205 results about "Cellular differentiation" patented technology

The invention provides an in-vitro skin blood vessel immune model as well as a preparation method and application thereof. THP-1 human monocyte leukemia cells are induced to be differentiated into M0 type macrophages, and then the M0 type macrophages are respectively induced into M1 type macrophages and / or M2 type macrophages; then co-culturing the M1 type and / or M2 type macrophages and vascular endothelial cells to form a vascular immune model; finally, the 3D skin model is placed on the blood vessel immune model, external stimulation is conducted, and the in-vitro skin blood vessel immune model is constructed. The in-vitro skin blood vessel immune model can be used for repairing skin barriers, inflammation pathways, blood vessel metabolism, the expression level of genes or proteins related to extracellular matrixes, vascular endothelial cells, the proliferation and migration ability of activated macrophages and the like. The seven feature dimensions of the physiological structure feature of the skin model are used for screening the to-be-tested sample and exploring the action mechanism, and the method has the characteristics of rapidness, multiple screening dimensions, high accuracy, low construction difficulty, low cost and high universality.

The invention provides a cryopreservation and resuscitation method for induced differentiation of pluripotent stem cells to metaphase cells and application, and the cryopreservation method comprises the following steps: (1) the initial cells are pluripotent stem cells, and are induced and differentiated to the metaphase; (2) recovering the cells by using a mild digestive enzyme, counting, and resuspending the cells in a cryopreservation solution; and (3) carrying out programmed cooling to-80 DEG C, and then transferring into liquid nitrogen for preservation for later use. According to the cryopreservation method and the cryopreservation liquid provided by the invention, the cryopreservation survival rate of the differentiated metaphase cells is obviously improved, apoptosis or irreversible stress injury induced by a traditional cryopreservation liquid is avoided, and the problems of large cell injury and low survival rate caused by using a general cryopreservation liquid in the prior art are obviously improved. The resuscitated cells keep good differentiation potential, can smoothly form a mature renal unit structure, and solves the problem of subsequent differentiation failure in the prior art.

The present invention relates to a method for preparing organ-specific mesenchymal cells from pluripotent stem cell-derived intestinal organoid stromal cells. By using cells derived from stromal cell layers adjacent to intestinal organoids for differentiation into organ-specific mesenchymal cells, the present invention can greatly increase the efficiency of differentiation into stromal cells through the regulation of retinoic acid (RA) and hedgehog (HH) signaling pathways, and can increase the expression of organ-specific markers without exhibiting undifferentiated state cell characteristics, and thus mesenchymal cells having well-simulated biological characteristics can be prepared.

The invention provides a method for jointly deducing dynamic cell communication and a cell state transition rate. Relates to the technical field of biological information. The method comprises the following steps: extracting candidate ligands, candidate receptors and characteristic genes from space transcriptome data to be processed; the method comprises the following steps: screening nodes which have an interaction relationship with candidate ligands, candidate receptors and characteristic genes from a pre-constructed prior database, and constructing a multi-layer signal network of which the structure is ligand-receptor-transcription factor-target genes; establishing a gene regulation kinetic model according to a ligand-receptor action relationship, a receptor-transcription factor action relationship and a transcription factor-target gene action relationship in the multilayer signal network; iteratively optimizing parameters to be estimated in the gene regulation and control kinetic model; and obtaining the change rate of the expression quantity of the target gene in the receiving cell based on the potential time after iterative optimization and the parameters to be estimated after iterative optimization. And combined analysis of dynamic cell communication and cell differentiation tracks can be realized.

The invention discloses a perfusion-free parallel double-cell intestine-liver chip system and application thereof in drug uptake evaluation, and belongs to the field of biomedical engineering and organ chips. The chip disclosed by the invention is simple in structure, free of an external pump and a complex pipeline, capable of realizing fluid circulation through swinging, convenient to operate, low in cost and small in pollution risk, and also capable of promoting cell differentiation and optimizing hepatocyte functions. The chip integrates a parallel intestinal cell and a liver cell which are communicated through a shared channel, can continuously simulate intestinal absorption and liver first-pass metabolism, and is closer to an in-vivo physiological state. The device adopts a detachable transparent modular design, can be repeatedly used, supports multi-group parallel operation, can improve experimental flux and result repeatability, and is suitable for in-vitro verification of drug absorption, permeability and metabolism evaluation.

