Cardiomyocyte-derived nucleic acid regulatory elements, methods and uses thereof

Abstract

The present invention relates to nucleic acid regulatory elements capable of enhancing heart- and / or muscle-targeted gene expression, in particular heart- and muscle-targeted gene expression, more particularly gene expression in cardiomyocytes, methods of using these nucleic acid regulatory elements, and uses of these elements. Expression cassettes and vectors comprising these nucleic acid regulatory elements are also disclosed. The present invention is particularly useful for applications using gene therapy, more particularly heart- and / or muscle-directed gene therapy, such as the treatment of cardiovascular diseases and disorders, muscle disorders and other diseases and disorders that may benefit from high transgene expression in heart and / or muscle cells, as well as for vaccination purposes.

Description

[Technical Field]

[0001] The present invention relates to nucleic acid modulating elements that can specifically enhance gene expression in cardiac and / or muscle cells or tissues, more specifically cardiac and muscle cells or tissues, and more specifically cardiomyocytes, methods using these nucleic acid modulating elements, and uses of these elements. The present invention further encompasses expression cassettes, vectors, and pharmaceutical compositions comprising these modulating elements. The present invention is particularly useful for the treatment of cardiovascular diseases and disorders, especially coronary heart disease and heart failure, as well as muscle disorders and diseases, or for the treatment of diseases requiring the secretion of therapeutic proteins from the heart or muscle, or for vaccination purposes, using gene therapy. [Background technology]

[0002] Coronary heart disease (CHD) is the most common heart disease, characterized by the accumulation of plaque in the heart's arteries, which can lead to sudden heart attacks (myocardial infarction) or chronic ischemic cardiomyopathy. Heart failure (HF) is the most common consequence of CHD, occurring when the heart muscle is no longer able to adequately pump blood and oxygen to meet the body's needs. Despite remarkable advances in surgical and medical treatments, including resynchronization therapy and the use of ventricular assist devices (Birks. 2013. Circulation Research 113:777-791), long-term survival rates for HF patients remain low. Therefore, effective and safe treatments for CHD and HF are needed.

[0003] Non-coding RNAs (ncRNAs), such as microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), as well as circular RNAs (circRNAs), have been identified as important novel regulators of cellular processes. The expression of these non-coding molecules appears to be tightly regulated not only in physiological states but also in cardiovascular diseases (reviewed in Poller et al. 2018 Eur Heart J. 39:2704-2716) and / or in several human diseases, including muscle disorders (reviewed in Beermann et al. 2016 Physiol Rev 96:1297-1325). These non-coding molecules are rapidly emerging as fundamentally new therapeutic agents and attractive alternatives to protein-based approaches. By regulating ncRNAs (e.g., through overexpression or inhibition), it is possible to activate or inactivate specific gene programs, holding unprecedented potential for the development of innovative gene-based therapies. In particular, these new findings have paved the way for the use of ncRNA-based gene therapy as a novel treatment for cardiovascular disease (CVD) and / or muscle disorders. ncRNAs (or their homologous inhibitors) offer several therapeutic advantages compared to conventional protein-based approaches. Typically, ncRNAs act on multiple pathways, potentially resulting in additive or synergistic effects. Some ncRNAs may even act as "molecular master switches" crucial for regulating cellular physiology in normal or pathological conditions, especially in the context of CHD and HF. Some ncRNAs (lncRNAs) function naturally at relatively low copy numbers per cell (less than 100), allowing for therapeutic effects with smaller amounts of vector. Several specific ncRNAs are highly promising targets, having demonstrated beneficial effects in animal models of diseases such as CHD and HF, justifying clinical trials. In addition, there are many genetic disorders (such as Pompe disease and muscular dystrophy) caused by genetic defects that impair the function of skeletal muscle and heart. These genetic defects can ultimately lead to life-threatening, severe muscle weakness and paralysis or cardiopulmonary failure.

[0004] The objective of this invention is to develop an innovative gene therapy platform for treating cardiovascular diseases, particularly coronary heart disease (CHD) and heart failure (HF), as well as muscle-related disorders. Furthermore, maximizing gene expression in muscle may also impact gene vaccination and potentially affect non-muscle diseases (e.g., hemophilia) that would benefit from increased expression of circulating therapeutic proteins.

[0005] However, gene therapy targeting muscle and / or cardiac cells or tissues is relatively inefficient due to limitations in gene delivery and expression. Conventional vector designs based on standard cardiac and / or muscle-targeted promoters typically result in suboptimal expression in the desired target tissue. Cis-regulatory elements (CREs) (also known as cis-regulatory modules (CRMs)) have been first identified across tissues / organs comprising different cell types. These CREs enable enhanced gene expression in the heart, muscle, and / or diaphragm (Sarcar et al. 2019. Nat Commun. 10(1):492; WO 2015 / 110449; WO 2018 / 178067; WO 2011 / 051450). These specific CREs were previously identified using a differential distance matrix (DDM) / multidimensional scaling algorithm (MDS) by De Bleser et al. (2007. Genome Biol 8, R83), which relied on identifying an array of transcription factor binding sites (TFBSs) common to genes highly expressed in a given tissue / organ. As a result, genes highly expressed in a tissue / organ but not sharing such a common array of TFBSs were excluded by this bioinformatics algorithm.

[0006] However, there remains a need in this field for safe and efficient gene therapy, more specifically for the safe and efficient expression of target genes in cardiac and / or muscle cells or tissues, particularly cardiomyocytes. [Overview of the project] [Problems that the invention aims to solve]

[0007] This invention addresses the need for efficient gene therapy for cardiovascular diseases, particularly coronary heart disease and heart failure, as well as myocardial disorders and other diseases and disorders that may benefit from high transgene expression in cardiac and / or muscle cells or tissues. Based on cardiomyocyte-derived cis-regulatory modules (CARD-CRE) that result in high (trans)gene expression not only in cardiomyocytes but also in skeletal muscle and diaphragmatic cells or tissues, an approach has been developed to maximize (trans)gene expression in the heart, particularly cardiomyocytes or tissues, and other types of muscle cells or tissues. The use of the CARD-CRE elements identified herein enhanced (trans)gene expression in cardiac and various skeletal muscle and diaphragmatic cells or tissues compared to (trans)gene expression from promoters alone. Therefore, the use of these novel CARD-CREs ​​is an attractive strategy for maximizing the overall efficacy and safety of gene therapy for cardiovascular diseases, particularly coronary heart disease and heart failure, as well as myocardial disorders and other diseases and disorders that may benefit from high transgene expression in cardiac and / or muscle cells or tissues. Furthermore, lower vector doses may be required to achieve similar or even improved therapeutic effects. [Means for solving the problem]

[0008] Therefore, the present invention provides the following aspects. Viewpoint 1: An isolated nucleic acid regulatory element for enhancing cardiac- and / or muscle-targeted gene expression, preferably cardiac- and muscle-targeted gene expression, comprising, essentially consisting of, or comprising, a functional fragment thereof of a sequence selected from the group consisting of Sequence ID No. 2, Sequence ID No. 3, Sequence ID No. 5, Sequence ID No. 6, Sequence ID No. 7, Sequence ID No. 8, and any of the sequences (full length) having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example, 95%, 96%, 97%, 98%, or 99% identity (i.e., a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example, 95%, 96%, 97%, 98%, or 99% identity with the sequences (full length) described in Sequence ID No. 2, Sequence ID No. 3, Sequence ID No. 5, Sequence ID No. 6, Sequence ID No. 7, or Sequence ID No. 8. In preferred embodiments of the above aspects, the nucleic acid regulatory element is up to 2000 nucleotides in length, preferably up to 1900 or 1800 nucleotides, more preferably up to 1700 nucleotides, and comprises, essentially consists of, or comprises the sequence or functional fragment thereof, selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and any of the sequences (in their entirety).

[0009] In embodiments of the above aspects, the nucleic acid regulatory element is up to 1000 nucleotides long, preferably up to 900, 800, 700, 600 or 500 nucleotides, more preferably up to 400 nucleotides, and includes, essentially consists of, or comprises the sequence or functional fragment thereof having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example 95%, 96%, 97%, 98%, or 99% identity with the sequence (full length) described in Sequence ID No. 2. In particular embodiments of the above aspects, the regulatory element consists of the sequence described in Sequence ID No. 2 (i.e., CARD-CRE8). In embodiments of the above aspects, the nucleic acid regulatory element is up to 2000 nucleotides long, preferably up to 1900 or 1800 nucleotides, more preferably up to 1700 nucleotides, and includes, essentially consists of, or comprises the sequence or functional fragment thereof, having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example 95%, 96%, 97%, 98%, or 99% identity with the sequence (full length) described in Sequence ID No. 3. In particular embodiments of the above aspects, the regulatory element consists of the sequence described in Sequence ID No. 3 (i.e., CARD-CRE11).In embodiments of the above aspects, the nucleic acid regulatory element is up to 1000 nucleotides long, preferably up to 900, 800, or 700 nucleotides, more preferably up to 600 nucleotides, and includes, essentially consists of, or comprises the sequence or functional fragment thereof, having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example 95%, 96%, 97%, 98%, or 99% identity with the sequence (full length) described in Sequence ID No. 5. In particular embodiments of the above aspects, the regulatory element consists of the sequence described in Sequence ID No. 5 (i.e., CARD-CRE14). In embodiments of the above aspects, the nucleic acid regulatory element is up to 1500 nucleotides long, preferably up to 1400, 1300, 1200, 1100 or 1000 nucleotides, more preferably up to 900 nucleotides, and includes, essentially consists of, or comprises the sequence or functional fragment thereof, having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example 95%, 96%, 97%, 98%, or 99% identity with the sequence (full length) described in SEQ ID NO: 6. In particular embodiments of the above aspects, the regulatory element consists of the sequence described in SEQ ID NO: 6 (i.e., CARD-CRE16) or a functional fragment thereof.In embodiments of the above aspects, the nucleic acid regulatory element is up to 1000 nucleotides long, preferably up to 900, 800, 700, 600 or 500 nucleotides, more preferably up to 450 or 400 nucleotides, and includes, essentially consists of, or comprises the sequence or functional fragment thereof, having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example 95%, 96%, 97%, 98%, or 99% identity with the sequence (full length) described in SEQ ID NO: 7. In particular embodiments of the above aspects, the regulatory element consists of the sequence described in SEQ ID NO: 7 (i.e., CARD-CRE17) or a functional fragment thereof. In embodiments of the above aspects, the nucleic acid regulatory element is up to 1700 nucleotides long, preferably up to 1600 nucleotides, more preferably up to 1500 nucleotides, and includes, essentially consists of, or comprises the sequence or functional fragment thereof, having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example 95%, 96%, 97%, 98%, or 99% identity with the sequence (full length) described in Sequence ID No. 8. In particular embodiments of the above aspects, the regulatory element consists of the sequence described in Sequence ID No. 8 (i.e., CARD-CRE20).

[0010] Viewpoint 2: A nucleic acid regulatory element according to Viewpoint 1, comprising, essentially consisting of, or comprising a functional fragment of a sequence selected from the group consisting of SEQ ID NOs. 2, SEQ ID NOs. 3, SEQ ID NOs. 5, SEQ ID NOs. 6, SEQ ID NOs. 7, and SEQ ID NOs. 8, wherein the functional fragment comprises, essentially consisting of, or comprising at least 20, preferably at least 25, more preferably at least 50, at least 100, at least 200, or at least 250 consecutive nucleotides from the original sequence from which it originates. In embodiments of the above aspects, the nucleic acid regulatory element is a functional fragment of SEQ ID NO: 2, and the functional fragment contains or consists of at least 310, preferably at least 320, 330, or 340, more preferably at least 345 or 350 consecutive nucleotides from SEQ ID NO: 2. In embodiments of the above aspects, the nucleic acid regulatory element is a functional fragment of SEQ ID NO: 3, and the functional fragment contains or consists of at least 1600, preferably at least 1610 or 1620, more preferably at least 1630 or 1635 consecutive nucleotides from SEQ ID NO: 3. In embodiments of the above aspects, the nucleic acid regulatory element is a functional fragment of SEQ ID NO: 5, and the functional fragment contains or consists of at least 500, preferably at least 510, 520, or 530, more preferably at least 535 or 540 consecutive nucleotides from SEQ ID NO: 5. In embodiments of the above aspects, the nucleic acid regulatory element is a functional fragment of SEQ ID NO: 6, and the functional fragment contains or consists of at least 800, preferably at least 810 or 820, more preferably at least 830 or 835 consecutive nucleotides from SEQ ID NO: 6. In embodiments of the above aspects, the nucleic acid regulatory element is a functional fragment of SEQ ID NO: 7, and the functional fragment contains or consists of at least 260, preferably at least 270 or 280, more preferably at least 290 or 295 consecutive nucleotides from SEQ ID NO: 7. In embodiments of the above aspects, the nucleic acid regulatory element is a functional fragment of SEQ ID NO: 8, and the functional fragment contains or consists of at least 1435, preferably at least 1440, 1450 or 1460, more preferably at least 1465 or 1470 consecutive nucleotides from SEQ ID NO: 8.

[0011] Viewpoint 3: A nucleic acid regulatory element for enhancing cardiac- and / or muscle-targeted gene expression, preferably cardiac- and muscle-targeted gene expression, comprising, essentially consisting of, or comprising a complement of the sequence defined in Viewpoint 1 or 2. Perspective 4: A nucleic acid regulatory element for enhancing cardiac- and / or muscle-targeted gene expression, preferably cardiac- and muscle-targeted gene expression, which hybridizes with a nucleic acid regulatory element according to any one of Perspectives 1 to 3 under stringent conditions. Perspective 5: A nucleic acid regulatory element according to any one of Perspectives 1 to 4, having a total length of 1700 nucleotides or less, preferably 1500 nucleotides or less, more preferably 900 nucleotides or less, and even more preferably 600 nucleotides or less. Perspective 6: Use of nucleic acid regulatory elements in nucleic acid expression cassettes or vectors according to any one of Perspectives 1 to 5, particularly for enhancing gene expression in cardiac and / or muscle cells or tissues, more specifically in cardiac and muscle cells or tissues, and even more specifically for enhancing gene expression in cardiomyocytes, preferably in vitro or ex vivo.

[0012] Perspective 7: A nucleic acid expression cassette comprising at least one, e.g., one, two, three, four, five, or six or more nucleic acid regulatory elements according to any one of Perspectives 1 to 5, operably linked to a promoter. Viewpoint 8: A nucleic acid expression cassette according to Viewpoint 7, wherein at least one nucleic acid regulatory element is operably linked to a promoter and a transgene. In certain embodiments of this aspect, the transgene encodes acid α-glucosidase (GAA) (e.g., GAA as secreted or innate). In other specific embodiments of this aspect, the transgene encodes a sarcoglycan, particularly a sarcoglycan selected from α-sarcoglycan, β-sarcoglycan, and γ-sarcoglycan, preferably β-sarcoglycan. In certain embodiments, the transgene encodes an antibody or a nanobody. Viewpoint 9: A nucleic acid expression cassette according to Viewpoint 7 or 8, wherein the promoter is a cardiac- and / or muscle-targeting promoter, preferably a cardiac- and muscle-targeting promoter.

[0013] Perspective 10: A nucleic acid expression cassette according to any one of Perspectives 7-9, wherein the promoter is selected from the group consisting of the hMLC promoter, particularly the hMLC promoter defined by SEQ ID NO: 14, the SPc5-12 promoter, particularly the SPc5-12 promoter defined by SEQ ID NO: 11, the desmin (DES) promoter, and the MHCK7 promoter, for example, the promoter is selected from the group consisting of the SPc5-12 promoter, particularly the SPc5-12 promoter defined by SEQ ID NO: 11, the desmin (DES) promoter, and the MHCK7 promoter. The use of a chimeric SPc5-12 promoter incorporating the CARD-CRE elements identified herein enhances gene expression in cardiac and various skeletal muscle cells or tissues compared to the synthetic muscle-directed SPc5-12 promoter. Furthermore, these novel CARD-CRE elements, combined with the SPc5-12 promoter, resulted in significantly higher gene expression than the CMV promoter, while preventing ectopic expression in non-target tissues such as the liver, in contrast to the CMV promoter. Viewpoint 11: A nucleic acid expression cassette according to either Viewpoint 7 or 8, wherein the promoter is a ubiquitously expressed promoter, preferably a CMV promoter, particularly one selected from the group consisting of the CMV promoter defined by Sequence ID No. 15, the RNA polymerase II promoter, or the RNA polymerase III promoter, for example, the RNA polymerase II promoter or the RNA polymerase III promoter. In the embodiment, the RNA polymerase III promoter is the U6 polymerase III promoter or the H1 polymerase III promoter.

[0014] Perspective 12: A nucleic acid expression cassette according to one of Perspectives 8-10, in which the transgene encodes a therapeutic protein or an immunogenic protein. Perspective 13: A nucleic acid expression cassette according to any one of Perspectives 8-11, wherein the transgene encodes a non-coding RNA, preferably a microRNA, long non-coding RNA (lncRNA), circular RNA, or short interfering RNA (siRNA). Viewpoint 14: A nucleic acid expression cassette according to any one of Viewpoints 7 to 13, further comprising an intron, preferably a mouse microvirus (MVM) intron, more preferably an MVM intron as defined by Sequence ID No. 12. Viewpoint 15: A nucleic acid expression cassette according to any one of Viewpoints 7 to 14, further comprising a polyadenylation signal, preferably a synthetic polyadenylation signal, more preferably a polyadenylation signal defined by Sequence ID No. 13. Perspective 16: A vector containing a nucleic acid regulatory element according to any one of Perspectives 1-5 or a nucleic acid expression cassette according to any one of Perspectives 7-15. Viewpoint 17: A vector according to Viewpoint 16, which is a viral vector, preferably an adeno-associated virus (AAV) vector, an adenovirus vector, or a lentiviral vector. Viewpoint 18: A vector according to Viewpoint 16, which is a nonviral vector, preferably a plasmid, minicircle, or transposon-based vector, such as a PiggyBac-based vector or a Sleeping Beauty-based vector.

