minutes to remove any gDNA that may be present in the sample. 2) Reverse transcription: An appropriate amount of enzyme, primer mix, and reaction buffer were added to the sample obtained in 1), and RNase-free water was added to a volume of 20 μl. The mixture was reacted in a 37°C water bath for 15 minutes, and then placed in an 85°C water bath for 5 seconds to obtain cDNA via transcription.

[0059] (4) Real-time PCR Fluorescence quantitative PCR was used to detect the copy number per 1 ml of the original virus solution.

[0060] The reaction system was mixed using TB Green Premix (Takara, catalog number RR820A), and amplification and reading were performed using a StepOne Plus real-time PCR instrument (brand: ABI). The number of copies contained per 1 ml of the original virus solution was calculated. The steps were as follows: 1) Establishment of standards: Plasmid pMT-RBD (the plasmid was provided by the Wuhan Institute of Virology, Chinese Academy of Sciences) was diluted to 5×10 8 copies / μL, 5×10 7 copies / μL, 5×10 6 copies / μL, 5×10 5 copies / μL, 5×10 4 copies / μL, 5×10 3 copies / μL, 5×10 2 copies / μL. For the qPCR reaction, 2 μL of the standard or cDNA template was taken. 2) The sequences of the primers used in the experiment were as follows (all shown in the 5'-3' direction): RBD-qF: CAATGGTTTAACAGGCACAGG RBD-qR: CTCAAGTGTCTGTGGATCACG 3) The reaction procedure was as follows: Pre-denaturation: 95°C for 5 minutes. Cycle parameters: 95°C for 15 seconds, 54°C for 15 seconds, 72°C for 30 seconds, a total of 40 cycles.

[0061] (5) Cytotoxicity test of drugs The detection of drug cytotoxicity was performed using a CCK-8 kit (Beoytime). The specific steps were as follows. 1) 1×10 4 Vero E6 (ATCC) cells were seeded into a 96-well plate and incubated at 37°C for 8 hours. 2) The drug was diluted with DMSO to the appropriate mother liquor concentration, and then diluted again with MEM medium (purchased from Gibco, catalog number 10370021) containing 2% FBS (purchased from Gibco, catalog number 16000044) to the same concentration as the drug treatment. The original medium in the 96-well plate was discarded, and 100 μL of drug-containing MEM medium was added to the cells, creating three replication wells for each concentration. Negative controls (vehicle group, DMSO and medium added to cell wells without drug) and blank controls (DMSO and medium added to wells without cells) were established. After drug addition, cells were cultured at 37°C for 48 hours. 3) 20 μL of CCK-8 solution (Beoytime) was added to the test well, gently mixed without generating bubbles, and incubated continuously at 37°C for 2 hours. OD 450 The data was read using a microplate reader (purchased from Molecular Devices, model: SpectraMax M5), and cell viability was calculated: Cell activity (%)=(A (薬物処置群) -A (ブランク対照) ) / (A (ビヒクル対照) -A (ブランク対照) ) × 100% In the formula, A is the reading from the microplate reader.

[0062] (6) Experimental results The results of the viral replication inhibition experiments showed that the test compounds at concentrations of 10 μM, 3.3 μM, 1.1 μM, and 0.37 μM effectively inhibited the replication of the SARS-CoV-2 viral genome in the infected supernatant (Table 1 and Figure 1).

[0063] [Table 1]

[0064] The cytotoxicity results showed that treatment with the test compound (cannabidiol) did not alter cell viability at concentrations of 1.56 μM and 0.78 μM, indicating that the test compound was not toxic to cells at any concentration (Table 2 and Figure 1).

[0065] [Table 2]

[0066] In addition to what is described herein, various modifications of the invention will be apparent to those skilled in the art based on the foregoing description. Such modifications also fall within the scope of the appended claims. All references cited herein (including all patents, patent applications, journal articles, books, and other publications) are incorporated herein by reference in their entirety.

Claims

1. Use of a compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates, or a pharmaceutical composition containing one or more of the above components, in the manufacture of a pharmacopoeia for inhibiting the replication and / or regeneration of SARS-CoV-2 in a subject. 【Chemistry 1】

2. The use according to claim 1, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient.

3. The use according to claim 1 or 2, wherein the pharmaceutical product is a solid preparation or a liquid preparation.

4. The use according to claim 3, wherein the pharmaceutical product is a tablet, an injection, or a spray.

5. The use according to any one of claims 1 to 4, wherein the compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, solvate, or hydrate thereof, is used as the sole pharmaceutically active ingredient in the pharmaceutical composition, or the pharmaceutical composition further comprises additional antiviral active ingredients.

6. The use according to claim 5, wherein the compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, solvate or hydrate thereof, or the pharmaceutical composition is administered in combination with the additional antiviral active ingredient by simultaneous, individual, or sequential administration.

7. The use according to claim 5 or 6, wherein the additional antiviral active ingredient is one or more selected from the group consisting of amantadine, rimantadine, enfuvirtide, maraviroc, acyclovir, ganciclovir, valacyclovir, famciclovir, foscarnet sodium, lamivudine, zidovudine, emtricitabine, tenofovir, adefovir dipivoxil, efavirenz, nevirapine, saquinavir, oseltamivir, zanamivir, ribavirin, and interferon.

8. A pharmaceutical composition for inhibiting the replication and / or regeneration of SARS-CoV-2 in a target, comprising a compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, solvate, or hydrate. 【Chemistry 2】

9. The pharmaceutical composition according to claim 8, further comprising a pharmaceutically acceptable carrier or excipient.

10. The pharmaceutical composition according to claim 8 or 9, wherein the pharmaceutical composition is a solid preparation or a liquid preparation.

11. The pharmaceutical composition according to claim 10, wherein the pharmaceutical composition is a tablet, an injection, or a spray.

12. The pharmaceutical composition according to any one of claims 8 to 11, wherein the compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, a solvate, or a hydrate thereof, is used as the sole pharmaceutically active ingredient in the pharmaceutical composition, or the pharmaceutical composition further comprises additional antiviral active ingredients.

13. The pharmaceutical composition according to claim 12, wherein the compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, solvate or hydrate thereof, or the pharmaceutical composition is administered simultaneously, individually or sequentially in combination with the additional antiviral active ingredient.

14. The pharmaceutical composition according to claim 12 or 13, wherein the additional antiviral active ingredient is one or more selected from the group consisting of amantadine, rimantadine, enfuvirtide, maraviroc, acyclovir, ganciclovir, valacyclovir, famciclovir, foscarnet sodium, lamivudine, zidovudine, emtricitabine, tenofovir, adefovir dipivoxil, efavirenz, nevirapine, saquinavir, oseltamivir, zanamivir, ribavirin, and interferon.

15. A non-therapeutic method for inhibiting the replication and / or regeneration of SARS-CoV-2 in vitro, comprising the step of contacting cells with a compound of formula I, or a geometric isomer thereof, a pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition comprising one or more of the said components. 【Transformation 3】

16. The method according to claim 15, wherein the cells are mammalian cells.

17. The method according to claim 16, wherein the mammal is selected from the group consisting of cattle, horses, sheep, pigs, dogs, cats, rodents, and primates.

18. The method according to claim 16, wherein the mammal is a human, a cat, a pig, or a dog.

19. The method according to claim 16, wherein the mammal is a human.