107 results about "Cellular differentiation" patented technology

The invention provides a method for jointly deducing dynamic cell communication and a cell state transition rate. Relates to the technical field of biological information. The method comprises the following steps: extracting candidate ligands, candidate receptors and characteristic genes from space transcriptome data to be processed; the method comprises the following steps: screening nodes which have an interaction relationship with candidate ligands, candidate receptors and characteristic genes from a pre-constructed prior database, and constructing a multi-layer signal network of which the structure is ligand-receptor-transcription factor-target genes; establishing a gene regulation kinetic model according to a ligand-receptor action relationship, a receptor-transcription factor action relationship and a transcription factor-target gene action relationship in the multilayer signal network; iteratively optimizing parameters to be estimated in the gene regulation and control kinetic model; and obtaining the change rate of the expression quantity of the target gene in the receiving cell based on the potential time after iterative optimization and the parameters to be estimated after iterative optimization. And combined analysis of dynamic cell communication and cell differentiation tracks can be realized.

The invention discloses a perfusion-free parallel double-cell intestine-liver chip system and application thereof in drug uptake evaluation, and belongs to the field of biomedical engineering and organ chips. The chip disclosed by the invention is simple in structure, free of an external pump and a complex pipeline, capable of realizing fluid circulation through swinging, convenient to operate, low in cost and small in pollution risk, and also capable of promoting cell differentiation and optimizing hepatocyte functions. The chip integrates a parallel intestinal cell and a liver cell which are communicated through a shared channel, can continuously simulate intestinal absorption and liver first-pass metabolism, and is closer to an in-vivo physiological state. The device adopts a detachable transparent modular design, can be repeatedly used, supports multi-group parallel operation, can improve experimental flux and result repeatability, and is suitable for in-vitro verification of drug absorption, permeability and metabolism evaluation.

The present invention relates to lipid nanoparticle (LNP) compositions, as well as diagnostic or therapeutic polynucleotides, such as TERT mRNA, that can be delivered in a formulation together with the LNP compositions to various tissue and cell types in the whole body of a mammal, such as, for example, TNP mRNA. Comprising stem cells, progenitor cells, germ cells, differentiated cells or terminally differentiated cells, cancer cells, endothelial cells, epithelial cells, splenic cells, hepatocells, kidney cells and / or osteoblasts, for example, for use in the diagnosis, prevention and / or treatment of a condition or disease.

The invention discloses construction of myocardial cells differentiated from propionemia stem cells based on a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) technology. The model constructed by the invention has the metabolic phenotype of propionemia and can also be differentiated into myocardial cells. A reliable and effective experimental model is provided for research of propionemia disease related targets and screening of drugs for preventing / treating propionemia, and the method has a wide application prospect.

A novel method of inducing or producing hepatocytes from human induced pluripotent stem cells at an unprecedented efficiency and functionality. The core of the invention is the use of experimentally discovered mRNAs at multiple critical differentiation decision points along a pluripotent to mesendoderm to endoderm to hepatocytes pathway in a previously unknown manner.

The application provides a freezing and recovery method and application of pluripotent stem cell induced differentiation middle stage cells, and the freezing method comprises the following steps: (1) the starting cells are pluripotent stem cells, which are induced to the middle stage; (2) the cells are recovered and counted by using a mild digestion enzyme, and the cells are resuspended in a freezing solution; (3) after programmed cooling to-80 DEG C, the cells are transferred into liquid nitrogen for storage, and are ready for use. The freezing method and the freezing solution provided by the application significantly improve the freezing survival rate of the differentiation middle stage cells, avoid the apoptosis or irreversible stress damage induced by the traditional freezing solution, and obviously improve the problems of cell damage and low survival rate caused by the general freezing solution in the prior art. The differentiation potential of the recovered cells is good, and the cells can successfully form mature kidney unit structures, so that the problem of subsequent differentiation failure in the prior art is solved.

