294 results about "Cellular differentiation" patented technology

The invention relates to the technical field of stem cell culture, and one embodiment of the invention provides a stem cell differentiation culture device which comprises a culture box and further comprises an air inlet pipe, a main fan, a fixed box, a conversion cylinder, a filter cylinder, an auxiliary fan, a discharge box and a cleaning mechanism, the culture box is communicated with a temperature adjusting system through the air inlet pipe, the fixed box is communicated with the air inlet pipe, and the air inlet pipe is communicated with the main fan. The conversion cylinder is rotatably arranged in the fixed box, the interior of the conversion cylinder is divided into two conversion cavities, the filter cylinder is fixedly connected to the interior of the conversion cavities and communicates with the air inlet, the auxiliary fan is installed in the filter cylinder, the discharge box communicates with the fixed box through the discharge port, and the discharge box communicates with a discharge pipe. The cleaning mechanism is used for being matched with the auxiliary fan to clean the inner wall of the filter cartridge. By means of the technical scheme, the technical problem that dust accumulates on a filter screen in a ventilation system in the prior art, and regular disassembly and cleaning are needed is solved.

The invention discloses a pharmaceutical composition for promoting aTreg cell differentiation and application thereof, and relates to the field of biological medicine, and the pharmaceutical composition comprises zinc salt, a basic cell culture medium, fetal calf serum, antibiotic, L-glutamine and a pH buffer agent. According to the application, the basic cell culture medium is used for providing basic nutrition required by cell growth for lymphocytes, the fetal calf serum is used for providing growth factors, hormones, adhesion proteins and nutrient substances required by cell growth for the lymphocytes, and the antibiotics are used for preventing bacterial infection; l-glutamine provides key amino acid for cell energy metabolism and participates in synthesis of protein and nucleic acid, zinc salt provides zinc ions, and under the comprehensive action, the proportion of Treg cells and aTreg cells differentiated from lymphocytes in peripheral blood mononuclear cells is increased.

The invention provides an in-vitro skin blood vessel immune model as well as a preparation method and application thereof. THP-1 human monocyte leukemia cells are induced to be differentiated into M0 type macrophages, and then the M0 type macrophages are respectively induced into M1 type macrophages and / or M2 type macrophages; then co-culturing the M1 type and / or M2 type macrophages and vascular endothelial cells to form a vascular immune model; finally, the 3D skin model is placed on the blood vessel immune model, external stimulation is conducted, and the in-vitro skin blood vessel immune model is constructed. The in-vitro skin blood vessel immune model can be used for repairing skin barriers, inflammation pathways, blood vessel metabolism, the expression level of genes or proteins related to extracellular matrixes, vascular endothelial cells, the proliferation and migration ability of activated macrophages and the like. The seven feature dimensions of the physiological structure feature of the skin model are used for screening the to-be-tested sample and exploring the action mechanism, and the method has the characteristics of rapidness, multiple screening dimensions, high accuracy, low construction difficulty, low cost and high universality.

The invention provides a method for generating platelet-like particles based on MEG-01 cells and evaluating functions of the platelet-like particles, and belongs to the technical field of cell biology. The invention provides a method for generating PLPs by inducing MEG-01 cells. According to the method, the MEG-01 cells are differentiated into PLPs with platelet characteristics by utilizing a PMA inducer. The PLPs disclosed by the invention has characteristic surface marker expression consistent with that of natural platelets, can respond to stimulation of an activator ADP, and shows biological functional characteristics of the platelets. The method for generating PLPs is simple and economical, experimental conditions are highly controllable, and an economical, efficient and repeatable in-vitro model is provided for functional research related to platelets.

To identify lipid metabolites that control Th17 cell differentiation and lipid biosynthetic enzymes involved therein, and based on that, to provide a screening method for a therapeutic agent for diseases caused by excessive Th17 cell responses.SOLUTION: Provided is 1-oleoyl-lysophosphatidylethanolamine (LPE(1-18:1)) as a lipid metabolic product that controls Th17 cell differentiation. Since LPE(1-18:1) binds to RORγt with high specificity and promotes differentiation into Th17 cells, a candidate compound for a therapeutic agent for diseases caused by excessive Th17 cell responses can be obtained by selecting a compound that inhibits the binding of LPE(1-18:1) to RORγt. Also provided are five lipid metabolic enzymes (Gpam, Gpat3, Lplat1, Pla2g12a, and Scd2) that are responsible for the biosynthesis of LPE(1-18:1) and control Th17 cell differentiation. By selecting a compound that inhibits the activity or expression of these lipid metabolic enzymes, a candidate compound for a therapeutic agent for diseases caused by excessive Th17 cell responses can be obtained.SELECTED DRAWING: None

