Cationic lipid

Abstract

The present invention provides a novel cationic lipid having excellent encapsulation and delivery stability of nucleic acid medicines. Provided is a compound represented by formula (I) or a pharmacologically acceptable salt thereof. (In the formula, R1 is a substituted or unsubstituted formula –(CH2)a-L1-(CH2)b-CH3; R2 is a substituted or unsubstituted C5-C20 alkyl group or a substituted or unsubstituted formula -(CH2)c-L2-(CH2)d-CH3; L1 and L2 are each independently -C(=O)O-, -OC(=O)-, or -OC(=O)O-; a, b, c, and d are each independently an integer of at least 1, and the total of a and b and the total of c and d are each an integer of 5-25; R3-R7 are each independently a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or the like; R8, R9, and R10 are each a hydrogen atom; the constituent atoms in formula (I) may form a ring; Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, or the like; and X is O or S)

Description

cationic lipids

[0001] The present invention relates to novel cationic lipids.

[0002] Unlike conventional drugs that target proteins, nucleic acid drugs can introduce and suppress sequence-specific target genes in vivo and ex vivo. By simply changing the design of the target sequence, it is possible to promote or suppress the expression of any protein. Therefore, nucleic acid drugs are attracting attention as next-generation pharmaceuticals that can treat not only general diseases but also genetic diseases and intractable diseases with high unmet medical needs.

[0003] Examples of nucleic acids that can be introduced into the body as nucleic acid drugs include siRNA (small interfering RNA), mRNA (messenger RNA), miRNA (microRNA), shRNA (small hairpin RNA or short hairpin RNA), antisense oligonucleotides, and immunostimulatory nucleic acids.

[0004] Although these nucleic acids are chemically stable, they have problems for therapeutic use in that they are easily degraded by nucleases in vivo and have low uptake efficiency into target cells due to their poor permeability through cell membranes alone. To overcome these two major problems, research has been conducted for many years on chemical modification of nucleic acids themselves and drug delivery systems (DDS) that deliver nucleic acids into target cells.

[0005] Examples of DDS include methods using carriers such as cationic liposomes and polymeric micelles. For example, it is known that encapsulating nucleic acids in microparticles containing cationic lipids protects the nucleic acids from degradation in the blood and enables their permeation through lipid-soluble cell membranes. Patent Document 1 describes the following compounds as such cationic lipids. The lipid formulation described in Patent Document 1 is a composition in which therapeutic nucleic acids are encapsulated in microparticles containing the lipids, and protects the nucleic acids from degradation in serum. The formulation is efficiently delivered throughout the body, and the encapsulated nucleic acids are also efficiently delivered into cells.

[0006] Furthermore, various compounds have been developed as cationic lipids that are expected to be used in nucleic acid medicines (Patent Documents 2 to 7 and 9, Non-Patent Documents 1 to 3).

[0007] Patent Document 2 describes the following compound. Patent Document 3 describes the following compound. Patent Document 4 and Non-Patent Document 1 describe the following compound ALN-319. Patent Document 5 describes the following compound YS-119.

[0008] Patent Document 6 describes the following compound. Patent Document 7 describes the following compound. Patent Document 9 describes the following compound. Non-Patent Document 2 describes the following compound. Non-Patent Document 3 describes the following compound. Patent Document 8 describes the use of the following compound as a lubricant. However, the cationic lipids of the present invention are neither described nor suggested in the above prior art.

[0009] International Publication No. WO 2010 / 144740, International Publication No. WO 2010 / 054405, International Publication No. WO 2015 / 105131, International Publication No. WO 2011 / 153493, International Publication No. WO 2016 / 104580, International Publication No. WO 2015 / 005253, International Publication No. WO 2019 / 235635, JP 2003-040847 A, International Publication No. WO 2020 / 118041

[0010] Molecular Therapy, 2013, vol. 21(8), 1570-1578 Angewandte Chemie, 2012, vol. 51(34), 8529-33 International Journal of Pharmaceuticals, 2017, vol. 519, 34-43

[0011] An object of the present invention is to provide novel cationic lipids that form lipid particles.

[0012] As a result of extensive research, the present inventors have designed and synthesized a novel cationic lipid. They have found that lipid nanoparticles (LNPs) containing this cationic lipid can efficiently encapsulate nucleic acids, including single-stranded or double-stranded polynucleotides such as siRNA and mRNA, and that the LNPs have high stability, making them excellent pharmaceuticals. They have also found that the nucleic acids contained in the LNPs suppress the expression of target sequences and promote the expression of target proteins in multiple cell lines.

[0013] Specifically, the present invention relates to the following: (1') Formula (I): (In the formula, R １ represents a substituted or unsubstituted group of the formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ and R ２ is a substituted or unsubstituted C ５ -C ２０ an alkyl group or a substituted or unsubstituted group of the formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ and L １ and L ２ are each independently -C(=O)O-, -OC(=O)-, or -OC(=O)O-; a and b are each independently an integer of 1 or more, and the sum of a and b is an integer of 5 to 25; c and d are each independently an integer of 1 or more, and the sum of c and d is an integer of 5 to 25; R １ Formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ and R ２ C ５ -C ２０ Alkyl groups and the formula: -(CH ２ ) ｃ -L２ - (CH ２ ) ｄ -CH ３ are each independently selected from a substituent group α; the substituent group α includes a halogen atom, an oxo group, a cyano group, a nitro group, a sulfanyl group, a carboxy group, C １ -C １０ Alkyl groups, halogenated C １ -C １０ Alkyl group, C ２ -C １０ Alkenyl group, halogenated C ２ -C １０ Alkenyl group, C ２ -C １０ Alkynyl group, halogenated C ２ -C １０ Alkynyl group, C １ -C １０ Alkoxy group, halogenated C １ -C １０ Alkoxy group, C １ -C １０ Alkylsulfanyl group, halogenated C １ -C １０ Alkylsulfanyl group, C １ -C １１ Alkanoyl group, C １ -C １１ Alkanoyloxy group, C １ -C １０ Alkoxy C １ -C １０ Alkoxy group, C １ -C １０ Alkoxycarbonyl group, C １ -C １０ Alkylcarbamoyl group, di(C １ -C １０ alkyl)carbamoyl group, C １ -C １０ Alkoxycarbonyloxy, C １ -C １１ Alkanoyl (C １ -C １０ alkyl)amino, C １ -C １０ Alkoxycarbonylamino and C １ -C １０alkylcarbamoyloxy; R ３ and R ４ are each independently a hydrogen atom or a substituted or unsubstituted C １ -C ６ an alkyl group; or R ３ and R ４ together form a substituted or unsubstituted C ３ -C ５ may form a non-aromatic carbocyclic ring; R ５ represents a hydrogen atom or a substituted or unsubstituted C １ -C ６ is an alkyl group; R ６ and R ７ are each independently a hydrogen atom, a substituted or unsubstituted C １ -C ６ alkyl group, substituted or unsubstituted C ２ -C ６ Alkenyl group, substituted or unsubstituted C ２ -C ６ Alkynyl group or substituted or unsubstituted C ３ -C ７ is a non-aromatic carbocyclic group; R ８ , R ９ and R １０ is a hydrogen atom; or R ３ and R ７ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ３ and R ８ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ５ and R ６ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ６ and R ７ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ８ and R ９may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic carbocyclic ring or a substituted or unsubstituted non-aromatic heterocyclic ring, in which case k is 1 or 2; R ７ and R ８ is R ５ and R ６ When they form a ring, they may be taken together with the atoms to which they are attached to form a substituted or unsubstituted non-aromatic heterocycle; Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)-, -OC(=O)N(R)-, -N(R)C(=O)N(R)-, -N(R)C(=O)O-, -C(=S)N(R)-, -N(R)C(=S)-, -C(=O)S-, -SC(=O)-, -N(R)S(=O) ２ -, -OS (=O) ２ -, -OP(=O)(-OR)O-, -OP(=S)(-OR)O-, -OS(=O) ２ -O-, -S (=O) ２ -N(R)-, -OP(=O)(-NR)O-, -C(=S)O-, or -OC(=S)-; X is O or S; p, q, s, and k each independently represent an integer of 0 to 2; r is an integer of 0 to 5; and R each independently represent a hydrogen atom or a substituted or unsubstituted C １ -C ６ is an alkyl group; R ３ ~R ７ and R's C １ -C ６ Alkyl group and R ６ and R ７ C ２ -C ６ Alkenyl group or C ２ -C ６ The substituents in the alkynyl group are each independently selected from a substituent group β1; the substituent group β1 includes a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, C １ -C ６ Alkoxy group, C １ -C ６ Alkylsulfanyl group, C １ -C ６ Alkylamino group, diC １-C ６ Alkylamino group and C １ -C ７ alkanoyl groups; R ３ and R ４ A ring formed by R ６ and R ７ C ３ -C ７ non-aromatic carbocyclic group, R ３ and R ７ A ring formed by R ３ and R ８ A ring formed by R ５ and R ６ A ring formed by R ６ and R ７ A ring formed by R ７ and R ８ The ring formed by and R ８ and R ９ The substituents in the ring formed by are each independently selected from the substituent group β2; the substituent group β2 is selected from the substituent group β1, C １ -C ６ Alkyl groups and halogenated C １ -C ６ (1) A compound represented by formula (I): or a pharmacologically acceptable salt thereof. (In the formula, R １ represents a substituted or unsubstituted group of the formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ and R ２ is a substituted or unsubstituted C ５ -C ２０ an alkyl group or a substituted or unsubstituted group of the formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ and L １ and L ２are each independently -C(=O)O-, -OC(=O)-, or -OC(=O)O-; a and b are each independently an integer of 1 or more, and the sum of a and b is an integer of 5 to 25; c and d are each independently an integer of 1 or more, and the sum of c and d is an integer of 5 to 25; R １ Formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ and R ２ C ５ -C ２０ Alkyl groups and the formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ are each independently selected from a substituent group α; the substituent group α includes a halogen atom, an oxo group, a cyano group, a nitro group, a sulfanyl group, a carboxy group, C １ -C １０ Alkyl groups, halogenated C １ -C １０ Alkyl group, C ２ -C １０ Alkenyl group, halogenated C ２ -C １０ Alkenyl group, C ２ -C １０ Alkynyl group, halogenated C ２ -C １０ Alkynyl group, C １ -C １０ Alkoxy group, halogenated C １ -C １０ Alkoxy group, C １ -C １０ Alkylsulfanyl group, halogenated C １ -C １０ Alkylsulfanyl group, C １ -C １１ Alkanoyl group, C １ -C １１ Alkanoyloxy group, C １ -C １０ Alkoxy C １ -C １０Alkoxy group, C １ -C １０ Alkoxycarbonyl group, C １ -C １０ Alkylcarbamoyl group, di(C １ -C １０ alkyl)carbamoyl group, C １ -C １０ Alkoxycarbonyloxy, C １ -C １１ Alkanoyl (C １ -C １０ alkyl)amino, C １ -C １０ Alkoxycarbonylamino and C １ -C １０ alkylcarbamoyloxy; R ３ and R ４ are each independently a hydrogen atom or a substituted or unsubstituted C １ -C ６ an alkyl group; or R ３ and R ４ together form a substituted or unsubstituted C ３ -C ５ may form a non-aromatic carbocyclic ring; R ５ represents a hydrogen atom or a substituted or unsubstituted C １ -C ６ is an alkyl group; R ６ and R ７ are each independently a hydrogen atom, a substituted or unsubstituted C １ -C ６ alkyl group, substituted or unsubstituted C ２ -C ６ Alkenyl group, substituted or unsubstituted C ２ -C ６ Alkynyl group or substituted or unsubstituted C ３ -C ７ is a non-aromatic carbocyclic group; R ８ , R ９ and R １０ is a hydrogen atom; or R ３ and R ７ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ３and R ８ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ５ and R ６ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ６ and R ７ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ８ and R ９ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic carbocyclic ring or a substituted or unsubstituted non-aromatic heterocyclic ring, in which case k is 1 or 2; R ７ and R ８ is R ５ and R ６ When they form a ring, they may be taken together with the atoms to which they are attached to form a substituted or unsubstituted non-aromatic heterocycle; Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)-, -OC(=O)N(R)-, -N(R)C(=O)N(R)-, -N(R)C(=O)O-, -C(=S)N(R)-, -N(R)C(=S)-, -C(=O)S-, -SC(=O)-, -N(R)S(=O) ２ -, -OS (=O) ２ -, -OP(=O)(-OR)O-, -OP(=S)(-OR)O-, -OS(=O) ２ -O-, -S (=O) ２ -N(R)-, -OP(=O)(-NR)O-, -C(=S)O-, or -OC(=S)-; X is O or S; p, q, s, and k each independently represent an integer of 0 to 2; r is an integer of 0 to 5; and R each independently represent a hydrogen atom or a substituted or unsubstituted C １ -C ６ is an alkyl group; R ３ ~R ７ and R's C １ -C ６ Alkyl group, R ３ and R ４ A ring formed by R ６ and R７ C ２ -C ６ Alkenyl group, C ２ -C ６ Alkynyl group or C ３ -C ７ non-aromatic carbocyclic group, R ３ and R ７ A ring formed by R ３ and R ８ A ring formed by R ５ and R ６ A ring formed by R ６ and R ７ A ring formed by R ７ and R ８ The ring formed by and R ８ and R ９ The substituents in the ring formed by are each independently selected from a substituent group β; the substituent group β includes a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, C １ -C ６ Alkyl groups, halogenated C １ -C ６ Alkyl group, C １ -C ６ Alkoxy group, C １ -C ６ Alkylsulfanyl group, C １ -C ６ Alkylamino group, diC １ -C ６ Alkylamino group and C １ -C ７ (2) A compound represented by the formula (I) or a pharmacologically acceptable salt thereof, wherein L is a group consisting of alkanoyl groups. １ (3) The compound according to (1), (2) or (1'), or a pharmacologically acceptable salt thereof, wherein a and b are each independently an integer of 5 to 10. (4) R １ But C １ -C １０ Formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH３ (5) The compound according to any one of (1) to (3) and (1′), or a pharmacologically acceptable salt thereof, wherein R ２ is a substituted or unsubstituted group of the formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ (6) The compound according to any one of (1) to (4) and (1′), or a pharmacologically acceptable salt thereof, wherein R ２ But C １ -C １０ Formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ (7) The compound according to (5) or a pharmacologically acceptable salt thereof, ２ (8) The compound according to any one of (5) to (7), or a pharmacologically acceptable salt thereof, wherein c and d are each independently an integer of 5 to 10. (9) R ２ is a substituted or unsubstituted C ５ -C ２０ (10') The compound according to any one of (1) to (4) and (1'), wherein Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)O- or -N(R)C(=O)-, wherein R is independently a hydrogen atom or an unsubstituted C １ (10) The compound according to any one of (1) to (9), (1') and (10'), or a pharmacologically acceptable salt thereof, wherein Z is -OC(=O)-, -C(=O)O-, or -OC(=O)O-. (11) R ６ and R ７ are each independently substituted or unsubstituted C １ -C ６(12) The compound according to any one of (1) to (10), (1') and (10'), or a pharmacologically acceptable salt thereof, wherein R is an alkyl group. ５ and R ６ (13) The compound according to any one of (1) to (10), (1') and (10'), wherein R ６ and R ７ (14) The compound according to any one of (1) to (10), (1') and (10'), wherein R ５ and R ６ together with the atoms to which they are attached form a substituted or unsubstituted non-aromatic heterocycle, while R ７ and R ８ and R are taken together with the atom to which they are attached to form a substituted or unsubstituted non-aromatic heterocycle, or a pharmacologically acceptable salt thereof. (16') The compound according to any one of (1) to (10), (1') and (10') or a pharmacologically acceptable salt thereof, wherein r is an integer of 0 to 3. (17') The compound according to any one of (1) to (10), (1'), (10') and (16') or a pharmacologically acceptable salt thereof, wherein the compound is selected from the group consisting of compounds I-6, I-8, I-37, I-39, I-55, I-56, I-58, I-60, I-65, I-66 and I-69. (15) A pharmaceutical composition comprising the compound according to any one of (1) to (14), (1'), (10'), (16') and (17') or a pharmacologically acceptable salt thereof, and a nucleic acid. (16) The pharmaceutical composition according to (15), wherein the nucleic acid is siRNA or mRNA.

[0014] The LNP containing the cationic lipid of the present invention can efficiently encapsulate nucleic acid and stably retain the nucleic acid within the particle. Furthermore, the nucleic acid contained in the LNP can act on target cells. Therefore, the cationic lipid of the present invention can be used as a lipid for nucleic acid delivery into cells.

[0015] The meaning of each term used in this specification is explained below. Unless otherwise specified, each term has the same meaning whether used alone or in combination with other terms. The present invention will be explained below with reference to embodiments. Throughout this specification, singular expressions should be understood to include the plural concept unless otherwise specified. Therefore, singular articles (e.g., "a," "an," "the," etc. in English) should be understood to include the plural concept unless otherwise specified. Furthermore, terms used in this specification should be understood to be used in the sense commonly used in the above-mentioned field unless otherwise specified. Therefore, unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by those skilled in the art to which this invention belongs. In the event of conflict, the present specification (including definitions) will prevail.

[0016] The term "alkyl group" includes straight-chain or branched hydrocarbon groups having 1 to 20 carbon atoms. Examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, isohexyl, n-heptyl, isoheptyl, n-octyl, isooctyl, n-nonyl, and n-decyl. R ２ "C" ５ -C ２０ The term "alkyl group" means a straight-chain hydrocarbon group having 5 to 20 carbon atoms. ５ -C １５ alkyl group, more preferably a straight-chain C ５ -C １０ is an alkyl group. ３ ~R ７ and R's "C １ -C ６ The term "alkyl group" means a straight-chain or branched hydrocarbon group having 1 to 6 carbon atoms. １ -C ４ alkyl group, more preferably a straight-chain or branched C １ -C ３It is preferably an alkyl group. More preferably, it is methyl. １ -C １０ The term "alkyl group" means a straight-chain or branched hydrocarbon group having 1 to 10 carbon atoms. ２ -C ８ The "C" in the substituent group β and the substituent group β2 is an alkyl group. １ -C ６ The term "alkyl group" means a straight-chain or branched hydrocarbon group having 1 to 6 carbon atoms. １ -C ３ It is an alkyl group, and more preferably, it is methyl.

[0017] The term "halogen atom" includes fluorine atom, chlorine atom, bromine atom and iodine atom. Particularly, fluorine atom and chlorine atom are preferred.

[0018] The "halogenated alkyl group" includes a linear or branched alkyl group having 1 to 20 carbon atoms substituted with one or more halogens. １ -C １０ The "C alkyl group" is the above-mentioned "C alkyl group" substituted with one or more halogen atoms. １ -C １０ Preferably, the alkyl group is a straight or branched C alkyl group substituted with 1 to 10 halogen atoms. ２ -C ８ The "halogenated C" of the substituent group β and the substituent group β2 is an alkyl group. １ -C ６ The "C alkyl group" is the above-mentioned "C alkyl group" substituted with one or more halogen atoms. １ -C ６ Preferably, the alkyl group is a straight or branched C alkyl group substituted with 1 to 4 halogen atoms. １ -C ３ It is an alkyl group.

[0019] The term "alkenyl group" includes a linear or branched hydrocarbon group having 2 to 20 carbon atoms and having one or more double bonds at any position. Examples thereof include vinyl, allyl, propenyl, isopropenyl, butenyl, isobutenyl, prenyl, butadienyl, pentenyl, isopentenyl, pentadienyl, hexenyl, isohexenyl, hexadienyl, heptenyl, octenyl, nonenyl, decenyl, undecenyl, dodecenyl, tridecenyl, tetradecenyl, and pentadecenyl. ２ -C １０ The term "alkenyl group" means a straight-chain or branched alkenyl group having 2 to 10 carbon atoms. Preferably, it is a straight-chain or branched alkenyl group having 1 to 4 double bonds. ２ -C １０ is an alkenyl group. ６ and R ７ "C" ２ -C ６ The term "alkenyl group" means a straight-chain or branched alkenyl group having 2 to 6 carbon atoms. Preferably, it is a straight-chain or branched alkenyl group having 1 or 2 double bonds. ２ -C ４ It is an alkenyl group.

[0020] The term "halogenated alkenyl group" includes a linear or branched alkenyl group having 2 to 20 carbon atoms substituted with one or more halogen atoms. ２ -C １０ The "alkenyl group" refers to the above "C" substituted with one or more halogen atoms. ２ -C １０ Preferably, the alkenyl group is a straight or branched C alkyl group substituted with 1 to 10 halogen atoms. ２ -C ８ It is an alkenyl group.

[0021] The term "alkynyl group" includes a linear or branched hydrocarbon group having 2 to 20 carbon atoms and having one or more triple bonds at any position. It may further have a double bond at any position. Examples of the alkynyl group include ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl, and decynyl. ２ -C １０The term "alkynyl group" means a straight-chain or branched alkynyl group having 2 to 10 carbon atoms. Preferably, it is a straight-chain or branched alkynyl group having one or two triple bonds. ２ -C １０ is an alkynyl group. ６ and R ７ "C" ２ -C ６ The term "alkynyl group" means a straight-chain or branched alkynyl group having 2 to 6 carbon atoms. Preferably, it is a straight-chain or branched alkynyl group having one triple bond. ２ -C ４ It is an alkynyl group.

[0022] The "halogenated alkynyl group" includes a linear or branched alkynyl group having 2 to 20 carbon atoms substituted with one or more halogen atoms. ２ -C １０ The "alkynyl group" refers to the above "C" substituted with one or more halogen atoms. ２ -C １０ Preferably, the alkynyl group is a straight or branched C alkynyl group substituted with 1 to 10 halogen atoms. ２ -C ８ It is an alkynyl group.

[0023] "Alkoxy" means alkyloxy.

[0024] The "halogenated alkoxy group" includes a linear or branched alkoxy group having 1 to 20 carbon atoms substituted with one or more halogen atoms. １ -C １０ The term "alkoxy group" means a linear or branched alkoxy group having 1 to 10 carbon atoms substituted with one or more halogen atoms. Preferably, the term "alkoxy group" means a linear or branched alkoxy group having 1 to 10 carbon atoms substituted with one or more halogen atoms. ２ -C ８ It is an alkoxy group.

[0025] "C" in the substituent group α １ -C １１ The "alkanoyl group" is a formyl group or C １ -C １０ Alkyl groups, halogenated C １ -C １０ Alkyl group, C ２-C １０ Alkenyl group, halogenated C ２ -C １０ Alkenyl group, C ２ -C １０ Alkynyl group or halogenated C ２ -C １０ The "C" in the substituent group β and the substituent group β1 includes a carbonyl group substituted with an alkynyl group. １ -C ７ The "alkanoyl group" is a formyl group or C １ -C ６ Alkyl group or halogenated C １ -C ６ It includes carbonyl groups substituted with alkyl groups.

[0026] The "alkoxyalkoxy group" includes a linear or branched alkoxy group having 1 to 20 carbon atoms substituted with one or more alkoxy groups. １ -C １０ Alkoxy C １ -C １０ The "alkoxy group" is a group having one or more C １ -C １０ It means a linear or branched alkoxy group having 1 to 10 carbon atoms substituted with an alkoxy group. １ -C １０ Alkoxy-substituted straight or branched C ２ -C ８ It is an alkoxy group.