[0015] Perspective 19: A pharmaceutical composition comprising a nucleic acid expression cassette according to any one of Perspectives 7 to 15 or a vector according to any one of Perspectives 16 to 18, and a pharmaceutically acceptable carrier. Perspective 20: A nucleic acid regulatory element according to any one of Perspectives 1 to 5, a nucleic acid expression cassette according to any one of Perspectives 7 to 15, a vector according to any one of Perspectives 16 to 18, or a pharmaceutical composition according to Perspective 19, for use in pharmaceuticals. Aspect 21: A nucleic acid regulatory element according to any one of Aspects 1 to 5, a nucleic acid expression cassette according to any one of Aspects 7 to 15, a vector according to any one of Aspects 16 to 18, or a pharmaceutical composition according to Aspect 19, for use in gene therapy, preferably cardiac and / or muscle (cell or tissue)-directed gene therapy. In an embodiment of this aspect, the nucleic acid expression cassette, vector or pharmaceutical composition is for use in cardiac (cell or tissue)-directed gene therapy, particularly cardiomyocyte-directed gene therapy. In an embodiment, the nucleic acid expression cassette, vector or pharmaceutical composition is for use in muscle (cell or tissue)-directed gene therapy.

[0016] Aspect 22: A nucleic acid expression cassette according to any one of Aspects 7 to 15, a vector according to any one of Aspects 16 to 18, or a pharmaceutical composition comprising the nucleic acid expression cassette or the vector, for use in a method of generating an antibody or nanobody in a subject, the method comprising introducing the nucleic acid expression cassette or vector into the heart and / or muscle cells of the subject, preferably the heart and muscle cells of the subject, more preferably the cardiomyocytes of the subject, in an effective amount to induce expression of the antibody or nanobody, wherein the transgene in the nucleic acid expression cassette or vector encodes the antibody or nanobody. In an embodiment of this aspect, the nucleic acid expression cassette, vector or pharmaceutical composition is administered to the subject. In another embodiment of this aspect, the nucleic acid expression cassette or vector is administered to the heart and / or muscle cells, preferably the heart and muscle cells, more preferably the cardiomyocytes, into which it is introduced.

[0017] Perspective 23: Cardiovascular diseases and disorders, lysosomal storage disorders, mitochondrial disorders (e.g., Barth syndrome), channelopathy (e.g., Brugada syndrome), metabolic disorders, myotubeal myopathy (MTM), muscular dystrophy (e.g., Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD)), myotonic dystrophy, myotonic muscular dystrophy (DM), Miyoshi myopathy, Fukuyama congenital dystrophy, dysferinopathy, neuromuscular diseases, motor neuron diseases (MND) (e.g., Charcot-Marie-Tooth disease (CMT), spinal muscular atrophy (SMA), or amyotrophic lateral sclerosis (ALS)), Emery-Dreyfus muscular dystrophy, Facioscapulohumeral muscular dystrophy (FSHD), congenital muscular dystrophy, congenital myopathy, limb-girdle muscular dystrophy (e.g., limb-girdle muscular dystrophy type 2E (LGMD2E), limb-girdle muscular dystrophy type 2D (LGMD2D), limb-girdle muscular dystrophy type 2C (LGMD2C), limb-girdle muscular dystrophy type 2B (LGMD2B), limb-girdle muscular dystrophy type 2L (LGMD2L), limb-girdle muscular dystrophy type 2A (LGMD2A)), metabolic myopathy, myoinflammatory disease, myasthenia gravis, mitochondrial myopathy, ion channel abnormalities, nuclear envelope disease, distal myopathy, hemophilia (e.g., hemophilia A and B, factor FVII deficiency, von A nucleic acid regulatory element according to any one of viewpoints 1 to 5, a nucleic acid expression cassette according to any one of viewpoints 7 to 15, a vector according to any one of viewpoints 16 to 18, or a pharmaceutical composition according to viewpoint 19 for use in the treatment of a disease or disorder selected from the group including Willebrand disease, C1 inhibitor deficiency or hereditary angioedema, diabetes mellitus, α1-antitrypsin deficiency, and renal failure.

[0018] In embodiments of this aspect, the nucleic acid expression cassette, vector, or pharmaceutical composition is for use in the treatment of cardiovascular disease or disorder or muscle disorder. In embodiments, the nucleic acid expression cassette, vector, or pharmaceutical composition is for use in the treatment of cardiovascular disease or disorder. In further embodiments of this aspect, the disease or disorder is atherosclerosis, arteriosclerosis, coronary heart disease or coronary artery disease, peripheral artery disease, congenital heart disease, congestive heart failure, heart failure or cardiac dysfunction, myocardial infarction or heart attack, myocardial ischemia, acute coronary syndrome or unstable and stable angina, cardiomyopathy (e.g., hypertrophic cardiomyopathy, dilated cardiomyopathy, restrictive cardiomyopathy, and primary cardiomyopathy caused by gene mutations (e.g., Brugada syndrome and Fabry disease)), Cardiovascular disease or disorder selected from the group including cardiac amyloidosis (or “cardiac rigidity syndrome”), myocarditis (or inflammatory cardiomyopathy), valvular heart disease, pericarditis, cardiac tamponade (also known as pericardial tamponade), endocarditis, cardiac arrhythmias (e.g., primary cardiac arrhythmias caused by genetic mutations (e.g., Brugada syndrome)), hypertension, hypotension, vascular or valvular stenosis, restenosis, deep vein thrombosis (DVT), pulmonary embolism, and ischemic or hemorrhagic stroke.

[0019] In embodiments of this perspective, the nucleic acid expression cassette, vector, or pharmaceutical composition is intended for use in the treatment of lysosomal storage disorders. In further embodiments, the disease or disorder is Fabry disease, glycogen storage disorders (e.g., Pompe disease, glycogen storage disorder (GSD) type II, Danon disease, GSD type IIb, GSD III or GSD3 (also known as Coli's disease or Forbes disease), GSD IV or GSD4 (also known as Andersen's disease), GSD V or GSD5 (also known as McArdle's disease), GSD VII or GSD7 (also known as Tarui's disease), GSD X or GSD10, GSD XII or GSD12 (also known as aldolase A deficiency), GSD XIII or GSD13, GSD XV or GSD15) and mucopolysaccharidosis (e.g., Hunter syndrome, Sanfilippo syndrome, mucopolysaccharidosis (MPS) I, MPS II, MPS III, MPS IIIA, MPS IIIB, MPS IIIC, MPS IV, MPS VI, MPS VII, MPS It is a lysosomal storage disorder selected from the group including IX).

[0020] Perspective 24: A nucleic acid regulatory element according to any one of Perspectives 1 to 5, a nucleic acid expression cassette according to any one of Perspectives 7 to 15, a vector according to any one of Perspectives 16 to 18, or a pharmaceutical composition according to Perspective 19, for use as a vaccine, preferably a prophylactic vaccine, or for use in vaccination therapy, preferably for prophylactic vaccination. Viewpoint 25: A method for expressing an introduced gene product in cardiac and / or muscle cells or tissues, preferably cardiac and muscle cells or tissues, more preferably cardiomyocytes, preferably in vitro or ex vivo: - Introducing a nucleic acid expression cassette according to any one of viewpoints 7 to 15 or a vector according to any one of viewpoints 16 to 18 into cardiac and / or muscle cells or tissue, preferably cardiac and muscle cells or tissue, more preferably cardiomyocytes; - Expressing the transgene product in cardiac and / or muscle cells or tissues, preferably cardiac and muscle cells or tissues, more preferably cardiomyocytes; and -Optionally, recover the transgene product from cardiac and / or muscle cells or tissue, preferably cardiomyocytes or culture medium. Methods that include...

[0021] Viewpoint 26: An in vitro or ex vivo method for generating antibodies or nanobodies in cardiac and / or muscle cells or tissues, preferably cardiomyocytes, comprising: -Introducing a nucleic acid expression cassette according to any one of viewpoints 7-15 or a vector according to any one of viewpoints 16-18 into the cardiac and / or muscle cells or tissue, preferably the cardiomyocytes, where the introduced gene encodes an antibody or a nanobody. - Expressing the antibody or nanobody in the heart and / or muscle cells or tissue, preferably the cardiomyocytes; and -Optionally, recover the antibody or nanobody from the heart and / or muscle cells or tissue, preferably the cardiomyocytes or culture medium. Methods that include... [Brief explanation of the drawing]

[0022] [Figure 1] Schematic diagram of the AAV2 vector plasmid containing a cardiomyocyte-targeted SPc5-12 promoter that drives the luciferase reporter (Luc2) gene. The identified CARD-CRE regulatory element was cloned upstream of the SPc5-12 promoter. The AAV2 vector plasmid further contains polyadenylation sites (pA) and mouse microvirus (MVM) introns. The AAV vector plasmid is flanked by 5' and 3' reverse terminal repeats (ITRs). [Figure 2]Schematic diagram of the in vivo screening and validation platform used to screen for identified CARD-CRE. CARD-CRE was cloned upstream of a cardiomyocyte-targeted promoter (e.g., SPc5-12 synthetic promoter) that drives the expression of the luciferase reporter (Luc2) gene. Control vectors lacked any CARD-CRE. The corresponding vector constructs were packaged in AAV9 particles and injected into CB17 SCID mice. Luciferase activity was quantified by in vivo bioluminescence imaging (BLI) or luminometry of cardiomyocytes purified from injected mice. Luciferase activity of the CARD-CRE vector was compared to the robustness of CARD-CRE in enhancing luciferase activity, or to a control vector or CMV reference construct lacking CARD-CRE. [Figure 3] Comparison of luciferase activity by whole-body bioluminescence (BLI). Whole-body BLI of CB17 SCID mice injected one week prior to administration with either an AAV9 viral vector containing CARD-CRE3, CARD-CRE11, and CARD-CRE12, or a control AAV9 viral vector lacking CARD-CRE. Regions shown in white indicate luciferase activity. [Figure 4] Comparison of luciferase activity by luminometry. Luminometry analysis was performed on fresh, purified cardiomyocytes from mice injected with an AAV9 viral vector containing CARD-CRE11 or a control AAV9 viral vector lacking CARD-CRE. An AAV viral vector encoding a luciferase reporter gene driven by a cytomegalovirus (CMV) promoter was used as the reference vector. Luciferase activity was expressed as relative luminescence units (RLU). [Figure 5]Comparison of luciferase activity in CB17 SCID mice injected with an AAV9 viral vector containing the CARD-CRE11 regulatory element, a control AAV9 viral vector lacking CARD-CRE, or an AAV9 viral vector containing the CMV promoter as a reference, by systemic BLI (A) 2 weeks after vector injection or by BLI analysis (B) of individual organs and tissues taken from mice dissected 3 weeks after vector injection. Areas shown in white indicate luciferase activity. (C) Quantitative analysis of luciferase activity in the heart and muscle tissue by BLI analysis. [Figure 6] Comparison of luciferase activity in CB17 SCID mice injected with an AAV9 viral vector containing CARD-CRE14, CARD-CRE16, or CARD-CRE17, or a control AAV9 viral vector lacking CARD-CRE (CRE-free control), by systemic BLI (A) one week after vector injection, or by BLI analysis (B) of individual organs and tissues taken from mice dissected 22 weeks after vector injection. Areas shown in white indicate luciferase activity. (C) Quantitative analysis of luciferase activity in the heart and muscle groups by BLI analysis. [Figure 7]Comparison of luciferase activity in CB17 SCID mice injected with an AAV9 viral vector containing CARD-CRE8, CARD-CRE11, CARD-CRE16, or CARD-CRE20, or a control AAV9 viral vector lacking CARD-CRE (CRE-free control), by systemic BLI (A) 12 weeks after vector injection or by BLI analysis of individual organs and tissues taken from mice dissected 14 weeks after vector injection (B). Areas shown in white indicate luciferase activity. (C) Quantitative analysis of luciferase activity in the heart and muscle tissue by BLI analysis. (D)Quantitative analysis of luciferase activity by BLI analysis in the heart, different muscle groups and organs 14 weeks after vector injection in CB17 SCID mice injected with (a) an AAV9 viral vector containing CARD-CRE16, (b) CARD-CRE11, (c) CARD-CRE8, or (d) CARD-CRE20, or (e) a control AAV9 viral vector lacking CARD-CRE (CRE-free control). [Figure 8] Vector map of AAVss-hMLC-Luc2-SynpA vectors. [Figure 9] Vector map of AAVss-Card CRE11-hMLC-Luc2-SynpA vector. [Figure 10] Luciferase activity in individually excised tissues 4 weeks after vector injection. CB17-SCID mice were injected with either ssAAV9-Card CRE11-hMLC-Luc2-SynpA(Card CRE11-hMLC) or ssAAV9-hMLC-Luc2-SynpA(hMLC) (vector dose: 10¹¹ vg / mouse). Luciferase expression was measured as total luminous flux (photons / second / cm² / sr) (mean + sem; n=3). [Figure 11] A vector map of AAVss-CMV-Luc2-SynpA vectors. [Figure 12] Vector map of AAVss-CARD CRE11-CMV-Luc2-SynpA vector. [Figure 13]Luciferase activity in individually isolated hearts 4 weeks after vector injection. CB17-SCID mice were injected with either ssAAV9-Card CRE11-CMV-Luc2-SynpA (Card CRE11-CMV) or a control vector lacking CARD-CRE11 (ssAAV9-CMV-Luc2-SynpA;CMV) (vector dose: 10E11 vg / mouse). Luciferase expression was measured as total luminous flux (photons / second / cm2 / sr) (mean + sem; n=3). [Modes for carrying out the invention]

[0023] In this specification, the singular forms ("a," "an," and "the") include both singular and plural references unless the context clearly indicates otherwise. As used herein, the terms “include,” “contain,” and “compose” are synonymous with “encompass,” or “contain,” and are inclusive or open-ended terms that do not exclude additional members, elements, or method steps not described herein. These terms also encompass the terms “consist of” and “essentially consist of,” which have established meanings as patent terminology. When specifying a numerical range using endpoints, the range includes not only the specified endpoint but also all numerical values ​​and subranges contained within that range. In this specification, the term “about” used when referring to measurable values ​​such as parameters, quantities, and durations means, to the extent appropriate for the disclosed invention, that it includes variations from / to a specified value, for example, variations of ±10%, preferably ±5%, more preferably ±1%, and even more preferably ±0.1% or less from a specified value. Values ​​modified with the “about” term should be understood to be disclosed both specifically and as preferred in themselves.

[0024] The terms “one or more” or “at least one” are self-clear, but to illustrate further, these terms encompass references to any one of the members, or any two or three or more of the members, for example, up to all of the members, such as any ≥3, 4, 5, 6, or 7 of the members. In another example, “one or more” or “at least one” may refer to 1, 2, 3, 4, 5, 6, 7, or more. This specification includes references to the background of the invention in order to explain the subject matter of the invention. Such references should not be construed as an acknowledgment that any of the referenced materials were published, known, or part of the common technical knowledge in any country as of the priority date of any claim. Throughout this disclosure, various publications, patents, and published patent specifications are referenced by specifying the documents. All documents cited herein are incorporated herein by reference in their entirety. Specifically, any teachings or sections of documents specifically mentioned herein are incorporated by reference.

[0025] Unless otherwise specified, all terms used in the disclosure of this invention, including technical and scientific terms, have the meanings generally understood by a person of ordinary skill in the art to which this invention pertains. For further guidance, definitions of terms are provided to better understand the teachings of this invention. Where a particular term is defined in relation to a particular aspect or embodiment of this invention, its implications apply throughout this specification, i.e., in the context of other aspects or embodiments of this invention, unless otherwise specified. Different aspects or embodiments of the present invention are described in more detail below. Each described aspect can be combined with any other aspect or embodiment unless otherwise explicitly stated. In particular, any feature indicated as preferred or advantageous may be combined with one or more other features indicated as preferred or advantageous. Throughout this specification, any reference to “one embodiment” or “a certain embodiment” means that a particular feature, structure, or characteristic described in relation to that embodiment is included in at least one embodiment of the present invention. Therefore, the phrases “in one embodiment” or “in a certain embodiment” appearing elsewhere in this specification do not necessarily refer to the same embodiment, but they may. Furthermore, certain features, structures, or characteristics may be combined in one or more embodiments in any suitable manner, as will be apparent to those skilled in the art from this disclosure. Moreover, some embodiments described herein include some features included in other embodiments and do not include others, but as will be understood to those skilled in the art, combinations of features from different embodiments fall within the scope of the present invention and constitute different embodiments. For example, any of the claimed embodiments can be used in any combination within the appended claims.

[0026] For general methods related to the present invention, see, in particular, "Molecular Cloning: A Laboratory Manual, 4" th Referencing well-known textbooks, including "Ed." (Green and Sambrook, 2012, Cold Spring Harbor Laboratory Press) and "Current Protocols in Molecular Biology" (Ausubel et al., 1987). In a certain view, the present invention relates to sequences selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example 95%, 96%, 97%, 98%, or 99% identity with respect to any of the sequences (total length) of sequence 2, sequence 3, sequence 5, sequence 6, sequence 7, sequence 8, or sequences, or to functional fragments thereof (i.e., functional fragments of sequences selected from the group consisting of sequence 2, sequence 3, sequence 5, sequence 6, sequence 7, sequence 8, or sequences (total length) of any of the sequences, or to functional fragments thereof having at least 80%, preferably at least 85%, more preferably at least 90%, The present invention relates to nucleic acid regulatory elements for enhancing cardiac- and / or muscle-targeted gene expression, more specifically cardiac- and muscle-targeted gene expression, more specifically cardiomyocyte-targeted gene expression, comprising, more preferably, a functional fragment of a sequence having at least 95%, for example, 95%, 96%, 97%, 98%, or 99% identity, or essentially consisting of such sequence or functional fragment (i.e., the regulatory element may additionally include, for example, a sequence used for cloning purposes, but the indicated sequence constitutes an essential part of the regulatory element, for example, the sequence does not form part of a larger regulatory region such as a promoter), or consisting of such sequence or functional fragment.

[0027] In certain embodiments, the nucleic acid regulatory element described herein comprises a sequence selected from the group consisting of SEQ ID NOs: 2, SEQ ID NOs: 3, SEQ ID NOs: 5, SEQ ID NOs: 6, SEQ ID NOs: 7, and SEQ ID NOs: 8, and at least one flanking nucleotide sequence (i.e., a 5' flanking nucleotide sequence and / or a 3' flanking nucleotide sequence), wherein the at least one flanking nucleotide sequence has a maximum length of 50 nucleotides, preferably a maximum length of 45, 40, 35, 30, or 25 nucleotides, more preferably a maximum length of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide. In certain embodiments, the nucleic acid regulatory element described herein comprises a sequence selected from the group consisting of SEQ ID NOs: 2, 3, 5, 6, 7, and 8, and two flanking nucleotide sequences (or a 5'-side flanking nucleotide sequence and a 3'-side flanking nucleotide sequence) located at opposite ends of the sequence selected from the group consisting of SEQ ID NOs: 2, 3, 5, 6, 7, and 8, each flanking nucleotide sequence independently having a maximum length of 50 nucleotides, preferably a maximum length of 45, 40, 35, 30, or 25 nucleotides, more preferably a maximum length of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide. In embodiments, the flanking nucleotide sequences are heterologous sequences (e.g., sequences used for cloning purposes). In other embodiments, the flanking nucleotide sequences are homologous sequences. In the context of this invention, "heterogeneous" in relation to a given sequence is understood to mean a nucleic acid sequence other than a sequence directly adjacent to that sequence in nature. The term "cognate" as used herein in relation to a given sequence is understood to mean a nucleic acid sequence directly adjacent to that sequence in nature.