Provided is a mammalian-derived cell model that can be used in anti-aging drugs. The mammalian-derived extraembryonic trophoblast cell model is an early mammalian-derived extraembryonic stage. A change model and an aging evaluation index system for differentiating the cells into the extraembryonic trophoblast cells / organoids can be used for various anti-aging researches and target detection, anti-aging drug detection, screening and identification, research on innovative drugs / natural products, and development of chemicals and / or health foods and additives. Screening and identifying many resistances is helpful. Candidate targets of aging may be further mechanically and functionally validated for future therapeutic use. The screening of anti-aging drugs or natural products will produce huge economic and social benefits.

The invention provides a cryopreservation and resuscitation method for induced differentiation of pluripotent stem cells to metaphase cells and application, and the cryopreservation method comprises the following steps: (1) the initial cells are pluripotent stem cells, and are induced and differentiated to the metaphase; (2) recovering the cells by using a mild digestive enzyme, counting, and resuspending the cells in a cryopreservation solution; and (3) carrying out programmed cooling to-80 DEG C, and then transferring into liquid nitrogen for preservation for later use. According to the cryopreservation method and the cryopreservation liquid provided by the invention, the cryopreservation survival rate of the differentiated metaphase cells is obviously improved, apoptosis or irreversible stress injury induced by a traditional cryopreservation liquid is avoided, and the problems of large cell injury and low survival rate caused by using a general cryopreservation liquid in the prior art are obviously improved. The resuscitated cells keep good differentiation potential, can smoothly form a mature renal unit structure, and solves the problem of subsequent differentiation failure in the prior art.

The present invention relates to a method for preparing organ-specific mesenchymal cells from pluripotent stem cell-derived intestinal organoid stromal cells. By using cells derived from stromal cell layers adjacent to intestinal organoids for differentiation into organ-specific mesenchymal cells, the present invention can greatly increase the efficiency of differentiation into stromal cells through the regulation of retinoic acid (RA) and hedgehog (HH) signaling pathways, and can increase the expression of organ-specific markers without exhibiting undifferentiated state cell characteristics, and thus mesenchymal cells having well-simulated biological characteristics can be prepared.

The invention provides a method for jointly deducing dynamic cell communication and a cell state transition rate. Relates to the technical field of biological information. The method comprises the following steps: extracting candidate ligands, candidate receptors and characteristic genes from space transcriptome data to be processed; the method comprises the following steps: screening nodes which have an interaction relationship with candidate ligands, candidate receptors and characteristic genes from a pre-constructed prior database, and constructing a multi-layer signal network of which the structure is ligand-receptor-transcription factor-target genes; establishing a gene regulation kinetic model according to a ligand-receptor action relationship, a receptor-transcription factor action relationship and a transcription factor-target gene action relationship in the multilayer signal network; iteratively optimizing parameters to be estimated in the gene regulation and control kinetic model; and obtaining the change rate of the expression quantity of the target gene in the receiving cell based on the potential time after iterative optimization and the parameters to be estimated after iterative optimization. And combined analysis of dynamic cell communication and cell differentiation tracks can be realized.

The invention discloses a perfusion-free parallel double-cell intestine-liver chip system and application thereof in drug uptake evaluation, and belongs to the field of biomedical engineering and organ chips. The chip disclosed by the invention is simple in structure, free of an external pump and a complex pipeline, capable of realizing fluid circulation through swinging, convenient to operate, low in cost and small in pollution risk, and also capable of promoting cell differentiation and optimizing hepatocyte functions. The chip integrates a parallel intestinal cell and a liver cell which are communicated through a shared channel, can continuously simulate intestinal absorption and liver first-pass metabolism, and is closer to an in-vivo physiological state. The device adopts a detachable transparent modular design, can be repeatedly used, supports multi-group parallel operation, can improve experimental flux and result repeatability, and is suitable for in-vitro verification of drug absorption, permeability and metabolism evaluation.