[0027] The term "non-aromatic carbocycle" refers to a monocyclic or bicyclic or more non-aromatic saturated or unsaturated hydrocarbon ring. Preferably, it refers to a 3- to 12-membered non-aromatic saturated or unsaturated hydrocarbon ring. Furthermore, the term "non-aromatic saturated hydrocarbon ring" also includes rings that form a bridged ring or a spiro ring as described below. The term "non-aromatic unsaturated hydrocarbon ring" refers to a non-aromatic saturated hydrocarbon ring having one or several (preferably 1 to 3) double bonds in the ring, and also includes rings that form bridged rings or spiro rings. Examples of monocyclic non-aromatic carbocyclic rings include cyclopropane, cyclobutane, cyclopentane, cyclohexane, cycloheptane, cyclooctane, cyclononane, cyclodecane, cyclopropene, cyclobutene, cyclopentene, cyclohexene, cycloheptene, cyclohexadiene, etc.

[0028] The term "non-aromatic carbocyclic group" refers to a group derived from the above-mentioned "non-aromatic carbocycle".

[0029] R ３ and R ４ "C" formed by ３ -C ５ "Non-aromatic carbocyclic ring" is C ３ -C ５ Cyclic saturated hydrocarbon ring or C ３ -C ５ It means a cyclic non-aromatic unsaturated hydrocarbon ring. ３ -C ５ Examples of the cyclic saturated hydrocarbon ring include cyclopropane, cyclobutane, and cyclopentane. ３ -C ５ The cyclic non-aromatic unsaturated hydrocarbon ring is C ３ -C ５ R means a ring containing one double bond in a saturated cyclic hydrocarbon ring, such as cyclopentene. ６ or R ７ "C" ３ -C ７ "Non-aromatic carbocyclic group" refers to a C ３ -C ７ A cyclic saturated hydrocarbon group or C ３ -C ７ C means a cyclic non-aromatic unsaturated hydrocarbon group. ３ -C ７ Examples of the cyclic saturated hydrocarbon group include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl. ３ -C ７ The cyclic non-aromatic unsaturated hydrocarbon cyclic group is C３ -C ７ The saturated cyclic hydrocarbon group means a cyclic group containing one double bond, and examples thereof include cyclopentenyl and cyclohexenyl.

[0030] The term "non-aromatic heterocycle" refers to a monocyclic or bicyclic or more non-aromatic saturated heterocycle or non-aromatic unsaturated heterocycle having 1 to 3 identical or different heteroatoms selected from O, S, and N(R') in the ring. Preferably, it refers to a 3- to 12-membered non-aromatic heterocycle. Here, R' is a hydrogen atom or a substituted or unsubstituted C １ -C ６ It is an alkyl group. The substituent is selected from the substituent group β1. Furthermore, the "non-aromatic heterocycle" also includes rings that form bridged rings or spiro rings as shown below. Examples of the monocyclic non-aromatic heterocycle include thiirane, oxirane, aziridine, oxetane, azetidine, oxathiolane, thiazolidine, pyrrolidine, pyrroline, imidazolidine, imidazoline, pyrazolidine, pyrazolone, tetrahydrofuran, and dihydrothiazolyl.

[0031] The term "non-aromatic heterocyclic group" refers to a group derived from the above-mentioned "non-aromatic heterocycle". ３ and R ７ The "non-aromatic heterocycle" formed by R ７ In addition to the nitrogen atom to which R is bonded and X, R may or may not further contain a heteroatom as a ring-constituting atom. ３ and R ８ The "non-aromatic heterocycle" formed by R may or may not contain a heteroatom other than X. ５ and R ６ The "non-aromatic heterocycle" formed by R ６ R may or may not contain any further heteroatoms in addition to the nitrogen atom to which R is bonded. ６ and R ７ The "non-aromatic heterocycle" formed by R ６ and R ７ R may or may not contain any further heteroatoms in addition to the nitrogen atom to which R is bonded.７ and R ８ The "non-aromatic heterocycle" formed by R ７ may or may not contain further heteroatoms in addition to the nitrogen atom to which is bonded.

[0032] "Ji (C １ -C １０ Two C alkyl)carbamoyl groups １ -C １０ The alkyls may be the same or different. １ -C ６ Two C's of "alkylamino group" １ -C ６ The alkyls may be the same or different.

[0033] R ２ "Substituted or unsubstituted C ５ -C ２０ In the "alkyl group", any substitutable hydrogen atom may be substituted with one or more substituents selected from the substituent group α. Any 1 to 10 hydrogen atoms may be substituted, or any 1 to 4 hydrogen atoms may be substituted. １ -C ６ alkyl group," "substituted or unsubstituted C ２ -C ６ alkenyl group" or "substituted or unsubstituted C ２ -C ６ In the "alkynyl group," any substitutable hydrogen atom may be substituted with 1 to 4 substituents selected from the substituent group β1. ３ -C ５ "Non-aromatic carbocyclic ring", "substituted or unsubstituted C ３ -C ７ In the "non-aromatic carbocyclic group" or the "substituted or unsubstituted non-aromatic heterocycle", any substitutable hydrogen atom may be substituted with 1 to 4 substituents selected from the substituent group β2.

[0034] The present invention will be described in detail below. The compound of the present invention is a cationic lipid. The cationic lipid of the present invention is represented by formula (I): (In the formula, R１ represents a substituted or unsubstituted group of the formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ and R ２ is a substituted or unsubstituted C ５ -C ２０ an alkyl group or a substituted or unsubstituted group of the formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ and L １ and L ２ are each independently -C(=O)O-, -OC(=O)-, or -OC(=O)O-; a and b are each independently an integer of 1 or more, and the sum of a and b is an integer of 5 to 25; c and d are each independently an integer of 1 or more, and the sum of c and d is an integer of 5 to 25; R １ Formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ and R ２ C ５ -C ２０ Alkyl groups and the formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ are each independently selected from a substituent group α; the substituent group α includes a halogen atom, an oxo group, a cyano group, a nitro group, a sulfanyl group, a carboxy group, C １ -C １０ Alkyl groups, halogenated C １ -C １０ Alkyl group, C ２ -C １０ Alkenyl group, halogenated C ２ -C １０ Alkenyl group, C ２ -C １０ Alkynyl group, halogenated C ２-C １０ Alkynyl group, C １ -C １０ Alkoxy group, halogenated C １ -C １０ Alkoxy group, C １ -C １０ Alkylsulfanyl group, halogenated C １ -C １０ Alkylsulfanyl group, C １ -C １１ Alkanoyl group, C １ -C １１ Alkanoyloxy group, C １ -C １０ Alkoxy C １ -C １０ Alkoxy group, C １ -C １０ Alkoxycarbonyl group, C １ -C １０ Alkylcarbamoyl group, di(C １ -C １０ alkyl)carbamoyl group, C １ -C １０ Alkoxycarbonyloxy, C １ -C １１ Alkanoyl (C １ -C １０ alkyl)amino, C １ -C １０ Alkoxycarbonylamino and C １ -C １０ alkylcarbamoyloxy; R ３ and R ４ are each independently a hydrogen atom or a substituted or unsubstituted C １ -C ６ an alkyl group; or R ３ and R ４ together form a substituted or unsubstituted C ３ -C ５ may form a non-aromatic carbocyclic ring; R ５ represents a hydrogen atom or a substituted or unsubstituted C １ -C ６ is an alkyl group; R ６ and R ７ are each independently a hydrogen atom, a substituted or unsubstituted C１ -C ６ alkyl group, substituted or unsubstituted C ２ -C ６ Alkenyl group, substituted or unsubstituted C ２ -C ６ Alkynyl group or substituted or unsubstituted C ３ -C ７ is a non-aromatic carbocyclic group; R ８ , R ９ and R １０ is a hydrogen atom; or R ３ and R ７ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ３ and R ８ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ５ and R ６ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ６ and R ７ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ８ and R ９ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic carbocyclic ring or a substituted or unsubstituted non-aromatic heterocyclic ring, in which case k is 1 or 2; R ７ and R ８ is R ５ and R ６ When they form a ring, they may be taken together with the atoms to which they are attached to form a substituted or unsubstituted non-aromatic heterocycle; Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)-, -OC(=O)N(R)-, -N(R)C(=O)N(R)-, -N(R)C(=O)O-, -C(=S)N(R)-, -N(R)C(=S)-, -C(=O)S-, -SC(=O)-, -N(R)S(=O) ２ -, -OS (=O) ２ -, -OP(=O)(-OR)O-, -OP(=S)(-OR)O-, -OS(=O)２ -O-, -S (=O) ２ -N(R)-, -OP(=O)(-NR)O-, -C(=S)O-, or -OC(=S)-; X is O or S; p, q, s, and k each independently represent an integer of 0 to 2; r is an integer of 0 to 5; and R each independently represent a hydrogen atom or a substituted or unsubstituted C １ -C ６ is an alkyl group; R ３ ~R ７ and R's C １ -C ６ Alkyl group and R ６ and R ７ C ２ -C ６ Alkenyl group or C ２ -C ６ The substituents in the alkynyl group are each independently selected from a substituent group β1; the substituent group β1 includes a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, C １ -C ６ Alkoxy group, C １ -C ６ Alkylsulfanyl group, C １ -C ６ Alkylamino group, diC １ -C ６ Alkylamino group and C １ -C ７ alkanoyl groups; R ３ and R ４ A ring formed by R ６ and R ７ C ３ -C ７ non-aromatic carbocyclic group, R ３ and R ７ A ring formed by R ３ and R ８ A ring formed by R ５ and R ６ A ring formed by R ６ and R ７ A ring formed by R ７ and R ８ The ring formed by and R ８ and R ９The substituents in the ring formed by are each independently selected from the substituent group β2; the substituent group β2 is selected from the substituent group β1, C １ -C ６ Alkyl groups and halogenated C １ -C ６ or a pharmacologically acceptable salt thereof.

[0035] The cationic lipid of the present invention is characterized in that it has X (wherein X is O or S) in the chemical structural formula represented by formula (I) above, R １ as a substituted or unsubstituted group of the formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ where the sum of a and b is an integer from 5 to 25, and L １ is —C(═O)O—, —OC(═O)— or —OC(═O)O—).

[0036] Preferred embodiments of the cationic lipid of the present invention will be described below. １ represents a substituted or unsubstituted group of the formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ One or more arbitrary hydrogen atoms may be substituted with a substituent selected from the substituent group α. Any of 1 to 10 hydrogen atoms may be substituted, or any of 1 to 4 hydrogen atoms may be substituted. L １ is preferably -C(=O)O- or -O-C(=O)-. More preferably, it is -C(=O)O-. a and b are preferably each independently an integer of 3 to 15. More preferably, they are each independently an integer of 5 to 10. Particularly preferably, they are each independently an integer of 6 to 8. R １ Formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３The substituent selected from the substituent group α in １ -C １０ Alkyl groups, halogenated C １ -C １０ Alkyl group, C １ -C １１ Alkanoyl group or C １ -C １１ An alkanoyloxy group is more preferred. １ -C １０ Alkyl groups, halogenated C １ -C １０ Alkyl group, C １ -C １１ Alkanoyl group or C １ -C １１ An alkanoyloxy group is particularly preferred. １ -C １０ Alkyl group or C １ -C １１ is an alkanoyloxy group. １ is preferably a substituted or unsubstituted group of the formula: -(CH ２ ) ａ -C(=O)O-(CH ２ ) ｂ -CH ３ or a substituted or unsubstituted formula: -(CH ２ ) ａ -OC(=O)-(CH ２ ) ｂ -CH ３ wherein the sum of a and b is an integer of 5 to 25, and a and b are each independently an integer of 3 to 15. More preferably, a substituted or unsubstituted group represented by the formula: -(CH ２ ) ａ -C(=O)O-(CH ２ ) ｂ -CH ３ and a and b are each independently an integer of 5 to 10. Particularly preferably, R １ is C １ -C １０ Formula: -(CH ２ ) ａ -C(=O)O-(CH ２ ) ｂ -CH３ and a and b are each independently an integer of 6 to 8.

[0037] R ２ The substituted or unsubstituted groups include those of the formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ is preferred. Any one or more hydrogen atoms may be substituted with a substituent selected from the substituent group α. Any one to ten hydrogen atoms may be substituted, or any one to four hydrogen atoms may be substituted. L ２ is preferably -C(=O)O- or -O-C(=O)-. More preferably, it is -C(=O)O-. c and d are preferably each independently an integer of 3 to 15. More preferably, they are each independently an integer of 5 to 10. Particularly preferably, they are each independently an integer of 6 to 8. Formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ The substituent in is selected from the substituent group α, and preferably a halogen atom, an oxo group, a cyano group, C １ -C １０ Alkyl groups, halogenated C １ -C １０ Alkyl group, C １ -C １１ Alkanoyl group or C １ -C １１ An alkanoyloxy group is more preferred. １ -C １０ Alkyl groups, halogenated C １ -C １０ Alkyl group, C １ -C １１ Alkanoyl group or C １ -C １１ An alkanoyloxy group is particularly preferred. １ -C １０ Alkyl group or C １ -C １１ is an alkanoyloxy group.２ is preferably a substituted or unsubstituted group of the formula: -(CH ２ ) ｃ -C(=O)O-(CH ２ ) ｄ -CH ３ or a substituted or unsubstituted formula: -(CH ２ ) ｃ -OC(=O)-(CH ２ ) ｄ -CH ３ wherein the sum of c and d is an integer of 5 to 25, and c and d are each independently an integer of 3 to 15. More preferably, the substituted or unsubstituted group is a group represented by the formula: -(CH ２ ) ｃ -C(=O)O-(CH ２ ) ｄ -CH ３ and c and d are each independently an integer of 5 to 10. Particularly preferably, C １ -C １０ Formula: -(CH ２ ) ｃ -C(=O)O-(CH ２ ) ｄ -CH ３ and c and d are each independently an integer of 6 to 8.

[0038] In another embodiment, R ２ is substituted or unsubstituted C ５ -C ２０ It is also preferable that the alkyl group is a substituted or unsubstituted C ５ -C １０ alkyl group, and particularly preferably C ５ -C １０ It is an alkyl group. ５ -C ２０ The substituent selected from the substituent group α in the alkyl group is preferably a halogen atom, an oxo group, a cyano group, C １ -C １０ Alkyl groups, halogenated C １ -C １０ Alkyl group, C １ -C １１ Alkanoyl group or C １ -C １１An alkanoyloxy group is more preferred. １ -C １０ Alkyl groups, halogenated C １ -C １０ Alkyl group, C １ -C １１ Alkanoyl group or C １ -C １１ An alkanoyloxy group is particularly preferred. １ -C １０ Alkyl group or C １ -C １１ It is an alkanoyloxy group.

[0039] R ３ C １ -C ６ The substituent selected from the substituent group β or the substituent group β1 in the alkyl group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, C １ -C ６ Alkyl group or halogenated C １ -C ６ R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ３ is preferably a hydrogen atom or a substituted or unsubstituted C １ -C ６ It is preferably a hydrogen atom or a C １ -C ６ Particularly preferred is a hydrogen atom or a C １ -C ３ It is an alkyl group.

[0040] R ４ C １ -C ６ The substituent selected from the substituent group β or the substituent group β1 in the alkyl group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, C １ -C ６ Alkyl group or halogenated C １ -C ６R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ４ is preferably a hydrogen atom or a substituted or unsubstituted C １ -C ６ It is preferably a hydrogen atom or a C １ -C ６ Particularly preferred is a hydrogen atom or a C １ -C ３ It is an alkyl group.

[0041] R ３ and R ４ together form a substituted or unsubstituted C ３ -C ５ It may form a non-aromatic carbocyclic ring. ３ and R ４ The substituent selected from the substituent group β or the substituent group β2 in the ring formed by １ -C ６ Alkyl group or halogenated C １ -C ６ It is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. C ３ -C ５ The non-aromatic carbocyclic ring is preferably C ３ -C ５ More preferably, it is cyclopropane, cyclobutane, or cyclopentane. Specifically, Particularly preferred is cyclopropane or cyclopentane.

[0042] R ５ C １ -C ６ The substituent selected from the substituent group β or the substituent group β1 in the alkyl group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, C １ -C６ Alkyl group or halogenated C １ -C ６ R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ５ is preferably a hydrogen atom or a substituted or unsubstituted C １ -C ３ More preferably, it is a C alkyl group substituted or unsubstituted with a hydrogen atom, a halogen atom, an oxo group, or a hydroxyl group. １ -C ３ An alkyl group is particularly preferred, and a hydrogen atom is particularly preferred.

[0043] R ６ C １ -C ６ Alkyl group, C ２ -C ６ Alkenyl group or C ２ -C ６ The substituent selected from the substituent group β or the substituent group β1 in the alkynyl group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, C １ -C ６ Alkyl group or halogenated C １ -C ６ R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ６ C ３ -C ７ The substituent selected from the substituent group β or the substituent group β2 in the non-aromatic carbocyclic group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, C １ -C ６ Alkyl group or halogenated C １ -C ６ R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ６ is preferably a hydrogen atom, a substituted or unsubstituted C １ -C６ alkyl group or substituted or unsubstituted C ２ -C ６ More preferably, it is a hydrogen atom or a substituted or unsubstituted C １ -C ６ Particularly preferred is a hydrogen atom or a C １ -C ６ It is an alkyl group.

[0044] R ７ C １ -C ６ Alkyl group, C ２ -C ６ Alkenyl group or C ２ -C ６ The substituent selected from the substituent group β or the substituent group β1 in the alkynyl group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, C １ -C ６ Alkyl group or halogenated C １ -C ６ R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ７ C ３ -C ７ The substituent selected from the substituent group β or the substituent group β2 in the non-aromatic carbocyclic group is preferably a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, C １ -C ６ Alkyl group or halogenated C １ -C ６ R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ７ is preferably a hydrogen atom, a substituted or unsubstituted C １ -C ６ alkyl group or substituted or unsubstituted C ２ -C ６ More preferably, it is a hydrogen atom or a substituted or unsubstituted C １ -C ６Particularly preferred is a hydrogen atom or a C １ -C ６ It is an alkyl group.

[0045] R ３ and R ７ The substituent selected from the substituent group β or the substituent group β2 in the ring formed by １ -C ６ Alkyl group or halogenated C １ -C ６ R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ３ and R ７ The ring formed by is preferably a substituted or unsubstituted 3- to 7-membered non-aromatic heterocyclic ring containing 2 to 4 heteroatoms in the ring, and more preferably a substituted or unsubstituted 5- to 7-membered monocyclic non-aromatic heterocyclic ring containing 2 heteroatoms in the ring. For example, Examples include:

[0046] R ３ and R ８ The substituent selected from the substituent group β or the substituent group β2 in the ring formed by １ -C ６ Alkyl group or halogenated C １ -C ６ R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ３ and R ８ The ring formed by is preferably a substituted or unsubstituted 3- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring, more preferably a substituted or unsubstituted 3- to 6-membered monocyclic non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring, and particularly preferably a substituted or unsubstituted 6-membered monocyclic non-aromatic heterocycle containing one heteroatom in the ring. For example, In the above, it is preferable that q is 0 and X is O.

[0047] R ５ and R ６ The substituent selected from the substituent group β or the substituent group β2 in the ring formed by １ -C ６ Alkyl group or halogenated C １ -C ６ R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ５ and R ６ The ring formed by is preferably a substituted or unsubstituted 3- to 8-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring, more preferably a substituted or unsubstituted 4- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring, and even more preferably a substituted or unsubstituted 6-membered monocyclic non-aromatic heterocycle or a substituted or unsubstituted bicyclic non-aromatic heterocycle containing 1 or 2 heteroatoms in the ring. Examples include the following structures. In addition, in the above, R ５ and R ６ The ring-constituting atoms of the non-aromatic heterocycle formed by may be bonded to each other at any bondable position or may be bridged. Specific examples are shown below.

[0048] R ６ and R ７ The substituent selected from the substituent group β or the substituent group β2 in the ring formed by １ -C ６ Alkyl group or halogenated C １ -C ６ R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ６ and R ７The ring formed by is preferably a substituted or unsubstituted 4- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring, and more preferably a substituted or unsubstituted 6-membered monocyclic non-aromatic heterocycle containing 1 or 2 heteroatoms in the ring.

[0049] R ８ and R ９ The substituent selected from the substituent group β or the substituent group β2 in the ring formed by １ -C ６ Alkyl group or halogenated C １ -C ６ R is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group. ８ and R ９ The ring formed by R is preferably a substituted or unsubstituted 3- to 7-membered non-aromatic carbocycle or a substituted or unsubstituted 4- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring, and more preferably a substituted or unsubstituted 6-membered non-aromatic carbocycle or a substituted or unsubstituted monocyclic 6-membered non-aromatic heterocycle containing 1 or 2 heteroatoms in the ring. ８ and R ９ When forms a ring, k is 1 or 2. For example, Examples include:

[0050] R ７ and R ８ is R ５ and R ６ When R forms a ring, it may also form a ring. ７ and R ８ The ring formed by is preferably a substituted or unsubstituted 4- to 7-membered non-aromatic heterocyclic ring containing 1 to 3 heteroatoms in the ring, and more preferably a substituted or unsubstituted 6-membered monocyclic non-aromatic heterocyclic ring containing 1 or 2 heteroatoms in the ring. For example, Specifically, In addition, R ５ and R６ The non-aromatic heterocycle formed by R ５ -C(R ８ )-(CH ２ ) ｒ -N(R ７ )-R ６ It is formed by R ７ and R ８ The non-aromatic heterocycle formed by R ８ -C(R ５ )-(CH ２ ) ｒ -N(R ６ )-R ７ It is formed by R ５ and R ６ When R forms a ring, ７ and R ８ When R forms a ring, r is preferably 1 to 3, and particularly preferably 2. ７ and R ８ The substituent selected from the substituent group β or the substituent group β2 in the ring formed by １ -C ６ Alkyl group or halogenated C １ -C ６ It is an alkyl group. More preferably, it is a halogen atom, an oxo group, a hydroxyl group, a cyano group, or a sulfanyl group. Particularly preferably, it is a halogen atom, an oxo group, or a hydroxyl group.

[0051] In addition, when a ring is formed in one of the combinations shown above, a ring may also be formed in another combination. For example, R ３ and R ７ When R forms a ring, ５ and R ６ or R ８ and R ９ may form a ring. ３ and R ８ When R forms a ring, ５ and R ６ , R ６ and R ７ may form a ring. ５ and R ６When R forms a ring, ３ and R ７ , R ３ and R ８ , R ７ and R ８ , R ８ and R ９ may form a ring. ６ and R ７ When R forms a ring, ３ and R ８ , R ８ and R ９ may form a ring. ８ and R ９ When R forms a ring, ３ and R ７ , R ５ and R ６ , R ６ and R ７ may form a ring.

[0052] For example, R ５ and R ６ forms a ring and at the same time R ８ and R ９ may form a ring. In this case, k is 1 or 2. For example, In this case, R ５ and R ６ The ring formed by R is preferably a 3- to 7-membered non-aromatic heterocyclic ring containing 1 to 3 heteroatoms in the ring, and more preferably a substituted or unsubstituted 4-membered non-aromatic heterocyclic ring containing 1 or 2 heteroatoms in the ring. ８ and R ９ The ring formed by is preferably a substituted or unsubstituted 3- to 7-membered non-aromatic carbocycle, or a substituted or unsubstituted 3- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring, more preferably a substituted or unsubstituted 4- to 6-membered non-aromatic carbocycle, or a substituted or unsubstituted 4- to 6-membered non-aromatic heterocycle containing 1 or 2 heteroatoms in the ring, and even more preferably a substituted or unsubstituted 4-membered non-aromatic carbocycle.

[0053] Z is preferably —OC(═O)—, —C(═O)O—, or —OC(═O)O—, more preferably —OC(═O)— or —C(═O)O—, and particularly preferably —OC(═O)—.

[0054] p is preferably 0 or 1, and particularly preferably 0.

[0055] q is preferably 0 or 1, and particularly preferably 0.