[0028] As used herein, “regulatory element” or “nucleic acid regulatory element” is also called “CRE” (cis regulatory element), “CRM” (cis regulatory module), or “CARD-CRE” or “CARD CRE” (cardiomyocyte-derived CRE), and refers to a transcriptional regulatory element capable of regulating and / or controlling gene transcription, particularly tissue- or cell-targeted transcription of genes, especially a non-coding cis-acting transcriptional regulatory element. A regulatory element includes at least one transcription factor binding site (TFBS), specifically at least one binding site for tissue- or cell-targeted transcription factors, more specifically at least one binding site for cardiac- and / or muscle-targeted transcription factors, more specifically at least one binding site for cardiac- and muscle-targeted transcription factors, and most specifically at least one binding site for cardiomyocyte-targeted transcription factors. Typically, the regulatory elements used herein increase or enhance promoter-driven gene expression compared to gene transcription from a promoter alone that does not have the regulatory element. Therefore, while regulatory elements include enhancer sequences in particular, it is understood that regulatory elements that enhance transcription are not limited to typical, far-upstream enhancer sequences, but can be located at any distance from the gene being regulated. In fact, it is known in the art that sequences that regulate transcription can be located either upstream (e.g., within the promoter region) or downstream (e.g., within the 3'UTR) of the gene being regulated in vivo, may be located very close to the gene, further distal, or even within the gene itself. The regulatory elements disclosed herein typically include naturally occurring sequences, but regulatory elements containing (parts of) such regulatory elements or combinations of multiple copies of such regulatory elements, i.e., sequences not naturally occurring, are also considered regulatory elements in themselves. The regulatory elements used herein may include portions of larger sequences involved in transcriptional regulation, such as portions of promoter sequences. However, regulatory elements alone are typically not sufficient to initiate transcription and require a promoter for this purpose.The regulatory elements disclosed herein are provided as nucleic acid molecules, i.e., isolated nucleic acids or isolated nucleic acid molecules. Thus, the nucleic acid regulatory elements are only a small portion of naturally occurring genome sequences and have sequences that are not naturally occurring on their own but have been isolated from nature.

[0029] As used herein, the term “nucleic acid” typically refers to an oligomer or polymer of any length (preferably a linear polymer) that is essentially composed of nucleotides. A nucleotide unit generally comprises a heterocyclic base, a sugar group, and at least one, for example, one, two, or three phosphate groups (including modified or substituted phosphate groups). Heterocyclic bases may include, in particular, purine and pyrimidine bases that are widely present in naturally occurring nucleic acids (e.g., adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U)), other naturally occurring bases (e.g., xanthine, inosine, hypoxanthine), and chemically or biochemically modified (e.g., methylated) unnatural or derived bases. The sugar groups may include, in particular, pentose (pentofuranose) groups (preferably ribose and / or 2-deoxyribose) common to naturally occurring nucleic acids, or arabinose, 2-deoxyarabinose, threose, or hexose sugar groups, as well as modified or substituted sugar groups. The nucleic acids intended herein may include naturally occurring nucleotides, modified nucleotides, or mixtures thereof. Modified nucleotides may include modified heterocyclic bases, modified sugar moieties, modified phosphate groups, or combinations thereof. Modification of phosphate groups or sugars may be introduced to improve stability, resistance to enzymatic degradation, or other useful properties. The term “nucleic acid” more preferably encompasses DNA, RNA, and DNA / RNA hybrid molecules, specifically including hnRNA, premRNA, guide (g)RNA, mRNA, cDNA, non-coding (nc)-RNA, long non-coding RNA (lnc)RNA, short hairpin (sh)RNA, small interfering (si)RNA, micro(mi)RNA, circular (c)RNA, genomic DNA, amplification products, oligonucleotides, and synthetic (e.g., chemically synthesized) DNA, RNA, or DNA / RNA hybrids. Nucleic acids may be naturally occurring, e.g., present in nature or isolated from nature; or they may be non-natural, e.g., recombinant, i.e., produced by recombinant DNA technology, and / or partially or whole, chemically or biochemically synthesized.Nucleic acids can be double-stranded, partially double-stranded, or single-stranded. When single-stranded, nucleic acids can be a sense strand or an antisense strand. Furthermore, nucleic acids can be cyclic or linear.

[0030] The sequences disclosed herein may be part of sequences of regulatory elements that can control gene transcription in vivo in cardiomyocytes, specifically normal human cardiomyocytes, more specifically, the following genes: tissue inhibitors of matrix metalloproteinase 1, also known as CLGI, EPA, EPO, or HCl (TIMP1 or TIMP-1); type VI collagen α2 chain, also known as PP3610, BTHLM1, or UCMD1 (COL6A2); OI4, EDSCV, or EDSART Type I collagen α2 chain (COL1A2), also known as H2; galectin 1 (LGALS1), also known as GAL1 or GBP; insulin-like growth factor binding protein 7 (IGFBP7), also known as AGM, FSTL2, IBP-7, IGFBP-7, IGFBP-7v, IGFBPRP1, MAC25, PSF, RAMSVPS or TAF; and fibronectin 1 (FN1), also known as CIG, ED-B, FINC, FN, FNZ, GFND, GFND2, LETS, MSF or SMDCF. Accordingly, in embodiments, the nucleic acid regulatory elements disclosed herein include TIMP1 regulatory elements, i.e., regulatory elements that control the expression of the TIMP1 gene in vivo, for example, a sequence derived from a regulatory element including SEQ ID NO: 2 (e.g., CARD-CRE8) or a functional fragment thereof. In embodiments, the nucleic acid regulatory elements disclosed herein include COL6A2 regulatory elements, i.e., regulatory elements that control the expression of the COL6A2 gene in vivo, for example, a sequence derived from a regulatory element including SEQ ID NO: 3 (e.g., CARD-CRE11) or a functional fragment thereof. In embodiments, the nucleic acid regulatory elements disclosed herein include COL1A2 regulatory elements, i.e., regulatory elements that control the expression of the COL1A2 gene in vivo, for example, a sequence derived from a regulatory element including SEQ ID NO: 5 (e.g., CARD-CRE14) or a functional fragment thereof. In embodiments, the nucleic acid regulatory elements disclosed herein include LGALS1 regulatory elements, i.e., regulatory elements that control the expression of the LGALS1 gene in vivo, such as sequences derived from regulatory elements including SEQ ID NO: 6 (e.g., CARD-CRE16) or SEQ ID NO: 7 (e.g., CARD-CRE17) or functional fragments thereof. In embodiments, the nucleic acid regulatory elements disclosed herein include IGFBP7 regulatory elements, i.e., regulatory elements that control the expression of the IGFBP7 gene in vivo, such as sequences derived from regulatory elements including SEQ ID NO: 8 (e.g., CARD-CRE20) or functional fragments thereof.

[0031] As used herein, the terms “identity” and “identical” and similar expressions refer to sequence similarity between two polymer molecules, for example, between two nucleic acid molecules, for example, between two DNA molecules. Sequence alignment and determination of sequence identity can be performed using, for example, the Basic Local Alignment Search Tool (BLAST) first described by Altschul et al. 1990 (J Mol Biol 215: 403-10), or the “Blast 2 sequences” algorithm described by, for example, Tatusova and Madden 1999 (FEMS Microbiol Lett 174: 247-250). Typically, the sequence identity percentage is calculated over the entire length of the sequence. As used herein, the term “substantially identical” refers to sequence identity of at least 90%, preferably at least 95%, for example, 95%, 96%, 97%, 98%, or 99%. As used herein, the term “functional fragment” means a fragment of a regulatory element sequence disclosed herein that retains the ability to regulate cardiac- and / or muscle-targeted expression, more specifically cardiac- and muscle-targeted expression, and more specifically cardiomyocyte-targeted expression, i.e., a functional fragment can still result in targeted expression in a particular tissue or cell and can regulate the expression of an (introduced) gene in the same manner (but possibly not to the same extent) as the original sequence from which it originates. A functional fragment as defined herein preferably has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or about 100% of the regulatory ability of the original nucleic acid regulatory element sequence from which it originates. The functional fragment may preferably contain at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 150, at least 200, at least 250, at least 300, at least 350, or at least 400 consecutive nucleotides from the original sequence from which it originates. The functional fragment may also contain at least one, more preferably at least two, at least three, or at least four, even more preferably at least five, at least 10, or at least 15 transcription factor binding sites (TFBSs) present in the original sequence from which it originates.

[0032] As used herein, “cardiac-and / or muscle-targeted expression” means the preferential or dominant expression of a (transformed) gene (as RNA and / or polypeptide) in cardiac and / or muscle cells or cardiac and / or muscle tissue, specifically cardiomyocytes or tissues, skeletal muscle cells or tissues and / or diaphragmatic cells or tissues, more specifically cardiomyocytes, skeletal muscle cells and / or diaphragmatic cells, compared to other (i.e., non-cardiac and / or-muscle) cells and tissues. According to certain embodiments, at least 50%, more specifically at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the (transformed) gene expression occurs in cardiac and / or muscle cells or tissues. According to certain embodiments, cardiac-and / or muscle-targeted expression involves "leaking" of less than 10%, less than 5%, less than 2%, or less than 1% of the expressed (transmitted) gene product into other organs, tissues, or cells other than cardiac and / or muscle cells and tissues, such as the lungs, liver, brain, kidneys, and / or spleen. As used herein, “cardiac-targeted expression” means the preferential or dominant expression of a (transformed) gene (as RNA and / or polypeptide) in cardiac cells or tissues, specifically cardiomyocytes or tissues, more specifically in cardiomyocytes, compared to other (i.e., non-cardiac) cells and tissues. According to certain embodiments, at least 50%, more specifically at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the (transformed) gene expression occurs within cardiac cells or tissues. According to certain embodiments, cardiac-targeted expression involves “leaking” of less than 10%, less than 5%, less than 2%, or less than 1% of the expressed (transformed) gene product into organs, tissues, or cells other than the heart, such as the lungs, liver, brain, kidneys, and / or spleen.

[0033] As used herein, “muscle-targeted expression” means the preferential or dominant expression of a (transformed) gene (as RNA and / or polypeptide) in muscle cells or tissues, specifically skeletal muscle cells or tissues and / or diaphragmatic cells or tissues, more specifically in skeletal muscle cells and / or diaphragmatic cells, compared to other (i.e., non-muscle) cells and tissues. According to certain embodiments, at least 50%, more specifically at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the (transformed) gene expression occurs within muscle cells or tissues. According to certain embodiments, cardiac-targeted expression involves “leaking” of less than 10%, less than 5%, less than 2%, or less than 1% of the expressed (transformed) gene product into organs, tissues, or cells other than muscle, such as the lungs, liver, brain, kidneys, and / or spleen. As used herein, “cardiac-and / or muscle-targeted expression” means the preferential or dominant expression of a (transformed) gene (as RNA and / or polypeptide) in cardiac and muscle cells or tissues, specifically cardiomyocytes or tissues, skeletal muscle cells or tissues and diaphragmatic cells or tissues, more specifically cardiomyocytes, skeletal muscle cells and diaphragmatic cells, compared to other (i.e., non-cardiac and-muscle) cells and tissues. According to certain embodiments, at least 50%, more specifically at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the (transformed) gene expression occurs in cardiac and muscle cells or tissues. According to certain embodiments, cardiac- and muscle-targeted expression involves "leaks" of less than 10%, less than 5%, less than 2%, or less than 1% of the expressed (transmitted) gene product to organs, tissues, or cells other than the heart and muscle, such as the lungs, liver, brain, kidneys, and / or spleen.

[0034] The same applies to (cardiac) myocyte targeting, (cardiac) muscle progenitor / stem cell targeting, (cardiac) muscle satellite cell targeting, and (cardiac) myoblast targeting expression (these can be considered special forms of cardiac- and / or muscle-targeting expression) (with necessary modifications). Throughout this application, where muscle targeting is referred to in relation to expression, (cardiac) myocyte targeting, (cardiac) muscle progenitor / stem cell targeting, (cardiac) muscle satellite cell targeting, and (cardiac) myoblast targeting expression are also explicitly assumed. Similarly, where cardiac targeting expression is used in this application, cardiomyocyte targeting, cardiomyocyte stem / progenitor cell targeting, cardiomyocyte satellite cell targeting, and cardiac myoblast targeting expression are also explicitly assumed. As used herein, the term “muscle” includes, but is not limited to, myocardial tissue, skeletal muscle tissue, and diaphragm, preferably skeletal muscle tissue and diaphragm. As used herein, the term "cardiac muscle" refers to the autonomically regulated striated muscle tissue found in the heart. As used herein, the term "skeletal muscle" refers to striated muscle tissue that is attached to the skeleton and is voluntarily controlled. Non-exclusive examples of skeletal muscle tissue include the biceps brachii, triceps brachii, quadriceps femoris, tibialis, and gastrocnemius muscles. As used herein, the term "diaphragm" refers to the sheet-like muscular tissue between the chest and abdomen. The term “muscle cell” refers to any muscle cell or muscle progenitor cell (including myoblasts, muscle progenitor / stem cells, and muscle satellite cells) in any type of muscle tissue (including smooth muscle, skeletal muscle, cardiac muscle, and diaphragm), but excludes other non-muscle cells present in muscle tissue (e.g., endothelial cells, fibroblasts, pericytes, and neurons). As used herein, the term “muscle cell” refers to a cell differentiated from a progenitor myoblast to express a muscle-specific phenotype under appropriate conditions. Terminally differentiated muscle cells fuse with each other to form myotubes, which are the main components of muscle fibers. The term “muscle cell” also refers to dedifferentiated muscle cells. This term includes in vivo and ex vivo cultured cells, whether primary or passaged cells. As used herein, the term “cardiac cell” refers specifically to the muscle cells that make up cardiac muscle tissue.

[0035] As used herein, the term "myoblast" refers to an embryonic cell in the mesoderm that differentiates to produce muscle cells. This term includes both in vivo and ex vivo cultured cells, whether primary or passaged cells. As used herein, the term "muscle progenitor / stem cell" refers to a cell that, in addition to producing differentiated offspring within a myogenic lineage, is capable of self-renewal. A specific example of a muscle progenitor / stem cell is a muscle satellite cell. This term includes in vivo and ex vivo cultured cells, whether primary or passaged cells. In embodiments, the present invention relates to nucleic acid regulatory elements for enhancing cardiac- and / or muscle-targeted gene expression, specifically cardiac- and muscle-targeted gene expression, more specifically cardiomyocyte-targeted gene expression, and comprising, or essentially consisting of, a functional fragment of a sequence selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example, 95%, 96%, 97%, 98%, or 99% identity with any of the sequences (full length) of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8, or the functional fragment being at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example, 95%, 96%, 97%, 98%, or 99% identity with respect to any of the sequences (full length) of the above, the functional fragment comprising, or essentially consisting of, the functional fragment comprising at least 20, preferably at least 25, more preferably at least 50, at least 100, at least 200, or at least 250 consecutive nucleotides from the original sequence from which it is derived. In further embodiments, the functional fragment comprises at least one, preferably at least five, more preferably at least 10, or at least 15 transcription factor binding sites (TFBS) present in the original sequence from which it is derived.

[0036] In a further embodiment, the present invention provides a nucleic acid regulatory element for enhancing cardiac- and / or muscle-targeted gene expression, specifically cardiac- and skeletal muscle-targeted gene expression, more specifically cardiomyocyte-targeted gene expression, comprising, essentially comprising, or comprising a sequence selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or any of the sequences (in their entirety). It is also possible to create nucleic acid regulatory elements, including artificial sequences, by combining two or more identical or different nucleic acid regulatory element sequences or functional fragments thereof disclosed herein. Accordingly, in certain embodiments, nucleic acid regulatory elements for enhancing cardiac- and / or muscle-targeted gene expression, specifically cardiac- and muscle-targeted gene expression, more specifically cardiomyocyte-targeted gene expression, are provided, comprising at least two sequences or functional fragments thereof selected from the group consisting of sequences having at least 90%, preferably at least 95%, for example, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and any of the sequences (in their entirety). For example, this specification discloses nucleic acid regulatory elements comprising, essentially consisting of, or comprising two, three, four, or five repeats of any one of SEQ ID NOs: 2, 3, 5, 6, 7, and 8, or a combination thereof, such as tandem repeats. The repeats can be combined in tandem, or with one or more intervening or flanking nucleotides (e.g., nucleotides used for cloning purposes) between one or more repeats.

[0037] When the regulatory element is provided as a single-stranded nucleic acid, for example when using a single-stranded AAV vector, the complementary strand is considered equivalent to the disclosed sequence. Accordingly, this Specification also discloses nucleic acid regulatory elements for enhancing cardiac- and / or muscle-targeted gene expression, specifically cardiac- and muscle-targeted gene expression, more specifically cardiomyocyte-targeted gene expression, comprising, essentially consisting of, or comprising said complement or functional fragment of a sequence selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95%, for example, 95%, 96%, 97%, 98%, or 99% identity with the sequences described herein, in particular SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and any of the sequences (in their entirety). Accordingly, this specification also discloses nucleic acid regulatory elements for enhancing cardiac- and / or muscle-targeted gene expression, specifically cardiac- and muscle-targeted gene expression, more specifically cardiomyocyte-targeted gene expression, which, under stringent conditions, include, or essentially consist of, a sequence selected from the group consisting of sequences having at least 90%, preferably at least 95%, for example, 95%, 96%, 97%, 98%, or 99% identity with any of the sequences (total length) of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and any of the sequences, a functional fragment thereof, or its complement, or a nucleic acid regulatory element consisting of said sequence, said functional fragment, or said complement. The nucleic acid regulatory elements do not need to be the same length as the sequences they hybridize with. In a preferred embodiment, the size of the nucleic acid regulatory element to be hybridized is not more than 25%, specifically 20%, more specifically 15%, and most specifically 10% in length of the sequence it hybridizes.