The invention relates to the technical field of medicines, and discloses a bifidobacterium longum strain GZBAI 01 and application thereof in degradation of benzoic acid and prevention or treatment of colorectal cancer. The strain is separated from faeces of healthy people, genomics identification is carried out, the metabolic profile of the strain is measured through metabonomics, the strain can convert benzoic acid with carcinogenic risk into protocatechuic acid with antitumor activity through unique metabolic capability, meanwhile, the function of regulatory T cells (Treg) in tumor drainage lymph nodes can be inhibited, differentiation of CD8 + T cells is promoted, and the tumor drainage lymph nodes can be inhibited. Therefore, the colorectal cancer is prevented through double ways of eliminating cancerogen and generating therapeutic agents. A colorectal cancer mouse model and a subcutaneous tumor mouse model verify that the strain can significantly reduce the number and volume of tumors, and shows a benzoic acid conversion effect superior to that of other strains in vivo and in vitro, and a new way is provided for prevention and treatment of colorectal cancer.

A microcavity bioreactor is provided that allows cell growth and cell differentiation in the same vessel, such that higher order three-dimensional cell cultures such as organoids can be generated in a singular vessel. The microcavity bioreactor may be part of a microcavity bioreactor system that allows for perfusion based cell culture and perfusion based cell harvesting. The microcavity bioreactor includes at least one, and preferably at least two, fluid distributor structures in the housing vessel of the microcavity bioreactor.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.

The invention relates to the technical field of cell differentiation, in particular to an ovarian granular cell exosome preparation method and system based on cell directional differentiation, and the method comprises the following steps: reprogramming starting material cells to obtain initial induced pluripotent stem cells, carrying out cell identification to obtain induced pluripotent stem cells, and carrying out directional differentiation on the induced pluripotent stem cells to obtain the ovarian granular cell exosome. Obtaining an ovarian granular cell cluster, obtaining a culture supernatant, purifying the culture supernatant to obtain an initial exosome, carrying out quality detection on the initial exosome to obtain a detection result, if the detection result is that the detection does not reach the standard, obtaining an adjusted exosome, taking the adjusted exosome as the initial exosome, and taking the adjusted exosome as the initial exosome. And returning to the step of detecting the quality of the initial exosome until the detection result is that the detection reaches the standard, and confirming the initial exosome as the target exosome when the detection result is that the detection reaches the standard. The problem that the purity of the exosome is low in the preparation process of the ovarian granular cell exosome at present can be solved.

This invention discloses a preparation process for a homogeneous immunomodulatory polysaccharide from *Gynostemma pentaphyllum* and its application in the preparation of anti-melanoma drugs and immunomodulators, relating to the field of pharmaceutical manufacturing technology. The preparation process includes four steps: compound enzyme-ultrasound synergistic extraction, fractional alcohol precipitation to remove proteins, DEAE-52 ion exchange column chromatography, and Sephacryl S-400 gel permeation chromatography purification. The resulting homogeneous polysaccharide (GOP-3) has a weight-average molecular weight of 12±1 kDa and is composed of mannose, glucose, and galactose in a specific ratio. The GOP-3 of this invention has a weight-average molecular weight (Mw) of 12.8 kDa, a dispersion (Mw / Mn) < 1.2, a uronic acid content of 23.5%, a well-defined structure, and is suitable for drug application. Furthermore, GOP-3 can significantly promote the secretion of IL-12 by dendritic cells and induce the differentiation of naive T cells into Th1 cells. Simultaneously, compared with a full-dose PD-1 monoclonal antibody, the combination of GOP-3 and a half-dose monoclonal antibody not only reduces the risk of immune-mediated pneumonia caused by antibody drugs but also increases the tumor inhibition rate by more than 40%.

The invention provides a guide RNA (Ribonucleic Acid), the guide RNA is targeted to SFPQ (Small Form-Factor Pluggable Quantitative), and the primer sequence of the guide RNA is as follows: SFPQ sgRNA-FWD: 5 '-CGTACAAACGTGCCATG-3'; and SFPQ sgRNA-REV: 5 '-CATGGCACGTTTGAGTACG-3', and SFPQ sgRNA-REV: 5 '- The invention further provides an adeno-associated virus targeting the SFPQ, and the adeno-associated virus contains the guide RNA. The invention also provides an application of the adeno-associated virus targeting SFPQ in preparation of a medicine for treating neuroblastoma. The adeno-associated virus targeting SFPQ provided by the invention not only can inhibit tumor growth, but also can provide a new strategy for NB treatment by promoting NB cell differentiation.