[0056] r is preferably 1 or 2.

[0057] s is preferably 0 or 1.

[0058] k is preferably 0 or 1, and particularly preferably 0.

[0059] R is preferably a hydrogen atom.

[0060] In the compound of formula (I), R １ , R ２ , L １ , L ２ , a, b, c, d, R ３ , R ４ , R ５ , R ６ , R ７ , R ８ , R ９ , R １０ , Z, X, p, q, s, k, r, R, R ３ and R ４ A ring formed by R ３ and R ７ A ring formed by R ３ and R ８ A ring formed by R ５ and R ６ A ring formed by R ６ and R ７ A ring formed by R ７ and R ８ The ring formed by and R ８ and R ９ Preferred embodiments of the ring formed by R are shown below. As the compound represented by formula (I), embodiments of all combinations of the specific examples shown below are exemplified. １ represents a substituted or unsubstituted group of the formula: -(CH２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ (hereinafter referred to as A-1). １ is a substituted group of formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ (hereinafter referred to as A-2). １ is C １ -C １０ Alkyl group or C ２ -C １０ Formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ (hereinafter referred to as A-3). １ is C １ -C １０ Formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ (hereinafter referred to as A-4). １ is an unsubstituted group of the formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ (hereinafter referred to as A-5). １ Examples of L include -C(=O)O-, -OC(=O)-, and -OC(=O)O- (hereinafter referred to as B-1). １ is -C(=O)O- or -OC(=O)- (hereinafter referred to as B-2). １ Examples of L include -C(=O)O- (hereinafter referred to as B-3). １Examples of the groups include -OC(=O)- (hereinafter referred to as B-4). a and b are each independently an integer of 1 or more, and the sum of a and b is an integer of 5 to 25 (hereinafter referred to as C-1). a and b are each independently an integer of 3 to 15 (hereinafter referred to as C-2). a and b are each independently an integer of 5 to 10 (hereinafter referred to as C-3). a and b are each independently an integer of 6 to 9 (hereinafter referred to as C-4). a is an integer of 6 to 8 (hereinafter referred to as D-1). b is an integer of 6 to 8 (hereinafter referred to as E-1). a is 6 (hereinafter referred to as D-2). a is 7 (hereinafter referred to as D-3). a is 8 (hereinafter referred to as D-4). b is 6 (hereinafter referred to as E-2). b is 7 (hereinafter referred to as E-3). b is 8 (hereinafter referred to as E-4). R １ is the formula: (In the formula, a, L １ is the same as defined in the above item (1); b1 is an integer of 1 or more, and the sum of a and b1 is an integer of 5 to 25; b2 and b3 are each independently an integer of 0 or more, and the sum of a, b2, and b3 is an integer of 4 to 24; and b4 is an integer of 0 to 9) (hereinafter referred to as F-1). １ is the formula: (Wherein, a is an integer of 6 to 8; L １ is —C(═O)O—; b1 is an integer of 5 to 12; b2 is an integer of 0 to 2; b3 is an integer of 3 to 6; and b4 is an integer of 1 to 6) (hereinafter referred to as F-2). １ is the formula: (Wherein, a is an integer of 6 to 8; L １ is —C(═O)O—; b1 is 7; b2 is an integer of 0 to 2; b3 is an integer of 3 to 6; and b4 is an integer of 3 to 6) (hereinafter referred to as F-3). １ is the formula: (In the formula, a, L １and b1 are groups represented by the same meaning as in the above item (F-3) (hereinafter referred to as F-4). １ is the formula: (In the formula, a, L １ , b2, b3 and b4 are the same as defined in the above item (F-3); the total of b2, b3 and b4 is 8, 9, 10 or 12 (hereinafter referred to as F-5). ２ is a substituted or unsubstituted C ５ -C ２０ an alkyl group or a substituted or unsubstituted group of the formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ (hereinafter referred to as G-1). ２ is a substituted or unsubstituted C ５ -C ２０ An alkyl group can be exemplified (hereinafter referred to as G-2). ２ is the C of the substitution ５ -C ２０ An alkyl group can be exemplified (hereinafter referred to as G-3). ２ is C １ -C １０ Alkyl group or C ２ -C １０ C substituted with alkenyl group ５ -C ２０ An alkyl group can be exemplified (hereinafter referred to as G-4). ２ is unsubstituted C ５ -C ２０ An alkyl group can be exemplified (hereinafter referred to as G-5). ２ is unsubstituted C ５ -C １０ An alkyl group can be exemplified (hereinafter referred to as G-6). ２ is unsubstituted C ９ -C １０ An alkyl group can be exemplified (hereinafter referred to as G-7). ２ is unsubstituted C ９ An alkyl group can be exemplified (hereinafter referred to as G-8). ２ represents a substituted or unsubstituted group of the formula: -(CH ２ )ｃ -L ２ - (CH ２ ) ｄ -CH ３ (hereinafter referred to as G-9). ２ is a substituted group of formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ (hereinafter referred to as G-10). ２ is C １ -C １０ Alkyl group or C ２ -C １０ Formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ (hereinafter referred to as G-11). ２ is C １ -C １０ Formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ (hereinafter referred to as G-12). ２ is an unsubstituted group of the formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ (hereinafter referred to as G-13). ２ Examples of L include -C(=O)O-, -OC(=O)-, and -OC(=O)O- (hereinafter referred to as H-1). ２ Examples of L include -C(=O)O- and -OC(=O)- (hereinafter referred to as H-2). ２ Examples of L include —C(═O)O— (hereinafter referred to as H-3). ２Examples of the groups include -OC(=O)- (hereinafter referred to as H-4). c and d are each independently an integer of 1 or more, and the sum of a and b is an integer of 5 to 25 (hereinafter referred to as J-1). c and d are each independently an integer of 3 to 15 (hereinafter referred to as J-2). c and d are each independently an integer of 5 to 10 (hereinafter referred to as J-3). c and d are each independently an integer of 6 to 9 (hereinafter referred to as J-4). c is an integer of 6 to 8 (hereinafter referred to as K-1). d is an integer of 6 to 8 (hereinafter referred to as L-1). c is an integer of 6 (hereinafter referred to as K-2). c is an integer of 7 (hereinafter referred to as K-3). c is an integer of 8 (hereinafter referred to as K-4). d is an integer of 6 (hereinafter referred to as L-2). d is an integer of 7 (hereinafter referred to as L-3). d is an integer of 8 (hereinafter referred to as L-4). R ２ is the formula: (In the formula, c, L ２ is the same as defined in the above item (1); d1 is an integer of 1 or more, and the sum of c and d1 is an integer of 5 to 25; d2 and d3 are each independently an integer of 0 or more, and the sum of c, d2, and d3 is an integer of 4 to 24; and d4 is an integer of 0 to 9) (hereinafter referred to as M-1). ２ is the formula: (wherein c is an integer of 6 to 8; L ２ is —C(═O)O—; d1 is an integer of 5 to 12; d2 is an integer of 0 to 2; d3 is an integer of 3 to 6; and d4 is an integer of 1 to 6) (hereinafter referred to as M-2). ２ is the formula: (wherein c is an integer of 6 to 8; L ２ is —C(═O)O—; d1 is 7; d2 is an integer of 0 to 2; d3 is an integer of 3 to 6; and d4 is an integer of 3 to 6 (hereinafter referred to as M-3). ２ is the formula: (In the formula, c, L ２and d1 are groups represented by the same meaning as in the above item (M-3) (hereinafter referred to as M-4). ２ is the formula: (In the formula, c, L ２ , d2, d3 and d4 are the same as those defined in the above item (M-3); the total of d2, d3 and d4 is 8, 9, 10 or 12 (hereinafter referred to as M-5). １ and R ２ are each independently represented by the formula: Examples of the group include a group selected from the following (hereinafter referred to as N-1). is the formula: Examples include a group selected from the following (hereinafter referred to as N-2). is the formula: Examples include a group selected from the following (hereinafter referred to as N-3). is the formula: (hereinafter referred to as N-4). is the formula: (hereinafter referred to as N-5). is the formula: Examples of the group include a group selected from the following (hereinafter referred to as N-6). ３ represents a hydrogen atom or a substituted or unsubstituted C １ -C ６ An alkyl group can be exemplified (hereinafter referred to as O-1). ３ is a hydrogen atom or an unsubstituted C １ -C ６ An alkyl group can be mentioned (hereinafter referred to as O-2). ３ is a hydrogen atom or an unsubstituted C １ -C ３ An alkyl group can be mentioned (hereinafter referred to as O-3). ３ is a hydrogen atom (hereinafter referred to as O-4). ３ is unsubstituted C １ -C ３ An alkyl group can be mentioned (hereinafter referred to as O-5). ４ represents a hydrogen atom or a substituted or unsubstituted C １ -C ６ An alkyl group can be exemplified (hereinafter referred to as P-1).４ is a hydrogen atom or an unsubstituted C １ -C ６ An alkyl group can be exemplified (hereinafter referred to as P-2). ４ is a hydrogen atom or an unsubstituted C １ -C ３ An alkyl group can be exemplified (hereinafter referred to as P-3). ４ is a hydrogen atom (hereinafter referred to as P-4). ４ is unsubstituted C １ -C ３ An alkyl group can be exemplified (hereinafter referred to as P-5). ３ and R ４ together form a substituted or unsubstituted C ３ -C ５ Forms a non-aromatic carbocyclic ring (hereinafter referred to as Q-1). ３ and R ４ together form an unsubstituted C ３ -C ５ Forms a non-aromatic carbocyclic ring (hereinafter referred to as Q-2). ３ and R ４ together form an unsubstituted cyclopropane or cyclopentane (hereinafter referred to as Q-3). ５ represents a hydrogen atom or a substituted or unsubstituted C １ -C ６ An alkyl group can be exemplified (hereinafter referred to as S-1). ５ is a hydrogen atom or an unsubstituted C １ -C ６ An alkyl group can be mentioned (hereinafter referred to as S-2). ５ is a hydrogen atom (hereinafter referred to as S-3). ６ represents a hydrogen atom, a substituted or unsubstituted C １ -C ６ alkyl group, substituted or unsubstituted C ２ -C ６ Alkenyl group, substituted or unsubstituted C ２ -C ６ Alkynyl group or substituted or unsubstituted C ３ -C ７ A non-aromatic carbocyclic group (hereinafter referred to as T-1) is exemplified. ６represents a hydrogen atom, a substituted or unsubstituted C １ -C ６ alkyl group or substituted or unsubstituted C ２ -C ６ An alkenyl group can be mentioned (hereinafter referred to as T-2). ６ represents a hydrogen atom or a substituted or unsubstituted C １ -C ６ An alkyl group can be exemplified (hereinafter referred to as T-3). ６ is a substituted or unsubstituted C １ -C ６ An alkyl group can be exemplified (hereinafter referred to as T-4). ６ is unsubstituted C １ -C ６ An alkyl group can be exemplified (hereinafter referred to as T-5). ７ represents a hydrogen atom, a substituted or unsubstituted C １ -C ６ alkyl group, substituted or unsubstituted C ２ -C ６ Alkenyl group, substituted or unsubstituted C ２ -C ６ Alkynyl group or substituted or unsubstituted C ３ -C ７ A non-aromatic carbocyclic group is exemplified (hereinafter referred to as U-1). ７ represents a hydrogen atom, a substituted or unsubstituted C １ -C ６ alkyl group or substituted or unsubstituted C ２ -C ６ An example of such an alkenyl group is U-2. ７ represents a hydrogen atom or a substituted or unsubstituted C １ -C ６ An alkyl group can be exemplified (hereinafter referred to as U-3). ７ is a substituted or unsubstituted C １ -C ６ An alkyl group can be exemplified (hereinafter referred to as U-4). ７ is a hydroxyl-substituted or unsubstituted C １ -C ６ An alkyl group can be exemplified (hereinafter referred to as U-5). ７ is unsubstituted C １ -C６ An alkyl group can be exemplified (hereinafter referred to as U-6). ７ is an unsubstituted methyl group (hereinafter referred to as U-7). ８ is a hydrogen atom (hereinafter referred to as V-1). ９ is a hydrogen atom (hereinafter referred to as W-1). １０ is a hydrogen atom (hereinafter referred to as Y-1). ３ and R ７ R together with the atom to which they are attached form a substituted or unsubstituted non-aromatic heterocycle (hereinafter referred to as Z-1). ３ and R ７ R together with the atom to which they are attached form a substituted or unsubstituted 3- to 7-membered non-aromatic heterocycle containing 2 to 4 heteroatoms in the ring (hereinafter referred to as Z-2). ３ and R ７ R together with the atom to which they are attached form a substituted or unsubstituted 5- to 7-membered monocyclic non-aromatic heterocycle containing two heteroatoms in the ring (hereinafter referred to as Z-3). ３ and R ７ R together with the atom to which they are attached form an alkyl-substituted or unsubstituted 6-membered monocyclic non-aromatic heterocycle containing two heteroatoms in the ring (hereinafter referred to as Z-4). ３ and R ８ R together with the atoms to which they are attached form a substituted or unsubstituted non-aromatic heterocycle (hereinafter referred to as AA-1). ３ and R ８ R together with the atoms to which they are attached form a substituted or unsubstituted 3- to 6-membered monocyclic non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring (hereinafter referred to as AA-2). ３ and R ８ R together with the atom to which they are attached form a substituted or unsubstituted 5- to 6-membered monocyclic non-aromatic heterocycle containing one heteroatom in the ring (hereinafter referred to as AA-3). ３ and R ８R together with the atoms to which they are attached form an unsubstituted 5- to 6-membered monocyclic non-aromatic heterocycle containing one heteroatom in the ring (hereinafter referred to as AA-4). ５ and R ６ R together with the atoms to which they are attached form a substituted or unsubstituted non-aromatic heterocycle (hereinafter referred to as AB-1). ５ and R ６ R together with the atoms to which they are attached form a substituted or unsubstituted 3- to 8-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring (hereinafter referred to as AB-2). ５ and R ６ R together with the atoms to which they are attached form a substituted or unsubstituted 4- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring (hereinafter referred to as AB-3). ５ and R ６ R together with the atoms to which they are attached form a substituted or unsubstituted 6-membered monocyclic non-aromatic heterocycle or a substituted or unsubstituted bicyclic non-aromatic heterocycle containing 1 or 2 heteroatoms in the ring (hereinafter referred to as AB-4). ５ and R ６ R together with the atoms to which they are attached form a substituted or unsubstituted 5- or 6-membered monocyclic non-aromatic heterocycle containing one heteroatom in the ring (hereinafter referred to as AB-5). ５ and R ６ R together with the atoms to which they are attached form a substituted or unsubstituted 6-membered monocyclic non-aromatic heterocycle containing one heteroatom in the ring (hereinafter referred to as AB-6). ５ and R ６ R together with the atom to which they are attached form a substituted or unsubstituted piperidine (hereinafter referred to as AB-7). ５ and R ６ together with the atoms to which they are attached, C １ -C ３ Form an alkyl- and / or halogen-substituted or unsubstituted piperidine (hereinafter referred to as AB-8). ５ and R ６ together with the atoms to which they are attached form a substituted piperidine (hereinafter referred to as AB-9).５ and R ６ together with the atoms to which they are attached, C １ -C ３ Form a piperidine substituted with alkyl and / or halogen (hereinafter referred to as AB-10). ５ and R ６ R together with the atoms to which they are attached form an unsubstituted piperidine or an unsubstituted pyrrolidine (hereinafter referred to as AB-12). ５ and R ６ together with the atoms to which they are attached form an unsubstituted piperidine (hereinafter referred to as AB-11). ６ and R ７ R together with the atoms to which they are attached form a substituted or unsubstituted non-aromatic heterocycle (hereinafter referred to as AC-1). ６ and R ７ R together with the atoms to which they are attached form a substituted or unsubstituted 4- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring (hereinafter referred to as AC-2). ６ and R ７ R together with the atom to which they are attached form a substituted or unsubstituted 6-membered monocyclic non-aromatic heterocycle containing 1 or 2 heteroatoms in the ring (hereinafter referred to as AC-3). ８ and R ９ R together with the atoms to which they are attached form a substituted or unsubstituted non-aromatic carbocyclic ring or a substituted or unsubstituted non-aromatic heterocyclic ring (hereinafter referred to as AD-1). ８ and R ９ R together with the atoms to which they are attached form a substituted or unsubstituted 3- to 7-membered non-aromatic carbocycle or a substituted or unsubstituted 5- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring (hereinafter referred to as AD-2). ８ and R ９ R together with the atoms to which they are attached form a substituted or unsubstituted monocyclic 4- to 6-membered non-aromatic carbocyclic ring or a substituted or unsubstituted monocyclic 4- to 6-membered non-aromatic heterocyclic ring containing 1 or 2 heteroatoms in the ring (hereinafter referred to as AD-3). ８ and R ９R together with the atoms to which they are attached form a substituted or unsubstituted monocyclic 4- to 6-membered non-aromatic carbocyclic ring (hereinafter referred to as AD-4). ８ and R ９ R together with the atoms to which they are attached form an unsubstituted monocyclic 4- to 6-membered non-aromatic carbocyclic ring (hereinafter referred to as AD-5). ７ and R ８ is R ５ and R ６ When R forms a ring, they together with the atoms to which they are attached form a substituted or unsubstituted non-aromatic heterocycle (hereinafter referred to as AE-1). ７ and R ８ is R ５ and R ６ When R form a ring, they together with the atoms to which they are attached form a substituted or unsubstituted 4- to 7-membered non-aromatic heterocycle containing 1 to 3 heteroatoms in the ring (hereinafter referred to as AE-2). ７ and R ８ is R ５ and R ６ When R form a ring, they together with the atoms to which they are attached form a substituted or unsubstituted 6-membered monocyclic non-aromatic heterocycle containing 1 or 2 heteroatoms in the ring (hereinafter referred to as AE-3). ５ and R ６ form a 3- to 7-membered non-aromatic heterocyclic ring containing 1 to 3 heteroatoms in the ring, and at the same time, R ８ and R ９ form a substituted or unsubstituted 3- to 7-membered non-aromatic carbocyclic ring or a substituted or unsubstituted 3- to 7-membered non-aromatic heterocyclic ring containing 1 to 3 heteroatoms in the ring (hereinafter referred to as AF-1). ５ and R ６ form an unsubstituted 4-membered non-aromatic heterocyclic ring containing 1 or 2 heteroatoms in the ring, and at the same time, R ８ and R ９form an unsubstituted 4-membered non-aromatic carbocyclic ring (hereinafter referred to as AF-2). Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)-, -OC(=O)N(R)-, -N(R)C(=O)N(R)-, -N(R)C(=O)O-, -C(=S)N(R)-, -N(R)C(=S)-, -C(=O)S-, -SC(=O)-, -N(R)S(=O) ２ -, -OS (=O) ２ -, -OP(=O)(-OR)O-, -OP(=S)(-OR)O-, -OS(=O) ２ -O-, -S (=O) ２Examples of Z include -N(R)-, -OP(=O)(-NR)O-, -C(=S)O-, and -OC(=S)- (hereinafter referred to as AG-1). Z includes -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)O-, and -N(R)C(=O)- (hereinafter referred to as AG-2). Z includes -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(H)-, -C(=O)N(Me)-, -N(H)C(=O)O-, and -N(H)C(=O)- (hereinafter referred to as AG-3). Examples of Z include -OC(=O)-, -C(=O)O-, and -OC(=O)O- (hereinafter referred to as AG-4). Examples of Z include -OC(=O)- or -C(=O)O- (hereinafter referred to as AG-5). Examples of Z include -OC(=O)- (hereinafter referred to as AG-6). Examples of X include O or S (hereinafter referred to as AH-1). Examples of X include O (hereinafter referred to as AH-2). Examples of X include S (hereinafter referred to as AH-3). Examples of p include integers of 0 to 2 (hereinafter referred to as AI-1). Examples of p include 0 or 1 (hereinafter referred to as AI-2). Examples of p include 0 (hereinafter referred to as AI-3). Examples of p include 1 (hereinafter referred to as AI-4). Examples of q include integers of 0 to 2 (hereinafter referred to as AJ-1). Examples of q include 0 or 1 (hereinafter referred to as AJ-2). Examples of q include 0 (hereinafter referred to as AJ-3). Examples of q include 1 (hereinafter referred to as AJ-4). Examples of s include an integer from 0 to 2 (hereinafter referred to as AK-1). Examples of s include 0 or 1 (hereinafter referred to as AK-2). Examples of s include 0 (hereinafter referred to as AK-3). Examples of s include 1 (hereinafter referred to as AK-4). Examples of k include an integer from 0 to 2 (hereinafter referred to as AL-1). Examples of k include 0 or 1 (hereinafter referred to as AL-2). Examples of k include 0 (hereinafter referred to as AL-3). Examples of k include 1 (hereinafter referred to as AL-4). Examples of r include an integer from 0 to 5 (hereinafter referred to as AM-1). Examples of r include an integer from 0 to 3 (hereinafter referred to as AM-2). Examples of r include 1 or 2 (hereinafter referred to as AM-3). Examples of r include 1 (hereinafter referred to as AM-4). r may be 2 (hereinafter referred to as AM-5).Each R is independently a hydrogen atom or a substituted or unsubstituted C. １ -C ６ An alkyl group (hereinafter referred to as AN-1) is exemplified. Each R independently represents a hydrogen atom (hereinafter referred to as AN-1).

[0061] In the compound represented by formula (I), the following embodiments are more preferred. All combinations of the following specific examples are exemplified: (i) Formula (Ia): or a pharmaceutically acceptable salt thereof. １ Examples of R include (F-2), (F-3), (F-4) and (F-5) above. ２ is (M-2), (M-3), (M-4) or (M-5) above. １ and R ２ is exemplified by (N-1), (N-2), (N-3), (N-4) or (N-5) above. p is exemplified by (AI-2), (AI-3) or (AI-4) above. Z is exemplified by (AG-2), (AG-3), (AG-4), (AG-5) or (AG-6) above. R ３ R includes the above (O-3), (O-4) or (O-5). ４ is (P-3), (P-4) or (P-5) above. ３ and R ４ is exemplified by (Q-2) or (Q-3) above. q is exemplified by (AJ-2), (AJ-3) or (AJ-4) above. X is exemplified by (AH-1), (AH-2) or (AH-3) above. r is exemplified by (AM-2), (AM-3), (AM-4) or (AM-5) above. R ５ The above (S-2) or (S-3) can be mentioned. ６ The above (T-4) or (T-5) can be mentioned. ５ and R ６ Examples of R include (AB-3), (AB-5), (AB-6), (AB-7), (AB-8), (AB-9), (AB-10) and (AB-11). ７(ii) Formula (Ib): or a pharmaceutically acceptable salt thereof. １ and R ２ R may be (N-1), (N-2), (N-3), (N-4) or (N-5) as above. p may be (AI-2), (AI-3) or (AI-4) as above. ３ Examples of R include (O-3) above. ４ The above (P-4) can be exemplified as the example of q. The above (AJ-3) can be exemplified as the example of R. ５ The above (S-2) or (S-3) can be mentioned. ６ Examples of the compound include (T-5) above. ７ (iii) Formula (Ic): or a pharmaceutically acceptable salt thereof. １ and R ２ Examples of the formula (N-2), (N-3), (N-4) and (N-5) are given above. Examples of the formula (AI-3) and (AI-4) are given above. Examples of the formula (AH-3) are given above. Examples of the formula (r) are given above. R ５ and R ６ Examples of R include (AB-11) and (AB-12) above. ７ (iv) Formula (Ic): or a pharmaceutically acceptable salt thereof. １ and R ２ Examples of R include (N-2), (N-3), (N-4) and (N-5) above. Examples of p include (AI-3) and (AI-4) above. Examples of X include (AH-2) above. Examples of r include (AM-5) above. ５ and R ６ Examples of R include (AB-11) and (AB-12) above. ７ Examples of the compound include (U-5) and (U-7) above.