[0038] The expression "hybridizes under stringent conditions" refers to the ability of a nucleic acid molecule to hybridize with a target nucleic acid molecule under specified temperature and salt concentration conditions. Typically, stringent hybridization conditions are temperatures not exceeding 25°C to 30°C (e.g., 20°C, 15°C, 10°C, or 5°C) below the melting temperature (Tm) of the native double helix. The method for calculating Tm is well known in the field. As a non-limiting example, typical salt and temperature conditions for achieving stringent hybridization are 1×SSC, 0.5% SDS, and 65°C. The abbreviation SSC refers to the buffer used in nucleic acid hybridization solutions. One liter of 20× (20-fold concentrate) stock SSC buffer (pH 7.0) contains 175.3 g of sodium chloride and 88.2 g of sodium citrate. A typical time to achieve hybridization is 12 hours.

[0039] Preferably, the nucleic acid regulatory elements described herein are limited in length but fully functional. This allows them to be used in vectors or nucleic acid expression cassettes without excessively limiting the maximum load. Therefore, in embodiments, the nucleic acid regulatory elements disclosed herein are nucleic acids of 2000 nucleotides or less, 1800 nucleotides or less, 1700 nucleotides or less, 1500 nucleotides or less, 1000 nucleotides or less, 900 nucleotides or less, 800 nucleotides or less, 700 nucleotides or less, more preferably 600 nucleotides or less, for example, 550 nucleotides or less, 500 nucleotides or less, 450 nucleotides or less, 400 nucleotides or less, 350 nucleotides or less, or 300 nucleotides or less (i.e., the nucleic acid regulatory elements have a maximum length of 2000 nucleotides, 1800 nucleotides, 1700 nucleotides, 1500 nucleotides, 1000 nucleotides, 900 nucleotides, 800 nucleotides, 700 nucleotides, preferably 600 nucleotides, for example, 550 nucleotides, 500 nucleotides, 450 nucleotides, 400 nucleotides, 350 nucleotides or 300 nucleotides; Alternatively, the nucleic acid regulatory element may be up to 2000 nucleotides long, 1800 nucleotides long, 1700 nucleotides long, 1500 nucleotides long, 1000 nucleotides long, 900 nucleotides long, 800 nucleotides long, 700 nucleotides long, preferably 600 nucleotides long, for example, 550 nucleotides long, 500 nucleotides long, 450 nucleotides long, 400 nucleotides long, 350 nucleotides long, or 300 nucleotides long; or 2000 nucleotides or less, 1800 nucleotides or less, 1700 nucleotides or less, 1500 nucleotides or less, 1000 nucleotides or less, 900 nucleotides or less, 800 nucleotides or less, 700 nucleotides or less, more preferably 600 nucleotides or less, for example, 550 nucleotides or less, 500 nucleotides or less, 450 nucleotides or less, 400 nucleotides or less, 350 nucleotides or less, or 300 nucleotides or less (the nucleic acid regulatory element is 2000 nucleotides or less, 500 nucleotides or less, 450 nucleotides or less, 400 nucleotides or less, 350 nucleotides or less, or 300 nucleotides or less).

[0040] However, it is understood that the disclosed nucleic acid regulatory elements retain regulatory activity (i.e., with respect to transcriptional specificity and / or activity) and therefore have minimum lengths of 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, or 400 nucleotides. The nucleic acid regulatory elements disclosed herein may be used in nucleic acid expression cassettes. Therefore, in a certain view, the present invention provides the use of the nucleic acid regulatory elements described herein in nucleic acid expression cassettes. In a certain view, the present invention provides a nucleic acid expression cassette comprising nucleic acid regulatory elements described herein, operably linked to a promoter. In embodiments, the nucleic acid expression cassette does not include a transgene. This nucleic acid expression cassette can be used to drive the expression of an endogenous gene. In preferred embodiments, the nucleic acid expression cassette comprises a promoter and nucleic acid regulatory elements described herein, operably linked to a transgene.

[0041] As used herein, the term “nucleic acid expression cassette” means a nucleic acid molecule comprising one or more transcriptional regulatory elements (e.g., promoters, enhancers and / or regulatory elements, polyadenylated sequences and introns, etc.) that lead to (trans)gene expression in one or more desired cell types, tissues or organs. Typically, a nucleic acid expression cassette contains a transgene, but it can also be envisioned as leading to the expression of an endogenous gene in a cell into which the nucleic acid expression cassette is inserted. As used herein, “operatably linked” means an arrangement of various nucleic acid molecular elements such that they are functionally linked and able to interact with one another. These elements include, but are not limited to, promoters, enhancers and / or regulatory elements, polyadenylated sequences, one or more introns and / or exons, and the coding sequences of genes intended for expression (i.e., transgenes), including transgenes expressing non-coding RNA as defined elsewhere herein. When nucleic acid sequence elements are correctly oriented or operatably linked, they can act together to modulate each other's activity and ultimately affect the expression level of the transgene. Modulation means increasing, decreasing, or maintaining the activity level of a particular element. The position of each element relative to other elements may be expressed with respect to the 5' and 3' ends of each element, and the distance between any particular elements may be referred to in terms of the number of intervening nucleotides or base pairs between them. As will be understood by those skilled in the art, “operatably linked” means functional activity and is not necessarily related to native positional relationships. In practice, when used in nucleic acid expression cassettes, regulatory elements are typically located immediately upstream of the promoter (this is generally true, but should not be interpreted as a limitation or exclusion of location within the nucleic acid expression cassette), but this is not required in vivo. For example, a regulatory element sequence that naturally exists downstream of a gene and affects the transcription of that gene can function in the same way when located upstream of the promoter. Therefore, according to certain embodiments, the regulatory or enhancing effect of a regulatory element is location-independent.

[0042] In certain embodiments, the nucleic acid expression cassette includes one nucleic acid regulatory element as described herein. In alternative embodiments, the nucleic acid expression cassette includes two or more nucleic acid regulatory elements as described herein, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10. That is, the nucleic acid regulatory elements are modularly combined to enhance their regulatory (and / or enhancing) effect. In further embodiments, at least two of the two or more nucleic acid regulatory elements are identical or substantially identical. Also in further embodiments, all of the two or more regulatory elements are identical or substantially identical. Copies of identical or substantially identical nucleic acid regulatory elements may be provided as tandem repeats in the nucleic acid expression cassette. In alternative further embodiments, at least two of the two or more nucleic acid regulatory elements are different from each other, i.e., defined by different sequence numbers. The nucleic acid expression cassette may also include combinations of identical and substantially identical nucleic acid regulatory elements and non-identical nucleic acid regulatory elements. At least two nucleic acid regulatory elements can be combined in tandem, or one or more intervening or flanking nucleotides (e.g., nucleotides used for cloning purposes) can be combined between one or more regulatory elements. As used in this application, the term “promoter” means a nucleic acid sequence that directly or indirectly regulates the transcription of a nucleic acid coding sequence (e.g., an introduced gene or an endogenous gene) to which it is operably ligated. A promoter may function alone to regulate transcription, or it may function in conjunction with one or more other regulatory sequences (e.g., enhancers or silencers, or regulatory elements). In the context of this application, a promoter is typically operably ligated to a regulatory element disclosed herein to regulate the transcription of an (introduced) gene. When a regulatory element as described herein is operably linked to both a promoter and a transgene, the regulatory element can (1) confer a significant degree of cardiac- and / or muscle-targeting, specifically cardiac- and muscle-targeting, more specifically cardiomyocyte-targeting expression of the transgene in vivo (and / or cardiac and / or muscle cells or tissues, specifically cardiac and muscle cells or tissues, more specifically cardiomyocytes, or cell lines derived in vitro from cardiac and / or muscle cells or tissues), and / or (2) increase the expression level of the transgene in cardiac and / or muscle cells or tissues, specifically cardiac and muscle cells or tissues, more specifically cardiomyocytes (and / or cardiac and / or muscle cells or tissues, in particular cardiomyocytes, or cell lines derived in vitro from cardiac and / or muscle cells or tissues).

[0043] The promoter may be of the same species (i.e., derived from the same species as the animal transfecting the nucleic acid expression cassette, particularly mammals) or of a different species (i.e., derived from a source other than the animal transfecting the expression cassette, particularly mammals). Thus, the source of the promoter may be any virus, any single-celled prokaryote or eukaryote, any vertebrate or invertebrate, or any plant, as long as the promoter functions in combination with the regulatory elements described herein, and may also be a synthetic promoter (i.e., a promoter having a sequence not found in nature). In a preferred embodiment, the promoter is a mammalian promoter, particularly a mouse or human promoter. Furthermore, the promoter does not necessarily have to be the promoter of the transgene in the nucleic acid expression cassette; the transgene can also be transcribed from its own promoter. In the embodiment, the promoter may be heterogeneous with respect to the regulatory element; that is, the promoter does not need to be the promoter of the regulatory element in the nucleic acid expression cassette. The promoter may be an inductive promoter or a constitutive promoter.

[0044] The nucleic acid regulatory elements disclosed herein, in principle, induce cardiac- and / or muscle-targeted, more specifically cardiac- and muscle-targeted, and more specifically cardiomyocyte-targeted expression, even from promoters that are not cardiac- and / or muscle-specific themselves (e.g., CAG promoter, CMV promoter). Therefore, the regulatory elements disclosed herein can be used in nucleic acid expression cassettes in combination with any promoter, specifically, the promoter may be tissue-specific, e.g., cardiac- and / or muscle-specific, or may be ubiquitously expressed. Non-limiting examples of ubiquitously expressed promoters include the cytomegalovirus (CMV) promoter, the RNA polymerase II (pol II) promoter, the RNA polymerase III (pol III) promoter (e.g., the U6 pol III promoter, particularly the human U6 micronucleus promoter (U6), or the H1 pol III promoter, particularly the human H1 promoter (H1)), and the chimeric pol III promoter. In certain embodiments, the promoter is SEQ ID NO: 15 () It is a CMV promoter defined by [the specified method].

[0045] These ubiquitously expressed promoters may be suitable for the expression of non-coding RNAs. In the embodiment, the promoter is an RNA polymerase promoter, preferably an RNA polymerase II (pol II) promoter or an RNA polymerase III (pol III) promoter. In embodiments, the nucleic acid expression cassettes disclosed herein are cardiac- and / or muscle-targeting promoters, more preferably cardiac- and muscle-targeting promoters. As used herein, a cardiac- and / or muscle-targeting promoter means a promoter that preferentially or predominantly expresses a (trans) gene in cardiac and / or muscle cells or tissues, and / or minimizes the expression of the (trans) gene in other (i.e., non-cardiac and / or muscle) cells and tissues. As used herein, a cardiac- and muscle-targeting promoter means a promoter that preferentially or predominantly expresses a (trans) gene in cardiac and muscle cells or tissues, and / or minimizes the expression of the (trans) gene in other (i.e., non-cardiac and muscle) cells and tissues. The use of cardiac- and / or muscle-targeting promoters, in particular cardiac- and muscle-targeting promoters, can increase targeted expression in cardiac and / or muscle, particularly targeted expression in cardiac and muscle, and / or avoid or reduce leakage of (trans) gene expression in other tissues or cells.Non-limiting examples of cardiac- and / or muscle-targeting promoters include: desmin (DES) promoter; α-actin 1 promoter (ACTA1); creatine kinase, muscle (CKM) promoter; 4.5LIM domain protein 1 (FHL1) promoter; α2-actinin (ACTN2) promoter; filamin-C (FLNC) promoter; sarcoplasmic reticulum / endoplasmic reticulum calcium ATPase 1 (ATP2A1) promoter; troponin I type 1 (TNNI1) promoter; troponin I type 2 (TNNI2) promoter; and Troponin T type 1 (TNNT1) promoter; Troponin T type 2 (TNNT2) promoter; Troponin T type 3 (TNNT3) promoter; Myosin-1 (MYH1) promoter; Myosin-2 (MYH2) promoter; Sarcolipin (SLN) promoter; Myosin-binding protein C1 (MYBPC1) promoter; Enolase (EN03) promoter; Carbonic anhydrase 3 (CA3) promoter; Phosphorylated fast-twitch skeletal muscle myosin light chain (MYLPF) promoter; Tropomyosin 1 (TPM1) promoter; Tropomyosin Myosin 2 (TPM2) promoter; α-3 chain tropomyosin (TPM3) promoter; Ankyrin repeat domain protein 2 (ANKRD2) promoter; Myosin heavy chain (MHC) promoter; Alpha myosin heavy chain (αMHC) promoter; Myosin light chain (MLC) promoter, e.g., human myosin light chain (hMLC) promoter; Muscle creatine kinase (MCK) promoter; Myosin light chain 1 (MYL1) promoter; Myosin light chain 2 (MYL2) promoter; Myoglobin (MB) promoter; Troponin C promoter Examples include the troponin type 1 (TNNC1) promoter; the troponin C type 2 (TNNC2) promoter; the titin-cap (TCAP) promoter; the myosin heavy chain 7 (MYH7) promoter; the aldolase A (ALDOA) ​​promoter; the myosin heavy chain 11 (Myh11) promoter; the transgerin (Tagln) promoter (also known as the SM22α promoter); the actin α2 and smooth muscle (Acta2) promoters; the SPc5-12 promoter; the dMCK promoter; the tMCK promoter; and the MHCK7 promoter.

[0046] In a preferred embodiment, the promoter is a cardiac- and / or muscle-targeting promoter selected from the group consisting of the hMLC promoter, the SPc5-12 promoter, the DES promoter, and the MHCK7 promoter. In this embodiment, the promoter is a cardiac- and / or muscle-targeting promoter selected from the group consisting of the SPc5-12 promoter, the DES promoter, and the MHCK7 promoter. The SPc5-12 promoter (sometimes called SPC-5-12-GTRM, but this term is used interchangeably herein) is a synthetic promoter described by Li et al. (1999. Nat Biotechnol. 17:241-245). In a particular embodiment, the promoter is SEQ ID NO: 11 (tggccaccgccttcggcaccatcctcacgacacccaaatatggcgacgggtgaggaatggtggggagttatttttagagcggtgaggaaggtgggcaggcagcaggtgttggcgctctaaaaataactcccgggagttatttttagagcggaggaatggtggacacc caaatatggcgacggttcctcacccgtcgccatatttgggtgtccgccctcggccggggccgcattcctgggggccgggcggtgctcccgcccgcctcgataaaaggctccggggccggcggcggcccacgagctacccggaggagcgggaggcgccaagctctaga) The SPc5-12 promoter is defined by [specified by]. The MHCK7 promoter is a synthetic skeletal muscle and cardiac muscle targeting promoter, described by Salva et al. (2007. Mol Ther 15: 320-9). In certain embodiments, the promoter is SEQ ID NO: 14 () hMLC pro motor motor

[0047] In embodiments, the promoter is a mammalian cardiac-and / or muscle-targeting promoter, particularly a mouse or human cardiac-and / or muscle-targeting promoter. In embodiments, the promoter is a synthetic cardiac-and / or muscle-targeting promoter. Non-limiting examples of synthetic cardiac-and / or muscle-targeting promoters are described by Li et al. (1999, Nat Biotechnol. 17:241-245) and include, for example, the SPc5-12 promoter, the dMCK promoter, the tMCK promoter, and the MHCK7 promoter. The dMCK and tMCK promoters each consist of a double or triple tandem of an MCK enhancer relative to the MCK basal promoter, as described by Wang et al. (2008, Gene Ther, 15:1489-1499). To minimize the length of the nucleic acid expression cassette, regulatory elements may be concatenated to a minimal promoter or a shortened version of the promoter described herein. As used herein, a “minimal promoter” (also called a basic promoter or core promoter) is a portion of a full-length promoter that is still capable of driving expression but lacks at least a portion of sequences that contribute to the regulation of expression (e.g., tissue-targeted). This definition covers both promoters that lack a (tissue-targeted) regulatory element and are capable of driving gene expression but have lost the ability to express the gene in a tissue-targeted manner, and promoters that lack a (tissue-targeted) regulatory element and are capable of driving (possibly reduced) gene expression but have not necessarily lost the ability to express the gene in a tissue-targeted manner. Preferably, promoters included in the nucleic acid expression cassettes disclosed herein have a length of 1000 nucleotides or less, 900 nucleotides or less, 800 nucleotides or less, 700 nucleotides or less, 600 nucleotides or less, 500 nucleotides or less, 400 nucleotides or less, 300 nucleotides or less, or 250 nucleotides or less.

[0048] As used herein, the term "transgene" refers to a specific nucleic acid sequence that encodes a polypeptide or a portion of a polypeptide to be expressed in the cell into which the nucleic acid sequence is introduced. However, a transgene can also be expressed as a non-coding RNA, for example, to control (e.g., reduce) the amount of a specific polypeptide in the cell into which the nucleic acid sequence is inserted. The method for introducing the nucleic acid sequence into cells is not essential to the present invention and may, for example, be introduced by integration into the genome or as an episomal plasmid. Notably, the expression of the introduced gene may be limited to a subset of cells into which the nucleic acid sequence has been introduced. The term “introduced gene” is defined as (1) a nucleic acid sequence not found naturally in the cell (i.e., a heterologous nucleic acid sequence); (2) a nucleic acid sequence that is a variant of a nucleic acid sequence found naturally in the cell into which it is introduced; (3) a nucleic acid sequence that works to add a further copy of the same (i.e., homologous) or similar nucleic acid sequence found naturally in the cell into which it is introduced; or (4) a silent, naturally occurring or homologous nucleic acid sequence whose expression is induced in the cell into which it is introduced.

[0049] The introduced gene may be homologous or heterogeneous with respect to the promoter (and / or (for example, if a nucleic acid expression cassette is used in gene therapy) the animal into which the introduced gene is introduced, particularly a mammal). The transgene may be a full-length cDNA or a genomic DNA sequence, or it may be any fragment, subunit, or mutant that has at least some biological activity. Specifically, the transgene may be a minigene, i.e., a gene sequence lacking some, most, or all intron sequences. Thus, the transgene may, in some cases, contain intron sequences. In some cases, the transgene may be a hybrid nucleic acid sequence, i.e., constructed from homogeneous and / or heterogeneous cDNA and / or genomic DNA fragments. A “mutant” means a nucleic acid sequence containing one or more nucleotides different from the wild-type or naturally occurring sequence; i.e., a mutant nucleic acid sequence includes one or more nucleotide substitutions, deletions, and / or insertions. Nucleotide substitutions, deletions, and / or insertions can produce a gene product (i.e., a protein or nucleic acid) whose amino acid / nucleic acid sequence differs from that of the wild-type amino acid / nucleic acid sequence. The production of such mutants is well known in the art. In some cases, the transgene may also include a sequence encoding a leader peptide or signal sequence so that the product of the transgene is secreted from the cell.