The application of BAHCC1 gene in preparing acute myeloid leukemia drugs belongs to the technical field of biological medicine. In order to solve the problems of treating acute myeloid leukemia and reducing its recurrence and drug resistance, the present application significantly inhibits the proliferation and clonogenic ability of acute myeloid leukemia by knocking down BAHCC1, and significantly induces the apoptosis of acute myeloid leukemia and promotes cell differentiation. The three-dimensional spatial structure of BAHCC1 protein is predicted by using AlphaFold software, small molecule compounds targeting BAHCC1 are screened in the three-dimensional spatial structure domain of BAHCC1 protein, and AML cells are treated by using the small molecule compounds targeting BAHCC1. The small molecule compounds targeting BAHCC1 are screened by molecular docking and cell experiments, including 8OK. The small molecule compounds targeting BAHCC1 are combined with cytarabine AraC, daunorubicin DNR or doxorubicin DOX.

The present invention relates in general to a platform to selectively eliminate unwanted cells from a population of cells. The invention relates to self-amplifying RNA constructs for cell purification preferably during differentiation and cell engineering.

The invention provides a whole-brain organoid based on human induced pluripotent stem cells as well as a construction method and application thereof, and belongs to the technical field of organoid construction. The method comprises the following steps: culturing human induced pluripotent stem cells in a complete culture medium to obtain a cell aggregate; culturing in an embryoid body forming culture medium to obtain a spherical embryoid body; culturing in a nerve induction culture medium tissue to form a nerve epithelium structure; embedding the single embryoid body with the nerve epithelium structure in a Matrigel gel drop, culturing in a nerve expansion culture medium to form a nerve epithelium-like structure, and replacing a mature culture medium for culturing to obtain the whole-brain organ. According to the method, by dynamically and accurately regulating and controlling culture parameters, the control ability of a cell differentiation area is improved, and interference of non-target cell types is reduced, so that the efficiency and consistency of embryoid formation and neural differentiation are directly improved, and finally, the obtained mature organoid has a more complete epithelial structure and cell polarity.

This invention provides an in vitro method for generating hematopoietic cells, the method comprising: a) providing cells genetically modified to contain nucleotide sequences encoding exogenous transcription factors, said exogenous transcription factors including ETS family transcription factors, T-cell acute lymphoblastic leukemia protein 1 (Tal1), and GATA family transcription factors, wherein expression of the exogenous transcription factors derived from said nucleotide sequences can be induced by co-culturing with an inducer, and wherein said cells contain exogenous transcription factors at detectable expression levels; and b) culturing the genetically modified cells in a differentiation medium without an inducer, such that the expression level of said exogenous transcription factors in said cells is reduced to a level that allows the cells to differentiate into hematopoietic cells. Genetically modified hematopoietic cells, genetically modified cells, and their therapeutic uses are also provided.

The present application relates to lipid vacuole (aka LV)-containing lipocartilage cells (aka LCs), and methods for the differentiation of human lipocartilage progenitors into LV-containing LCs. Also disclosed are methods related to purifying, labeling, maturing, and delivering of LV-containing LCs to a subject in need thereof.

The invention relates to the field of binding molecules comprising at least one single variable antibody domain, targeted at receptors present on myofibroblasts and / or hepatic stellate cells (HSCs). The invention also relates to a binding molecule comprising at least two single variable antibody domains, each targeting a receptor on HSCs and / or on myofibroblasts. The invention further relates to nucleic acids encoding such binding molecules, a host cell for expression of such binding molecules and to methods for preparing such binding molecules. The invention further relates to pharmaceutical compositions that comprise such binding molecule and to uses of such binding molecules and / or compositions, in particular for prophylactic, therapeutic or diagnostic purposes.

Disclosed herein are methods for directing the differentiation of stem cells towards a specific cell type.

The invention provides a method of producing a population of CD34+ hematopoietic precursor cells. The CD34+ hematopoietic precursor cells are used in methods of producing natural killer (NK), methods of inducing NK cell differentiation from pluripotent stem cells (PSCs), and methods of generating terminally differentiated hematopoietic cells from PSCs. The differentiation of immune cells such as NK cells from PSCs includes the use of a hemogenic endothelium induction cocktail that includes a WNT signaling pathway activator, a bone morphogenetic protein and / or a vascular endothelial growth factor. Also provided is a method of producing hematopoietic stem cells from pluripotent stem cells.