[0062] One or more hydrogen, carbon and / or other atoms of the compounds of formula (I) may be replaced with isotopes of the respective hydrogen, carbon and / or other atoms. Examples of such isotopes include, but are not limited to, ２ H. ３ H. １１ C. １３ C. １４ C. １５ N. １８ O. １７ O. ３１ P. ３２ P. ３５ S. １８ F. １２３ I and ３６ The isotopes of the compounds of formula (I) include hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, iodine, and chlorine, such as Cl. The compounds of formula (I) also include compounds substituted with such isotopes. The isotope-substituted compounds are also useful as pharmaceuticals, and include all radiolabeled compounds of formula (I). The present invention also includes a "radiolabeling method" for producing the "radiolabeled compound," and the "radiolabeled compound" is useful as a research and / or diagnostic tool in metabolism pharmacokinetic studies and binding assays.

[0063] Radiolabeled compounds of formula (I) can be prepared by methods well known in the art. For example, tritium-labeled compounds of formula (I) can be prepared by introducing tritium into a specific compound of formula (I) via catalytic dehalogenation using tritium. This method involves reacting a precursor of a compound of formula (I) in which the appropriate halogen is substituted with tritium gas in the presence of a suitable catalyst, such as Pd / C, with or without a base. Other suitable methods for preparing tritium-labeled compounds can be found in "Isotopes in the Physical and Biomedical Sciences, Vol. 1, Labeled Compounds (Part A), Chapter 6 (1987)." １４ C-labeled compounds are １４ It can be prepared by using a raw material having C carbon.

[0064] The term "pharmacologically acceptable salt" refers to a compound of formula (I) and an alkali metal (e.g., lithium, sodium, potassium, etc.), alkaline earth metal (e.g., calcium, magnesium, barium, etc.), magnesium, transition metal (e.g., zinc, iron, copper, nickel, cobalt, etc.), aluminum, ammonia, an organic base (e.g., trimethylamine, triethylamine, trioctylamine, diethylamine, dibenzylamine, dicyclohexylamine, N,N'-dibenzylethylenediamine, ethanolamine, diethanolamine, triethanolamine, meglumine, ethylenediamine, N-benzyl-phenethylamine, pyridine, picoline, quinoline, morpholine, phenylglycine alkyl ester, N-methylglucamine, guanidine, chloramphenicol ... "Iron phosphate salts" refers to salts with amino acids (e.g., glycine, arginine, ornithine, methionine, tyrosine, glutamine, aspartic acid, etc.), inorganic acids (e.g., hydrochloric acid, perchloric acid, sulfuric acid, nitric acid, carbonic acid, hydrobromic acid, phosphoric acid, hydrofluoric acid, hydroiodic acid, phosphoric acid, etc.), or organic acids (e.g., formic acid, acetic acid, propionic acid, trifluoroacetic acid, citric acid, lactic acid, tartaric acid, oxalic acid, maleic acid, fumaric acid, succinic acid, mandelic acid, glutaric acid, malic acid, benzoic acid, phthalic acid, ascorbic acid, benzenesulfonic acid, p-toluenesulfonic acid, methanesulfonic acid, ethanesulfonic acid, trifluoroacetic acid, trifluoromethanesulfonic acid, etc.). Preferably, it is a salt with an inorganic or organic acid.

[0065] The compound of formula (I) according to the present invention can be produced, for example, by the general synthesis method shown below. Extraction, purification, etc. may be carried out by treatments typically performed in organic chemistry experiments. The compound of the present invention can be synthesized by referring to methods known in the art.

[0066] The compound of formula (I) in which Z is —OC(═O)— can be prepared, for example, as follows.

[0067] In the above formula, A is a leaving group (for example, a halogen atom, a tosyloxy group, a mesyloxy group, etc.); Pro is a protecting group (for example, a tert-butoxycarbonyl group, a benzyloxycarbonyl group, etc.); and the other symbols are as defined above.

[0068] A compound represented by formula (X-2) can be produced by reacting a compound represented by formula (X-1) with a hydrohalic acid or a sulfonyl halide. Examples of hydrohalic acids include hydrofluoric acid, hydrochloric acid, hydrobromic acid, and hydroiodic acid. Examples of sulfonyl halides include mesyl chloride and tosyl chloride. The reaction temperature is 0°C to the reflux temperature of the solvent, preferably 20°C to 60°C. The reaction time is 1 hour to 48 hours, preferably 1 hour to 6 hours. Examples of reaction solvents include tetrahydrofuran, dimethylformamide, dichloromethane, chloroform, toluene, xylene, neat, and the like, and these can be used alone or in combination.

[0069] A compound represented by formula (X-3) can be produced by reacting a compound represented by formula (X-2) with a compound represented by formula (X-3-0) in the presence or absence of a base. Examples of bases include sodium hydride, DIEA, potassium tert-butoxide, lithium hydroxide, potassium hydroxide, sodium hydroxide, and potassium carbonate, and these can be used in an amount of 2 to 10 molar equivalents relative to the compound represented by formula (X-2). The reaction temperature is 0°C to the reflux temperature of the solvent, preferably 20°C to 80°C. The reaction time is 1 hour to 24 hours, preferably 1 to 6 hours. Examples of reaction solvents include tetrahydrofuran, dimethylformamide, tert-butanol, and water, and these can be used alone or in combination.

[0070] A compound represented by formula (X-5) can be obtained by reacting a compound represented by formula (X-3) with a compound represented by formula (X-4) in the presence or absence of a base and in the presence or absence of a condensing agent. Examples of bases include triethylamine, DIEA, DMAP, pyridine, etc., and can be used in an amount of 2 to 20 molar equivalents relative to the compound represented by formula (X-4). Examples of condensing agents include DCC, DIC, EDC, 2-methyl-6-nitrobenzoic anhydride, thionyl chloride, etc. The reaction temperature is from 0°C to the reflux temperature of the solvent, preferably from 20°C to 60°C. The reaction time is from 1 hour to 72 hours, preferably from 1 to 20 hours. Examples of reaction solvents include dichloromethane, tetrahydrofuran, dioxane, dimethylformamide, N-methylpyrrolidone, benzene, etc., and these can be used alone or in combination.

[0071] The amino-protecting group of the compound represented by formula (X-5) is deprotected with R ６ can be introduced to obtain a compound represented by formula (I). Deprotection conditions include reaction with an acid such as hydrochloric acid or trifluoroacetic acid, or reaction with hydrogen gas in the presence of a metal catalyst. The reaction temperature is 0°C to 60°C, preferably 10°C to 40°C. The reaction time is 1 hour to 6 hours, preferably 1 hour to 2 hours. Reaction solvents include ethyl acetate, dioxane, tetrahydrofuran, dichloromethane, methanol, etc., which can be used alone or in combination. R ６ can be introduced by forming an iminium cation intermediate from the deprotected compound using, for example, an aldehyde or formaldehyde, and then reducing the resulting intermediate. Examples of reducing agents that can be used include sodium triacetate borohydride and sodium cyanoborohydride. The reaction temperature is 0°C to the reflux temperature of the solvent, preferably 20°C to 40°C. The reaction time is 1 hour to 6 hours, preferably 1 hour to 2 hours. Examples of reaction solvents include dichloromethane, acetonitrile, and tetrahydrofuran, and these can be used alone or in combination.

[0072] In the above formula, each symbol has the same meaning as defined above. A compound represented by formula (I) can be obtained by reacting a compound represented by formula (X-6) with a compound represented by formula (X-4) in the presence or absence of a base and in the presence or absence of a condensing agent. This step can be carried out in the same manner as the step of obtaining a compound represented by formula (X-5) from a compound represented by formula (X-3) described above.

[0073] In the above formula, each symbol has the same meaning as defined above.

[0074] A compound of formula (X-8) can be obtained by reacting a compound of formula (X-7) with a compound of formula (X-4) in the presence or absence of a base. This step can be carried out in the same manner as the step of obtaining a compound of formula (I) from a compound of formula (X-6).

[0075] The compound represented by formula (X-8) is reacted with hydrogen gas in the presence of a metal catalyst, and then R ６ and R ７ The compound represented by formula (I) can be obtained by introducing the metal catalyst. Examples of the metal catalyst include palladium-carbon (Pd—C), platinum oxide, rhodium-aluminum oxide, and chlorotris(triphenylphosphine)rhodium(I). These metal catalysts can be used in an amount of 0.01 to 100 weight percent relative to the compound represented by formula (X-8). The hydrogen pressure can be 1 to 50 atmospheres. Examples of hydrogen sources that can be used include cyclohexene, 1,4-cyclohexadiene, formic acid, and ammonium formate. The reaction temperature is 0°C to the reflux temperature of the solvent, preferably 20°C to 40°C. The reaction time is 1 to 72 hours, preferably 1 to 8 hours. Examples of reaction solvents include methanol, ethyl acetate, tetrahydrofuran, and dioxane, which can be used alone or in combination. To stabilize the resulting amino compound, it is desirable to carry out the reaction in an acidic solution. For example, a hydrochloric acid-1,4-dioxane solution or the like can be added. The resulting amino compound can be converted to R. ６ and R ７to obtain the compound represented by formula (I), the step of introducing R ６ can be carried out in the same manner as in the step of obtaining the compound represented by formula (I) by introducing

[0076] In the above formula, Pro １ represents a benzyl group, etc.; other symbols have the same meanings as above.

[0077] A compound represented by formula (X-10) can be obtained by introducing a protecting group into a compound represented by formula (X-9) in the presence or absence of a base. Examples of the base include sodium bicarbonate, cesium carbonate, potassium carbonate, and sodium carbonate, and can be used in an amount of 1 to 10 molar equivalents relative to the compound represented by formula (X-9). The reaction temperature is 0°C to the reflux temperature of the solvent, preferably 20°C to 50°C. The reaction time is 1 hour to 72 hours, preferably 2 to 18 hours. Examples of the reaction solvent include DMF, tetrahydrofuran, dioxane, and acetonitrile, and these can be used alone or in combination.

[0078] A compound represented by formula (X-11) can be obtained by reacting a compound represented by formula (X-10) with an allyl halide in the presence or absence of a base. The reaction temperature is -78°C to 30°C, preferably -78°C to 0°C. The reaction time is 1 hour to 8 hours, preferably 1 to 2 hours. Examples of the base include lithium hexamethyldisilazide (LHMDS), LDA, and NaH. Examples of the reaction solvent include n-hexane, tetrahydrofuran, and dimethylformamide, which can be used alone or in combination.

[0079] A compound represented by formula (X-12) can be obtained by reacting a compound represented by formula (X-11) with a metal catalyst. The reaction temperature is 0°C to the reflux temperature of the solvent, preferably 30°C to the reflux temperature of the solvent. The reaction time is 1 hour to 18 hours, preferably 1 to 2 hours. Examples of reaction solvents include benzene, dichloromethane, toluene, etc., which can be used alone or in combination. Examples of metal catalysts include Grubbs' catalyst (first generation), Grubbs' catalyst (second generation), and Schrock's catalyst.

[0080] A compound represented by formula (X-13) can be obtained by reacting a compound represented by formula (X-12) with hydrogen gas in the presence of a metal catalyst. Examples of metal catalysts include palladium-carbon (Pd—C), platinum oxide, rhodium-aluminum oxide, and chlorotris(triphenylphosphine)rhodium(I). These catalysts can be used in an amount of 0.01 to 100 weight percent relative to the compound represented by formula (X-12). The hydrogen pressure can be 1 to 50 atmospheres. Examples of hydrogen sources that can be used include cyclohexene, 1,4-cyclohexadiene, formic acid, and ammonium formate. The reaction temperature is 0°C to the reflux temperature of the solvent, preferably 20°C to 40°C. The reaction time is 1 to 72 hours, preferably 1 to 8 hours. Examples of reaction solvents include methanol, ethyl acetate, tetrahydrofuran, and dioxane, which can be used alone or in combination.

[0081] The compound represented by formula (I) can be obtained from the compound represented by formula (X-13) by the same process as the process for obtaining the compound represented by formula (I) from the compound represented by formula (X-3) described above.

[0082] In the above formula, each symbol has the same meaning as defined above. A compound represented by formula (X-14) can be obtained by reacting a compound represented by formula (X-11) with hydrogen gas in the presence of a metal catalyst. This step can be performed in the same manner as the step of obtaining a compound represented by formula (X-13) from a compound represented by formula (X-12).

[0083] The compound represented by formula (I) can be obtained from the compound represented by formula (X-14) by the same process as the process for obtaining the compound represented by formula (I) from the compound represented by formula (X-3) described above.

[0084] The compound of formula (I) in which Z is —C(═O)O— can be prepared, for example, as follows.

[0085] In the above formula, each symbol has the same meaning as defined above. A compound represented by formula (I) can be obtained by reacting a compound represented by formula (X-15) with a compound represented by formula (X-16) in the presence or absence of a base and in the presence or absence of a condensing agent. This step can be carried out in the same manner as the step of obtaining a compound represented by formula (X-5) from a compound represented by formula (X-3).

[0086] The compound of formula (I) in which Z is —N(R)—C(═O)— can be prepared, for example, as follows.

[0087] In the above formula, each symbol has the same meaning as defined above. The hydroxyl group of the compound represented by formula (X-4) is protected with a mesyl group, a tosyl group, or the like, followed by the reaction with sodium azide or the like to obtain a compound represented by formula (X-21). The compound represented by formula (X-21) is reacted with hydrogen gas in the presence of a metal catalyst, and then R is introduced as necessary to obtain a compound represented by formula (X-19). This step can be performed in the same manner as the step of obtaining the compound represented by formula (I) from the compound represented by formula (X-8) described above.

[0088] A compound represented by formula (I) can be obtained by reacting a compound represented by formula (X-19) with a compound represented by formula (X-6) in the presence or absence of a base and in the presence or absence of a condensing agent. Examples of bases include triethylamine and DIEA. Examples of condensing agents include HATU, HBTU, COMU (registered trademark) (Sigma-Aldrich Brand Chemicals, etc.), and PyBOP (registered trademark) (EMD Biosciences, Inc., Merck, etc.). The reaction temperature is 0°C to the reflux temperature of the solvent, preferably 20°C to 50°C. The reaction time is 1 hour to 48 hours, preferably 1 hour to 12 hours. Examples of reaction solvents include dichloromethane, tetrahydrofuran, dioxane, dimethylformamide, N-methylpyrrolidone, etc., and these can be used alone or in combination.

[0089] The compound of formula (I) in which Z is —O—C(═O)O— or —N(R)—C(═O)O— can be produced, for example, as follows.

[0090] In the above formula, each symbol has the same meaning as defined above. A compound represented by formula (X-18) can be obtained by reacting a compound represented by formula (X-17) with 4-nitrophenyl chloroformate or bis(4-nitrophenyl)carbonate in the presence of a base. Examples of the base include triethylamine, DIEA, and pyridine. The reaction temperature is 0°C to 50°C, preferably 0°C to 30°C. The reaction time is 1 hour to 24 hours, preferably 1 hour to 4 hours. Examples of the reaction solvent include dichloromethane, dichloroethane, and the like, which can be used alone or in combination.

[0091] A compound represented by formula (X-20) can be obtained by reacting a compound represented by formula (X-4) or (X-19) with a compound represented by formula (X-17) or (X-18) in the presence or absence of a base and in the presence or absence of a condensing agent. Examples of bases include triethylamine, DIEA, DMAP, and pyridine. Examples of condensing agents include triphosgene. The reaction temperature is 0°C to the reflux temperature of the solvent, preferably 20°C to the reflux temperature of the solvent. The reaction time is 1 hour to 48 hours, preferably 1 hour to 12 hours. Examples of reaction solvents include dichloromethane, dichloroethane, and the like, which can be used alone or in combination.

[0092] The amino-protecting group of the compound represented by formula (X-20) is deprotected to form R ７ This step can be carried out in the same manner as in the step of obtaining the compound of formula (I) from the compound of formula (X-5).

[0093] The present invention includes a pharmaceutical composition comprising the cationic lipid of the present invention (a compound represented by formula (I) or a pharmacologically acceptable salt thereof) and a nucleic acid (a nucleic acid drug). For example, the pharmaceutical composition of the present invention can be produced using the method shown below.

[0094] The cationic lipid, neutral lipid, sterol, and polyethylene glycol-modified lipid of the present invention are dissolved in a polar organic solvent to obtain a lipid solution. A nucleic acid solution prepared in a buffer solution is mixed with the lipid solution to obtain a nucleic acid-lipid mixed solution. The pharmaceutical composition of the present invention can be synthesized by replacing the polar organic solvent in the polar organic solvent with an aqueous solution such as a buffer solution.

[0095] In the nucleic acid-encapsulated LNP of this embodiment, the content of the cationic lipid of the present invention is preferably 10 mol% to 100 mol%, more preferably 20 mol% to 90 mol%, and particularly preferably 40 mol% to 70 mol%.

[0096] Examples of the nucleic acid include siRNA, mRNA, miRNA, shRNA, antisense oligonucleotide, immunostimulated oligonucleotide, guide RNA (CRISPR-cas), ribozyme, and expression vector. siRNA, mRNA, and antisense oligonucleotide are preferred. siRNA or mRNA is more preferred.

[0097] In the LNP of this embodiment, the nucleic acid content is preferably 0.01% to 50% by weight, more preferably 0.1% to 30% by weight, and particularly preferably 1% to 10% by weight.

[0098] Examples of neutral lipids include dioleoylphosphatidylethanolamine, palmitoyloleoylphosphatidylcholine, egg phosphatidylcholine, dimyristoylphosphatidylcholine, dipalmitoylphosphatidylcholine, distearoylphosphatidylcholine, diarachidoylphosphatidylcholine, dibehenoylphosphatidylcholine, dilignoceroylphosphatidylcholine, dioleoylphosphatidylcholine, sphingomyelin, ceramide, dioleoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, phosphatidylethanolamine, and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate.

[0099] The neutral lipid content in the LNP of this embodiment is preferably 0 mol% to 50 mol%, more preferably 0 mol% to 40 mol%, and particularly preferably 0 mol% to 30 mol%.

[0100] Examples of polyethylene glycol-modified lipids include PEG2000-dimyristylglycerol, PEG2000-dipalmitoylglycerol, PEG2000-distearoylglycerol, PEG5000-dimyristylglycerol, PEG5000-dipalmitoylglycerol, PEG5000-distearoylglycerol, N-[(methoxypoly(ethylene glycol)2000)carbamyl]-1,2-dimyristyloxylpropyl-3-amine, R-3-[(ω-methoxy-poly(ethylene glycol)2000)carbamoyl)]-1,2-dimyristyloxylpropyl-3-amine, PEG-diacylglycerol, PEG-dialkyloxypropyl, PEG-phospholipid, and PEG-ceramide.

[0101] The content of polyethylene glycol-modified lipid in the LNP of this embodiment is preferably 0 mol% to 30 mol%, more preferably 0 mol% to 20 mol%, and particularly preferably 0 mol% to 10 mol%.

[0102] Examples of sterols include cholesterol, dihydrocholesterol, lanosterol, β-sitosterol, campesterol, stigmasterol, brassicasterol, ergocasterol, fucosterol, 3β-[N-(N',N'-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol), and the like.

[0103] The sterol content in the LNP of this embodiment is 0 mol% to 90 mol%, more preferably 10 mol% to 80 mol%, and particularly preferably 20 mol% to 50 mol%.

[0104] Examples of the aqueous solution containing a polar organic solvent include ethanol.

[0105] The combination of lipid compositions in the LNP of this embodiment is not particularly limited, but for example, a combination of a cationic lipid, a neutral lipid, and a sterol of the present invention, or a combination of a cationic lipid, a neutral lipid, a polyethylene glycol-modified lipid, and a sterol of the present invention is preferred.

[0106] The pharmaceutical composition of the present invention has any or all of the following excellent characteristics: a) weak inhibitory effect on CYP enzymes (e.g., CYP1A2, CYP2C9, CYP2C19, CYP2D6, CYP3A4, etc.); b) good pharmacokinetics, such as high bioavailability and moderate clearance; c) high metabolic stability; d) no irreversible inhibitory effect on CYP enzymes (e.g., CYP3A4) within the concentration range of the measurement conditions described herein; e) no mutagenicity; f) low cardiovascular risk; g) high nucleic acid encapsulation rate; h) high stability of particles encapsulating nucleic acid; i) high transferability to target tissues; j) ability to reduce dosage; k) ability to encapsulate low-solubility APIs and improve solubility; l) ability to efficiently transport encapsulated nucleic acids to the cytoplasm; m) low residual amount of constituent lipids in the body.

[0107] Nucleosides or internucleoside bonds in the nucleic acids contained in the pharmaceutical compositions of the present invention may be modified. Appropriately modified nucleic acids have any or all of the following characteristics compared to unmodified nucleic acids: a) high affinity for the target gene of the nucleic acid contained in the pharmaceutical composition of the present invention; b) high resistance to nucleases; c) improved pharmacokinetics; and d) high tissue distribution.

[0108] The pharmaceutical composition of the present invention can be administered by any method and formulation known in the art.

[0109] The pharmaceutical composition of the present invention can be administered by various methods depending on whether local or systemic treatment is desired or the area to be treated. The administration method may be, for example, topical (including direct administration into an organ such as ophthalmic, intravaginal, rectal, intranasal, transdermal, intraauricular, intraocular, intraventricular, intratympanic, or intravesical administration, and intratumoral), oral, or parenteral. Parenteral administration includes intravenous injection or infusion, subcutaneous, intraperitoneal, or intramuscular injection, pulmonary administration by aspiration or inhalation, subdural administration, intraventricular administration, intrathecal administration, etc. Intravenous injection, subcutaneous administration, or intramuscular injection is preferred.

[0110] When the pharmaceutical composition of the present invention is administered locally, it can be used in the form of a transdermal patch, ointment, lotion, cream, gel, drop, suppository, spray, liquid, powder, or other formulation. Compositions for oral administration include powders, granules, suspensions or solutions in water or non-aqueous media, capsules, powders, tablets, and the like. Compositions for parenteral, subdural, or intraventricular administration include sterile aqueous solutions containing buffers, diluents, and other suitable additives.

[0111] The pharmaceutical composition of the present invention can be obtained by mixing, as necessary, effective amounts of various pharmaceutical additives suitable for the dosage form, such as excipients, binders, wetting agents, disintegrants, lubricants, diluents, etc. In the case of an injection, the composition may be sterilized together with an appropriate carrier to form a formulation.

[0112] Examples of excipients include sucrose, trehalose, mannitol, sodium chloride, and amino acids. Examples of binders include methylcellulose, carboxymethylcellulose, hydroxypropylcellulose, gelatin, and polyvinylpyrrolidone. Examples of disintegrants include carboxymethylcellulose, sodium carboxymethylcellulose, starch, sodium alginate, agar powder, and sodium lauryl sulfate. Examples of lubricants include talc, magnesium stearate, and macrogol. Examples of suppository bases include cocoa butter, macrogol, and methylcellulose. When preparing liquid, emulsion, or suspension injections, commonly used solubilizers, suspending agents, emulsifiers, stabilizers, preservatives, and isotonic agents may be added as appropriate. For oral administration, flavoring agents, fragrances, and the like may be added.