[0050] In certain embodiments, the transgene is codon-optimized. As used herein, the terms “codon-optimized,” “codon-optimized,” and similar expressions refer to altering the nucleic acid sequence, particularly the codon composition of a transgene, without altering its amino acid sequence, for optimal expression in, for example, a host cell or organism. Codon optimization of a transgene can further enhance the cardiac- and muscle-targeted expression of the transgene. The size of the transgene contained in the nucleic acid expression cassettes and vectors described herein is not particularly limited, but can be determined by the packaging capacity of the vector, as will be readily apparent to those skilled in the art. In embodiments, for example, when using an AAV vector, the transgene contained in the nucleic acid expression cassette disclosed herein has a length of 5 kb or less, for example, 4 kb or less, 3 kb or less, or 2 kb or less. In embodiments, for example, when using an adenovirus vector, the transgene contained in the nucleic acid expression cassette disclosed herein has a length of 36 kb or less, for example, 35 kb or less, 30 kb or less, 25 kb or less, 20 kb or less, or 15 kb or less. In embodiments, for example, when using a lentiviral vector, the transgene contained in the nucleic acid expression cassette disclosed herein has a length of 10 kb or less, for example, 8 kb or less, 6 kb or less, 5 kb or less, or 4 kb or less.

[0051] The transgenes that may be included in the nucleic acid expression cassettes described herein typically encode gene products such as RNA or polypeptides (proteins). In some embodiments, the transgene encodes non-coding RNA (ncRNA). As used herein, “non-coding RNA” means RNA molecules that are transcribed from DNA but not translated into proteins. These non-coding RNA molecules include, but are not limited to, molecules that exert their function through RNA interference (e.g., short hairpin RNA (shRNA), small interfering RNA (siRNA)), microRNA regulation (miRNA) (which can be used to control the expression of specific genes), long non-coding RNA (lncRNA), circular RNA (cRNA), catalytic RNA, antisense RNA, RNA aptamers, and guide RNA used in connection with the CRISPR system. In further embodiments, the transgene encodes non-coding RNA selected from microRNA, long non-coding RNA, circular RNA, and short interfering RNA. In embodiments, the transgene encodes a therapeutic protein. Non-limiting examples of transgenes encoding therapeutic proteins include: transgenes encoding angiogenic factors for therapeutic angiogenesis (e.g., VEGF, PlGF, or guidance molecules such as ephrin, semaphorin, slitz, and netrin, or their related receptors); transgenes encoding coagulation factors (e.g., factor VIII or factor IX); transgenes encoding insulin; transgenes encoding lipoprotein lipases; transgenes encoding plasma factors; cytokines, chemokines, and / or growth factors. Factors (e.g., erythropoietin (EPO), interferon-α, interferon-β, interferon-γ, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8 (IL-8), interleukin-9 (IL-9), interleukin-10 (IL-10), interleukin-11 (IL-11), Transgenes encoding interleukin-12 (IL-12), chemokine (CXC motif) ligand 5 (CXCL5), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), macrophage colony-stimulating factor (M-CSF), stem cell factor (SCF), keratinocyte growth factor (KGF), monocyte chemoattraction protein-1 (MCP-1), and tumor necrosis factor (TNF); transgenes encoding proteins involved in calcium handling (e.g., sarcoplasmic reticulum / endoplasmic reticulum Ca2+-ATPase (SERCA), phospholamban, calcechestrin, sodium-calcium exchanger, L-type calcium channel, ryanodine receptor); transgenes encoding calcineurin; transgenes encoding microdystrophin; transgenes encoding follistatin (FST); transgenes encoding myotubularin 1 (MTM1); transgenes encoding dysferin; transgenes encoding dystrophin; transgenes encoding metabolic enzymes; transgenes encoding nucleoproteins;Transgenes encoding mitochondrial proteins (e.g., tafadin); transgenes encoding lysosomal proteins (e.g., acid α-glucosidase (GAA) (as secreted or native form), α-galactosidase A, LAMP2); transgenes encoding ion channels (e.g., SCN5A); transgenes encoding enzymes involved in glycogen metabolism (e.g., glycogen synthase (GYS2), glycogen debranchase (AGL), glycogen branching enzyme (GBE1), muscle glycogen phosphorylase (PYGM), muscle phosphofructokinase (PKFM), phosphoglycerate mutase (PGAM2), aldolase A (ALDOA), β-enolase (ENO3), or glycogenin 1 (GYG1)); transgenes encoding enzymes deficient in mucopolysaccharidosis (e.g., α-L-iduronidase, iduronate sulfatase, heparin). Examples of transgenes include those encoding nsulfamidase, N-acetylglucosaminidase, heparan-α-glucosaminide N-acetyltransferase, N-acetylglucosamine-6-sulfatase, galactose-6-sulfatase, β-galactosidase, N-acetylgalactosamine-4-sulfatase, β-glucuronidase, or hyaluronidase; transgenes encoding sarcoglycans (e.g., α-sarcoglycan, β-sarcoglycan, and γ-sarcoglycan); transgenes encoding anoctamin 5; transgenes encoding calpain 3; transgenes encoding antibodies, transgenes encoding nanobodies, transgenes encoding antiviral dominant-negative proteins; and transgenes encoding fragments, subunits, or variants of any of these therapeutic proteins. In certain embodiments, the transgene encodes acid α-glucosidase (GAA) (e.g., GAA as secreted or innate). In certain embodiments, the transgene encodes a sarcoglycan, particularly a sarcoglycan selected from α-sarcoglycan, β-sarcoglycan, and γ-sarcoglycan, preferably β-sarcoglycan. In certain embodiments, the transgene encodes an antibody or a nanobody.

[0052] In embodiments, the transgene encodes an immunogenic protein. As used herein, the term "immunogenic" refers to a substance or composition that can induce an immune response. Non-limiting examples of immunogenic proteins include pathogen-derived epitopes and antigens. Typically, other sequences (e.g., introns and / or polyadenylated sequences) may also be incorporated into the nucleic acid expression cassette disclosed herein to further increase or stabilize the expression of the transgene product. Any intron can be used in the expression cassettes described herein. The term “intron” encompasses any portion of an entire intron that is large enough to be recognized and spliced ​​by the nuclear splicing apparatus. Typically, short, functional intron sequences are preferred to minimize the size of the expression cassette and facilitate its construction and manipulation. In some embodiments, the intron is obtained from a gene encoding a protein encoded by a coding sequence in the expression cassette. The intron can be located at the 5' end of the coding sequence, at the 3' end of the coding sequence, or within the coding sequence. The advantage of placing the intron at the 5' end of the coding sequence is that it minimizes the possibility of the intron interfering with the function of the polyadenylation signal. In embodiments, the nucleic acid expression cassettes disclosed herein further include introns. Non-restrictive examples of appropriate introns include mouse microvirus (MVM) introns, beta-globin introns (betaIVS-II), factor IX (FIX) intron A, Simianvirus 40 (SV40) small t introns, and beta-actin introns.

[0053] Preferably, the intron is an MVM intron, more preferably SEQ ID NO: 12 (aagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttgg) It is an MVM intron as defined by [the relevant documentation]. Any polyadenylation signal that directs the synthesis of a polyA tail (also referred herein as a "polyadenylation site," "polyA," or "pA") is useful in the expression cassette described herein, and examples thereof are well known to those skilled in the art. Exemplary polyadenylation signals include, but are not limited to, the polyA sequence derived from the late Simian virus 40 (SV40) gene, the bovine growth hormone (BGH) polyadenylation signal, the minimal rabbit β-globin (mRBG) gene, and synthetic polyA sites (SPAs or synthetic pAs) such as the synthetic pA site described by Levitt et al. (1989, Genes Dev 3:1019-1025). Preferably, the polyadenylation signal is a synthetic polyadenylation signal, more preferably SEQ ID NO: 13. (aataaaagatctttattttcattagatctgtgtgttggttttttgtgtg) This is a polyadenylation signal defined by [the specified method / function]. In certain embodiments, the present invention provides a nucleic acid expression cassette comprising a nucleic acid regulatory element comprising a sequence selected from the group consisting of sequences having at least 95% identity to sequence numbers 2, 3, 5, 6, 7, and 8 or any one of the sequences (in full length), operably linked to a promoter, preferably an SPc5-12 promoter (preferably the SPc5-12 promoter as defined by sequence number 11), and a transgene. In further embodiments, the nucleic acid expression cassette further comprises an MVM intron (preferably the MVM intron as defined by sequence number 12). In even further embodiments, the nucleic acid expression cassette further comprises a polyadenylation signal, preferably a synthetic polyadenylation signal, more preferably a polyadenylation signal as defined by sequence number 13.

[0054] The nucleic acid regulatory elements and nucleic acid expression cassettes disclosed herein may be used as is, or typically as a portion of a nucleic acid vector. Therefore, a further point of view concerns the use of the nucleic acid regulatory elements or nucleic acid expression cassettes described herein in vectors, particularly nucleic acid vectors. In a certain view, the present invention also provides a vector comprising a nucleic acid regulatory element disclosed herein. In a further embodiment, the vector comprises a nucleic acid expression cassette disclosed herein. As used in this application, the term "vector" refers to a nucleic acid molecule, such as double-stranded DNA, which may contain another nucleic acid molecule (inserted nucleic acid molecule) (e.g., a cDNA molecule, but not limited to cDNA). The vector is used to transport the inserted nucleic acid molecule to a suitable host cell. The vector may contain necessary elements that enable the transcription of the inserted nucleic acid molecule and, optionally, the translation of the transcript into a polypeptide. The inserted nucleic acid molecule may originate from a host cell or from a different cell or organism. Once inside the host cell, the vector may replicate independently of or simultaneously with the host's chromosomal DNA, and several copies of the vector and its inserted nucleic acid molecule may be produced. The vector may be an episomal vector (i.e., not integrated into the host cell's genome) or a vector that is integrated into the host cell's genome. Thus, the term "vector" can be defined as a gene delivery vehicle that facilitates gene delivery to a target cell. This definition includes both non-viral and viral vectors. Nonviral vectors include, but are not limited to, cationic lipids, liposomes, nanoparticles, PEG, PEI, plasmid vectors (e.g., pUC vectors, BlueScript vectors (pBS) and pBR322, or their derivatives lacking bacterial sequences (minicircles)), and transposon vectors (e.g., PiggyBac (PB) vectors or Sleeping Beauty (SB) vectors). Viral vectors are derived from viruses and include, but are not limited to, retroviral vectors, lentiviral vectors, adeno-associated virus vectors, adenovirus vectors, herpesvirus vectors, and hepatitis virus vectors. Typically (but not always), viral vectors are replication-deficient because the viral genes essential for replication have been removed, thus losing the ability to proliferate in a given cell. However, some viral vectors can be adapted to specifically replicate in a given cell (e.g., cancer cells), and are typically used to induce (cancer) cell-specific (tumor) lysis.Virosoms are a non-limiting example of vectors containing both viral and non-viral elements. Specifically, virosoms combine liposomes with inactivated HIV or influenza virus (Yamada et al., 2003). Another example includes viral vectors mixed with cationic lipids.

[0055] In preferred embodiments, the vector is a viral vector, such as a retroviral vector, lentiviral vector, adenovirus vector, or adeno-associated virus (AAV) vector, preferably an AAV vector, lentiviral vector, or adenovirus vector, and more preferably an AAV vector. The AAV vector is preferably used as a self-complementary double-stranded AAV vector (scAAV) to overcome one of the limiting steps in AAV transduction (i.e., conversion from single-stranded AAV to double-stranded AAV) (McCarty, 2001, 2003; Nathwani et al., 2002, 2006, 2011; Wu et al., 2008), although the use of a single-stranded AAV vector (ssAAV) is also included herein. Any AAV serotype can be used. The selection of the AAV serotype may be determined by the intended use and / or the host organism. In embodiments, the vector is an AAV serotype, e.g., AAV9, that achieves efficient transduction in cardiac and / or muscle tissue or cells. The vector may be an AAV vector in which the AAV capsid has been engineered to induce the vector in a specific tissue or cell of interest, e.g., cardiac and / or muscle tissue or cells. The production of AAV vector particles can be done, for example, by transient transfection of suspension-adapted mammalian HEK293 cells, as described (Chahal et al., Production of adeno-associated virus (AAV) serotypes by transient transfection of HEK293 cell suspension cultures for gene delivery, Journal of Virological Methods. 196: 163-173 (2014); Grieger et al., Production of recombinant adeno-associated virus vectors using suspension HEK293 cells and continuous harvest of vector from the culture media for GMP FIX and FLT1 clinical vector. Molecular Therapy. 24: 287-297 (2016); Blessing et al., Scalable Production of AAV Vectors in Orbitally Shaken HEK293 Cells. Molecular Therapy Methods & Clinical Development. 13: 14-26 (2019)), or by transient transfection of suspension-adapted mammalian HEK293 cells, as described (Kotin et al., Manufacturing Clinical Grade Recombinant Adeno-Associated This can be achieved by infecting Spodoptera frugiperda (Sf9) insect cells using a baculovirus expression vector system (BEVS) and then purifying the virus. (Virus Using Invertebrate Cell Lines. Human Gene Therapy. 28: 350-360 (2017))Purification may be carried out by ultracentrifugation with a cesium chloride (CsCl) density gradient, as described (VandenDriessche et al., 2007), or by chromatographic techniques or columns, or by immunoaffinity known in the art.

[0056] In other embodiments, the vector is a nonviral vector, preferably a plasmid, minicircle, or transposon-based vector, such as a Sleeping Beauty (SB)-based vector or a piggyBac (PB)-based vector. In yet another embodiment, the vector includes a viral element and a non-viral element. In a particular embodiment, the vector is provided comprising a nucleic acid expression cassette comprising a sequence selected from the group consisting of SEQ ID NOs: 2, 3, 5, 6, 7, and 8, or a sequence having at least 95% identity to any one of these sequences (in full length), or a nucleic acid regulatory element comprising such sequence, a promoter, preferably an SPc5-12 promoter (more preferably an SPc5-12 promoter as defined by SEQ ID NO: 11), an MVM intron (preferably an MVM intron as defined by SEQ ID NO: 12), a transgene, and a polyadenylation signal, preferably a synthetic polyadenylation signal, more preferably a polyadenylation signal as defined by SEQ ID NO: 13. The nucleic acid expression cassettes and vectors disclosed herein may be used, for example, to express proteins that are normally expressed and utilized in cardiac and / or muscle cells or tissues (i.e., structural proteins), or to express proteins that are expressed in muscle cells or tissues and subsequently exported into the bloodstream for transport to other parts of the body (i.e., secretible proteins). For example, the expression cassettes and vectors disclosed herein may be used for therapeutic purposes, particularly for gene therapy, to express therapeutic amounts of gene products (e.g., polypeptides, particularly therapeutic proteins, or RNA). Typically, the gene product is encoded by a transgene within the expression cassette or vector, but in principle, it is also possible to increase the expression of endogenous genes for therapeutic purposes. In an alternative example, the expression cassettes and vectors disclosed herein may be used for vaccination purposes to express immunological amounts of gene products (e.g., polypeptides, particularly immunogenic proteins, or RNA).

[0057] The nucleic acid expression cassettes and vectors taught herein may be incorporated into a pharmaceutical composition together with pharmaceutically acceptable excipients, i.e., one or more pharmaceutically acceptable carrier substances and / or additives, such as buffers, carriers, excipients, stabilizers, etc. The pharmaceutical composition may be provided in the form of a kit. As used herein, the term "pharmaceutically acceptable" means, in accordance with the art, compatibility with other components of a pharmaceutical composition and no harmful effects on the recipient. Therefore, a further aspect of the present invention relates to pharmaceutical compositions comprising nucleic acid expression cassettes or vectors as described herein. The use of nucleic acid modulating elements described herein for the manufacture of these pharmaceutical compositions is also disclosed herein.

[0058] In embodiments, the pharmaceutical composition may be a vaccine. The vaccine may further contain one or more adjuvants for enhancing the immune response. Suitable adjuvants include, but are not limited to, saponins, mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyols, polyanions, peptides, oils or hydrocarbon emulsions, Bacillus calmette-Guérin (BCG), Corynebacterium parvum, and the synthetic adjuvant QS-21. Optionally, the vaccine may further contain one or more immunostimulatory molecules. Non-limiting examples of immunostimulatory molecules include various cytokines, lymphokines, and chemokines with immunostimulatory, immunoenhancing, and pro-inflammatory activities, such as interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-12, IL-13); growth factors (e.g., granulocyte-macrophage (GM) colony-stimulating factor (CSF)); and other immunostimulatory molecules, such as macrophage inflammatory factors, Flt3 ligands, B7.1; B7.2. In a further view, the present invention relates to nucleic acid regulatory elements, nucleic acid expression cassettes, vectors, or pharmaceutical compositions described herein for use in pharmaceuticals. As used herein, the terms “to treat” or “treatment” refer to both therapeutic and preventive measures. Beneficial or desirable clinical outcomes include, but are not limited to, prevention of undesirable clinical conditions or disabilities, whether detectable or undetectable; reduction of the incidence of disability; relief of symptoms associated with disability; reduction of the extent of disability; stabilization of disability (i.e., no worsening); delay or slowing of the progression of disability; improvement or mitigation of the disability; remission (partial or whole); or a combination thereof. “Treatment” may also mean extending survival compared to the survival expected without treatment. As used herein, the terms “therapeutic treatment” or “therapy” and similar expressions mean treatments whose purpose is to move a person’s body or its components from an undesirable physiological change or disorder to a desirable state, such as a less severe or less unpleasant state (e.g., improvement or alleviation), or to a normal and healthy state (e.g., to restore the person’s health, physical integrity and physical well-being), or to keep the undesirable physiological change or disorder at a certain level (e.g., to stabilize or prevent worsening), or to prevent or delay progression to a state more severe or worse than the undesirable physiological change or disorder.

[0059] As used herein, the terms “prevention” or “preventive measures” and similar expressions encompass the prevention of the onset of a disease or disorder (including reducing the severity of a disease or disorder or related symptoms before onset). Such pre-onset prevention or reduction means administering the nucleic acid modulating elements, nucleic acid expression cassettes, vectors, or pharmaceutical compositions described herein to patients who are not exhibiting clear symptoms of the disease or disorder at the time of administration. “Prevention” includes preventing the recurrence of a disease or disorder, for example, after a period of improvement. Further perspectives relate to nucleic acid regulatory elements, nucleic acid expression cassettes, vectors, or pharmaceutical compositions described herein for use in gene therapy, specifically cardiac and / or muscle (cell or tissue)-targeted gene therapy, and more specifically cardiac and muscle (cell or tissue)-targeted gene therapy. Furthermore, the use of nucleic acid regulatory elements, nucleic acid expression cassettes, vectors, or pharmaceutical compositions described herein for gene therapy, specifically cardiac and / or muscle (cell or tissue)-targeted gene therapy, and more specifically for the manufacture of pharmaceuticals for cardiac and muscle (cell or tissue)-targeted gene therapy is also disclosed herein.