The invention provides a method for inducing HL-60 cells to be differentiated into neutrophil-like cells, and belongs to the technical field of cell culture. According to the method, the induced differentiation efficiency of the HL-60 cells to the neutrophil-like cells (D-HL-60) and the cell quality are remarkably improved, high-proportion functional D-HL-60 cells can be obtained, a good motility rate can be maintained, and a stable and reliable cell model is provided for researching a neutrophil differentiation mechanism, screening related drugs and analyzing immune functions. Particularly, the functional D-HL-60 cells obtained on the basis of the method can be used as an ideal model, deep analysis of neutrophil trapping nets (NETs) in inflammation and tumor pathological mechanisms is assisted, and an experimental basis is provided for development of therapeutic strategies of targeted NETs.

The present invention relates to lipid nanoparticle (LNP) compositions, as well as diagnostic or therapeutic polynucleotides, such as TERT mRNA, that can be delivered in a formulation together with the LNP compositions to various tissue and cell types in the whole body of a mammal, such as, for example, TNP mRNA. Comprising stem cells, progenitor cells, germ cells, differentiated cells or terminally differentiated cells, cancer cells, endothelial cells, epithelial cells, splenic cells, hepatocells, kidney cells and / or osteoblasts, for example, for use in the diagnosis, prevention and / or treatment of a condition or disease.

The invention discloses construction of myocardial cells differentiated from propionemia stem cells based on a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) technology. The model constructed by the invention has the metabolic phenotype of propionemia and can also be differentiated into myocardial cells. A reliable and effective experimental model is provided for research of propionemia disease related targets and screening of drugs for preventing / treating propionemia, and the method has a wide application prospect.

A skin care composition includes a plurality of agents that include at least one retinol derivative that may comprise, for example, hydroxypinacolone retinoate, and at least one bark extract that may comprise, for example, Eperua falcata bark extract, the plurality of agents providing reduced retinol associated inflammation as compared with a composition that includes the at least one retinol and lacks the at least one bark extract. The plurality of agents may also include hydroxy acid, for example, comprising lactic acid. The composition may confer one or a combination of increased skin cell proliferation, improved cellular migration, improved cellular differentiation, an anti-inflammatory retinol genetic signature as demonstrated by via bulk-RNA sequencing of human keratinocytes and restores epidermal disruption and reduce IL-1A and IL-23 inflammatory cytokines in human ex-vivo skin models of chronic inflammation.

The application of phlorizin in the medicine for treating and / or preventing lupus nephritis, the molecular formula of phlorizin is C 21 H 24 O 10 , the application promotes the differentiation of regulatory T cells (Treg) by applying phlorizin to up-regulate the PI3K / Akt signal pathway, thereby reducing the symptoms of lupus nephritis, and provides an effective treatment method with less side effects. In the application, the traditional Chinese medicine monomer phlorizin can effectively promote the differentiation of Treg cells, and compared with compound traditional Chinese medicine, the use of single component has more advantages in drug efficacy control and efficacy evaluation. In addition, phlorizin is widely sourced, low in cost and non-toxic, and is very suitable for long-term treatment of lupus nephritis.

A skin care composition includes a plurality of agents that include at least one retinol derivative and at least one bark extract, the plurality of agents providing reduced retinol associated inflammation as compared with a composition that includes the at least one retinol and lacks the at least one bark extract. The plurality of agents may include at least one retinol derivative comprising hydroxypinacolone retinoate and at least one bark extract which may include at least one bark extract comprising Eperua falcata bark extract. The plurality of agents may also include at least one hydroxy acid, for example, comprising lactic acid. The composition confers one or more of increased skin cell proliferation, improved cellular migration, improved cellular differentiation, or a combination thereof. Application the plurality of agents confers to skin cells and tissues an anti-inflammatory retinol genetic signature as demonstrated by via bulk-RNA sequencing of human keratinocytes and restores epidermal disruption and reduce IL-1A and IL-23 inflammatory cytokines in human ex-vivo skin models of chronic inflammation.

A novel method of inducing or producing hepatocytes from human induced pluripotent stem cells at an unprecedented efficiency and functionality. The core of the invention is the use of experimentally discovered mRNAs at multiple critical differentiation decision points along a pluripotent to mesendoderm to endoderm to hepatocytes pathway in a previously unknown manner.