[0113] Administration depends on the severity and responsiveness of the condition being treated, with the course of treatment lasting from several days to several months, or until a cure is achieved or a diminution of the condition is achieved. Those skilled in the art can determine the optimal dose, administration method, and repetition frequency. For example, the optimal administration schedule for pharmaceutical compositions containing the compounds and siRNA described herein can be calculated from appropriate biomarkers in vivo. The optimal dose varies depending on the relative efficacy of the complexes used in the present invention, but can generally be calculated based on the effects of in vitro and in vivo animal experiments. For example, given the molecular weight of the nucleic acid drug (derived from its sequence and chemical structure) and the experimentally derived effective dose, the dose expressed in mg / kg or mg / head can be calculated as usual.

[0114] The pharmaceutical composition of the present invention can be used, together with an appropriate nucleic acid drug, to prevent or treat various diseases for which nucleic acid drugs are expected to be effective, in order to improve the promotion of expression of target proteins or the inhibition of expression of target genes of the nucleic acid drugs contained therein.

[0115] The present invention will be explained in more detail below by way of examples and reference examples of the present invention, but the present invention is not limited to these examples.

[0116] The abbreviations used in this specification have the following meanings. Bn: benzyl Boc: tert-butoxycarbonyl DCC: N,N'-dicyclohexylcarbodiimide DIC: N,N'-diisopropylcarbodiimide DIEA: N,N-diisopropylethylamine DMAP: 4-dimethylaminopyridine DMEM: Dulbecco's modified Eagle's medium DMF: N,N-dimethylformamide DMG-PEG: 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene DMSO: dimethyl sulfoxide DSPC: distearoylphosphatidylcholine EDC: 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide GAPDH: glyceraldehyde-3-phosphate dehydrogenase Hprt1: hypoxanthine-guanine phosphoribosyltransferase 1 LHMDS: lithium bis(trimethylsilyl)amide NMP: N-methylpyrrolidone OVA: Ovalbumin PyBOP: (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate SOD1: Cu / Zn superoxide dismutase 1 TBAF: tetrabutylammonium fluoride TBAI: tetrabutylammonium iodide TBDPS: tert-butyldiphenylsilyl TBS: tert-butyldimethylsilyl TMS: trimethylsilyl

[0117] The NMR analysis obtained in each example was performed at 400 MHz, and DMSO-d ６ , CDCl ３ When NMR data is presented, not all measured peaks are listed in some cases.

[0118] The UPLC analysis was performed under the following conditions: (Measurement Condition 1) Column: ACQUITY UPLC (registered trademark) BEH C18 (1.7 μm, i.d. 2.1×50 mm) (Waters) Flow rate: 0.8 mL / min PDA detection wavelength: 254 nm (detection range 210-500 nm) Mobile phase: [A] is an aqueous solution containing 0.1% formic acid [B] is an acetonitrile solution containing 0.1% formic acid Gradient: A linear gradient of 5%-100% solvent [B] was performed over 3.5 minutes, followed by maintaining 100% solvent [B] for 0.5 minutes. (Measurement Condition 2) Column: Xbridge Protein BEH C4 (3.5 μm, i.d. 2.1×50 mm) (Waters) Flow rate: 0.8 mL / min PDA detection wavelength: 254 nm (detection range 210-500 nm) Mobile phase: [A] is an aqueous solution containing 10 mM ammonium carbonate, [B] is acetonitrile Gradient: A linear gradient of 60%-100% solvent [B] was performed over 3.5 minutes, and 100% solvent [B] was maintained for 0.5 minutes. (Measurement Condition 3) Column: Xbridge Protein BEH C4 (3.5 μm, i.d. 2.1×50 mm) (Waters) Flow rate: 0.8 mL / min PDA detection wavelength: 254 nm (detection range 210-500 nm) Mobile phase: [A] is an aqueous solution containing 10 mM ammonium carbonate, [B] is acetonitrile Gradient: A linear gradient of 5%-100% solvent [B] was performed over 3.5 minutes, and 100% solvent [B] was maintained for 0.5 minutes. (Measurement Condition 4) Column: ACQUITY UPLC (registered trademark) BEH C18 (1.7 μm, i.d. 2.1 × 50 mm) (Waters) Flow rate: 0.8 mL / min PDA detection wavelength: 254 nm (detection range 210-500 nm) Mobile phase: [A] is an aqueous solution containing 10 mM ammonium carbonate, [B] is acetonitrile Gradient: A linear gradient of 5%-100% solvent [B] was performed over 3.5 minutes, and 100% solvent [B] was maintained for 0.5 minutes. In the specification, the term MS (m / z) refers to a value observed by mass spectrometry.

[0119] Synthesis of Compounds of the Invention

[0120] Synthesis of Compound I-1

[0121] Step 1: To compound 1 (3.27 g, 28.2 mmol), hydroiodic acid (10.6 mL, 141 mmol) was added, and the mixture was stirred at 50°C for 2 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 2 (3.56 g, yield 56%). 1 H-NMR (CDCl3) δ: 1.07(t, 2H), 1.73 (t, 2H), 3.41 (s, 2H).

[0122] Step 2: To a solution of sodium hydride (531 mg, 13.3 mmol) in tetrahydrofuran (15 mL), a solution of N-Boc-N-methyl-2-aminoethanol (1.55 g, 4.42 mmol) in tetrahydrofuran (3.5 mL) and compound 2 (1.0 g, 4.42 mmol) were added under ice-cooling, and the mixture was stirred at room temperature for 3 hours. Water was added to the reaction solution, and the organic solvent was evaporated under reduced pressure. The resulting aqueous solution was washed with chloroform. The aqueous layer was adjusted to pH 2 with saturated aqueous citric acid, and extracted with chloroform. The organic layer was washed with water and then dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure to give compound 3 (672 mg, yield 56%). 1 H-NMR (CDCl3) δ: 0.96 (t, 2H), 1.33 (t, 2H), 1.44 (s, 9H), 2.90 (s, 3H), 3.40 (brs, 2H), 3.60 (brs, 4H).

[0123] Step 3: To a dichloromethane solution (3.5 mL) of compound 4 (see International Patent Application Publication No. 2016 / 104580, 50 mg, 0.104 mmol), compound 3 (28 mg, 0.104 mmol), 2-methyl-6-nitrobenzoic anhydride (107 mg, 0.311 mmol), DIEA (0.11 mL, 0.621 mmol), and DMAP (76 mg, 0.621 mmol) were added, and the mixture was heated to reflux for 5 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction solution, and the mixture was extracted with chloroform. The solvent was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 5 (54 mg, 71% yield).1 H-NMR (CDCl3) δ: 0.88 (m, 11H), 1.25-1.61 (m, 58H), 2.29 (t, 2H), 2.89 (s, 3H), 3.36 (brs, 2H), 3.56 (brs, 2H), 3.62 (s, 2H), 3.96 (d, 2H), 4.85 (m, 1H). ESI-MS(m / z): 739 (M+1).

[0124] Step 4: To compound 5 (150 mg, 0.203 mmol), a solution of hydrochloric acid in 1,4-dioxane (1.52 mL, 6.08 mmol) was added, and the mixture was stirred at room temperature for 2 hours. The solvent was evaporated under reduced pressure. To a solution of the resulting residue in dichloromethane (3.9 mL), 36% formaldehyde solution (0.05 mL, 0.711 mmol) and sodium triacetoxyborohydride (301 mg, 1.42 mmol) were added, and the mixture was stirred at room temperature for 1 hour. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with chloroform. The solvent was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fraction containing the target compound was evaporated under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound I-1 (93 mg, yield 70%) as a transparent oil. 1 H-NMR (CDCl3) δ: 0.88 (m, 11H), 1.17-1.28 (m, 42H), 1.49 (m, 4H), 1.60 (m, 12H), 2.25-2.31 (m, 8H), 2.49 (t, 2H), 3.56 (t, 2H), 3.62 (s, 2H), 3.97 (d, 2H), 4.85 (m, 1H). ESI-MS(m / z): 653 (M+1).

[0125] Synthesis of Compound I-2

[0126] Step 5: To a DMF solution (20.9 mL) of compound 6 (973 mg, 4.17 mmol), Bn bromide (1.04 mL, 8.76 mmol) and sodium bicarbonate (1.12 g, 13.4 mmol) were added under ice-cooling, and the mixture was stirred for 40 hours. To the reaction solution, Bn bromide (0.30 mL, 2.53 mmol) and sodium bicarbonate (0.48 g, 5.72 mmol) were added, and the mixture was stirred at 50°C for 5 hours. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with water, and the solvent was evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 7 (1.14 g, 85% yield). 1 H-NMR (CDCl3) δ: 1.44 (s, 9H), 2.92 (s, 3H), 3.42 (brs, 2H), 3.66 (brs, 2H), 4.13 (s, 2H), 5.19 (s, 2H), 7.31-7.36 (m, 5H).

[0127] Step 6: To a solution of compound 7 (371 mg, 1.15 mmol) in tetrahydrofuran (11.5 mL), allyl iodide (2.1 mL, 22.9 mmol) and LHMDS-tetrahydrofuran solution (2.29 mL, 2.29 mmol) were added at −78° C., and the mixture was stirred for 1 hour. To the reaction solution, LHMDS-tetrahydrofuran solution (1.15 mL, 1.15 mmol) was added, and the mixture was stirred for 1 hour. A saturated aqueous solution of ammonium chloride was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 8 (197 mg, yield 43%). 1 H-NMR (CDCl3) δ: 1.44 (s, 9H), 2.55 (m, 4H), 2.89 (s, 3H), 3.36 (brs, 2H), 3.54 (brs, 2H), 5.05 (m, 4H), 5.14 (s, 2H), 5.69 (m, 2H), 7.31-7.36 (m, 5H). ESI-MS(m / z): 404 (M+1).

[0128] Step 7: To a solution of compound 8 (96 mg, 0.24 mmol) in dichloromethane (2.4 mL), Grubbs Catalyst (registered trademark) second generation (Sigma-Aldrich Brand Chemicals) (10.1 mg, 0.012 mmol) was added, and the mixture was heated under reflux for 2 hours. The reaction mixture was evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 9 (85 mg, yield 95%). 1 H-NMR (CDCl3) δ: 1.44 (s, 9H), 2.61 (s, 1H), 2.65 (s, 1H), 2.86-2.92 (m, 5H), 3.33 (brs, 2H), 3.49 (brs, 2H), 5.20 (s, 2H), 5.64 (s, 2H), 7.31-7.36 (m, 5H). ESI-MS(m / z): 376 (M+1).

[0129] Step 8: To a solution of compound 9 (85 mg, 0.23 mmol) in ethyl acetate (4.5 mL), Pd—C (12.1 mg, 0.011 mmol) was added, and the mixture was stirred at room temperature under a hydrogen atmosphere for 3 hours. The reaction mixture was filtered through Celite® (Kanto Chemical). The solvent was evaporated under reduced pressure to give compound 10 (58 mg, 89% yield). ESI-MS (m / z): 288 (M+1).

[0130] Step 9: Compound 10 was used instead of compound 3 in step 3, and the procedure was repeated in the same manner as in steps 3 and 4 to give compound I-2 (148 mg, total yield 81%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (m, 9H), 1.20-1.35 (m, 41H), 1.50-1.65 (m, 13H), 1.65-1.80 (m, 4H), 1.90-2.05 (m, 4H), 2.25-2.31 (m, 8H), 2.52 (t, 2H), 3.47 (t, 2H), 3.97 (d, 2H), 4.91 (m, 1H). ESI-MS(m / z): 667 (M+1).

[0131] Synthesis of Compound I-3

[0132] Step 10: To a dichloromethane solution (42 mL) of compound 11 (see International Patent Application Publication No. 2017 / 222016, 10.7 g, 21.0 mmol), imidazole (3.00 g, 44.0 mmol) and TBS chloride (3.47 g, 23.1 mmol) were added, and the mixture was stirred at room temperature for 1.5 hours. Ethyl acetate was added to the reaction solution, and the mixture was washed sequentially with 2 mol / L hydrochloric acid, water, a saturated aqueous solution of sodium bicarbonate, and a saturated aqueous solution of sodium chloride. The organic layer was dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure to give compound 12 (13.2 g, 100% yield). 1 H-NMR (CDCl3) δ: 0.00 (s, 3H), 0.02 (s, 3H), 0.88 (s, 9H), 1.17-1.38 (m, 21H), 1.64 (t, 4H), 2.35 (t, 4H), 3.44 (d, 2H), 5.11 (s, 4H), 7.30-7.38 (m, 10H). ESI-MS(m / z): 625 (M+1).

[0133] Step 11: To a solution of compound 12 (12.9 g, 20.6 mmol) in tetrahydrofuran (41 mL) was added Pd—C (1.10 g, 1.03 mmol), and the mixture was stirred under a hydrogen atmosphere at room temperature for 6 hours. The reaction mixture was filtered through Celite, and the solvent was evaporated under reduced pressure. To a solution of the resulting residue in dichloromethane (21 mL), 2-butyl-1-octanol (4.6 mL, 20.6 mmol), 2-methyl-6-nitrobenzoic anhydride (10.6 g, 30.9 mmol), DIEA (10.8 mL, 61.8 mmol), and DMAP (252 mg, 2.06 mmol) were added, and the mixture was stirred at room temperature for 17 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water. The solvent was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 13 (2.52 g, 31% yield). 1H-NMR (CDCl3) δ: 0.00 (s, 3H), 0.02 (s, 3H), 0.87 (m, 21H), 1.17-1.39 (m, 55H), 1.63 (m, 6H), 2.29 (t, 4H), 3.45 (d, 2H), 3.97 (d, 4H). ESI-MS(m / z): 782 (M+1).

[0134] Step 12: To a solution of compound 13 (2.52 g, 3.23 mmol) in tetrahydrofuran (16 mL), acetic acid (1.84 mL, 32.3 mmol) and a TBAF-tetrahydrofuran solution (12.9 mL, 12.9 mmol) were added, and the mixture was stirred at room temperature for 17 hours. Ethyl acetate was added to the reaction mixture, and the mixture was washed sequentially with saturated aqueous sodium bicarbonate and water. The organic layer was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 14 (1.87 g, yield 87%). 1 H-NMR (CDCl3) δ: 0.88 (m, 12H), 1.11-1.44 (m, 55H), 1.62 (m, 6H), 2.30 (t, 4H), 3.53 (t, 2H), 3.97 (d, 4H). ESI-MS(m / z): 668 (M+1).

[0135] Step 13: Compound 14 was used instead of compound 4 in step 3, and the procedure was repeated in the same manner as in steps 3 and 4 to give compound I-3 (105 mg, total yield 56%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (m, 14H), 1.22-1.27 (m, 55H), 1.61 (m, 6H), 2.25-2.31 (m, 10H), 2.50 (t, 2H), 3.56 (t, 2H), 3.61 (s, 2H), 3.96 (m, 6H). ESI-MS(m / z): 837 (M+1).

[0136] Synthesis of Compound I-4

[0137] Step 14: To a dichloromethane solution (1.9 mL) of compound 15 (300 mg, 0.95 mmol), 2-butyl-1-octanol (0.64 mL, 2.86 mmol), 2-methyl-6-nitrobenzoic anhydride (985 mg, 2.86 mmol), DIEA (1.3 mL, 7.63 mmol), and DMAP (23 mg, 0.19 mmol) were added, and the mixture was stirred at room temperature for 6 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water. The solvent was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate). The solvent of the fraction containing the target product was evaporated under reduced pressure. Sodium borohydride (72 mg, 1.91 mmol) was added to a 50% tetrahydrofuran-methanol solution (9.6 mL) of the resulting residue, and the mixture was stirred at 0°C for 2 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain Compound 16 (530 mg, yield 85%). 1 H-NMR (CDCl3) δ: 0.88 (m, 12H), 1.27-1.31 (m, 46H), 1.37-1.42 (m, 6H), 1.61 (m, 6H), 2.30 (t, 4H), 3.57 (brs, 1H), 3.97 (d, 4H). ESI-MS(m / z): 654 (M+1).

[0138] Step 15: Compound 16 was used instead of compound 4 in step 3, and the procedure was repeated in the same manner as in steps 3 and 4 to give compound I-4 (131 mg, total yield 69%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (m, 14H), 1.19-1.28 (m, 50H), 1.49 (m, 4H), 1.59 (m, 6H), 2.25-2.31 (m, 10H), 2.49 (t, 2H), 3.58 (t, 2H), 3.62 (s, 2H), 3.96 (d, 4H), 4.84 (m, 1H). ESI-MS(m / z): 823 (M+1).

[0139] Synthesis of Compound I-5

[0140] Step 16: Compound 17 (485 mg, yield 75%) was obtained in the same manner as in Step 14, except that 7-tridecanol was used instead of 2-butyl-1-octanol. 1 H-NMR (CDCl3) δ: 0.88 (m, 12H), 1.20-1.35 (m, 49H), 1.35-1.53 ​​(m, 14H), 1.62 (m, 4H), 2.28 (t, 4H), 3.58 (brs, 1H), 4.87 (m, 2H). ESI-MS(m / z): 682 (M+1).

[0141] Step 17: To a solution of compound 17 (160 mg, 0.235 mmol) in NMP (1.2 mL), compound 18 (67 mg, 0.352 mmol), 2-methyl-6-nitrobenzoic anhydride (162 mg, 0.470 mmol), DIEA (0.16 mL, 0.940 mmol), and DMAP (5.7 mg, 0.047 mmol) were added and stirred at room temperature for 18 hours. Compound 18 (33 mg, 0.176 mmol), 2-methyl-6-nitrobenzoic anhydride (81 mg, 0.235 mmol), and DIEA (0.08 mL, 0.470 mmol) were added, and the mixture was stirred at room temperature for 3 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water and evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fraction containing the target compound was evaporated under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound I-5 (86 mg, yield 43%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.20-1.35 (m, 49H), 1.45-1.70 (m, 25H), 2.03 (m, 4H), 2.27 (m, 7H), 2.79 (d, 3H), 3.23 (s, 2H), 4.86 (m, 3H). ESI-MS(m / z): 853 (M+1).

[0142] Synthesis of Compound I-6

[0143] Step 18: Compound 20 (3.24 g, yield 100%) was obtained in the same manner as in Step 2, except that Compound 19 was used instead of Compound 2 in Step 2. 1 H-NMR (CDCl3) δ: 1.44 (m, 12H), 2.92 (s, 3H), 3.38 (brs, 2H), 3.63 (brs, 2H), 4.03 (q, 1H).

[0144] Step 19: Compound 21 (0.541 g) was obtained as a colorless transparent oil in the same manner as in Step 14, except that 3-pentyl-1-octanol was used instead of 2-butyl-1-octanol. 1 H-NMR (CDCl3) δ: 0.87 (t, 12H), 1.25-1.63 (m, 63H), 2.26 (t, 4H), 3.57 (brs, 1H), 4.06 (t, 4H). ESI-MS(m / z): 682 (M+1).

[0145] Step 20: Compound 21 was used instead of compound 4 in step 3, and compound 20 was used instead of compound 3 in step 3. The procedure was repeated in the same manner as in steps 3 and 4 to give compound I-6 (460 mg, total yield 75%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.20-1.35 (m, 48H), 1.41 (d, 5H), 1.50-1.65 (m, 23H), 2.27 (m, 10H), 2.54 (t, 2H), 3.46 (m, 1H), 3.68 (m, 1H), 3.96 (q, 1H), 4.08 (t, 4H), 4.92 (m, 1H). ESI-MS(m / z): 825 (M+1).

[0146] Synthesis of Compound I-7

[0147] Step 21: Compound 22 (1.44 g, yield 82%) was obtained in the same manner as in Step 14, except that 3-hexyl-1-nonanol was used instead of 2-butyl-1-octanol. 1H-NMR (CDCl3) δ: 0.88 (m, 12H), 1.20-1.50 (m, 66H), 1.52-1.68 (m, 10H), 2.28 (t, 4H), 3.57 (brs, 1H), 4.08 (t, 4H).

[0148] Step 22: Compound 22 was used instead of compound 21 in Step 20, and the procedure was repeated as in Step 20 to give compound I-7 (351 mg, total yield 59%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (t, 14H), 1.20-1.45 (m, 66H), 1.48-1.66 (m, 15H), 2.27 (m, 10H), 2.53 (t, 2H), 3.46 (m, 1H), 3.69 (m, 1H), 3.96 (q, 1H), 4.08 (t, 4H), 4.91 (m, 1H).

[0149] Synthesis of Compound I-8

[0150] Step 23: Compound 21 was used instead of compound 17 in Step 17, and the procedure was carried out in the same manner as in Step 17 to give compound I-8 (539 mg, yield 86%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.20-1.42 (m, 52H), 1.48-1.68 (m, 22H), 2.00 (m, 4H), 2.28 (m, 7H), 2.79 (brs, 3H), 3.23 (s, 2H), 4.08 (t, 4H), 4.88 (m, 1H). ESI-MS(m / z): 853 (M+1).

[0151] Synthesis of Compound I-9

[0152] Step 24: Compound 23 (856 mg, yield 16%) was obtained in the same manner as in Step 2, except that 2,2-dimethyl-3-iodopropionic acid was used instead of Compound 2 and 2-azidoethanol was used instead of N-Boc-N-methyl-2-aminoethanol. 1H-NMR (CDCl3) δ: 1.24 (s, 6H), 3.35 (t, 2H), 3.52 (s, 2H), 3.66 (t, 2H). ESI-MS(m / z): 188 (M+H).

[0153] Step 25: Compound 24 (188 mg, yield 89%) was obtained in the same manner as in Step 3, except that Compound 21 was used instead of Compound 4 and Compound 23 was used instead of Compound 3 in Step 3. 1 H-NMR (CDCl3) δ: 0.88 (t, 14H), 1.15-1.42 (m, 61H), 1.48-1.65 (m, 23H), 2.27 (t, 4H), 3.31 (t, 2H), 3.49 (s, 2H), 3.61 (t, 2H), 4.08 (t, 4H), 4.85 (m, 1H). ESI-MS(m / z): 868 (M+18).

[0154] Step 26: To a solution of compound 24 (188 mg, 0.22 mmol) in tetrahydrofuran (5.4 mL), Pd—C (235 mg, 0.22 mmol) and a solution of hydrochloric acid in 1,4-dioxane (0.28 mL, 1.11 mmol) were added, and the mixture was stirred under a hydrogen atmosphere at room temperature for 3 hours. The reaction mixture was filtered through Celite, and the solvent was evaporated under reduced pressure. To a solution of the resulting residue in tetrahydrofuran (5.4 mL), 36% formaldehyde solution (0.09 mL, 1.11 mmol) and sodium triacetoxyborohydride (469 mg, 2.21 mmol) were added, and the mixture was stirred at room temperature for 1 hour. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with chloroform. The solvent was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fraction containing the target compound was evaporated under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound I-9 (71 mg, yield 38%) as a clear oil. 1H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.17 (s, 6H), 1.20-1.45 (m, 51H), 1.45-1.65 (m, 42H), 2.27 (m, 10H), 2.48 (t, 2H), 3.42 (s, 2H), 3.52 (t, 2H), 4.08 (t, 4H), 4.84 (m, 1H). ESI-MS(m / z): 853 (M+1).

[0155] Synthesis of Compound I-10

[0156] Step 27: Compound 25 was used instead of compound 18 in Step 17, and the procedure was carried out in the same manner as in Step 17 to give compound I-10 (162 mg, yield 67%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.25-1.35 (m, 50H), 1.45-1.55 (m, 12H), 1.55-1.65 (m, 8H), 2.27 (m, 10H), 2.48 (t, 2H), 2.58 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 4.86 (m, 3H).