[0060] Furthermore, this specification includes methods for gene therapy, specifically cardiac and / or muscle (cell or tissue)-targeted gene therapy, and more specifically cardiac and muscle (cell or tissue)-targeted gene therapy, for subjects requiring gene therapy: - To introduce a nucleic acid expression cassette, vector, or pharmaceutical composition described herein into a target, specifically the target cardiac and / or muscle cells, more specifically the target cardiac and muscle cells, and even more specifically the target cardiomyocytes, wherein the nucleic acid expression cassette, vector, or pharmaceutical composition comprises a promoter and a nucleic acid regulatory element described herein operably linked to the transgene; and - To express a therapeutically effective dose of the transgene product in the target, specifically in the target cardiac and / or muscle cells, more specifically in the target cardiac and muscle cells, and even more specifically in the target cardiomyocytes. A method including the following is disclosed. The transgene product may be a polypeptide, particularly a therapeutic protein. Non-limiting examples of therapeutic proteins are disclosed above in relation to the transgene. The therapeutic protein may also be a secreted protein. Non-limiting examples of secreted proteins, particularly secreted therapeutic proteins, include coagulation factors, e.g., factor VIII or factor IX, secreted form of GAA, insulin, erythropoietin, lipoprotein lipase, antibodies or nanobodies, growth factors, cytokines, chemokines, metabolic enzymes, plasma factors, etc. The therapeutic protein may also be a non-secreted protein. Non-limiting examples of non-secreted proteins include intracellular proteins, metabolic enzymes (e.g., tafadin), organelle-targeting proteins (e.g., lysosomal proteins such as GAA, nucleoproteins), etc. The therapeutic protein may also be a structural protein. Non-limiting examples of structural proteins, particularly structural therapeutic proteins, include dystrophin and sarcoglycans.

[0061] Alternatively, the transgene product may be a non-coding RNA (ncRNA) molecule, such as an siRNA molecule, miRNA molecule, lncRNA molecule, or circRNA molecule, as described above in relation to the transgene. Exemplary diseases and disorders that may benefit from gene therapy using nucleic acid regulatory elements, nucleic acid expression cassettes, vectors, or pharmaceutical compositions described herein, particularly cardiac and / or muscle (cell or tissue)-targeted gene therapy, include the following: • Cardiovascular diseases and heart diseases (for example, atherosclerosis (defined as a disease in which plaque accumulates in the arteries, causing thickening and hardening of the arterial walls); arteriosclerosis (defined as a disease in which plaque accumulates on the inner wall of the vascular lumen, causing narrowing of the lumen); coronary heart disease or coronary artery disease (defined as a disease in which damage to the major blood vessels of the heart, mainly due to arteriosclerosis, is the main cause or etiology); peripheral artery disease (defined as a disease in which narrowing of blood vessels due to arteriosclerosis is the main cause or etiology, resulting in reduced blood flow to the limbs); congenital heart disease (a condition in which the heart structure develops before birth) A disease is defined as one in which an abnormality is the primary cause or etiology; congestive heart failure, heart failure (defined as a disease that occurs when the heart is unable to pump enough blood to meet the body's needs for blood, oxygen, and nutrients); myocardial infarction or heart attack (typically defined by significant and persistent ischemia leading to myocardial cell necrosis); cardiac ischemia (defined as a disease that occurs when the blood supply to the myocardium does not meet the demand); acute coronary syndrome, unstable angina, stable angina (usually a medical condition characterized by ischemic chest pain or pressure due to insufficient blood flow to the heart). Defined as a disorder; cardiomyopathy such as hypertrophic cardiomyopathy (defined as a disease in which abnormal enlargement, thickening, and rigidity of the heart muscle typically leads to insufficient blood supply to the coronary arteries), dilated cardiomyopathy (defined as a disease in which the cavities of the heart enlarge and become unable to effectively pump blood), restrictive cardiomyopathy (defined as a disease in which the ventricles of the heart become rigid because abnormal tissue such as scar tissue replaces normal heart tissue), and primary cardiomyopathy caused by gene mutations such as Brugada syndrome and Fabry disease; cardiac amyloidosis or "cardiac rigidity syndrome" ( Amyloid deposition is defined as a disease that occurs when amyloid deposits replace normal myocardium; myocarditis or inflammatory cardiomyopathy (defined as a disease characterized by inflammation and / or infection of the heart); valvular heart disease (defined as a disease involving one or more of the four valves of the heart (i.e., the aortic valve, mitral valve, pulmonary valve, and tricuspid valve), which may be caused by stenosis, regurgitation, endocarditis, or rheumatic heart disease (i.e., valvular damage due to rheumatic fever)); pericarditis (defined as a disease caused by inflammation and / or infection of the pericardium);Cardiac tamponade, also known as pericardial tamponade (defined as a condition caused by fluid accumulation in the pericardium, leading to compression of the heart); endocarditis (defined as a condition caused by inflammation and / or infection of the endocardium); cardiac arrhythmias, such as primary arrhythmias resulting from genetic mutations like Brugada syndrome (defined as a condition characterized by an abnormal rhythm of the heart); hypertension (defined as a medical disorder characterized by abnormally high systolic or diastolic blood pressure); hypotension (defined as a medical disorder characterized by abnormally low systolic or diastolic blood pressure). ; Vascular stenosis or valvular stenosis (defined as a medical disorder characterized by abnormal narrowing of the opening of a blood vessel or heart valve, respectively); restenosis (defined as the recurrence of abnormal narrowing of an artery or valve after corrective surgery such as angioplasty); deep vein thrombosis (DVT) (defined as a disorder characterized by the formation of blood clots or thrombi in the veins deep within the body, generally in the lower extremities); pulmonary embolism (defined as occlusion of one pulmonary artery secondary to DVT); and ischemic or hemorrhagic stroke (defined as a medical disorder in which blood flow to the brain is impaired, and cells die due to either insufficient blood flow or bleeding);

[0062] Lysosomal storage disorders, including glycogen storage disorders (e.g., Pompe disease, GSD type II, Danon disease, GSD type IIb, GSD III or GSD3 (also known as Coli's disease or Forbes disease), GSD IV or GSD4 (also known as Andersen's disease), GSD V or GSD5 (also known as McArdle's disease), GSD VII or GSD7 (also known as Tarui's disease), GSD X or GSD10, GSD XII or GSD12 (also known as aldolase A deficiency), GSD XIII or GSD13, GSD XV or GSD15) and mucopolysaccharidosis (e.g., Hunter syndrome, Sanfilippo syndrome, mucopolysaccharidosis (MPS) I, MPS II, MPS III, MPS IIIA, MPS IIIB, MPS IIIC, MPS IV, MPS VI, MPS VII, MPS IX) (e.g., Fabry disease); • Mitochondrial diseases (e.g., Barth syndrome); • Channelopathy (e.g., Brugada syndrome); ·Metabolic abnormalities; Myotubal myopathy (MTM); • Muscular dystrophy (e.g., Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD)); Myotonic dystrophy; Myotonic muscular dystrophy (DM); • Miyoshi-type myopathy: Fukuyama type congenital dystrophy; Dysferinopathy; • Neuromuscular diseases; • Motor neuron diseases (MND) (e.g., Charcot-Marie-Tooth disease (CMT), spinal muscular atrophy (SMA), or amyotrophic lateral sclerosis (ALS)); Emery-Dreyfus muscular dystrophy; • Facioscapulohumeral Muscular Dystrophy (FSHD); • Congenital muscular dystrophy; • Congenital myopathy; Limb-girdle muscular dystrophy (e.g., Limb-girdle muscular dystrophy type 2E (LGMD2E), Limb-girdle muscular dystrophy type 2D (LGMD2D), Limb-girdle muscular dystrophy type 2C (LGMD2C), Limb-girdle muscular dystrophy type 2B (LGMD2B), Limb-girdle muscular dystrophy type 2L (LGMD2L), Limb-girdle muscular dystrophy type 2A (LGMD2A)); • Metabolic myopathy; • Myoinflammatory disease; ·Myasthenia; Mitochondrial myopathy; • Abnormalities in ion channels; • Nuclear envelope diseases; • Distal myopathy; Hemophilia (e.g., hemophilia A and B, factor FVII deficiency, von Willebrand disease); ·Diabetes; • C1 inhibitor deficiency or hereditary angioedema; • α1-antitrypsin deficiency, and ·Kidney failure.

[0063] The diseases and disorders described herein involve cardiac and / or muscular dysfunction and may benefit from cardiac and / or muscular (cell or tissue)-targeted gene therapies described herein. Depending on the underlying dysfunction of the disease or disorder, these diseases and disorders may particularly benefit from cardiac (cell or tissue)-targeted gene therapies, especially cardiomyocyte-targeted gene therapies, or muscular (cell or tissue)-targeted gene therapies, or both, as will be understood by those skilled in the art. These diseases and disorders may benefit from the expression of appropriate therapeutic proteins from cardiac and / or muscular (cell or tissue) or from appropriate non-coding RNAs (e.g., siRNA, microRNA, lncRNA, or circRNA). Non-limiting examples of diseases or disorders that particularly benefit from cardiac (cell or tissue)-targeted gene therapy, especially cardiomyocyte-targeted gene therapy, include: atherosclerosis; arteriosclerosis; coronary heart disease or coronary artery disease; peripheral artery disease; congenital heart disease; congestive heart failure, heart failure or cardiac dysfunction; myocardial infarction or heart attack, myocardial ischemia, acute coronary syndrome or unstable and stable angina; cardiomyopathy, such as hypertrophic cardiomyopathy, dilated cardiomyopathy, restrictive cardiomyopathy, and gene Cardiovascular diseases and disorders include primary cardiomyopathy caused by mutations, such as Brugada syndrome and Fabry disease; cardiac amyloidosis or "cardiac rigidity syndrome," myocarditis or inflammatory cardiomyopathy; valvular heart disease; pericarditis; cardiac tamponade, also known as pericardial tamponade; endocarditis; cardiac arrhythmias, such as primary cardiac arrhythmias caused by gene mutations, such as Brugada syndrome; hypertension; hypotension; vascular stenosis or valvular stenosis; and restenosis.

[0064] Non-limiting examples of diseases or disorders that particularly benefit from muscle (cell or tissue)-targeted gene therapy include glycogen storage disorders (e.g., Pompe disease, GSD type II, Danon disease, GSD type IIb, GSD III or GSD 3 (also known as Coli's disease or Forbes disease), GSD IV or GSD4 (also known as Andersen's disease), GSD V or GSD5 (also known as McArdle's disease), GSD VII or GSD7 (also known as Tarui's disease), GSD X or GSD10, GSD XII or GSD12 (also known as aldolase A deficiency), GSD XIII or GSD13, GSD XV or GSD15) and mucopolysaccharidosis (e.g., Hunter syndrome, Sanfilippo syndrome, mucopolysaccharidosis (MPS) I, MPS II, MPS III, MPS IIIA, MPS IIIB, MPS IIIC, MPS IV, MPS Lysosomal storage disorders (e.g., Fabry disease), including MPS VI, MPS VII, MPS IX); mitochondrial disorders (e.g., Barth syndrome); channelopathy (e.g., Brugada syndrome); metabolic disorders; myotubeal myopathy (MTM); muscular dystrophy (e.g., Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD)); myotonic dystrophy; myotonic muscular dystrophy (DM); Miyoshi type myopathy; Fukuyama type congenital dystrophy; dysferinopathy; neuromuscular diseases; motor neuron diseases (MND) (e.g., Charcot-Marie-Tooth disease (CMT), spinal muscular atrophy (SMA), or amyotrophic lateral sclerosis (ALS)); Emery-D Rayfus muscular dystrophy; facioscapulohumeral muscular dystrophy (FSHD); congenital muscular dystrophy; congenital myopathy; limb-girdle muscular dystrophy (e.g., limb-girdle muscular dystrophy type 2E (LGMD2E), limb-girdle muscular dystrophy type 2D (LGMD2D), limb-girdle muscular dystrophy type 2C (LGMD2C), limb-girdle muscular dystrophy type 2B (LGMD2B), limb-girdle muscular dystrophy type 2L (LGMD2L), limb-girdle muscular dystrophy type 2A (LGMD2A)); metabolic myopathy; myoinflammatory diseases; myasthenia gravis; mitochondrial myopathy; ion channel abnormalities; nuclear envelope diseases; distal myopathy; cardiomyopathy;Cardiac hypertrophy; heart failure; deep vein thrombosis (DVT); pulmonary embolism; and ischemic or hemorrhagic stroke are among the conditions that can occur. Other diseases and disorders described herein, such as, but not limited to, hemophilia (e.g., hemophilia A and B, factor FVII deficiency, von Willebrand disease), C1 inhibitor deficiency or hereditary angioedema, diabetes mellitus, α1-antitrypsin deficiency, and renal failure, may benefit from the cardiac and / or muscle (cell or tissue)-targeted gene therapies described herein, particularly muscle (cell or tissue)-targeted gene therapies, by expressing the secretory therapeutic proteins described herein from muscle (cells or tissues), particularly skeletal muscle (cells or tissues).

[0065] Certain forms of gene therapy disclosed herein include antibody gene therapy. More specifically, provided herein are nucleic acid expression cassettes, vectors, or pharmaceutical compositions comprising the nucleic acid expression cassette or vector for use in a method for causing an antibody or nanobody to be produced in a subject, preferably a human subject, the method comprising introducing the nucleic acid expression cassette or vector into the cardiac and / or muscle cells of the subject, preferably the cardiac and muscle cells of the subject, more preferably the cardiomyocytes of the subject, in an effective amount to induce the expression of an antibody or nanobody, wherein the introduced gene in the nucleic acid expression cassette or vector encodes an antibody or nanobody. In embodiments of this aspect, nucleic acid expression cassettes, vectors, or pharmaceutical compositions are administered to a subject. Methods for delivering nucleic acid expression cassettes and vectors to the cells or tissues of the subject's heart and / or muscle are described elsewhere in this specification. The introduction of nucleic acid expression cassettes or vectors into target cardiac and / or muscle cells can also be performed in vitro. In embodiments, desired target cardiac and / or muscle cells are removed from the subject, transfected or transduced with the nucleic acid expression cassette or vector, and reintroduced into the subject. Alternatively, syngeneic or heterogeneic cardiac and / or muscle cells can be used if those cells do not produce an inappropriate immune response in the subject.

[0066] Suitable methods for transfection or transduction, and for the reintroduction of transfected or transduced cells into a target, are known in the art. For example, cardiac and / or muscle cells can be transfected or transduced in vitro, for example, by combining a nucleic acid expression cassette or vector with cardiac and / or muscle cells in a suitable culture medium and screening for cells containing the DNA of interest using conventional techniques such as Southern blotting and / or PCR, or by using a selection marker. The transfected or transduced cells can then be incorporated into a pharmaceutical composition, which can be introduced into a target by various techniques, such as intramuscular, intravenous, subcutaneous and intraperitoneal injection, or by injection into smooth muscle and / or myocardium using a catheter, for example. Accordingly, in embodiments, a method for causing antibody or nanobody production in a target includes the step of administering cardiac and / or muscle cells, preferably cardiac and muscle cells, more preferably cardiomyocytes, into the target, into which the nucleic acid expression cassette or vector has been introduced. Further considerations include cardiovascular diseases and disorders (e.g., atherosclerosis; arteriosclerosis; coronary heart disease or coronary artery disease; peripheral artery disease; congenital heart disease; congestive heart failure, heart failure or cardiac dysfunction; myocardial infarction or heart attack, myocardial ischemia, acute coronary syndrome or unstable and stable angina; cardiomyopathy, e.g., hypertrophic cardiomyopathy, dilated cardiomyopathy, restrictive cardiomyopathy, and primary cardiomyopathy caused by genetic mutations, e.g., Brugada syndrome and Fabry disease; cardiac amyloidosis or "cardiac rigidity syndrome"; myocardial Inflammatory or inflammatory cardiomyopathy; valvular heart disease; pericarditis; cardiac tamponade, also known as pericardial tamponade; endocarditis; cardiac arrhythmias, e.g., primary cardiac arrhythmias caused by genetic mutations, e.g., Brugada syndrome; hypertension; hypotension; vascular or valvular stenosis; restenosis; deep vein thrombosis (DVT); pulmonary embolism; and ischemic or hemorrhagic stroke); glycogen storage disorders (e.g., Pompe disease, glycogen storage disorder (GSD) type II, Danon disease, glycogen storage disorder (GSD) type IIb, GSD) GSD III or GSD 3 (also known as Coli's disease or Forbes' disease), GSD IV or GSD4 (also known as Andersen's disease), GSD V or GSD5 (also known as McArdle's disease), GSD VII or GSD7 (also known as Tarui's disease), GSD X or GSD10, GSD XII or GSD12 (also known as aldolase A deficiency), GSD XIII or GSD13, GSD XV or GSD15) and mucopolysaccharidosis (e.g., Hunter syndrome, Sanfilippo syndrome, mucopolysaccharidosis (MPS) I, MPS II, MPS III, MPS IIIA, MPS IIIB, MPS IIIC, MPS IV, MPS VI, MPS VII, MPS IX) Lysosomal storage disorders (e.g., Fabry disease); mitochondrial disorders (e.g., Barth syndrome); channelopathy (e.g., Brugada syndrome); metabolic disorders; myotubeal myopathy (MTM); muscular dystrophy (e.g., Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD)); myotonic dystrophy; myotonic muscular dystrophy (DM); Miyoshi type myopathy; Fukuyama type congenital dystrophy; dysferinopathy; neuromuscular diseases;Motor neuron diseases (MND) (e.g., Charcot-Marie-Tooth disease (CMT)), spinal muscular atrophy (SMA) or amyotrophic lateral sclerosis (ALS); Emery-Dreyfus muscular dystrophy; facioscapulohumeral muscular dystrophy (FSHD); congenital muscular dystrophy; congenital myopathy; limb-girdle muscular dystrophy (e.g., limb-girdle muscular dystrophy type 2E (LGMD2E), limb-girdle muscular dystrophy type 2D (LGMD2D)). This invention relates to nucleic acid modulating elements, nucleic acid expression cassettes, vectors, or pharmaceutical compositions described herein for use in the treatment of diseases or disorders selected from the group including, for example, limb-girdle muscular dystrophy type 2C (LGMD2C), limb-girdle muscular dystrophy type 2B (LGMD2B), limb-girdle muscular dystrophy type 2L (LGMD2L), limb-girdle muscular dystrophy type 2A (LGMD2A); metabolic myopathy; myoinflammatory diseases; myasthenia gravis; mitochondrial myopathy; ion channel abnormalities; nuclear envelope diseases; distal myopathy; hemophilia (e.g., hemophilia A and B, factor FVII deficiency, von Willebrand disease), C1 inhibitor deficiency or hereditary angioedema, diabetes mellitus, α1-antitrypsin deficiency, and renal failure.