The application provides a freezing and recovery method and application of pluripotent stem cell induced differentiation middle stage cells, and the freezing method comprises the following steps: (1) the starting cells are pluripotent stem cells, which are induced to the middle stage; (2) the cells are recovered and counted by using a mild digestion enzyme, and the cells are resuspended in a freezing solution; (3) after programmed cooling to-80 DEG C, the cells are transferred into liquid nitrogen for storage, and are ready for use. The freezing method and the freezing solution provided by the application significantly improve the freezing survival rate of the differentiation middle stage cells, avoid the apoptosis or irreversible stress damage induced by the traditional freezing solution, and obviously improve the problems of cell damage and low survival rate caused by the general freezing solution in the prior art. The differentiation potential of the recovered cells is good, and the cells can successfully form mature kidney unit structures, so that the problem of subsequent differentiation failure in the prior art is solved.

The invention relates to the technical field of medicines, and discloses a bifidobacterium longum strain GZBAI 01 and application thereof in degradation of benzoic acid and prevention or treatment of colorectal cancer. The strain is separated from faeces of healthy people, genomics identification is carried out, the metabolic profile of the strain is measured through metabonomics, the strain can convert benzoic acid with carcinogenic risk into protocatechuic acid with antitumor activity through unique metabolic capability, meanwhile, the function of regulatory T cells (Treg) in tumor drainage lymph nodes can be inhibited, differentiation of CD8 + T cells is promoted, and the tumor drainage lymph nodes can be inhibited. Therefore, the colorectal cancer is prevented through double ways of eliminating cancerogen and generating therapeutic agents. A colorectal cancer mouse model and a subcutaneous tumor mouse model verify that the strain can significantly reduce the number and volume of tumors, and shows a benzoic acid conversion effect superior to that of other strains in vivo and in vitro, and a new way is provided for prevention and treatment of colorectal cancer.

Disclosed is a technology for: generating virtual time-series pathway data from RNA sequence data of cells; estimating differentiation pathways of a plurality of sets of cells by using the generated virtual time-series pathway data; completing an ODE model that describes an evolution rule of the cells, by using the estimated differentiation pathways of the plurality of sets of cells; and determining a target drug that induces a state change of the cells, by using the completed ODE model.

The purpose of the present invention is to provide an antibody against sPLA2-XIIA and a pharmaceutical composition containing the same. The present invention provides: an antibody or an antigen-binding fragment thereof that binds to sPLA2-XIIA, wherein the antibody or antigen-binding fragment thereof inhibits the enzymatic activity of sPLA2-XIIA and inhibits induction of differentiation of naïve T cells into Th17 cells; and a pharmaceutical composition containing the antibody or antigen-binding fragment thereof. The pharmaceutical composition of the present invention can be used, for example, for treating Th17-related diseases or cancer.

A microcavity bioreactor is provided that allows cell growth and cell differentiation in the same vessel, such that higher order three-dimensional cell cultures such as organoids can be generated in a singular vessel. The microcavity bioreactor may be part of a microcavity bioreactor system that allows for perfusion based cell culture and perfusion based cell harvesting. The microcavity bioreactor includes at least one, and preferably at least two, fluid distributor structures in the housing vessel of the microcavity bioreactor.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.

The invention relates to the technical field of cell differentiation, in particular to an ovarian granular cell exosome preparation method and system based on cell directional differentiation, and the method comprises the following steps: reprogramming starting material cells to obtain initial induced pluripotent stem cells, carrying out cell identification to obtain induced pluripotent stem cells, and carrying out directional differentiation on the induced pluripotent stem cells to obtain the ovarian granular cell exosome. Obtaining an ovarian granular cell cluster, obtaining a culture supernatant, purifying the culture supernatant to obtain an initial exosome, carrying out quality detection on the initial exosome to obtain a detection result, if the detection result is that the detection does not reach the standard, obtaining an adjusted exosome, taking the adjusted exosome as the initial exosome, and taking the adjusted exosome as the initial exosome. And returning to the step of detecting the quality of the initial exosome until the detection result is that the detection reaches the standard, and confirming the initial exosome as the target exosome when the detection result is that the detection reaches the standard. The problem that the purity of the exosome is low in the preparation process of the ovarian granular cell exosome at present can be solved.