The invention provides a method for inducing HL-60 cells to be differentiated into neutrophil-like cells, and belongs to the technical field of cell culture. According to the method, the induced differentiation efficiency of the HL-60 cells to the neutrophil-like cells (D-HL-60) and the cell quality are remarkably improved, high-proportion functional D-HL-60 cells can be obtained, a good motility rate can be maintained, and a stable and reliable cell model is provided for researching a neutrophil differentiation mechanism, screening related drugs and analyzing immune functions. Particularly, the functional D-HL-60 cells obtained on the basis of the method can be used as an ideal model, deep analysis of neutrophil trapping nets (NETs) in inflammation and tumor pathological mechanisms is assisted, and an experimental basis is provided for development of therapeutic strategies of targeted NETs.

There is provided a hydrogel, such as a functionalized hydrogel, for use in the expansion and / or differentiation of cells, that are encapsulated within the three-dimensional structure of the hydrogel. In some aspects of the invention, the hydrogel better mimics the thymus microenvironment than prior hydrogels for T cell expansion and differentiation and can be used in the expansion and differentiation of HSPCs, HSCs or PCs or combinations thereof in the production of T cells, T-cell committed precursors or progenitor cells and in methods for producing mature T cells. Methods of making the hydrogels, methods of culturing the cells in the hydrogel and uses of the hydrogels and cells produced are also described.

The invention discloses a key effect and a targeted intervention strategy of YTHDF1 in regulation and control of a hepatocellular carcinoma immunosuppression microenvironment. In the tumor-associated fibroblasts, YTHDF1 enhances the translation efficiency of OTUD5 mRNA through an m6A dependency mechanism, an up-regulated deubiquitination enzyme OTUD5 is directly combined with a tryptophan metabolic rate-limiting enzyme IDO1, ubiquitination degradation of the tryptophan metabolic rate-limiting enzyme IDO1 is inhibited, tryptophan is further driven to catabolism to generate kynurenine, regulatory T cell differentiation is promoted, and an immunosuppression microenvironment is formed. Spatial transcriptomics shows that YTHDF1 + CAFs and Tregs are significantly co-localized in tumor tissues and have metabolic interaction. Based on artificial intelligence virtual screening, it is found that a natural compound hesperidin can be specifically combined with a YTH structural domain of YTHDF1, an OTUD5-IDO1 signal axis mediated by the natural compound hesperidin is blocked, and the KYN level is remarkably reduced. Animal experiments prove that the tumor inhibition rate of combined treatment of hesperidin and anti-PD-1 is increased by 40% or above compared with that of a single drug group, and synergistic interaction is achieved by inhibiting Tregs infiltration and enhancing the activity of cytotoxic T lymphocytes.

The present invention relates to lipid nanoparticle (LNP) compositions, as well as diagnostic or therapeutic polynucleotides, such as TERT mRNA, that can be delivered in a formulation together with the LNP compositions to various tissue and cell types in the whole body of a mammal, such as, for example, TNP mRNA. Comprising stem cells, progenitor cells, germ cells, differentiated cells or terminally differentiated cells, cancer cells, endothelial cells, epithelial cells, splenic cells, hepatocells, kidney cells and / or osteoblasts, for example, for use in the diagnosis, prevention and / or treatment of a condition or disease.

The invention discloses construction of myocardial cells differentiated from propionemia stem cells based on a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) technology. The model constructed by the invention has the metabolic phenotype of propionemia and can also be differentiated into myocardial cells. A reliable and effective experimental model is provided for research of propionemia disease related targets and screening of drugs for preventing / treating propionemia, and the method has a wide application prospect.

A skin care composition includes a plurality of agents that include at least one retinol derivative that may comprise, for example, hydroxypinacolone retinoate, and at least one bark extract that may comprise, for example, Eperua falcata bark extract, the plurality of agents providing reduced retinol associated inflammation as compared with a composition that includes the at least one retinol and lacks the at least one bark extract. The plurality of agents may also include hydroxy acid, for example, comprising lactic acid. The composition may confer one or a combination of increased skin cell proliferation, improved cellular migration, improved cellular differentiation, an anti-inflammatory retinol genetic signature as demonstrated by via bulk-RNA sequencing of human keratinocytes and restores epidermal disruption and reduce IL-1A and IL-23 inflammatory cytokines in human ex-vivo skin models of chronic inflammation.