[0067] Gene therapy protocols are extensively documented in the field. These include, but are not limited to, intramuscular injection of plasmids (naked plasmids or plasmids in liposomes), hydrodynamic gene delivery to various tissues including muscle, interstitial injection, intravenous infusion into the airways, endothelial application, and intravenous or intra-arterial administration. Various devices have been developed to increase the rate at which DNA reaches target cells. A simple method is to physically contact target cells with a catheter or implantable material containing DNA. Another approach is to use a jet injection device that directly injects a column of liquid into the target tissue under high pressure, without using a needle. These delivery examples can also be used for vector delivery. Another approach to targeted gene delivery is the use of molecular conjugates consisting of proteins or synthetic ligands conjugated with nucleic acids or DNA-binding substances for specific targeting of nucleic acids to cells (Cristiano et al., 1993). Further perspectives relate to nucleic acid modulating elements, nucleic acid expression cassettes, vectors, or pharmaceutical compositions described herein for use as vaccines, and more specifically for use as prophylactic vaccines. Furthermore, this specification also discloses the use of nucleic acid modulating elements, nucleic acid expression cassettes, vectors, or pharmaceutical compositions described herein for the manufacture of vaccines, particularly for the manufacture of prophylactic vaccines.

[0068] Furthermore, this specification includes methods for administering vaccines to those who require them, particularly preventive vaccines, as follows: - To introduce a nucleic acid expression cassette, vector, or pharmaceutical composition described herein, comprising a nucleic acid regulatory element described herein, operably linked to a promoter and a transgene, into a target, specifically the target's cardiac and / or muscle cells, more specifically cardiomyocytes; and - To express an immunologically effective amount of the transgene product in the target, specifically in the target's heart and muscle. A method including the following is disclosed. As used herein, phrases such as “subjects requiring treatment” include subjects who would benefit from treatment for the disease or disorder mentioned. Such subjects may include, but are not limited to, persons diagnosed with the disease or disorder, persons susceptible to or prone to developing the disease or disorder, and / or persons who should be prevented from developing the disease or disorder.

[0069] The terms “subject” and “patient” are used interchangeably herein and refer to animals, preferably vertebrates, more preferably mammals, specifically including human patients and non-human mammals. Subjects of “mammals” include, but are not limited to, humans, livestock, commercial animals, agricultural and livestock animals, zoo animals, sporting animals, pets and laboratory animals, e.g., dogs, cats, guinea pigs, rabbits, rats, mice, horses, and cattle; primates, e.g., apes, monkeys, orangutans and chimpanzees; canids, e.g., dogs and wolves; felines, e.g., cats, lions and tigers; equids, e.g., horses, donkeys and zebras; food animals, e.g., cattle, pigs and sheep; artiodactyls, e.g., deer and giraffes; rodents, e.g., mice, rats, hamsters and guinea pigs. The preferred patient or subject is a human subject. As used herein, “therapeutic dose” or “therapeutic effective dose” refers to the amount of gene product effective in treating a disease or disorder in a subject, that is, in obtaining the desired local or systemic effect. Therefore, this term refers to the amount of gene product required by researchers, veterinarians, physicians, and other clinicians to induce a biological or medical response in a tissue, system, animal, or human. Such amounts typically depend on the gene product and the severity of the disease, but can probably be determined by those skilled in the art through routine experimentation.

[0070] As used herein, “immunologically effective amount” means the amount of (introduced) gene product effective in enhancing the subject’s immune response to subsequent exposure to the immunogen encoded by the (introduced) gene. The level of induced immunity can be determined, for example, by measuring the amount of secretory neutralizing antibodies and / or serum antibodies by plaque neutralization, complement fixation, enzyme-linked immunosorbent assay, or microneutralization assay. Typically, the amount of gene product expressed (transmitted) when using the expression cassettes or vectors described herein (i.e., having at least one cardiac- and muscle-targeting nucleic acid regulatory element) is greater than when using the same expression cassettes or vectors without the nucleic acid regulatory element. The expression can be at least 2 times, at least 5 times, at least 10 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, or at least 60 times higher compared to the same nucleic acid expression cassettes or vectors without the nucleic acid regulatory element. Furthermore, the higher expression preferably remains targeted to the heart and muscle. Moreover, the expression cassettes and vectors described herein can lead to therapeutic levels of gene product expression over extended periods. Typically, therapeutic expression is expected to last for at least 20 days, at least 50 days, at least 100 days, at least 200 days, and possibly 300 days or more. The expression of a gene product (e.g., a polypeptide) can be measured by any means recognized in the relevant field, for example, by antibody-based assays such as Western blotting or ELISA assays, to assess whether therapeutic expression of the gene product is achieved. Alternatively, gene product expression can be measured by bioassays that detect the enzymatic or biological activity of the gene product.

[0071] Furthermore, this specification also discloses the use of the nucleic acid regulatory elements, nucleic acid expression cassettes, or vectors disclosed herein for transfecting or transducing cardiac and muscle cells, preferably cardiomyocytes. Furthermore, this specification also discloses the use of nucleic acid expression cassettes or vectors disclosed herein, comprising nucleic acid regulatory elements operably linked to a promoter and a transgene, for expressing a transgene product in cardiac and / or muscle cells, preferably cardiomyocytes. Furthermore, this specification describes a method for expressing an introduced gene product in cardiac and / or muscle cells, preferably cardiomyocytes: - Transfecting or transfecting cardiac and / or muscle cells, specifically cardiomyocytes, with nucleic acid expression cassettes or vectors disclosed herein, which include nucleic acid regulatory elements operably linked to a promoter and a transgene; and - To express the introduced gene product in cardiac and / or muscle cells. Methods including this are also disclosed. Expression of a transgene product in cardiac and / or muscle cells may involve culturing cardiac and / or muscle cells or tissues, such as cardiomyocytes, under appropriate conditions that enable expression of a transgene product in cardiac and / or muscle cells or tissues, such as cardiomyocytes.

[0072] In a further embodiment, the method may further include a step of recovering the transgene product from cardiac and / or muscle cells, such as cardiomyocytes, or from tissue and / or culture medium. Nonviral transfection or viral vector-mediated transduction of cardiac and / or muscle cells, particularly cardiomyocytes, can be performed in vitro, ex vivo, or in vivo procedures. An in vitro approach requires in vitro transfection or transduction of cardiac and / or muscle cells, such as those pre-collected from a subject, cardiac and / or muscle cell lines, or cardiac and / or muscle cells differentiated from, for example, induced pluripotent stem cells or embryonic cells. An ex vivo approach requires collection of cardiac and / or muscle cells from a subject, in vitro transfection or transduction, and optionally, reintroduction of the transfected cardiac and / or muscle cells into the subject. An in vivo approach requires administration of nucleic acid expression cassettes or vectors disclosed herein to the subject. In preferred embodiments, transfection of cardiac and / or muscle cells is performed in vitro or ex vivo. Those skilled in the art will understand that the use of nucleic acid regulatory elements, nucleic acid expression cassettes and vectors disclosed herein has significance beyond gene therapy, such as the induction and differentiation of stem cells into cardiogenic or myogenic cells, and transgenic models for the overexpression of proteins in the heart and muscle.

[0073] The present invention will be further explained by the following non-limiting embodiments. [Examples]

[0074] Example 1: Identification of nucleic acid regulatory elements (CARD-CRE) derived from normal human cardiomyocytes. Materials and methods We purchased three cell pellets derived from normal human cardiomyocytes from Promocell (Cat.# C-14080). Total RNA was extracted from this cell pellet using the AllPrep DNA / RNA Mini Kit (Qiagen, Germany) according to the manufacturer's instructions. In short, Add 1,200 μl of phosphate-buffered saline (PBS) to 200 μl of cell pellet (approximately 1 × 10⁶). 6 It was added to a tube containing cells. 2. The tube was centrifuged at 500g / 4℃ for 10 minutes, and the supernatant was removed. 350 μl of RLT Plus buffer supplemented with 3.1% 2-mercaptoethanol was added, and the cells were completely lysed by pipetting several times. Add 4.350 μl of 70% ethanol and mix thoroughly by pipetting. Transfer the entire solution to the RNeasy spin column of the AllPrep DNA / RNA Mini Kit and follow the manufacturer's instructions as follows: 5. The RNeasy spin column was centrifuged at 13,000 rpm for 1 minute, and the flow-through was discarded. 6.350 μl of RW1 buffer was added to the RNeasy spin column. 7. The RNeasy spin column was centrifuged at 13,000 rpm for 1 minute, and the flow-through was discarded. 8. 80 μl of DNase I in RDD buffer (Qiagen, Germany) was added directly to an RNeasy spin column and incubated at room temperature for 15 minutes. 9.350 μl of RW1 buffer was added to the RNeasy spin column. 10. The RNeasy spin column was centrifuged at 13,000 rpm for 1 minute, and the flow-through was discarded. 11,500 μl of RPE buffer was added to the RNeasy spin column. 12. The RNeasy spin column was centrifuged at 13,000 rpm for 1 minute, and the flow-through was discarded.

[0075] Expression analysis in normal human cardiomyocytes was determined by RNA sequencing (RNA-seq) (BGI tech solutions Ltd. (Hong Kong)). FPKM (i.e., number of fragments per kilobase of exon model per 1 million mapped reads) readings corresponded to normalized gene expression levels. Based on RNA-seq analysis from normal human cardiomyocytes, six highly expressed genes were selected for CRE identification: TIMP1, COL6A2, COL1A2, LGALS1, IGFBP7, and FN1. The transcription start sites of selected genes were mapped using the UCSC Genome Brower Database. Nucleic acid elements were selected based on the following criteria: i) presence of DNAse hypersensitivity sites; ii) high content of epigenetic markers associated with open chromatin; and iii) high content of transcription factor binding sites (TFBS).

[0076] result Based on the above criteria, nucleic acid regulatory elements associated with high expression in cardiomyocytes (referred to as cis-regulatory elements (CREs); also referred to as CARD-CREs ​​herein) were selected (Table 1). The location, sequence, and length of each CRE are also shown (Table 1).

[0077] [Table 1-1] [Table 1-2] [Table 1-3]

[0078] Example 2: In vivo validation of identified cardiomyocyte-derived nucleic acid regulatory elements (CARD-CRE). Materials and methods Cloning of cardiomyocyte-derived cis-regulatory element (CARD-CRE) into AAV vectors The CARD-CRE fragments shown in Table 1 were individually screened for their ability to enhance gene expression under artificial synthetic conditions different from those of the natural genome. To do this, CARD-CRE fragments were first synthesized using conventional oligonucleotide synthesis methods, and for convenient cloning, a MluI restriction site was added to the 5' end and a BsiWI restriction site to the 3' end. These synthetic CRE fragments were restricted with MluI and BsiWI, and then cloned into an AAV2 vector plasmid backbone restricted with AscI at the 5' end and Acc65I at the 3' end. Since MluI / AscI and Acc65I / BsiWI generate interchangeable ends, sticky-end cloning was possible. Different CARD-CREs ​​(SEQ ID NOs: 1-8) were cloned upstream of an artificial heart and muscle-directed promoter called SPc5-12 or Spc5-12GTRM (Li et al. 1999. Nat Biotechnol. 17(3):241-245) in a single-stranded adeno-associated virus vector (AAV) backbone (Figure 1). This promoter drove the reporter gene luciferase (Luc2). To ensure proper transcription termination, a synthetic polyadenylation site (PolyA) (also referred to herein as synt.pA) was cloned downstream of the Luc2 gene.

[0079] AAV production The AAV vector was constructed as previously described by cotransfection of AAV-293 cells (Stratagene, San Diego, California, USA) with calcium phosphate (Invitrogen Corp, Carlsbad, California, USA) using the target vector plasmid, a chimeric packaging construct expressing AAV2 Rep and AAV9 Cap, and an adenovirus helper plasmid (Chuah et al. 2014. Mol Ther. 22(9):1605-1613; VandenDriessche et al. 2007. J Thromb Haemost. 5(1): 16-24). The capsid was derived from the AAV9 serotype, considering its cardiac and myotropic properties (VandenDriessche et al. 2007, Sarcar et al. 2019. Nat Commun. 10(1):492). Two days after transfection, cells were collected and lysed by a combination of freeze / thaw cycles and sonication, followed by treatment with benzonase (Novagen, Madison, Wisconsin, USA) and deoxycholic acid (Sigma-Aldrich, St Louis, Missouri, USA), and three consecutive density gradient ultracentrifugations using cesium chloride (Invitrogen Corp, Carlsbad, California, USA). The AAV vector-containing fraction was recovered and dialyzed in Dulbecco's phosphate-buffered saline (PBS) (Gibco, BRL) containing 1 mM MgCl2. The concentration of viral particles containing the viral genome (also called vector titer) was determined by quantitative real-time polymerase chain reaction (PCR) using SYBR® Green with luciferase-specific primers: forward: 5'-CCCACCGTCGTATTCGTGAG-3' (SEQ ID NO: 9) and reverse: 5'-TCAGGGCGATGGTTTTGTCCC-3' (SEQ ID NO: 10). Corresponding vector plasmids with known copy numbers were used to construct the standard curve. The AAV9 virus vector had a high titer (typically 10). 12 ~10 13 This resulted in a vector genome (vg) / ml).

[0080] Animal experiments In CB17 SCID mice aged 4-5 weeks, an AAV9 viral vector expressing the luciferase gene from the CARD-CRE3, -CRE11, or -CRE12 / SPc5-12 promoter, or a control AAV9 vector lacking any of the CREs, was inserted into the tail vein in 3 × 10⁻¹⁴ mice. 10 The vector genome (vg) was administered intravenously to mice (2-3 mice per group). An AAV vector encoding a luciferase reporter gene driven by a cytomegalovirus (CMV) promoter was used as a reference for comparison. The AAV9-CMV vector was used as a reference construct because most experiments related to cardiovascular disease use the CMV promoter to drive the expression of the transgene. To evaluate the effects of CARD-CRE on gene expression, an in vivo screening platform based on the assessment of luciferase reporter activity using bioluminescence imaging (BLI) or luminometry was employed (Figure 2). Luciferase expression was measured in the heart, skeletal muscle (i.e., quadriceps femoris, gastrocnemius, tibialis, triceps brachii, biceps brachii, and diaphragm), and non-muscle tissue (e.g., liver, kidney, spleen, lung, and brain). Luminometry analysis was performed on purified cardiomyocytes.

[0081] Dissection of adult mouse hearts and isolation and purification of cardiomyocytes 1. Adult mice were anesthetized with isoflurane in a sealed chamber. 2. The chest was cut open and the heart was exposed. 3. The descending aorta and vena cava were transected, and 7 ml of EDTA buffer (130 mM NaCl, 5 mM KCl, 0.5 mM NaH2PO4, 10 mM HEPES, 10 mM glucose, 10 mM 2,3-butanedione monooxime (BDM), 10 mM taurine, 5 mM EDTA, pH 7.8) was immediately injected into the right ventricle to flush out the blood. 4. After clamping the heart at the ascending aorta, the ascending aorta was cut and the heart was removed. 5. Next, the heart was transferred to a 15 ml Falcon containing fresh EDTA buffer, and the tissue was fully immersed until further processing. 6. The heart was transferred to a 60mm Petri dish and attached to a syringe pump infusion system (SP220IZ) via the left ventricle (lower bulge of the heart) using a 25G butterfly needle. 7. The heart was perfused with 10 ml of EDTA buffer at a rate of 2 ml / min. 8. Next, the heart was transferred to a new dish containing perfusion buffer (130 mM NaCl, 5 mM KCl, 0.5 mM NaH2PO4, 10 mM HEPES, 10 mM glucose, 10 mM BDM, 10 mM taurine, 1 mM MgCl2, pH 7.8). 9.7 ml of perfusion buffer was similarly injected into the left ventricle at a rate of 2 ml / min through the same perforation. 10. Next, the heart was transferred to a new dish containing warm (37°C) collagenase buffer (0.5 mg / mL collagenase 2 (Thermo Fisher Scientific, catalog number: 17101015), 0.5 mg / mL collagenase 4 (Thermo Fisher Scientific, catalog number: 17104019), and 0.05 mg / mL protease XIV (Sigma. Cat. No. P5147) dissolved in perfusion buffer). 11. Next, 10 ml of warm collagenase buffer was injected into the left ventricle four times at a rate of 2 ml / min. 12. The heart was transferred to a new 60 mm petri dish containing 3 ml of collagenase buffer. 13. Gently tear the tissue into 1mm x 1mm pieces using tweezers. 14. Next, the tissue was gently disintegrated for 2 minutes using a 1000 μl pipette. The tip of the 1000 μl pipette was cut to increase the tip diameter and facilitate the disintegration process. 15. Enzymatic digestion was stopped on a rotary bench by adding the cell suspension to 5 ml of warm (37°C) stop solution (perfusion buffer containing 5% sterile fetal bovine serum (FBS)) in a petri dish. 16. The obtained cell suspension was passed through a 100 μm pore cell strainer and placed in a 50 ml Falcon tube to remove cell debris. 17. The filter was then washed with an additional 5 ml of stop buffer. 18. The cells were allowed to settle by gravity for 20 minutes. Half of the supernatant was transferred to a new 50 ml Falcon tube for isolation of endothelial cells. 19. The cell suspension containing the pellet was subjected to gravity sedimentation two more times in a 15 ml Falcon with 4-5 ml of perfusion buffer. 20. The formed cell pellet was resuspended in 2 ml of perfusion buffer, and the number of cells in the resulting muscle cell population was measured using a hemocytometer.