[0157] Synthesis of Compound I-11

[0158] Step 28: Compound 21 was used instead of compound 4 in step 3, and the procedure was repeated in the same manner as in steps 3 and 4 to give compound I-11 (123 mg, total yield 61%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (t, 14H), 1.19-1.35 (m, 50H), 1.35-1.65 (m, 28H), 2.28 (m, 10H), 2.49 (t, 2H), 3.56 (t, 2H), 3.62 (s, 2H), 4.08 (t, 4H), 4.84 (m, 1H). ESI-MS(m / z): 851 (M+1).

[0159] Synthesis of Compound I-12

[0160] Step 29: Compound I-12 (169 mg, 87% yield) was obtained as a clear oil in the same manner as in Step 17, except that compound 26 was used instead of compound 18. H-NMR (CDCl) δ: 0.88 (t, 12H), 1.26-1.29 (m, 45H), 1.50-1.74 (m, 21H), 1.90-1.95 (m, 2H), 2.08-2.13 (m, 2H), 2.25-2.29 (m, 7H), 2.70-2.74 (m, 2H), 3.38-3.44 (m, 1H), 4.08 (s, 2H), 4.79-4.97 (m, 3H). ESI-MS (m / z): 837 (M+1).

[0161] Synthesis of Compound I-13

[0162] Step 30: Compound 4 (497 mg, 1.0 mmol), DMAP (277 mg, 2.26 mmol), and EDC (217 mg, 1.13 mmol) were added to a dichloromethane solution of compound 6 (1.3 mL), and the mixture was stirred at room temperature for 10 hours. Silica gel was added to the reaction solution, and the solvent was evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 27 (601 mg, yield 84%). 1 H-NMR (CDCl3) δ: 0.88 (m, 9H), 1.28-1.43 (m, 41H), 1.45-1.61 (m, 23H), 2.30 (t, 2H), 2.93 (s, 3H), 3.44 (brs, 2H), 3.66 (brs, 2H), 3.97 (d, 2H), 4.06 (s, 2H), 4.95 (m, 1H). ESI-MS(m / z): 699 (M+H).

[0163] Step 31: Compound 27 was used instead of compound 5 in Step 4, and the procedure was carried out in the same manner as in Step 4 to give compound I-13 (250 mg, yield 95%) as a clear oil. 1H-NMR (CDCl3) δ: 0.88 (m, 9H), 1.26 (m, 39H), 1.59 (m, 21H), 2.27-2.31 (m, 8H), 2.56 (t, 2H), 3.65 (t, 2H), 3.96 (d, 2H), 4.09 (s, 2H), 4.95 (t, 1H). ESI-MS(m / z): 613 (M+H).

[0164] Synthesis of Compound I-14

[0165] Step 32: Compound 4 was used instead of compound 17 and compound 28 was used instead of compound 18 in Step 17. The procedure was repeated as in Step 17 to obtain compound I-14 (21 mg, 13% yield) as a clear oil. H-NMR (CDCl) δ: 0.88 (t, 9H), 1.25-1.28 (m, 43H), 1.42-1.58 (m, 54H), 1.85 (t, 6H), 2.29 (t, 2H), 3.36 (s, 2H), 3.41 (t, 6H), 3.97 (d, 2H), 4.02 (s, 2H), 4.94 (m, 1H). ESI-MS (m / z): 665 (M+H).

[0166] Synthesis of Compound I-15

[0167] Step 33: Compound 29 (2.52 g) was obtained in the same manner as in Steps 11 and 12, except that 3-pentyl-1-octanol was used instead of 2-butyl-1-octanol in Step 11. 1 H-NMR (CDCl3) δ: 0.87 (m, 12H), 1.26-1.63 (m, 64H), 2.26 (t, 4H), 3.53 (brs, 2H), 4.06 (t, 4H). ESI-MS(m / z): 696 (M+1).

[0168] Step 34: Compound 29 was used instead of compound 21 in step 25, and the procedure was repeated in the same manner as in steps 25 and 26 to give compound I-15 (100 mg, total yield 33%) as a clear oil. 1H-NMR (CDCl3) δ: 0.88 (t, 14H), 1.18 (s, 6H), 1.25-1.42 (m, 56H), 1.57 (m, 26H), 2.26 (m, 10H), 2.48 (t, 2H), 3.43 (s, 2H), 3.53 (t, 2H), 3.96 (d, 2H), 4.08 (t, 4H). ESI-MS(m / z): 867 (M+H).

[0169] Synthesis of Compound I-16

[0170] Step 35: Compound I-16 (115 mg, total yield 60%) was obtained as a clear oil in the same manner as in Step 17, except that compound 16 was used instead of compound 17 and compound 26 was used instead of compound 18. 1 H-NMR (CDCl3) δ: 0.88 (m, 14H), 1.28 (m, 40H), 1.51-1.71 (m, 12H), 1.91 (m, 2H), 2.11 (m, 2H), 2.29 (m, 7H), 2.70 (m, 2H), 3.41 (m, 1H), 3.96 (d, 4H), 4.08 (s, 2H), 4.94 (t, 1H). ESI-MS(m / z): 809 (M+1).

[0171] Synthesis of Compound I-17

[0172] Step 36: Compound 4 was used instead of compound 21 in step 25, and the procedure was repeated in the same manner as in steps 25 and 26 to give compound I-17 (20 mg, total yield 9%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (t, 9H), 1.17 (s, 6H), 1.25-1.28 (m, 40H), 1.49-1.61 (m, 23H), 2.26 (s, 6H), 2.29 (t, 2H), 2.48 (t, 2H), 3.42 (s, 2H), 3.53 (t, 2H), 3.96 (d, 2H), 4.84 (t, 1H). ESI-MS(m / z): 655 (M+H).

[0173] Synthesis of Compound I-18

[0174] Step 37: Compound 11 was used instead of compound 17 and compound 25 was used instead of compound 18 in Step 17, and the procedure was repeated in the same manner as in Step 17 to obtain compound 30. Subsequently, compound 30 was used instead of compound 12 in Step 11 and 1-hexanol was used instead of 2-butyl-1-octanol in Step 11, and the procedure was repeated in the same manner as in Step 11 to obtain compound I-18 (120 mg, total yield 57%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.89 (t, 6H), 1.22-1.40 (m, 33H), 1.55-1.65 (m, 18H), 2.25-2.31 (m, 10H), 2.49 (t, 2H), 2.60 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.98 (d, 2H), 4.06 (t, 4H). ESI-MS(m / z): 643 (M+1).

[0175] Synthesis of Compound I-19

[0176] Step 38: Compound I-19 (111 mg, 50% overall yield) was obtained as a clear oil in the same manner as in Step 37, except that 7-tridecanol was used instead of 1-hexanol. 1 H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.20-1.35 (m, 51H), 1.45-1.65 (m, 15H), 2.25-2.31 (m, 10H), 2.49 (t, 2H), 2.60 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.98 (d, 2H), 4.87 (m, 2H). ESI-MS(m / z): 839 (M+1).

[0177] Synthesis of Compound I-20

[0178] Step 39: Compound I-20 (116 mg, 51% overall yield) was obtained as a clear oil in the same manner as in Step 37, except that 2-ethyl-1-hexanol was used instead of 1-hexanol. 1H-NMR (CDCl3) δ: 0.89 (t, 12H), 1.20-1.40 (m, 36H), 1.51-1.67 (m, 9H), 2.25-2.32 (m, 10H), 2.49 (t, 2H), 2.60 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.98 (m, 6H). ESI-MS(m / z): 699 (M+1).

[0179] Synthesis of Compound I-21

[0180] Step 40: A tetrahydrofuran solution (60 mL) of copper bromide (735 mg, 5.12 mmol) and lithium chloride (434 mg, 10.2 mmol) was stirred at room temperature for 5 minutes. To the reaction solution, trans-2-methyl octenoate (8.0 g, 51.2 mmol) and TMS chloride (7.2 mL, 56.3 mmol) were added under ice-cooling, and the mixture was stirred for 15 minutes. To the reaction solution, a hexylmagnesium bromide-tetrahydrofuran solution (77 mL, 77 mmol) was added dropwise under ice-cooling, and the mixture was stirred for 2 hours. A saturated ammonium chloride solution and water were added to the reaction solution, and the mixture was extracted with diethyl ether. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to obtain compound 31 (9.80 g, yield 79%). 1 H-NMR (CDCl3) δ: 0.88 (t, 6H), 1.26 (brs, 19H), 1.84 (brs, 1H), 2.23 (d, 2H), 3.66 (s, 3H).

[0181] Step 41: A solution of compound 31 (9.80 g, 40.4 mmol) in tetrahydrofuran (27 mL) was added dropwise to a solution of lithium aluminum hydride (3.07 g, 81 mmol) in tetrahydrofuran (100 mL), and the mixture was heated to reflux for 3 hours. Sodium sulfate decahydrate was added under ice-cooling, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was filtered, and the filtrate was evaporated under reduced pressure. Diethyl ether was added to the resulting residue, and the aqueous layer was removed. The organic layer was dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 32 (8.26 g, yield 95%). 1 H-NMR (CDCl3) δ: 0.88 (t, 6H), 1.12 (t, 1H), 1.26 (brs, 18H), 1.41 (brs, 1H), 1.53 (m, 2H), 3.66 (m, 2H).

[0182] Step 42: Compound 1-21 (137 mg, total yield 54%) was obtained as a clear oil in the same manner as in Step 37, except that compound 32 was used instead of 1-hexanol in Step 37. 1 H-NMR (CDCl3) δ: 0.89 (t, 12H), 1.20-1.45 (m, 58H), 1.54-1.66 (m, 11H), 2.25-2.32 (m, 10H), 2.49 (t, 2H), 2.60 (t, 2H), 3.55 (t, 2H), 3.72 (t, 2H), 3.98 (d, 2H), 4.08 (t, 4H). ESI-MS(m / z): 867 (M+1).

[0183] Synthesis of Compound I-22

[0184] Step 43: Compound I-22 (134 mg, 54% overall yield) was obtained as a clear oil in the same manner as in Step 37, except that 1-tridecanol was used instead of 1-hexanol. 1H-NMR (CDCl3) δ: 0.88 (t, 6H), 1.20-1.35 (m, 59H), 1.55-1.65 (m, 12H), 2.25-2.31 (m, 10H), 2.48 (t, 2H), 2.60 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.98 (d, 2H), 4.05 (t, 4H). ESI-MS(m / z): 839 (M+1).

[0185] Synthesis of Compound I-23

[0186] Step 44: Compound 1-23 (183 mg, yield 66%) was obtained as a clear oil in the same manner as in Step 17, except that compound 25 was used instead of compound 18 and compound 14 was used instead of compound 17. 1 H-NMR (CDCl3) δ: 0.88 (m, 12H), 1.20-1.35 (m, 53H), 1.55-1.65 (m, 16H), 2.25-2.31 (m, 10H), 2.49 (t, 2H), 2.60 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.98 (m, 6H). ESI-MS(m / z): 811 (M+1).

[0187] Synthesis of Compound I-24

[0188] Step 45: Compound 29 was used instead of compound 4 in step 3, and the procedure was repeated in the same manner as in steps 3 and 4 to give compound I-24 (102 mg, total yield 55%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (m, 14H), 1.20-1.45 (m, 57H), 1.52-1.65 (m, 15H), 2.25-2.31 (m, 10H), 2.50 (t, 2H), 3.56 (t, 2H), 3.61 (s, 2H), 3.95 (d, 2H), 4.08 (t, 4H). ESI-MS(m / z): 865 (M+1).

[0189] Synthesis of Compound I-25

[0190] Step 46: Compound 14 was used instead of compound 21 in step 25, and the procedure was repeated in the same manner as in steps 25 and 26 to give compound I-25 (46 mg, total yield 37%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (m, 12H), 1.18 (s, 6H), 1.20-1.35 (m, 54H), 1.52-1.65 (m, 24H), 2.25-2.31 (m, 10H), 2.48 (t, 2H), 3.42 (s, 2H), 3.53 (t, 2H), 3.97 (m, 6H). ESI-MS(m / z): 839 (M+1).

[0191] Synthesis of Compound I-26

[0192] Step 47: Compound 33 (50 mg, yield 64%) was obtained in the same manner as in Step 8, except that compound 8 was used instead of compound 9 in Step 8. ESI-MS (m / z): 318 (M+1).

[0193] Step 48: Using compound 33 instead of compound 3 in step 3, the procedure was repeated in the same manner as in steps 3 and 4 to afford I-26 (54 mg, total yield 50%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.89 (m, 15H), 1.20-1.40 (m, 45H), 1.45-1.65 (m, 17H), 1.65-1.80 (m, 4H), 2.25-2.31 (m, 8H), 2.53 (t, 2H), 3.44 (t, 2H), 3.97 (d, 2H), 4.88 (m, 1H). ESI-MS(m / z): 697 (M+1).

[0194] Synthesis of Compound I-27

[0195] Step 49: Compound 34 (29 mg, 4% yield) was obtained in the same manner as in Step 2, except that 4-bromobutyric acid was used instead of Compound 2. ESI-MS (m / z): 262 (M+1).

[0196] Step 50: Compound 34 was used instead of compound 3 in step 3, and the procedure was repeated in the same manner as in steps 3 and 4 to give compound I-27 (40 mg, total yield 57%) as a clear oil.1 H-NMR (CDCl3) δ: 0.88 (m, 9H), 1.20-1.35 (m, 40H), 1.45-1.65 (m, 13H), 1.90 (m, 2H), 2.25-2.31 (m, 8H), 2.37 (t, 2H), 2.49 (t, 2H), 3.46 (t, 2H), 3.51 (t, 2H), 3.97 (d, 2H), 4.86 (m, 1H). ESI-MS(m / z): 641 (M+1).

[0197] Synthesis of Compound I-28

[0198] Step 51: The procedure was repeated in the same manner as in Step 2, except that 2-bromoacetic acid was used instead of Compound 2 and N-Boc-3-methylamino-1-propanol was used instead of N-Boc-N-methyl-2-aminoethanol, to give Compound 35 (247 mg, yield 69%). ESI-MS (m / z): 248 (M+1).

[0199] Step 52: Compound 35 was used instead of compound 3 in step 3, and the procedure was repeated in the same manner as in steps 3 and 4 to give compound I-28 (99 mg, total yield 76%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (m, 9H), 1.20-1.35 (m, 41H), 1.45-1.65 (m, 17H), 1.80 (m, 2H), 2.23 (s, 6H), 2.29 (t, 2H), 2.38 (t, 2H), 3.58 (t, 2H), 3.97 (d, 2H), 4.05 (s, 2H), 4.95 (m, 1H). ESI-MS(m / z): 627 (M+1).

[0200] Synthesis of Compound I-29

[0201] Step 53: Compound 36 (see International Patent Application Publication No. WO 2019 / 131580) was used instead of compound 4 in Step 3, and the procedure was repeated in the same manner as in Steps 3 and 4 to obtain compound I-29 (87 mg, total yield 66%) as a clear oil. 1H-NMR (CDCl3) δ: 0.88 (m, 11H), 1.20-1.45 (m, 49H), 1.50-1.65 (m, 10H), 2.25-2.31 (m, 8H), 2.50 (t, 2H), 3.56 (t, 2H), 3.61 (s, 2H), 3.96 (d, 2H), 4.08 (t, 2H). ESI-MS(m / z): 695 (M+1).

[0202] Synthesis of Compound I-30

[0203] Step 54: To a dichloromethane solution (15 mL) of compound 26 (434 mg, 2.07 mmol), DMF (0.12 mL) was added and cooled to 0°C. Oxalyl chloride (0.163 mL, 0.622 mmol) was added, and the mixture was heated to reflux for 90 minutes. The reaction mixture was evaporated under reduced pressure, and dichloromethane (1 mL) was added to the resulting residue. This solution was added to a dichloromethane (50 mL)-triethylamine (0.43 mL) solution of compound 4 (500 mg, 1.04 mmol) under ice-cooling, and the mixture was stirred overnight. Aqueous sodium bicarbonate solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The solvent was evaporated under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound I-30 (250 mg, 38% yield) as a colorless, transparent oil. 1 H-NMR (CDCl3) δ: 0.88 (m, 9H), 1.25-1.74 (m, 49H), 1.91-1.93 (m, 2H), 2.10 (t, 2H), 2.26 (s, 3H), 2.29 (t, 2H), 2.70 (m, 2H), 3.41 (m, 1H), 3.96 (d, 2H), 4.08 (s, 2H), 4.95 (m, 1H). ESI-MS(m / z): 639 (M+1).

[0204] Synthesis of Compound I-31

[0205] Step 55: A solution of 2-(propylamino)ethan-1-ol (9 g, 87 mmol) in ethyl acetate (60 mL) was ice-cooled, and a solution of di-tert-butyl dicarbonate (17.1 g, 79 mmol) in ethyl acetate (60 mL) was added dropwise. The mixture was stirred at room temperature overnight. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and filtered. The solvent was evaporated under reduced pressure to give compound 37 (15.6 g) as a colorless, transparent oil. Compound 38 (4.9 g, a mixture with compound 37) was obtained in the same manner as in Step 2, except that compound 37 (4.39 g) was used instead of N-Boc-N-methyl-2-aminoethanol and 2-bromoacetic acid was used instead of compound 2. Compound 38 was used instead of compound 3 in Step 3, and compound 39 (0.875 g) was obtained in the same manner as in Step 3. 1 H-NMR (CDCl3) δ: 0.86 (m, 12H), 1.25-1.63 (m, 58H), 2.27 (t, 2H), 3.19 (t, 2H), 3.41 (brs, 2H), 3.65 (brs, 2H), 3.96 (d, 2H), 4.06 (s, 2H), 4.93 (m, 1H). ESI-MS(m / z): 727 (M+1).

[0206] Step 56: To compound 39 (0.875 g, 1.21 mmol), a solution of hydrochloric acid in 1,4-dioxane (8.4 mL, 33.6 mmol) was added, followed by stirring at room temperature for 30 minutes. The solvent was evaporated under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound I-31 (0.61 g, 80% yield) as a slightly colored oil. 1 H-NMR (CDCl3) δ: 0.88-0.94 (m, 12H), 1.25-1.61 (m, 50H), 2.27 (t, 2H), 2.57 (t, 2H), 2.83 (m, 2H), 3.66(brs, 2H), 3.96 (d, 2H), 4.08 (s, 2H), 4.94 (m, 1H). ESI-MS(m / z): 627 (M+1).

[0207] Synthesis of Compound I-32

[0208] Step 57: To a dichloromethane solution (2.1 mL) of compound I-31 (0.143 g, 0.228 mmol), 36% formaldehyde solution (0.061 mL) and sodium triacetoxyborohydride (0.335 g) were added, and the mixture was stirred at room temperature for 3 hours. Sodium triacetoxyborohydride (0.335 g) and a solution of hydrochloric acid in 1,4-dioxane were added, and the mixture was stirred for 1 hour. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The solvent was evaporated under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound I-32 (115 mg, yield 79%) as a colorless, transparent oil. 1 H-NMR (CDCl3) δ: 0.86 (m, 12H), 1.25-1.61 (m, 49H), 2.28 (s, 3H), 2.29-2.37 (m, 4H), 2.60 (t, 2H), 3.63 (t, 2H), 3.96 (d, 2H), 4.09 (s, 2H), 4.92 (m, 1H). ESI-MS(m / z): 641 (M+1).

[0209] Synthesis of Compound I-33

[0210] Step 58: To a dichloromethane solution (2.1 mL) of compound I-31 (0.154 g, 0.246 mmol), hydrochloric acid-1,4-dioxane solution (1 drop), propionaldehyde (0.058 mL), and sodium triacetoxyborohydride (0.335 g) were added, and the mixture was stirred at room temperature for 3 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The solvent was evaporated under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound I-33 (108 mg, yield 66%) as a colorless, transparent oil. 1H-NMR (CDCl3) δ: 0.85-0.89 (m, 15H), 1.25-1.63 (m, 51H), 2.27 (t, 2H), 2.41 (t, 4H), 2.68 (t, 2H), 3.59 (t, 2H), 3.96 (d, 2H), 4.09 (s, 2H), 4.93 (m, 1H). ESI-MS(m / z): 669 (M+1).

[0211] Synthesis of Compound I-34

[0212] Step 59: Compound 40 was obtained in the same manner as in Step 2, except that 2-bromobutanoic acid was used instead of Compound 2 in Step 2. Subsequently, compound 40 was used instead of Compound 3 in Step 3, and the procedure was carried out in the same manner as in Steps 3 and 4 to obtain Compound I-34 (144 mg) as a colorless, transparent oil. 1 H-NMR (CDCl3) δ: 0.82 (m, 9H), 0.95 (t, 3H), 1.25-1.60 (m, 47H), 1.69 (m, 2H), 2.27 (s, 6H), 2.29 (t, 2H), 2.53 (t, 2H), 3.41 (m, 1H), 3.67 (m, 1H), 3.75 (m, 1H), 3.96 (d, 2H), 4.90 (m, 1H). ESI-MS(m / z): 641 (M+1).

[0213] Synthesis of Compound I-35

[0214] Step 60: To a solution of compound 32 (1.65 g, 7.68 mmol) in tetrahydrofuran (22 mL), compound 41 (see International Patent Application Publication No. 2016 / 104580, 2 g, 6.4 mmol), triphenylphosphine (2.01 g, 7.68 mmol), and bis(2-methoxyethyl) azodicarboxylate (2.1 g, 8.96 mmol) were added, and the mixture was stirred at room temperature for 2 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The solvent was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate / chloroform) to give compound 42 (2.71 g, 83% yield). 1H-NMR (CDCl3) δ: 0.83 (m, 9H), 1.25-1.62 (m, 47H), 2.26 (t, 2H), 2.35 (t, 4H), 4.06 (t, 2H). ESI-MS(m / z): 510 (M+1).

[0215] Step 61: To a 50% tetrahydrofuran-methanol solution (27 mL) of compound 42 (2.71 g, 5.33 mmol), sodium borohydride (0.4 g, 10.7 mmol) was added under ice-cooling, and the mixture was stirred for 40 minutes. Acetone and saturated aqueous ammonium chloride were added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and filtered. The solvent was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate). The solvent of the fraction containing the target product was evaporated under reduced pressure. Subsequently, compound I-35 (0.537 g, total yield 84%) was obtained as a colorless, transparent oil in the same manner as in Step 17, except that compound 25 was used instead of compound 18 and the resulting residue was used instead of compound 17. 1 H-NMR (CDCl3) δ: 0.87 (m, 9H), 1.26-1.62 (m, 51H), 2.25-2.29 (m, 8H), 2.41 (t, 2H), 2.56 (t, 2H), 3.53 (t, 2H), 3.70 (t, 2H), 4.06 (t, 2H), 4.85 (m, 1H). ESI-MS(m / z): 654 (M+1).

[0216] Synthesis of Compound I-36

[0217] Step 62: Compound 43 (1.6 g, yield 64%) was obtained in the same manner as in Step 60, except that 2-propylheptanol was used instead of compound 32. 1 H-NMR (CDCl3) δ: 0.86-0.91 (m, 9H), 1.26-1.63 (m, 39H), 2.27 (t, 2H), 2.36 (t, 4H), 3.96 (d, 2H). ESI-MS(m / z): 453 (M+1).

[0218] Step 63: Compound 43 was used instead of compound 42 in Step 61, and the procedure was carried out in the same manner as in Step 61 to give compound I-36 as a colorless transparent oil (0.314 g, total yield 72%). 1 H-NMR (CDCl3) δ: 0.86 (m, 9H), 1.25-1.65 (m, 43H), 2.25-2.31 (m, 8H), 2.47 (t, 2H), 2.56 (t, 2H), 3.53 (t, 2H), 3.70 (t, 2H), 3.96 (d, 2H), 4.85 (m, 1H). ESI-MS(m / z): 598 (M+1).