To provide a differentiation inhibitor for stem cell culture which can inhibit differentiation of stem cells and increase cell yield when the stem cells are subjected to stirred culture.SOLUTION: A differentiation inhibitor for stem cell culture comprising, as an active ingredient, an alkaline extract protein of tea leaves. It is preferable that the tea leaves are residues obtained after hot-water extraction treatment of tea leaves. It is also preferable that the alkaline extract protein has a molecular weight of 3000 or more. Furthermore, it is preferable that the tea leaves are green tea.SELECTED DRAWING: None

This invention discloses a preparation process for a homogeneous immunomodulatory polysaccharide from *Gynostemma pentaphyllum* and its application in the preparation of anti-melanoma drugs and immunomodulators, relating to the field of pharmaceutical manufacturing technology. The preparation process includes four steps: compound enzyme-ultrasound synergistic extraction, fractional alcohol precipitation to remove proteins, DEAE-52 ion exchange column chromatography, and Sephacryl S-400 gel permeation chromatography purification. The resulting homogeneous polysaccharide (GOP-3) has a weight-average molecular weight of 12±1 kDa and is composed of mannose, glucose, and galactose in a specific ratio. The GOP-3 of this invention has a weight-average molecular weight (Mw) of 12.8 kDa, a dispersion (Mw / Mn) < 1.2, a uronic acid content of 23.5%, a well-defined structure, and is suitable for drug application. Furthermore, GOP-3 can significantly promote the secretion of IL-12 by dendritic cells and induce the differentiation of naive T cells into Th1 cells. Simultaneously, compared with a full-dose PD-1 monoclonal antibody, the combination of GOP-3 and a half-dose monoclonal antibody not only reduces the risk of immune-mediated pneumonia caused by antibody drugs but also increases the tumor inhibition rate by more than 40%.

The invention provides a guide RNA (Ribonucleic Acid), the guide RNA is targeted to SFPQ (Small Form-Factor Pluggable Quantitative), and the primer sequence of the guide RNA is as follows: SFPQ sgRNA-FWD: 5 '-CGTACAAACGTGCCATG-3'; and SFPQ sgRNA-REV: 5 '-CATGGCACGTTTGAGTACG-3', and SFPQ sgRNA-REV: 5 '- The invention further provides an adeno-associated virus targeting the SFPQ, and the adeno-associated virus contains the guide RNA. The invention also provides an application of the adeno-associated virus targeting SFPQ in preparation of a medicine for treating neuroblastoma. The adeno-associated virus targeting SFPQ provided by the invention not only can inhibit tumor growth, but also can provide a new strategy for NB treatment by promoting NB cell differentiation.

The application of BAHCC1 gene in preparing acute myeloid leukemia drugs belongs to the technical field of biological medicine. In order to solve the problems of treating acute myeloid leukemia and reducing its recurrence and drug resistance, the present application significantly inhibits the proliferation and clonogenic ability of acute myeloid leukemia by knocking down BAHCC1, and significantly induces the apoptosis of acute myeloid leukemia and promotes cell differentiation. The three-dimensional spatial structure of BAHCC1 protein is predicted by using AlphaFold software, small molecule compounds targeting BAHCC1 are screened in the three-dimensional spatial structure domain of BAHCC1 protein, and AML cells are treated by using the small molecule compounds targeting BAHCC1. The small molecule compounds targeting BAHCC1 are screened by molecular docking and cell experiments, including 8OK. The small molecule compounds targeting BAHCC1 are combined with cytarabine AraC, daunorubicin DNR or doxorubicin DOX.

The present application relates to a cell differentiation trajectory inference method based on deep hyperbolic manifold embedding, comprising: obtaining single-cell RNA sequencing data; introducing hyperbolic space embedding with negative curvature, extracting features of the single-cell RNA sequencing data through a deep feature extraction network, and mapping the extracted high-dimensional features to a low-dimensional hyperbolic space; constructing the transition path of cells from progenitor cells to various differentiated end cell types through trajectory inference in the low-dimensional hyperbolic space, and evaluating key genes and pathways using a sensitivity analysis method. The beneficial effects of the present application are: by introducing hyperbolic space embedding with negative curvature, the model can better capture the hierarchical structure of the data, and enhance the accuracy and consistency of the differentiation trajectory. Moreover, the present application can process high-dimensional single-cell sequencing data, overcome the limitations of traditional methods in high-dimensional cases, and improve the applicability of the model.