[0082] Analysis of luciferase activity in isolated cells: 1. After isolating cardiomyocytes, the total number of cells was counted using a hemocytometer. 2. The required cell suspension was collected in a separate 1.5 ml or 2 ml Eppendorf tube. 3. The cell suspension was centrifuged in an Eppendorf tube using a benchtop centrifuge at 8000-9000 rpm for 2 minutes. 4. Discard the supernatant and transfer the cell pellet to ONE-Glo TM Samples were collected according to the manufacturer's instructions for analysis using the EX Luciferase Assay System. 5.410 μl ONE-Glo TM EX reagent was added to the cell pellet. 6. Cell pellets and ONE-Glo TM The EX reagent was mixed several times by pipetting to lyse the cells, and then incubated at room temperature for 3 minutes. 7. Next, 410 μl of the mixture was divided equally into two adjacent wells of a 96-well plate (200 μl / well) (Greiner Bio, Cat#655073). 8. After adding the mixture, the 96-well plate was placed in the plate holder of the GloMax Explorer system. The plate was inserted according to the instructions displayed on the machine.

[0083] Results In vivo screening of cardiomyocyte-derived cis-regulatory elements (CARD-CRE) by bioluminescence imaging (BLI) Into the tail vein of 4- to 5-week-old CB17 SCID mice, an AAV9 vector expressing the luciferase gene from the SPc5-12 promoter operably linked to the CARD-CRE3, -CRE11, or -CRE12 regulatory element identified in Example 1 or a control AAV9 vector lacking any CRE was injected intravenously at 3 × 10 10 vector genomes (vg) / mouse (injected into 2-3 mice per group). The results of whole-body BLI are shown in Fig. 3. Whole-body BLI (Fig. 3) clearly showed that the highest level of luciferase activity (white area) was observed in mice injected with an AAV vector containing the CARD-CRE11 regulatory element, compared to a control AAV lacking any CARD-CRE. A strong enhancement of luciferase activity was evident. CARD-CRE12 moderately enhanced luciferase activity, while CARD-CRE3 did not increase luciferase activity. Thus, a relatively robust increase in gene expression was seen with CARD-CRE11.

[0084] In vivo validation of cardiomyocyte-derived cis-regulatory elements (CARD-CRE) by luminescence analysis Mice were injected with an AAV9-CARD-CRE11 vector (n = 2) or a control AAV9 vector lacking any CRE (n = 2). Mice injected with an AAV vector encoding a luciferase reporter gene driven by the cytomegalovirus (CMV) promoter were used as a reference for comparison (n = 2). Approximately 2 weeks after vector injection, the mice were sacrificed and the heart of each mouse was isolated. Thereafter, cardiomyocytes were purified according to the protocol. Freshly purified cardiomyocytes from three different groups of mice were counted, and 50,000 cardiomyocytes were collected for measurement of luciferase activity using a luminometer. Luciferase activity was expressed as relative light units (RLU) (Fig. 4). As a result, mice injected with an AAV vector containing the CARD-CRE11 regulatory element showed the highest levels of luciferase expression compared to a control AAV vector lacking any CARD-CRE. A difference of up to 30 times in luciferase activity was evident. Furthermore, the AAV9 vector containing the CARD-CRE11 regulatory element showed a 20-fold increase in luciferase activity compared to the CMV reference vector. This suggests that CARD-CRE11 may lead to an unexpectedly potent increase in gene expression in cardiomyocytes, making it advantageous for cardiovascular gene therapy. conclusion CARD-CRE11 potently increases gene expression in the heart and other muscle tissues, making it advantageous for gene therapy in the treatment of cardiovascular and muscle-related diseases.

[0085] Example 3: In vivo verification of the identified CARD-CRE11 regulatory element To confirm the robustness of the CARD-CRE11 regulatory element observed in Example 2, another experiment was performed using 4-5 week old CB17 SCID mice, as described in Example 2. In the tail veins of these mice, AAV9-CARD-CRE11 (n=2), a control AAV vector lacking any CRE (CRE-free control) (n=2), and an AAV9-CMV reference vector (n=2) were inserted in 3 × 10⁻¹⁶ doses. 10 The effects of CARD-CRE11 on gene expression in the heart and other organs were evaluated by intravenous injection in vg mice. Results for whole-body BLI and 12 different individual organs / tissues are shown in Figures 5A and 5B. Quantification of the BLI analysis is shown in Figure 5C. Whole-body BLI (Figure 5A) showed that mice injected with an AAV vector containing the CARD-CRE11 regulatory element exhibited the highest levels of luciferase activity (white area) compared to control AAV lacking any CARD-CRE. Furthermore, the inclusion of the CARD-CRE11 regulatory element significantly increased gene expression, which was higher than when luciferase expression was driven using the reference CMV promoter.

[0086] The results were consistent with luciferase activity obtained based on isolated organs and tissues recovered during dissection of injected animals (Figure 5B). AAV vectors containing the CARD-CRE11 regulatory element showed higher levels of luciferase activity in the heart and all muscle tissues (i.e., diaphragm, quadriceps femoris, gastrocnemius, tibialis, triceps, and biceps brachii) compared to cardiac and muscle tissues obtained from mice injected with a control AAV9 vector lacking any CARD-CRE, or compared to mice injected with a CMV reference vector. In contrast, the CMV reference vector produced luciferase expression in non-muscle tissues, particularly the liver (Figures 5B and 5C). Quantification of luciferase activity in individual organs and tissues showed that including the CARD-CRE11 regulatory element increased luciferase expression 70-fold in the heart and 80-130-fold in various skeletal muscle groups (i.e., diaphragm, quadriceps femoris, gastrocnemius, tibialis, triceps, and biceps brachii) compared to a control vector lacking any CARD-CRE. Including the CARD-CRE11 regulatory element increased luciferase expression 10-fold in the heart and 3-20-fold in various skeletal muscle groups (i.e., diaphragm, quadriceps femoris, gastrocnemius, tibialis, triceps, and biceps brachii) compared to a reference vector with a CMV promoter. conclusion The data shown in Figure 5 clearly demonstrate that CARD-CRE11 leads to a potent increase in gene expression in the heart and other muscle tissues, resulting in significantly higher expression compared to the reference CMV vector, which is advantageous for gene therapy in the treatment of cardiovascular and muscle-related diseases.

[0087] Example 4: In vivo validation of identified cardiomyocyte-derived nucleic acid regulatory elements (CARD-CRE). Several CARD-CREs ​​identified in Example 1, specifically CARD-CRE14, CARD-CRE16, and CARD-CRE17, were compared for their ability to increase gene expression, as described in Example 2. In this experiment, 1 × 10⁻¹⁶ AAV9 vectors containing a luciferase gene driven by the SPc5-12 promoter operably linked to the CARD-CRE regulatory element, or a control AAV9 vector lacking any CRE (CRE-free control), were inserted into the tail veins of 4-5 week old CB17 SCID mice. 11 The effects of selected CARD-CRE on gene expression in the heart, muscle, and other organs were evaluated by intravenous injection (3 mice per group) into vg / mice. Whole-body BLI results are shown in Figure 6A, and results in 12 different individual organs / tissues recovered during dissection of the injected animals are shown in Figures 6B and 6C. Whole-body BLI (Figure 6A) showed increased luciferase activity (white area) in mice injected with AAV vectors containing different CARD-CRE (i.e., CARD-CRE14, CARD-CRE16, and CARD-CRE17) compared to a control AAV vector lacking CARD-CRE. The results were consistent with luciferase activity obtained based on isolated organs and tissues recovered during dissection of the injected animals (Figure 6B). AAV vectors containing CARD-CRE14, CARD-CRE16, and CARD-CRE17 showed higher levels of luciferase activity in the heart and all muscle tissues (i.e., diaphragm, quadriceps femoris, gastrocnemius, tibialis, triceps, and biceps brachii) compared to heart and muscle tissue obtained from mice injected with a control AAV9 vector lacking CARD-CRE. Luciferase activity was barely detectable in non-muscle tissues such as the liver, kidneys, spleen, lungs, and brain. Quantification of luciferase activity in individual organs and tissues revealed that the inclusion of CARD-CRE14, CARD-CRE16, and CARD-CRE17 increased luciferase expression in the heart and most skeletal muscle groups compared to a control vector lacking CARD-CRE (Figure 6C). Specifically, in the heart, CARD-CRE14, CARD-CRE16, and CARD-CRE17 increased luciferase activity 18-fold, 23-fold, and 9-fold, respectively, compared to a control vector lacking CARD-CRE. CARD-CRE14 increased luciferase activity 16-fold in the gastrocnemius (16-fold), quadriceps femoris (11-fold), tibialis (6-fold), biceps brachii (4-fold), and diaphragm (4-fold) compared to the control vector, while the increase was less pronounced in the triceps brachii (1.6-fold). Similarly, CARD-CRE16 increased luciferase activity in the gastrocnemius (16x), quadriceps femoris (30x), tibialis (5x), biceps brachii (12x), diaphragm (4x), and triceps brachii (3x) muscles compared to the control vector. CARD-CRE17 also increased luciferase activity in the gastrocnemius (13x), quadriceps femoris (12x), tibialis (5x), biceps brachii (5x), and diaphragm (2.5x) muscles compared to the control vector, and slightly increased it in the triceps brachii (1.3x). The increases in luciferase activity in the heart and various muscle groups by CARD-CRE14, CARD-CRE16, and CARD-CRE17 compared to the control vector are summarized in Table 2.

[0088] [Table 2]

[0089] conclusion The data shown in Figure 6 demonstrates that CARD-CRE14, CARD-CRE16, and CARD-CRE17 strongly increase gene expression in the heart and other muscle tissues, making them advantageous for gene therapy in the treatment of cardiovascular and muscle-related diseases.

[0090] Example 5: In vivo validation of identified cardiomyocyte-derived nucleic acid regulatory elements (CARD-CRE). Several CARD-CREs ​​identified in Example 1, specifically CARD-CRE8, CARD-CRE11, CARD-CRE16, and CARD-CRE20, were compared for their ability to increase gene expression, as described in Example 2. In this experiment, 5 × 10¹⁶ IV fluid was injected into the tail vein of 4-5 week old CB17 SCID mice. 10 The drug was administered intravenously to vg / mice (3 mice per group). A control AAV9 vector lacking both CREs (CRE-free control) was used for comparison to evaluate the effect of a given CARD-CRE on gene expression in the heart and other muscle tissues and organs. Figure 7 shows the results in whole-body BLI of the injected animals and in 12 different individual organs / tissues recovered at dissection. Whole-body BLI (Figure 7A) showed that luciferase activity (white region) was increased in all vectors containing CARD-CRE (i.e., CARD-CRE8, CARD-CRE11, CARD-CRE16, and CARD-CRE20) compared to AAV control vectors lacking any CARD-CRE. Similar results were observed when luciferase expression in 12 individual tissues and organs was quantitatively evaluated by BLI (Figures 7B, 7D). Specifically, CARD-CRE8, CARD-CRE11, CARD-CRE16, and CARD-CRE20 increased luciferase activity in the heart and all muscle tissues tested (i.e., diaphragm, quadriceps femoris, gastrocnemius, tibialis, triceps, and biceps brachii). Expression was hardly detectable in non-muscle tissues such as the liver, kidneys, spleen, lungs, and brain. Four different selected CARD-CRE (i.e., CARD-CRE8, CARD-CRE11, CARD-CRE16, and CARD-CRE20) increased luciferase activity in the heart by 17–32 times compared to a control vector without CARD-CRE (Figure 7C). Similarly, CARD-CRE enhanced luciferase activity in all other different organs tested, namely the diaphragm (3–7 times), quadriceps femoris (4–13 times), gastrocnemius (22–34 times), tibialis (12–24 times), triceps brachii (4–8 times), and biceps brachii (1–3 times) (Figure 7C, Table 3).

[0091] [Table 3]

[0092] conclusion The data shown in Figure 7 demonstrates that CARD-CRE8, CARD-CRE11, CARD-CRE16, and CARD-CRE20 strongly increase gene expression in the heart and other muscle tissues, making them advantageous for gene therapy in the treatment of cardiovascular and muscle-related diseases.

[0093] Summary Based on the data presented in Examples 2-5, the most robust increase in transgene expression was observed in the following CARD-CREs: CARD-CRE8 (SEQ ID NO: 2), CARD-CRE11 (SEQ ID NO: 3), CARD-CRE14 (SEQ ID NO: 5), CARD-CRE16 (SEQ ID NO: 6), CARD-CRE17 (SEQ ID NO: 7), and CARD-CRE20 (SEQ ID NO: 8). These CARD-CREs ​​were identified by data mining of RNA-seq expression data obtained from the most highly expressed genes in normal human cardiomyocytes (Example 1).

[0094] Example 6: In vivo validation of identified CARD-CRE11 regulatory element operably linked to an hMLC promoter. Materials and methods AAV vector creation A human myosin light chain (hMLC) promoter (567 bp, SEQ ID NO: 14) was synthesized by conventional DNA synthesis and cloned into a single-stranded AAV vector skeleton as described in Example 2, either with or without the CARD-CRE11 element identified in Example 1, to produce either an AAVss-hMLC-Luc2-SynpA vector (Figure 8) or an AAVss-Card CRE11-hMLC-Luc2-SynpA vector (Figure 9). Here, "Luc2" refers to the luciferase reporter, "SynpA" refers to the synthetic polyadenylylation site, AAVss refers to the single-stranded vector structure, and AAV9 refers to AAV serotype 9.

[0095] AAV production The corresponding AAV9 vector particles were manufactured by Signagen, and the vector titer was determined as described in Example 2. Bioluminescence imaging analysis Adult CB17 / IcrTac / Prkdcscid (also known as CB17 SCID) male mice (5-6 weeks old, body weight: 18-21g) were given 10 11 Mice were injected with an AAV9 vector at a dose equivalent to vg / mouse. Four weeks after vector injection, the mice were euthanized, and luciferase activity was subsequently measured by bioluminescence imaging in excised hearts, compared to individual muscle types. Manually selected regions of interest (ROIs) were used for each individual tissue. Luciferase expression from individual tissues was measured as photons / sec / cm². 2 The total luminous flux was measured as expressed in / sr (average value + sem; n=3). result CARD-CRE11 selectively enhanced luciferase activity from the hMLC promoter most strongly (up to 30 times) in the heart compared to other skeletal muscle or diaphragmatic tissues (Figure 10).

[0096] Example 7: In vivo validation of identified CARD-CRE11 regulatory elements operably linked to a ubiquitously expressed CMV promoter. The materials and methods used / applied were as described in Example 6, in which the CARD-CRE11 element was cloned upstream of the CMV promoter in the AAVss-CMV-Luc2-SynpA vector (Figure 11) to prepare the AAVss-CARD-CRE11-CMV-Luc2-SynpA vector (Figure 12). CARD-CRE11 also increased luciferase activity from promoter CMV ubiquitously expressed in the heart by a (7-fold) factor compared to a control CMV-luciferase vector lacking CARD-CRE11 (Figure 13).

Claims

1. A nucleic acid regulatory element for enhancing cardiac- and / or muscle-targeted gene expression, comprising the sequence of Sequence ID No. 3, or a sequence having at least 90% identity with the full length of Sequence ID No. 3, or a functional fragment of the sequence of Sequence ID No. 3, the nucleic acid regulatory element having a maximum length of 2000 nucleotides.

2. Use in vitro or ex vivo in nucleic acid expression cassettes or vectors for enhancing cardiac- and / or muscle-specific gene expression of nucleic acid regulatory elements comprising the sequence of SEQ ID NO: 3, or a sequence having at least 90% identity with the full-length sequence of SEQ ID NO: 3, or a functional fragment of the sequence of SEQ ID NO:

3.

3. A nucleic acid expression cassette comprising a promoter and at least one nucleic acid regulatory element operably linked to a transgene, wherein the nucleic acid regulatory element comprises the sequence of SEQ ID NO: 3, or a sequence having at least 90% identity with the full-length sequence of SEQ ID NO: 3, or a functional fragment of the sequence of SEQ ID NO:

3.

4. The nucleic acid expression cassette according to claim 3, wherein the promoter is a cardiac- and / or muscle-targeted promoter.

5. The nucleic acid expression cassette according to claim 4, wherein the cardiac- and / or muscle-targeting promoter is a promoter selected from the group consisting of a promoter selected from the group consisting of an hMLC promoter, an SPc5-12 promoter, a desmin (DES) promoter, and an MHCK7 promoter.

6. The nucleic acid expression cassette according to claim 3, wherein the promoter is a promoter that is expressed ubiquitously.

7. The nucleic acid expression cassette according to claim 6, wherein the ubiquitously expressed promoter is a promoter selected from the group consisting of the CMV promoter, RNA polymerase II, or RNA polymerase III promoter.

8. The nucleic acid expression cassette according to any one of claims 3 to 7, wherein the introduced gene encodes a therapeutic protein or an immunogenic protein.

9. The nucleic acid expression cassette according to any one of claims 3 to 7, wherein the introduced gene encodes a non-coding RNA.

10. The nucleic acid expression cassette according to claim 9, wherein the non-coding RNA is selected from the group consisting of short hairpin RNA, microRNA, long non-coding RNA, circular RNA, and short interfering (SiO)RNA.

11. A nucleic acid expression cassette according to any one of claims 3 to 10, further comprising an intron.

12. The nucleic acid expression cassette according to claim 11, wherein the intron is a mouse microvirus (MVM) intron.

13. A nucleic acid expression cassette according to any one of claims 3 to 12, further comprising a polyadenylation signal.

14. The nucleic acid expression cassette according to claim 13, wherein the polyadenylation signal is a synthetic polyadenylation signal.

15. A vector comprising a nucleic acid expression cassette according to any one of claims 3 to 14.

16. The vector according to claim 15, which is a viral vector.

17. The vector according to claim 16, which is an adeno-associated virus (AAV) vector.

18. A pharmaceutical composition comprising a nucleic acid expression cassette according to any one of claims 3 to 14 or a vector according to any one of claims 15 to 17, and a pharmaceutically acceptable carrier.

19. A nucleic acid expression cassette according to any one of claims 3 to 14, a vector according to any one of claims 15 to 17, or a pharmaceutical composition according to claim 18, for use in pharmaceuticals.

20. A nucleic acid expression cassette according to any one of claims 3 to 14, a vector according to any one of claims 15 to 17, or a pharmaceutical composition according to claim 18, for use in gene therapy.

21. A nucleic acid expression cassette according to any one of claims 3 to 14, a vector according to any one of claims 15 to 17, or a pharmaceutical composition according to claim 18, for use as a vaccine or for use in vaccination therapy.

22. An in vitro or ex vivo method for expressing a transgene product in cardiac and / or muscle cells: - Introducing a nucleic acid expression cassette according to any one of claims 3 to 14 or a vector according to any one of claims 15 to 17 into cardiac and / or muscle cells; - To express the introduced gene product in cardiac and / or muscle cells; and optionally additionally - Recovering the transgene product from heart and / or muscle cells or from culture media. Methods that include...

Images