The invention relates to the technical field of biological medicine, in particular to application of targeted DBC1 in treatment of systemic lupus erythematosus. The application for knocking out or inhibiting the expression of the DBC1 gene as shown in SEQ ID NO.1, or blocking or inhibiting the active function of the DBC1 protein as shown in SEQ ID NO.2 comprises the following applications: 1) inhibiting the transcription of STAT5 and inhibiting the activation of an STAT5 signal channel; 2) the differentiation of Treg cells is promoted, and the differentiation of Tfh and Th2 cells is inhibited; according to the application, DBC1 in DCs is inhibited or knocked out, STAT5 signal activity is lowered, then Treg differentiation is promoted, Tfh and Th2 differentiation is inhibited, and finally the SLE treatment effect is achieved.

The invention discloses a method for separating, identifying and proliferating myoblasts of small-tailed han sheep, which comprises the following steps: (1) taking and treating skeletal muscle tissues: selecting healthy small-tailed han sheep, collecting the skeletal muscle tissues under sterile conditions, washing and cutting into pieces to obtain tissue blocks; (2) primary myoblast isolated culture: digesting, filtering and centrifuging the obtained tissue block, and culturing; (3) myoblast purification: purifying the cultured primary myoblasts to obtain purified myoblasts; (4) identifying myoblasts: identifying the obtained purified myoblasts; and (5) proliferation of myoblasts: after identification is completed, carrying out cell proliferation on the purified myoblasts obtained in the step (3) by utilizing a proliferation culture medium containing vitamin E. According to the method provided by the invention, high-purity and high-activity myoblasts can be obtained; vitamin E is utilized, so that the proliferation capacity of myoblasts can be remarkably improved, and the cell differentiation function of the myoblasts is not influenced.

The application provides a guide RNA which targets SFPQ, primer sequences of the guide RNA are as follows: SFPQ sgRNA-FWD: 5'-CGTACTCAAACGTGCCATG-3'; SFPQ sgRNA-REV: 5'-CATGGCACGTTTGAGTACG-3'. The application also provides an adeno-associated virus which targets SFPQ and contains the guide RNA. The application also provides use of the adeno-associated virus which targets SFPQ in preparation of a drug for treating neuroblastoma. The adeno-associated virus which targets SFPQ provided by the application can not only inhibit tumor growth, but also promote NB cell differentiation, thereby providing a new strategy for NB treatment.

The present invention relates to a process for producing a population of cells which comprises mature atrial cardiomyocytes. The process comprises the step of treating iPS cells according to a treatment regimen which comprises contacting the iPS cells with Gremlin2 and retinoic acid, such that at least a portion of the iPS cells differentiate into mature atrial cardiomyocytes.

The invention relates to a piezoelectric nano-material with ultrasonic responsiveness, which is a PVP (Polyvinyl Pyrrolidone) modified bismuth oxyiodate nano-sheet, the particle size is 100-200 nm, and a surface electric field can be generated under the ultrasonic action. The piezoelectric nano material can hyperpolarize the potential of a T cell membrane and inhibit an ion channel Kv1.3 regulated and controlled by the membrane potential, so that Th17 cell differentiation is reduced, and joint inflammation is relieved; the piezoelectric nano material is further prepared into a joint injection preparation, and the joint injection preparation can be combined with ultrasonic irradiation to be applied to treatment of rheumatoid arthritis. According to the invention, the piezoelectric nano material is successfully applied to immune microenvironment regulation and control of rheumatoid arthritis for the first time, and the product and technology blank in the field of'precisely regulating and controlling immune cell functions by using physical signals to treat autoimmune diseases' is filled.