The present application relates to a method for inducing liver oval cell line to form functional liver-like organ tissue on a liver acellular biological scaffold, belonging to the field of biotechnology, wherein the liver oval cell line (HOCL) is used as seed stem cells, and is implanted into a regenerative liver acellular biological scaffold (R-DLS) with biological activity; according to the in-vitro simulation of the development of a body-like liver organ microenvironment concept, a conditional culture solution capable of inducing HOCL liver function differentiation and reconstructing a functional liver organ structure is added, and a functional liver-like organ tissue is constructed in an in-vitro 3D culture system. In the method, the HOCL in the R-DLS shows its differentiation into functional hepatocytes in 2-24h in the in-vitro 3D culture system, and the liver-like organ tissue can be formed in 21 days. The "new liver" constructed by the method has important clinical conversion value for being used as a liver transplantation donor and treating ESLD.

The present invention relates in general to a platform to selectively eliminate unwanted cells from a population of cells. The invention relates to self-amplifying RNA constructs for cell purification preferably during differentiation and cell engineering.

The invention discloses application of a BAHCC1 gene in preparation of acute myelogenous leukemia drugs, and belongs to the technical field of biological medicines. In order to treat the acute myelogenous leukemia and reduce the recurrence and drug resistance of the acute myelogenous leukemia, the knock-down BAHCC1 disclosed by the invention has the advantages that the proliferation and clone formation capabilities of the acute myelogenous leukemia are remarkably inhibited, the apoptosis of the acute myelogenous leukemia is remarkably induced, and the cell differentiation is promoted. AlphaFold software is used for predicting the three-dimensional space structure of the BAHCC1 protein, a small molecule compound targeting BAHCC1 is screened in the three-dimensional space structure domain of the BAHCC1 protein, and the small molecule compound targeting BAHCC1 is used for treating AML cells. A small molecule compound, including 8OK, targeting BAHCC1 is screened through molecular docking and cell experiments. The small molecular compound targeting BAHCC1 is combined with cytarabine arabinoside AraC, daunorubicin DNR or doxorubicin DOX for use.

The invention discloses a special culture medium for enriching primary lung cancer stem cells and a cell culture and identification method, the cell culture medium is composed of a basic culture medium, a nutrient source, a pathway activation / inhibition component, an antioxidant component, an anti-apoptosis component, a proliferation promoting component and a cell differentiation related component, and the culture medium takes advanced DMEM / F12 as the basic culture medium. A serum-free cell culture additive in the cell culture medium improves the universality of the cell culture medium to lung cancer cells, Wnt / beta-catenin signals are amplified by a Wnt signal enhancer R-Spondin3 to maintain the characteristics of stem cells, proliferation and survival of the stem cells are jointly promoted by EGF, bFGF and vitamin B3 derivative Nicotinamide, cell apoptosis is inhibited by an ROCK inhibitor Y-27632 and EGF, and the cell culture medium is used for treating lung cancer cells. The TGF-beta receptor inhibitor A83-01 and the bFGF are used for inhibiting cell differentiation signals and maintaining the state of stem cells / progenitor cells, the antioxidant B27 and the N-Acetyl Cysteine are used for preventing oxidative stress damage and maintaining downward survival, and the proportion of all the components in the cell culture medium is adjusted.

Provided is a method of differentiating a pluripotent stem cell of mammalian origin into a desired cell type by predicting the direction of cell differentiation to be caused by induction of expression of a transcription factor. A human gene expression correlation matrix using human cells has been newly created, and further, it has been confirmed that human pluripotent stem cells can be differentiated into a desired cell type by introducing, into the human pluripotent stem cells, a transcription factor cocktail selected from the matrix.

The present invention relates to the field of data analysis technology, and in particular to a method for analyzing cell differentiation trajectories based on topological entropy, comprising the following steps: obtaining gene expression data of cells of the same cell type; standardizing the gene expression data to obtain a cell standardized expression matrix, and constructing a single-cell gene regulatory network based on the cell standardized expression matrix; constructing a single-cell gene regulatory network representation matrix based on the single-cell gene regulatory network; obtaining a single-cell differentiation trajectory and a cell topological entropy matrix based on the single-cell gene regulatory network representation matrix; and analyzing the cell topological entropy matrix and the single-cell differentiation trajectory to obtain key evolution-determining genes of adjacent states in the differentiation trajectory. The present invention identifies key evolution-determining genes based on topological entropy, and can effectively screen key nodes that affect fluctuations in the stability of the adjacent state network structure.