The invention relates to the field of stem cell biology, and discloses a culture solution and a method for differentiating human pluripotent stem cells into natural killer cells. The culture solution comprises a DMEM (Dulbecco Modified Eagle Medium), an F12 culture medium, an APEL blood cell culture medium, an induction factor, a chemotactic factor CXCL12, L-ascorbic acid, L-glutamine, beta-mercaptoethanol, sodium selenite, ethanolamine and penicillin-streptomycin. The invention also discloses a more efficient differentiation method for inducing the human induced pluripotent stem cells to differentiate into the NK cells, and the differentiation method provided by the invention can rapidly, efficiently, simply and conveniently induce the pluripotent stem cells to differentiate into the natural killer cells at low cost based on a culture medium with definite components and an optimized cell factor combination.

The application of phlorizin in the medicine for treating and / or preventing lupus nephritis, the molecular formula of phlorizin is C 21 H 24 O 10 , the application promotes the differentiation of regulatory T cells (Treg) by applying phlorizin to up-regulate the PI3K / Akt signal pathway, thereby reducing the symptoms of lupus nephritis, and provides an effective treatment method with less side effects. In the application, the traditional Chinese medicine monomer phlorizin can effectively promote the differentiation of Treg cells, and compared with compound traditional Chinese medicine, the use of single component has more advantages in drug efficacy control and efficacy evaluation. In addition, phlorizin is widely sourced, low in cost and non-toxic, and is very suitable for long-term treatment of lupus nephritis.

A skin care composition includes a plurality of agents that include at least one retinol derivative and at least one bark extract, the plurality of agents providing reduced retinol associated inflammation as compared with a composition that includes the at least one retinol and lacks the at least one bark extract. The plurality of agents may include at least one retinol derivative comprising hydroxypinacolone retinoate and at least one bark extract which may include at least one bark extract comprising Eperua falcata bark extract. The plurality of agents may also include at least one hydroxy acid, for example, comprising lactic acid. The composition confers one or more of increased skin cell proliferation, improved cellular migration, improved cellular differentiation, or a combination thereof. Application the plurality of agents confers to skin cells and tissues an anti-inflammatory retinol genetic signature as demonstrated by via bulk-RNA sequencing of human keratinocytes and restores epidermal disruption and reduce IL-1A and IL-23 inflammatory cytokines in human ex-vivo skin models of chronic inflammation.

The present invention provides a method for culturing immune organoids and its application. The present invention cultures immune organoids by isolating lung-infiltrating lymph nodes and evaluates the level of mucosal immune response produced against influenza virus. By adding components such as BAFF and IL-2 to the cell culture medium and using the air-liquid interface method to three-dimensionally reconstruct immune cells derived from lung-infiltrating lymph nodes, immune organoids with a lymphoid structure are formed. These immune organoids can more realistically reflect the level of local immune response in the lungs and better retain various immune cells. At the same time, T cells are activated, enhancing their helper effect on B cells; the time for B cells to differentiate into plasma cells and mature is greatly shortened, and the efficiency of detecting and evaluating the immunogenicity of viral antigens is improved.

The invention discloses an application of Notch2 overexpression lentivirus in promoting aTreg cell differentiation, and relates to the field of immune cell culture, and the application comprises the following steps: suspending PBMC in a T cell culture medium, laying a plate, adding Notch2 overexpression lentivirus, and culturing at 36.8-37.2 DEG C. The invention also discloses a preparation method of the Notch2 overexpression lentivirus. According to the application, the Notch2 overexpression lentivirus and the PBMC (peripheral blood mononuclear cell) are co-cultured on a culture medium, and the PBMC (peripheral blood mononuclear cell) is transfected by utilizing the Notch2 overexpression lentivirus, so that Notch2 protein molecules are overexpressed, and the number of Treg cells and aTreg cells in lymphocytes is increased.

A novel method of inducing or producing hepatocytes from human induced pluripotent stem cells at an unprecedented efficiency and functionality. The core of the invention is the use of experimentally discovered mRNAs at multiple critical differentiation decision points along a pluripotent to mesendoderm to endoderm to hepatocytes pathway in a previously unknown manner.

The application provides a freezing and recovery method and application of pluripotent stem cell induced differentiation middle stage cells, and the freezing method comprises the following steps: (1) the starting cells are pluripotent stem cells, which are induced to the middle stage; (2) the cells are recovered and counted by using a mild digestion enzyme, and the cells are resuspended in a freezing solution; (3) after programmed cooling to-80 DEG C, the cells are transferred into liquid nitrogen for storage, and are ready for use. The freezing method and the freezing solution provided by the application significantly improve the freezing survival rate of the differentiation middle stage cells, avoid the apoptosis or irreversible stress damage induced by the traditional freezing solution, and obviously improve the problems of cell damage and low survival rate caused by the general freezing solution in the prior art. The differentiation potential of the recovered cells is good, and the cells can successfully form mature kidney unit structures, so that the problem of subsequent differentiation failure in the prior art is solved.