This invention discloses a fish-derived bioactive peptide with dual functions of enhancing saltiness and inhibiting adipocyte differentiation, and its applications, belonging to the field of biotechnology. The bioactive peptide is a γ-glutamylarginine peptide with the general formula γ-[Glu]n-Arg, where n is an integer from 1 to 4. This invention efficiently prepared a series of γ-[Glu]n-Arg peptides through a targeted enzymatic synthesis method, further elucidating the dual effects of this bioactive peptide at the molecular mechanism level. The bioactive peptide can effectively enhance saltiness perception by binding to the saltiness receptor TMC4, and inhibit adipocyte differentiation and reduce lipid accumulation through multiple targets by downregulating PPAR-γ, C / EBPα, and FAS genes, and upregulating AMPK and HSL genes. This invention provides a reliable scientific basis and technical support for developing innovative food ingredients with both flavoring and health functions.

The invention belongs to the technical field of biological medicine, provides a mustard gas immunotoxicity evaluation method based on Foxp3 promoter methylation, and evaluates the application effect of the Foxp3 promoter methylation level in mustard gas immunotoxicity evaluation in combination with in-vitro cell experiments and in-vivo animal experiments. Results show that Treg cell deficiency is a main reason for tissue damage and inflammation caused by mustard gas poisoning, cell fate and functions of the Treg cell deficiency are mainly regulated and controlled by Foxp3 transcription factors, mustard gas can cause increase of the DNA methylation level of Foxp3 gene loci, DNA hypermethylation of Foxp3 promoters is crucial to Treg cell differentiation inhibition, Th17 / Treg imbalance and systemic inflammation caused by mustard gas exposure, and the Treg cell deficiency is a main reason for tissue damage and inflammation caused by mustard gas poisoning. The methylation level of the Foxp3 promoter can be used as a marker of a mustard gas immunotoxicity evaluation method.

The invention discloses a preparation method and application of autonomic ganglion organoid, and relates to the technical field of biology. The method comprises the following steps: 1) providing neural crest stem cells; 2) differentiating the neural crest stem cells into autonomic ganglion-like organs through the combined action of added external factors and internal factors; wherein the external factors comprise a bFGF (basic fibroblast growth factor), an IGF-1 (insulin-like growth factor), a BDNF (brain-derived neurotrophic factor), a GDNF (brain-derived neurotrophic factor), an NGF (nerve growth factor), an NT-3, an EGF (epidermal growth factor), Forskolin, a DAPT (diaminopropyltriethoxysilane), an insulin, a Transferrin, an Activin A and a BMP4 (bone morphogenetic protein 4); the addition of the intrinsic factors is that the following four transcription factors, namely Ascl1, Hand2, Phox2a and Phox2b, are overexpressed in the neural crest stem cells at the same time. The organoid prepared by the scheme contains various neurons similar to the autonomic ganglion in vivo, Schwann glial cells and satellite glial cells. The prepared autonomic ganglion organoid can be applied to research on development regulation of autonomic ganglions and occurrence and development mechanisms of various human diseases, development of therapeutic drugs and the like.

A method and system are disclosed for differentiating non-human primate induced pluripotent stem cells (NHP iPSCs) into hepatocyte-like cells through a defined, multi-stage protocol. The method includes sequentially exposing NHP iPSCs to six distinct cell differentiation media over an approximate eighteen-day period. Each medium comprises defined combinations of growth factors, small molecules, and inhibitors that direct progressive lineage specification through anterior primitive streak, definitive endoderm, posterior foregut, liver bud progenitors, hepatoblasts, and hepatocyte-like cells. Concentration ranges and exposure durations are provided for each stage, ensuring reproducibility and reducing heterogeneity across cell populations. In some embodiments, treatment with a transforming growth factor beta (TGF-β ) receptor I inhibitor during early hepatoblast specification enhances lineage fidelity. The resulting hepatocyte-like cells are validated by immunostaining and western blotting for hepatic markers. Applications include preclinical drug metabolism, hepatotoxicity assessment, and in vitro disease modeling using non-human primate–derived systems.

The invention relates to a method of generating endolymph-producing epithelial cells and in vitro use of a hedgehog signalling inhibitor for differentiation of inner ear progenitor cells into endolymph-producing epithelial cells; in vitro endolymph-producing epithelial cells and an inner ear organoid comprising endolymph-producing epithelial cells. Also provided is in vitro use of an inner ear organoid in drug discovery; the endolymph-roducing epithelial cells for use in a method of treating diseases of the inner ear; and a method of testing one of more therapeutic agents using these cells or organoids. Lastly, also provided is a kit and an organoid maturation medium.