[0219] Synthesis of Compound I-37

[0220] Step 64: Compound 44 was used instead of compound 18 in Step 17, and compound 4 was used instead of compound 17 in Step 17. The procedure was carried out in the same manner as in Step 17, to give compound I-37 (0.276 g, yield 71%) as a colorless, transparent oil. 1 H-NMR (CDCl3) δ: 0.87 (m, 9H), 1.25-1.62 (m, 50H), 2.27-2.31 (m, 8H), 2.53 (t, 2H), 3.43 (m, 1H), 3.65 (m, 1H), 3.93 (m, 3H), 4.90 (m, 1H). ESI-MS(m / z): 627 (M+1).

[0221] Synthesis of Compound I-38

[0222] Step 65: Compound 29 was used instead of compound 17 in Step 17, and the procedure was carried out in the same manner as in Step 17 to give compound I-38 (0.219 g, yield 44%) as a colorless, transparent oil. 1 H-NMR (CDCl3) δ: 0.87 (m, 12H), 1.25-1.68 (m, 65H), 1.96 (brs, 4H), 2.26-2.30 (m, 7H), 2.78 (brs, 3H), 3.25 (s, 2H), 4.02 (d, 2H), 4.06 (t, 4H). ESI-MS(m / z): 867 (M+1).

[0223] Synthesis of Compound I-39

[0224] Step 66: Compound 44 was used instead of compound 18 in Step 17, and compound 29 was used instead of compound 17 in Step 17. Compound I-39 (0.186 g, yield 51%) was obtained as a colorless, transparent oil in the same manner as in Step 17. 1 H-NMR (CDCl3) δ: 0.87 (t, 12H), 1.25-1.68 (m, 66H), 2.26-2.30 (m, 10H), 2.52 (t, 2H), 3.45 (m, 1H), 3.66 (m, 1H), 3.96-4.06 (m, 7H). ESI-MS(m / z): 839 (M+1)

[0225] Synthesis of Compound I-40

[0226] Step 67: Compound I-40 (0.373 g, 77% yield) was obtained as a slightly colored transparent oil in the same manner as in Step 17, except that compound 25 was used instead of compound 18 and compound 29 was used instead of compound 17. 1 H-NMR (CDCl3) δ: 0.87 (t, 12H), 1.25-1.64 (m, 63H), 2.25-2.30 (m, 10H), 2.47 (t, 2H), 2.58 (t, 2H), 3.53 (t, 2H), 3.70 (t, 2H), 3.97 (d, 2H), 4.06 (t, 4H). ESI-MS(m / z): 839 (M+1)

[0227] Synthesis of Compound I-41

[0228] Step 68: Compound 45 was used instead of compound 18 in Step 17, and compound 29 was used instead of compound 17 in Step 17. Compound I-41 (0.232 g, yield 64%) was obtained as a colorless, transparent oil in the same manner as in Step 17. 1H-NMR (CDCl3) δ: 0.87 (t, 12H), 1.18-1.64 (m, 66H), 2.28 (dd, 1H), 2.25-2.30 (m, 10H), 2.51 (dd, 1H), 3.66 (m, 1H), 4.03 (d, 2H), 4.06 (t, 4H), 4.17 (m, 2H). ESI-MS(m / z): 839 (M+1)

[0229] Synthesis of Compound I-42

[0230] Step 69: Compound 46 (1.69 g, total yield 23%) was obtained in the same manner as in Steps 11 and 12, except that 7-tridecanol was used instead of 2-butyl-1-octanol in Step 11. 1 H-NMR (CDCl3) δ: 0.88 (t, 14H), 1.20-1.35 (m, 56H), 1.40-1.65 (m, 21H), 2.27 (t, 4H), 3.53 (t, 2H), 4.87 (m, 2H). ESI-MS(m / z): 696 (M+1).

[0231] Step 70: Compound 45 was used instead of compound 18 in Step 17, and compound 46 was used instead of compound 17 in Step 17, and the procedure was carried out in the same manner as in Step 17 to obtain compound I-42 (0.046 g, yield 32%) as a colorless, transparent oil. 1 H-NMR (CDCl3) δ: 0.86 (t, 12H), 1.18-1.63 (m, 68H), 2.19 (dd, 1H), 2.25-2.29 (m, 10H), 2.49 (dd, 1H), 3.66 (m, 1H), 4.00 (d, 2H), 4.13 (m, 2H), 4.84 (m, 2H). ESI-MS(m / z): 839 (M+1)

[0232] Synthesis of Compound I-43

[0233] Step 71: Compound 16 was used instead of compound 17 in Step 17, and the procedure was carried out in the same manner as in Step 17 to give compound I-43 (0.084 g, yield 67%) as a colorless, transparent oil. 1H-NMR (CDCl3) δ: 0.87 (t, 12H), 1.27-1.68 (m, 60H), 1.96-2.05 (br., 4H), 2.26-2.31 (m, 7H), 2.78 (brs, 3H), 3.22 (s, 2H), 3.96 (d, 4H), 4.85 (m, 1H). ESI-MS(m / z): 825 (M+1)

[0234] Synthesis of Compound I-44

[0235] Step 72: Compound 22 was used instead of compound 17 in Step 17, and the procedure was carried out in the same manner as in Step 17 to give compound I-44 (0.271 g, yield 55%) as a colorless, transparent oil. 1 H-NMR (CDCl3) δ: 0.87 (t, 12H), 1.25-1.68 (m, 72H), 1.96-2.05 (br., 4H), 2.26-2.30 (m, 7H), 2.78 (brs, 3H), 3.23 (s, 2H), 4.06 (t, 4H), 4.85 (m, 1H). ESI-MS(m / z): 909 (M+1)

[0236] Synthesis of Compound I-45

[0237] Step 73: Compound 47 (1.46 g, total yield 81%) was obtained in the same manner as in Step 14, except that 2-hexyl-1-octanol was used instead of 2-butyl-1-octanol. 1 H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.20-1.50 (m, 65H), 1.55-1.70 (m, 8H), 2.30 (t, 4H), 3.57 (brs, 1H), 3.97 (d, 4H).

[0238] Step 74: Compound I-45 (0.518 g, 83% yield) was obtained as a slightly colored clear oil in the same manner as in Step 17, except that compound 47 was used instead of compound 17 in Step 17. 1H-NMR (CDCl3) δ: 0.81 (t, 12H), 1.27-1.64 (m, 68H), 1.96-2.06 (brs, 4H), 2.26-2.31 (m, 7H), 2.79 (brs, 3H), 3.23 (s, 2H), 4.06 (d, 4H), 4.85 (m, 1H). ESI-MS(m / z): 882 (M+1)

[0239] Synthesis of Compound I-46

[0240] Step 75: Compound 20 was used instead of Compound 3 in Step 3, and Compound 47 was used instead of Compound 4 in Step 3, and the procedure was repeated in the same manner as in Steps 3 and 4 to obtain Compound I-46 (0.488 g) as a colorless transparent oil. 1 H-NMR (CDCl3) δ: 0.87 (t, 12H), 1.27-1.61 (m, 69H), 2.27-2.31 (m, 10H), 2.52 (t, 2H), 3.45 (m, 1H), 3.67 (m, 1H), 3.96 (m, 5H), 4.91 (m, 1H). ESI-MS(m / z): 854 (M+1)

[0241] Synthesis of Compound I-47

[0242] Step 76: Compound 16 was used instead of compound 21 in step 25, and the procedure was carried out in the same manner as in steps 25 and 26 to give compound I-47 (80 mg) as a colorless transparent oil. 1 H-NMR (CDCl3) δ: 0.87 (m, 12H), 1.17 (s, 6H), 1.27-1.60 (m, 58H), 2.25-2.31 (m, 10H), 2.46 (t, 2H), 3.42 (s, 2H), 3.51 (t, 2H), 3.95 (d, 4H), 4.81 (m, 1H). ESI-MS(m / z): 825 (M+1)

[0243] Synthesis of Compound I-48

[0244] Step 77: Compound 45 was used instead of compound 18 in Step 17, and compound 21 was used instead of compound 17 in Step 17. Compound I-48 (0.172 g, yield 85%) was obtained as a colorless, transparent oil in the same manner as in Step 17. 1 H-NMR (CDCl3) δ: 0.87 (t, 12H), 1.18 (d, 3H), 1.25-1.62 (m, 62H), 2.19 (dd, 1H), 2.26-2.29 (m, 10H), 2.50 (dd, 1H), 3.66 (m, 1H), 4.06 (t, 4H), 4.11 (m, 2H), 4.91 (m, 1H). ESI-MS(m / z): 825 (M+1)

[0245] Synthesis of Compound I-49

[0246] Step 78 Synthesis of Compound I-49 Compound I-49 (0.042 g, yield 60%) was obtained as a colorless, transparent oil in the same manner as in Step 17, except that compound 25 was used instead of compound 18 and compound 21 was used instead of compound 17 in Step 17. 1 H-NMR (CDCl3) δ: 0.87 (t, 12H), 1.25-1.62(m, 62H), 2.25-2.29 (m, 10H), 2.42 (t, 2H), 2.56 (t, 2H), 3.53 (t, 2H), 3.70 (t, 2H), 4.06 (t, 4H), 4.84 (m, 1H). ESI-MS(m / z): 825 (M+1)

[0247] Synthesis of Compound I-50

[0248] Step 79: Synthesis of Compound I-50 Compound I-50 was obtained as a colorless, transparent oil (0.128 g, yield 88%) in the same manner as in Step 17, except that compound 45 was used instead of compound 18 in Step 17. 1H-NMR (CDCl3) δ: 0.86 (t, 12H), 1.18 (d, 3H), 1.26-1.62 (m, 64H), 2.19 (dd, 1H), 2.26-2.29 (m, 10H), 2.49 (dd, 1H), 3.66 (m, 1H), 4.13 (m, 2H), 4.83 (m, 2H), 4.91 (m, 1H). ESI-MS(m / z): 825 (M+1)

[0249] Synthesis of Compound I-51

[0250] Step 80: Synthesis of Compound I-51 Compound I-51 was obtained as a slightly colored transparent oil (0.406 g, 80% yield) in the same manner as in Step 17, except that compound 25 was used instead of compound 18 and compound 36 was used instead of compound 17. 1 H-NMR (CDCl3) δ: 0.87 (m, 9H), 1.25-1.62 (m, 52H), 2.25-2.30 (m, 8H), 2.47 (t, 2H), 2.58 (t, 2H), 3.53 (t, 2H), 3.71 (t, 2H), 3.98 (d, 2H), 4.06 (t, 2H). ESI-MS(m / z): 668 (M+1).

[0251] Synthesis of Compound I-52

[0252] Step 81 Synthesis of Compound I-52 Compound I-52 (52.5 mg, yield 41%) was obtained in the same manner as in Step 17, except that compound 25 was used instead of compound 18 in Step 17 and compound 4 was used instead of compound 17. 1H-NMR (CDCl3) δ: 0.86-0.91 (m, 9H), 1.18-1.35 (m, 42H), 1.45-1.55 (m, 4H), 1.55-1.66 (m, 1H), 2.25 (s, 6H), 2.29 (t, 2H), 2.48 (t, 2H), 2.58 (t, 2H), 3.54 (t, 2H), 3.72 (t, 2H), 3.97 (d, 2H), 4.88 (m, 1H). ESI-MS(m / z): 627 (M+1).

[0253] Synthesis of Compound I-53

[0254] Step 82 Synthesis of Compound I-53 Compound I-53 (139.8 mg, yield 52%) was obtained in the same manner as in Step 17, except that Compound 4 was used instead of Compound 17 in Step 17. 1 H-NMR (CDCl3) δ: 0.84-0.93 (m, 9H), 1.20-1.37 (m, 42H), 1.46-1.56 (m, 4H), 1.56-1.69 (m, 3H), 1.93-2.08 (m, 4H), 2.26 (s, 3H), 2.29 (t, 2H), 2.73-2.84 (m, 3H), 3.23 (s, 2H), 3.97 (d, 2H), 4.89 (m, 1H). ESI-MS(m / z): 655 (M+1).

[0255] Synthesis of Compound I-54 Step 83 Synthesis of Compound I-54 Compound I-54 (74.3 mg, total yield 14%) was obtained in the same manner as in Step 17, except that compound 45 was used instead of compound 18 and compound 4 instead of compound 17 in Step 17. 1 H-NMR (CDCl3) δ: 0.83-0.94 (m, 9H), 1.19 (d, 3H), 1.21-1.36 (m, 42H), 1.47-1.56 (m, 4H), 1.56-1.66 (m, 1H), 2.18-2.32 (m, 9H), 2.48-2.55 (m, 1H), 3.65-3.75 (m, 1H), 3.97 (d, 2H), 4.10-4.22 (m, 2H), 4.94 (m, 1H) ESI-MS(m / z): 627 (M+1).

[0256] Synthesis of Compound I-55 Step 84: Compound I-55 (188 mg, yield 76%) was obtained as a clear oil in the same manner as in Step 17, except that compound 21 was used instead of compound 17 and compound 26 was used instead of compound 18. 1H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.20-1.42 (m, 53H), 1.48-1.75 (m, 32H), 1.92 (m, 2H), 2.10 (m, 2H), 2.28 (m, 7H), 2.70 (brs, 2H), 3.41 (m, 1H), 4.08 (t, 6H), 4.94 (m, 1H). ESI-MS(m / z): 837 (M+1).

[0257] Synthesis of Compound I-56 Step 85: Compound 1-56 (162 mg, yield 81%) was obtained as a clear oil in the same manner as in Step 17, except that compound 29 was used instead of compound 17 and compound 26 was used instead of compound 18. 1 H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.20-1.45 (m, 59H), 1.50-1.75 (m, 34H), 1.92 (m, 2H), 2.10 (m, 2H), 2.28 (m, 7H), 2.70 (brs, 2H), 3.42 (m, 1H), 4.08 (m, 8H). ESI-MS(m / z): 851 (M+1).

[0258] Synthesis of Compound I-80 Step 86: Synthesis of Compound 48 To a dichloromethane solution (3.7 mL) of compound 21 (510 mg, 0.75 mmol), methanesulfonyl chloride (0.070 mL, 0.898 mmol) and triethylamine (0.125 mL, 0.898 mmol) were added under ice-cooling, and the mixture was stirred for 2 hours. Methanesulfonyl chloride (0.023 mL, 0.299 mmol) and triethylamine (0.042 mL, 0.299 mmol) were added to the reaction mixture, and the mixture was stirred for an additional 15 minutes. Methanol was added to the reaction mixture, and the mixture was stirred at room temperature for 15 minutes. A saturated aqueous solution of sodium bicarbonate was then added, and the mixture was extracted with chloroform. The organic layer was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate). The solvent from the fraction containing the target product was evaporated under reduced pressure. Sodium azide (97 mg, 1.498 mmol) was added to a DMF solution (3.7 mL) of the resulting residue, and the mixture was stirred at 80°C for 75 minutes. After cooling the reaction mixture to room temperature, water was added and the mixture was extracted with ethyl acetate. The organic layer was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate). The solvent of the fraction containing the target product was evaporated under reduced pressure. To a tetrahydrofuran solution (7.0 mL) of the resulting residue, Pd—C (746 mg, 0.70 mmol) and a hydrochloric acid-1,4-dioxane solution (0.88 mL, 3.50 mmol) were added, and the mixture was stirred at room temperature for 3 hours under a hydrogen atmosphere. The reaction mixture was filtered through Celite, and the solvent was evaporated under reduced pressure. To a solution of the obtained residue in tetrahydrofuran (7.0 mL), Pd—C (746 mg, 0.70 mmol) and a solution of hydrochloric acid in 1,4-dioxane (0.88 mL, 3.50 mmol) were added, and the mixture was stirred under a hydrogen atmosphere at room temperature for 2 hours. The reaction mixture was filtered through Celite, and the solvent was evaporated under reduced pressure. The obtained residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound 48 (185 mg, total yield 37%) as a transparent oil. 1 H-NMR (CDCl3) δ: 0.87 (t, 12H), 1.18-1.42 (m, 58H), 1.50-1.63 (m, 10H), 2.28 (t, 4H), 2.66 (brs, 1H), 4.08 (t, 4H). ESI-MS(m / z): 681 (M+1).

[0259] Step 87 Synthesis of Compound I-80 Compound 26 (43 mg, 0.203 mmol), PyBOP (106 mg, 0.203 mmol), and DIEA (0.11 mL, 0.609 mmol) were added to a solution of compound 48 (92 mg, 0.135 mmol) in NMP (1.4 mL), and the mixture was stirred at room temperature for 2.5 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous solution of sodium chloride and then evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fractions containing the target compound was evaporated under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound I-80 (94 mg, 83% yield) as a transparent oil. 1 H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.20-1.42 (m, 55H), 1.48-1.70 (m, 28H), 1.92 (m, 2H), 2.12 (m, 2H), 2.28 (m, 7H), 2.68 (brs, 2H), 3.37 (m, 1H), 3.94 (m, 3H), 4.08 (t, 4H), 6.28 (d, 1H). ESI-MS(m / z): 836 (M+1).

[0260] Synthesis of Compound I-65 Step 88: Synthesis of Compound 49 To a dichloromethane solution (6 mL) of compound 21 (300 mg, 0.440 mmol), N-Boc-4-carboxymethoxypiperidine (171 mg, 0.661 mmol), 2-methyl-6-nitrobenzoic anhydride (455 mg, 1.321 mmol), DIPA (0.49 mL, 2.64 mmol), and DMAP (11 mg, 0.088 mmol) were added, and the mixture was stirred at room temperature for 15 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous solution of sodium chloride and then evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 49 (390 mg, yield 96%) as a clear oil. 1H-NMR (CDCl3) δ: 0.88(t, 14H), 1.20-1.42 (m, 58H), 1.45 (s, 11H), 1.48-1.70 (m, 26H), 1.85 (brs, 2H), 2.26 (t, 4H), 3.07 (m, 2H), 3.55 (m, 1H), 3.76 (brs, 2H), 4.11 (m, 6H), 4.95 (m, 1H) ESI-MS(m / z): 923(M+1).

[0261] Step 89 Synthesis of Compound I-65 Compound 49 (190 mg, 0.206 mmol) was added to a 4 mol / L hydrochloric acid-1,4-dioxane solution (1 mL), and the mixture was stirred at room temperature for 4 hours, followed by evaporation under reduced pressure. TBAI (16 mg, 0.044 mmol), triethylamine (0.243 mL, 1.75 mmol), and 2-bromoethanol (0.062 mL, 0.876 mmol) were added to a tetrahydrofuran solution (3 mL) of the resulting residue, and the mixture was stirred at room temperature for 72 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous solution of sodium chloride and then evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fractions containing the target compound was evaporated under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound I-65 (74 mg, yield 39%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.89 (t, 12H), 1.20-1.42 (m, 52H), 1.48-1.70 (m, 18H), 1.93 (m, 2H), 2.28 (m, 6H), 2.53 (m, 2H), 2.78 (m, 2H) 3.43 (m, 1H), 3.53 (t, 2H), 4.07 (t, 6H), 4.92 (m, 1H). ESI-MS(m / z): 867 (M+1).

[0262] Synthesis of Compound I-61 Step 90: Synthesis of Compound 51 To a dichloromethane solution (10 mL) of compound 50 (500 mg, 0.901 mmol), pentadecan-8-ol (103 mg, 0.451 mmol), 2-methyl-6-nitrobenzoic anhydride (155 mg, 0.451 mmol), DIPA (0.472 mL, 2.70 mmol), and DMAP (22 mg, 0.18 mmol) were added, and the mixture was stirred at room temperature for 20 hours. The organic layer was washed with saturated aqueous sodium chloride and then evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate). The solvent of the fraction containing the target product was evaporated under reduced pressure, and 3-pentyloctan-1-ol (82 mg, 0.412 mmol), 2-methyl-6-nitrobenzoic anhydride (189 mg, 0.549 mmol), DIPA (0.192 mL, 1.1 mmol), and DMAP (7 mg, 0.055 mmol) were added to a dichloromethane solution (3 mL) of the resulting residue, and the mixture was stirred at room temperature for 20 hours. The organic layer was washed with saturated aqueous sodium chloride and then evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fraction containing the target product (205 mg, 0.216 mmol) was evaporated under reduced pressure, and a tetrahydrofuran solution of TBAF (0.649 mL, 0.649 mmol) was added to a tetrahydrofuran solution (2 mL) of the resulting residue, and the mixture was stirred at room temperature for 20 hours. Ethyl acetate was added to the reaction mixture, which was then washed successively with a saturated aqueous solution of sodium bicarbonate, a 2 mol / L aqueous solution of hydrochloric acid, a saturated aqueous solution of sodium bicarbonate, and a saturated aqueous solution of sodium chloride. The organic layer was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 51 (90 mg, yield 59%). 1 H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.27-1.64 (m, 73H), 2.28 (t, 4H), 3.57 (brs, 1H), 4.11 (t, 2H), 4.88 (m, 1H). ESI-MS(m / z): 710 (M+1).

[0263] Step 91 Synthesis of Compound I-61 Compound 26 (64 mg, 0.302 mmol), 2-methyl-6-nitrobenzoic anhydride (208 mg, 0.605 mmol), DIPA (0.211 mL, 1.21 mmol), and DMAP (5 mg, 0.04 mmol) were added to a dichloromethane solution (3 mL) of compound 51 (143 mg, 0.202 mmol), and the mixture was stirred at room temperature for 16 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous solution of sodium chloride and then evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fractions containing the target compound was evaporated under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound I-61 (127 mg, yield 73%) as a transparent oil. 1 H-NMR (CDCl3) δ: 0.88 (t, 13H), 1.20-1.42 (m, 54H), 1.54-1.70 (m, 21H), 1.92 (m, 2H), 2.11 (m, 2H), 2.26(m, 7H), 2.70 (brs, 2H), 3.40 (m, 1H), 4.13 (m, 4H), 4.95 (m, 2H) ESI-MS(m / z): 865 (M+1).

[0264] Synthesis of Compound I-73 Step 92 Synthesis of Compound 53 To a solution of compound 52 (254 mg, 1.04 mmol) in dichloromethane (2.6 mL), 4-nitrophenyl chloroformate (250 mg, 1.24 mmol) and triethylamine (0.172 mL, 1.24 mmol) were added under ice-cooling, and the mixture was stirred at room temperature for 90 minutes. 4-Nitrophenyl chloroformate (250 mg, 1.24 mmol), triethylamine (0.172 mL, 1.24 mmol), and dichloromethane (1.6 mL) were added to the reaction mixture, and the mixture was stirred for an additional 90 minutes. 4-Nitrophenyl chloroformate (125 mg, 0.62 mmol), triethylamine (0.086 mL, 0.62 mmol), and dichloromethane (1.0 mL) were added to the reaction mixture, and the mixture was stirred for an additional 90 minutes. Water was added to the reaction mixture, and the mixture was extracted with chloroform. The organic layer was washed with saturated aqueous sodium bicarbonate and evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give Compound 53 (386 mg, yield 91%) as a clear oil. 1 H-NMR (CDCl3) δ: 1.46 (s, 9H), 1.54-1.57 (m, 8H), 1.85 (brs, 2H), 3.12 (m, 2H), 3.54 (m, 1H), 3.77 (t, 4H), 4.43 (t, 2H), 7.39 (dd, 2H), 8.28 (dd, 2H). ESI-MS(m / z): 411 (M+1).