The invention relates to the technical field of medicines, and discloses a bifidobacterium longum strain GZBAI 01 and application thereof in degradation of benzoic acid and prevention or treatment of colorectal cancer. The strain is separated from faeces of healthy people, genomics identification is carried out, the metabolic profile of the strain is measured through metabonomics, the strain can convert benzoic acid with carcinogenic risk into protocatechuic acid with antitumor activity through unique metabolic capability, meanwhile, the function of regulatory T cells (Treg) in tumor drainage lymph nodes can be inhibited, differentiation of CD8 + T cells is promoted, and the tumor drainage lymph nodes can be inhibited. Therefore, the colorectal cancer is prevented through double ways of eliminating cancerogen and generating therapeutic agents. A colorectal cancer mouse model and a subcutaneous tumor mouse model verify that the strain can significantly reduce the number and volume of tumors, and shows a benzoic acid conversion effect superior to that of other strains in vivo and in vitro, and a new way is provided for prevention and treatment of colorectal cancer.

Disclosed is a technology for: generating virtual time-series pathway data from RNA sequence data of cells; estimating differentiation pathways of a plurality of sets of cells by using the generated virtual time-series pathway data; completing an ODE model that describes an evolution rule of the cells, by using the estimated differentiation pathways of the plurality of sets of cells; and determining a target drug that induces a state change of the cells, by using the completed ODE model.

The purpose of the present invention is to provide an antibody against sPLA2-XIIA and a pharmaceutical composition containing the same. The present invention provides: an antibody or an antigen-binding fragment thereof that binds to sPLA2-XIIA, wherein the antibody or antigen-binding fragment thereof inhibits the enzymatic activity of sPLA2-XIIA and inhibits induction of differentiation of naïve T cells into Th17 cells; and a pharmaceutical composition containing the antibody or antigen-binding fragment thereof. The pharmaceutical composition of the present invention can be used, for example, for treating Th17-related diseases or cancer.

The present invention provides the use of fangchinoline in preparing a drug for treating STAG2 mutation acute myeloid leukemia, and relates to the field of leukemia therapeutics. The use of fangchinoline in preparing a drug for treating STAG2 mutation acute myeloid leukemia according to the present invention addresses the problems of high incidence, poor prognosis and lack of effective drugs in STAG2 mutation acute myeloid leukemia. Fangchinoline can inhibit the proliferation and colony formation of AML cell lines SKM-1, Kasumi-6, THP-1 and U-937, induce apoptosis, cell cycle arrest and cell differentiation in these cells, and thus exert an anti-STAG2 mutation acute myeloid leukemia effect.

A microcavity bioreactor is provided that allows cell growth and cell differentiation in the same vessel, such that higher order three-dimensional cell cultures such as organoids can be generated in a singular vessel. The microcavity bioreactor may be part of a microcavity bioreactor system that allows for perfusion based cell culture and perfusion based cell harvesting. The microcavity bioreactor includes at least one, and preferably at least two, fluid distributor structures in the housing vessel of the microcavity bioreactor.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.

The present invention relates to the field of genetic engineering technology, and particularly to the application of knocking down CDYL genes in improving the meat production performance of cattle. The present invention provides the application of knocking down CDYL genes in improving the differentiation ability of bovine muscle satellite cells and / or improving the meat production performance of cattle, and the gene ID of the CDYL gene is 539013. The present invention deletes the 404th base A upstream of the transcription start site of the CDYL gene by gene editing, thereby creating a CDYL gene-edited cattle with knocked-down gene. Compared with wild-type cattle, the myotube formation ability of muscle satellite cells in gene-edited cattle is significantly enhanced, the number of desmin-positive cells, a myotube marker, is significantly increased, the number of multinucleated myotubes is significantly increased, and the body weight and body size data (body height, rump height, body slant length, chest girth and abdominal girth) of gene-edited cattle are all greater than those of wild-type cattle. The present invention enriches the breeding genes for high-yield beef cattle and provides technical support for the cultivation of new gene-edited animals.