[0265] Step 93: Synthesis of Compound 54 Compound 53 (147 mg, 0.358 mmol), DIEA (0.063 mL, 0.358 mmol), and DMAP (44 mg, 0.358 mmol) were added to a dichloromethane solution (1.8 mL) of compound 21 (61 mg, 0.089 mmol), and the mixture was heated under reflux for 13 hours. The reaction mixture was cooled to room temperature and then washed with water. The organic layer was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate) to give compound 54 (76 mg, 89% yield) as a clear oil. 1H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.25-1.45 (m, 63H), 1.51-1.60 (m, 47H), 1.80 (brs, 2H), 2.28 (t, 4H), 3.07 (m, 2H), 3.49 (m, 1H), 3.69 (t, 2H), 3.73 (brs, 2H), 4.08 (t, 4H), 4.26 (t, 2H), 4.67 (m, 1H). ESI-MS(m / z): 953 (M+1).

[0266] Step 94 Synthesis of Compound I-73 Compound I-73 (57 mg, total yield 82%) was obtained as a clear oil in the same manner as in Step 4, except that compound 54 was used instead of compound 5 in Step 4. 1 H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.22-1.42 (m, 52H), 1.54-1.68 (m, 32H), 1.88 (d, 2H), 2.10 (t, 2H), 2.28 (m, 7H), 2.68 (brs, 2H), 3.34 (m, 1H), 3.67 (t, 2H), 4.08 (t, 4H), 4.26 (t, 2H), 4.67 (m, 1H). ESI-MS(m / z): 867 (M+1).

[0267] Synthesis of Compound II-8 Step 95: Synthesis of Compound 56 To a toluene solution (5.0 mL) of methyl L-glycerate (300 mg, 2.50 mmol), 1-carbobenzoxy-4-piperidone (0.50 mL, 2.50 mmol) and p-toluenesulfonic acid monohydrate (47.5 mg, 0.25 mmol) were added, and the mixture was heated to reflux using a Dean-Stark apparatus for 12 hours. After cooling to room temperature, saturated aqueous sodium bicarbonate solution was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated aqueous sodium chloride solution and evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (n-hexane-ethyl acetate), and the solvent from the fraction containing Compound 55 was evaporated under reduced pressure. To a tetrahydrofuran / methanol / water mixture (8.4 mL, 1:2:1) of Compound 55, lithium hydroxide monohydrate (352 mg, 8.39 mmol) was added, and the mixture was stirred at room temperature for 17 hours. The reaction mixture was evaporated under reduced pressure to remove the organic solvent, and then water was added and the mixture was washed with chloroform. The aqueous layer was adjusted to pH 3 with saturated citric acid solution and extracted with chloroform. The organic layer was washed with saturated sodium chloride solution, dried over anhydrous magnesium sulfate, and filtered. The solvent was evaporated under reduced pressure to give compound 56 (359 mg, total yield 45%). 1 H-NMR (CDCl3) δ: 1.72-1.86 (brs, 4H), 3.55 (m, 2H), 3.72 (m, 2H), 4.22 (t, 1H), 4.30 (t, 1H), 4.66 (q, 1H), 5.14 (s, 2H), 7.31-7.39 (m, 5H). ESI-MS(m / z): 322 (M+1).

[0268] Step 96 Synthesis of Compound 57 Compound 57 (280 mg, yield 99%) was obtained as a clear oil in the same manner as in Step 3, except that compound 21 was used instead of compound 4 and compound 56 was used instead of compound 3 in Step 3. 1H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.25-1.40 (m, 52H), 1.53-1.71 (m, 30H), 2.28 (t, 4H), 3.63 (m, 4H), 4.09 (m, 5H), 4.25 (t, 1H), 4.59 (t, 1H), 4.92 (m, 1H), 5.13 (s, 2H), 7.31-7.36 (m, 5H). ESI-MS(m / z): 985 (M+1).

[0269] Step 97 Synthesis of Compound II-8 To a solution of compound 57 (280 mg, 0.28 mmol) in ethyl acetate (2.8 mL), Pd—C (15.1 mg, 0.014 mmol) was added, and the mixture was stirred at room temperature under a hydrogen atmosphere for 5 hours. The reaction mixture was filtered through Celite, and the solvent was evaporated under reduced pressure. Subsequently, to a solution of the resulting residue in dichloromethane (5.5 mL), 36% formaldehyde solution (0.076 mL, 0.99 mmol) and sodium cyanoborohydride (53 mg, 0.85 mmol) were added, and the mixture was stirred at room temperature for 4 hours. To the reaction mixture, 36% formaldehyde solution (0.076 mL, 0.99 mmol) and sodium cyanoborohydride (53 mg, 0.85 mmol) were added, and the mixture was stirred at room temperature for 39 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted with chloroform. The organic layer was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (chloroform-methanol). The solvent of the fraction containing the target compound was evaporated under reduced pressure, and the resulting residue was purified by aminosilica gel column chromatography (n-hexane-ethyl acetate) to give compound II-8 (110 mg, total yield 45%) as a clear oil. 1 H-NMR (CDCl3) δ: 0.88 (t, 12H), 1.25-1.42 (m, 52H), 1.54-1.59 (m, 39H), 1.83 (m,2H), 1.96 (m, 1H), 2.28 (m, 7H), 2.53 (brs, 4H), 4.09 (m, 5H), 4.24 (t, 1H), 4.58 (dd, 1H), 4.92 (t, 1H). ESI-MS(m / z): 865 (M+1).

[0270] Compounds other than those mentioned above can also be synthesized in the same manner as above.

[0271]

[0272]

[0273]

[0274]

[0275] The following compounds were synthesized according to the above general synthesis method and the method described in the Examples. The structures and physical properties (LC / MS data, NMR spectra) are shown in the table below. In the structural formulas, a "wedge" and a "dashed line" indicate the configuration. In particular, among compounds for which the configuration is described, compounds with "a" in the "S" column are racemic compounds with a specific relative configuration. Compounds with "c" in the "S" column indicate that the configuration is determined as shown in the chemical structure. Furthermore, among compounds in which the bond forming the asymmetric carbon is described with a solid line, compounds with "d" in the "S" column are racemic compounds.

[0276]

[0277]

[0278]

[0279]

[0280]

[0281]

[0282]

[0283]

[0284]

[0285]

[0286] ALN-319 and YS-119 used in comparative examples were synthesized by the methods described in Patent Documents 4 and 5, respectively. ALN-319 represents the following compound. YS-119 represents the following compound:

[0287] Preparation Example 1 Preparation of LNPs encapsulating siRNA1

[0288] To prepare a lipid solution with a total lipid concentration of 40 mmol / L, the cationic lipid of the present invention or comparative example, DSPC (Nippon Fine Chemicals Co., Ltd.), cholesterol (Nippon Fine Chemicals Co., Ltd.), and DMG-PEG 2000 (NOF Corporation) were dissolved in ethanol at a molar ratio of 60 / 8.5 / 30 / 1.5. To prepare a nucleic acid solution with a concentration of 0.033 mmol / L, siRNA1 was dissolved in 50 mmol / L acetic acid / sodium acetate buffer (pH 4.0, Fujifilm Wako Pure Chemical Industries, Ltd.). The lipid solution and nucleic acid solution were mixed at flow rates of 3 mL / min and 9 mL / min, respectively, to obtain a nucleic acid-lipid mixed solution. The resulting solution was replaced with phosphate-buffered saline (pH 7.4, Thermo Fisher Scientific) using a dialysis membrane (Repligen, 50 kDa MWCO or Thermo Fisher Scientific, 10 kDa MWCO) to obtain LNPs encapsulating siRNA1. The encapsulated nucleic acid was siRNA1 targeting HPRT1, having the sequences shown in (SEQ ID NO: 1) and (SEQ ID NO: 2). Sense strand: G(F)^A(M)^U(F)^G(M)^A(F)^U(M)C(F)U(F)C(F)U(M)C(F)A(M)A(M)C(M)^U(F)^U(M)^U(F)^A(M)^A(F) (SEQ ID NO: 1); Antisense strand: PO-U(M)^U(F)^A(M)A(F)A(M)G(F)U(F)U(F)G(M)A(F)G(M)A(M)G(M)A(F)U(M)C(F)A(M)U(F)C(M)^T(D)^T(D) (Sequence number: 2) In the notation, (F) represents 2'-F modified nucleic acid, (M) represents 2'-OMe modified nucleic acid, (D) represents DNA, ^ represents phosphorothioate bond, and PO represents 5'-terminal phosphate modification. These terms are used commonly throughout this specification.

[0289] Preparation Example 2 Preparation of siRNA2-encapsulated LNPs siRNA2-encapsulated LNPs were obtained using the cationic lipids of the present invention or comparative example and siRNA2 in the same manner as in Preparation Example 1. The encapsulated nucleic acid was siRNA2 targeting SOD1, having the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4. Sense strand: G(F)^G(M)^G(F)^C(M)^A(F)^A(M)A(F)G(F)G(F)U(M)G(F)G(M)A(M)A(M)^A(F)^U(M)^G(F)^A(M)^A(F) (SEQ ID NO: 3); Antisense strand: PO-U(M)^U(F)^C(M)A(F)U(M)U(F)U(F)C(F)C(M)A(F)C(M)C(M)U(M)U(F)U(M)G(F)C(M)C(F)C(M)^T(D)^T(D)) (SEQ ID NO: 4)

[0290] Preparation Example 3: Preparation of mRNA1-Encapsulated LNPs. To prepare a lipid solution with a total lipid concentration of 10 mmol / L, a cationic lipid of the present invention or comparative example, DSPC, cholesterol, and DMG-PEG 2000 were dissolved in ethanol at a molar ratio of 60 / 8.5 / 30 / 1.5. To prepare a nucleic acid solution with a concentration of 100 mg / L, mRNA1 was dissolved in 50 mmol / L acetic acid / sodium acetate buffer (pH 4.0). The lipid solution and nucleic acid solution were mixed at flow rates of 3 mL / min and 9 mL / min, respectively, to obtain a nucleic acid / lipid mixed solution. The external solution of the obtained solution was replaced with phosphate-buffered saline (pH 7.4) using a dialysis membrane to obtain mRNA1-encapsulated LNPs. The encapsulated nucleic acid used was mRNA1 (TriLink, L-7210) targeting OVA.

[0291] Test Example 1 Evaluation of particle size and encapsulation rate of nucleic acid-encapsulated LNPs The particle size and encapsulation rate of the nucleic acid-encapsulated LNPs prepared in Preparation Examples 1 to 3 were evaluated. The average particle size of the nucleic acid-encapsulated LNPs was measured using a Zetasizer Nano ZS (Malvern). The encapsulation rate of the nucleic acid-encapsulated LNPs was measured using Quant-iT ＴＭ RiboGreen ＴＭMeasurements were performed using an RNA Assay Kit (Thermo Fisher Scientific). The value measured for the composition disrupted in the presence of 2% Triton X-100 was taken as the total nucleic acid concentration, and the value measured for the composition without disruption in the absence of 2% Triton X-100 was taken as the unencapsulated nucleic acid concentration. The encapsulation rate was calculated using the following formula: Encapsulation rate (%) = 100 - (unencapsulated nucleic acid concentration / total nucleic acid concentration) x 100. The average particle size (nm) and encapsulation rate (%) of siRNA1-encapsulated LNP are shown in Table 11. The leftmost column in Table 11 indicates the cationic lipid used.

[0292]

[0293] As shown in Table 11, the siRNA1-encapsulated LNPs prepared according to the present invention exhibited particle sizes similar to those of the comparative examples YS-119 and ALN-319. Furthermore, it was revealed that the siRNA1-encapsulated LNPs prepared according to the present invention formed complexes with a higher nucleic acid encapsulation rate than the comparative examples.

[0294] The average particle size (nm) and encapsulation rate (%) of siRNA2-encapsulated LNPs are shown in Tables 12 and 13. The leftmost columns in Tables 12 and 13 show the cationic lipids used.

[0295]

[0296]

[0297] As shown in Tables 12 and 13, the siRNA2-encapsulated LNPs prepared according to the present invention exhibited a particle size similar to that of the comparative example, YS-119. Furthermore, it was revealed that the siRNA2-encapsulated LNPs prepared according to the present invention formed complexes with a higher nucleic acid encapsulation rate than the comparative example.

[0298] The average particle size and encapsulation rate (%) of mRNA1-encapsulated LNPs are shown in Table 14. The leftmost column in Table 14 shows the cationic lipids used.

[0299]

[0300] As shown in Table 14, the mRNA1-encapsulated LNPs prepared using the present invention exhibited an average particle size similar to that of the comparative example, ALN-319. Furthermore, it was revealed that the mRNA1-encapsulated LNPs prepared using the present invention formed complexes with a higher nucleic acid encapsulation rate than the comparative example.

[0301] As shown in Tables 11 to 14, it was revealed that the nucleic acid-encapsulated LNPs prepared using the present invention formed complexes with a higher nucleic acid encapsulation rate than the comparative examples.

[0302] Test Example 2 Evaluation of Storage Stability of Compositions The siRNA1-encapsulated LNPs and siRNA2-encapsulated LNPs prepared in Preparation Examples 1 and 2 were stored at room temperature in sealed vials, and the encapsulation rates before and after 4 weeks of storage were measured in the same manner as in Test Example 1. The change in encapsulation rate was calculated using the following formula: Change in encapsulation rate Δ (%) = encapsulation rate (after 4 weeks) - encapsulation rate (before storage).

[0303] The change in encapsulation rate Δ (%) of siRNA1-encapsulated LNPs is shown in Table 15. The leftmost column in Table 15 shows the cationic lipid used.

[0304]

[0305] As shown in Table 15, it was revealed that the siRNA1-encapsulated LNP prepared using the present invention showed a small change in encapsulation rate during storage compared to the comparative example ALN-319, and had high storage stability.

[0306] The change in encapsulation rate Δ (%) of siRNA2-encapsulated LNPs is shown in Table 16. The leftmost column in Table 16 shows the cationic lipid used.

[0307]

[0308] As shown in Table 16, it was revealed that the siRNA2-encapsulated LNP prepared using the present invention showed a small change in encapsulation rate during storage compared to the comparative example YS-119, and had high storage stability.

[0309] As shown in Tables 15 and 16, it was revealed that the nucleic acid-encapsulated LNPs prepared using the present invention showed a small change in encapsulation rate during storage compared to the comparative examples, and had high storage stability.

[0310] Test Example 3 Evaluation of SOD1 gene expression inhibitory activity of a composition using siRNA 2 A cell suspension of human cervical cancer-derived cell line HeLa was prepared in DMEM containing 10% fetal bovine serum (FBS) and 500 units / mL penicillin-streptomycin to a concentration of 80,000 cells / mL, and 0.10 mL of the suspension was seeded into a 96-well flat-bottom plate (Corning Inc.). The suspension was incubated at 37°C, 95-98% humidity, and 5% CO ２ The cells were cultured for 1 day at 4°C. The siRNA2-encapsulated LNP prepared in Preparation Example 2 was added to the medium so that the final siRNA2 concentration was 3 nM, and the culture was continued. PBS was added to the medium as a vehicle control. 24 hours after the addition of the nucleic acid-encapsulated LNP, RNA was extracted from the cells and cDNA was synthesized using SuperPrep Cell Lysis & RT Kit for qPCR (Toyobo Co., Ltd.), and real-time PCR was performed using Fast SYBR Green Master Mix (ThermoFisher Scientific). GAPDH was used as an endogenous control. The test was performed with N=3 for each preparation. The primer sequences used to measure the expression level of human SOD1 were: Fw primer: AGTGCAGGGCATCATCAATTTC (SEQ ID NO: 5); Rv primer: CCATGCAGGCCTTCAGTCAG (SEQ ID NO: 6); and the primer sequences used to measure the expression level of human GAPDH were: Fw primer: GCACCGTCAAGGCTGAGAAC (SEQ ID NO: 7); Rv primer: TGGTGAAGACGCCAGTGGA (SEQ ID NO: 8). The change in the expression level of SOD1 was calculated by subtracting the ΔCt of SOD1 in the vehicle control cells from the difference (ΔΔCt) between the expression level of SOD1 (Ct value) and the expression level of GAPDH (Ct value) in the cells to which each composition was added, and the relative expression level (RQ) to the vehicle control was calculated using the following formula: RQ (%)=2 －ΔΔＣｔ The relative expression levels of the SOD1 gene (SOD1-RQ) when each siRNA2-encapsulated LNP was added are shown in Tables 17 and 18. The leftmost columns in Tables 17 and 18 show the cationic lipids used.

[0311]

[0312]

[0313] As shown in Tables 17 and 18, the siRNA2-encapsulated LNPs prepared according to the present invention were shown to have a higher inhibitory effect on SOD1 gene expression than the comparative example YS-119. Furthermore, it was revealed that the encapsulated siRNA2 could be efficiently transported into the cytoplasm.

[0314] Test Example 4: Evaluation of the Hprt1 gene expression inhibitory activity of a composition using siRNA1 A cell suspension of human cervical cancer-derived cell line HeLa was prepared in DMEM containing 10% fetal bovine serum (FBS) and 500 units / mL penicillin-streptomycin to a concentration of 80,000 cells / mL. 0.10 mL of the suspension was seeded into a 96-well flat-bottom plate and incubated at 37°C, 95-98% humidity, and 5% CO. ２ The cells were cultured for 1 day at 4°C. The siRNA1-encapsulated nanoparticles prepared in Preparation Example 1 were added to the medium so that the final siRNA1 concentration was 1 nM, and the culture was continued. For the vehicle control, PBS was added to the medium. 24 hours after the addition of the composition, RNA was extracted from the cells and cDNA was synthesized using the SuperPrep Cell Lysis & RT Kit for qPCR, and real-time PCR was performed using Fast SYBR Green Master Mix. GAPDH was used as an endogenous control. The test was performed with N=3 for each preparation. The primer sequences used to measure the expression level of human HPRT1 were: Fw primer: GGCAGTATAATCCAAAGATGGTCAA (SEQ ID NO: 9); Rv primer: GTCAAGGGCATATCCTACAACAAAC (SEQ ID NO: 10); and the primer sequences used to measure the expression level of human GAPDH were the sequences set forth in SEQ ID NO: 7 and SEQ ID NO: 8. The change in HPRT1 expression level was calculated by subtracting the ΔCt of HPRT1 in the vehicle control cells from the difference (ΔΔCt) between the expression level (Ct value) of HPRT1 in the cells to which each siRNA1-encapsulated LNP had been added, and calculating the relative expression level (RQ) to the vehicle control using the following formula: RQ (%)=2－ΔΔＣｔ The relative expression level of the HPRT1 gene (HPRT1-RQ) when each siRNA1-encapsulated LNP was added is shown in Table 19. The leftmost column in Table 19 shows the cationic lipid used.

[0315]

[0316] As shown in Table 19, the siRNA1-encapsulated LNPs prepared according to the present invention were shown to have a higher inhibitory effect on HPRT1 gene expression than the comparative example, YS-119. Furthermore, it was revealed that the encapsulated siRNA1 could be efficiently transported into the cytoplasm.

[0317] As shown in Tables 17 to 19, it was revealed that the nucleic acid-encapsulated LNPs prepared according to the present invention can efficiently transport the encapsulated nucleic acid into the cytoplasm.

[0318] Test Example 5: Evaluation of OVA protein expression activity of a composition using mRNA 1 A cell suspension of human cervical cancer-derived cell line HeLa was prepared in DMEM containing 10% fetal bovine serum (FBS), 100 units / mL penicillin, and 0.10 mg / mL streptomycin at 10,000 cells / well. 90 μL of the suspension was seeded into a 96-well flat-bottom plate (Greiner) and incubated at 37°C, 95-98% humidity, and 5% CO. ２ The cells were cultured for 1 day at 4°C. The nucleic acid-encapsulated LNPs prepared in Preparation Example 3 were added to the medium so that the nucleic acid amount was 25 or 200 ng / well, and the culture was continued. For the vehicle control (control 1), DMEM was added to the medium. For the comparative control (control 2), mRNA1 alone was added to the medium so that it was 25 ng / well or 200 ng / well. The test was performed three times for each nucleic acid-encapsulated LNP and nucleic acid addition amount, and the average value was calculated. The cell culture supernatant was collected 24 hours after the addition of the nucleic acid-encapsulated LNP. OVA protein secreted into the culture supernatant was quantified using an OVA ELISA kit (ITEA). Table 19 shows the OVA protein concentration in the culture supernatant when each nucleic acid-encapsulated LNP was added. The leftmost column in Table 20 indicates the type of control or the cationic lipid used, and N.D. indicates undetected.

[0319]

[0320] As shown in Table 20, mRNA1-encapsulated LNPs prepared according to the present invention were shown to promote OVA protein expression compared to the comparative examples YS-119 and ALN-319. In other words, it was demonstrated that nucleic acid-encapsulated LNPs prepared according to the present invention can efficiently transport the encapsulated nucleic acid into the cytoplasm.

[0321] As is clear from the above, lipid particles containing the novel cationic lipid of the present invention can efficiently encapsulate nucleic acids and maintain a high encapsulation rate even after storage for a certain period of time. Furthermore, lipid particles containing the cationic lipid of the present invention exhibit high knockdown activity and protein expression promoting effect in vitro. From the above points, the cationic lipid of the present invention can be used as a pharmaceutical composition for delivering nucleic acids into cells.

Claims

1. Formula (I): 【Chemistry 1】 (In the formula, R １ is a substituted or unsubstituted group of the formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ and R ２ is a substituted or unsubstituted C ５ -C ２０ An alkyl group or a substituted or unsubstituted group of the formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ and L １ and L ２ are each independently -C(=O)O-, -OC(=O)-, or -OC(=O)O-; a and b are each independently an integer of 1 or more, and the sum of a and b is an integer of 5 to 25; c and d are each independently an integer of 1 or more, and the sum of c and d is an integer of 5 to 25; R １ Formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ And R ２ C ５ -C ２０ Alkyl groups and the formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ are each independently selected from substituent group α; The substituent group α is a halogen atom, an oxo group, a cyano group, a nitro group, a sulfanyl group, a carboxy group, C １ -C １０ Alkyl groups, halogenated C １ -C １０ Alkyl group, C ２ -C １０ Alkenyl group, halogenated C ２ -C １０ Alkenyl group, C ２ -C １０ Alkynyl group, halogenated C ２ -C １０ Alkynyl group, C １ -C １０ Alkoxy group, halogenated C １ -C １０ Alkoxy group, C １ -C １０ Alkylsulfanyl group, halogenated C １ -C １０ Alkylsulfanyl group, C １ -C １１ Alkanoyl group, C １ -C １１ Alkanoyloxy group, C １ -C １０ Alkoxy C １ -C １０ Alkoxy group, C １ -C １０ Alkoxycarbonyl group, C １ -C １０ Alkylcarbamoyl group, di(C １ -C １０ alkyl)carbamoyl group, C １ -C １０ Alkoxycarbonyloxy, C １ -C １１ Alkanoyl (C １ -C １０ alkyl)amino, C １ -C １０ Alkoxycarbonylamino and C １ -C １０ The group consisting of alkylcarbamoyloxy; R ３ and R ４ Each independently represents a hydrogen atom or a substituted or unsubstituted C １ -C ６ is an alkyl group; Or, R ３ and R ４ together represent a substituted or unsubstituted C ３ -C ５ may form a non-aromatic carbocyclic ring; R ５ is a hydrogen atom or a substituted or unsubstituted C １ -C ６ is an alkyl group; R ６ and R ７ Each independently represents a hydrogen atom, a substituted or unsubstituted C １ -C ６ Alkyl group, substituted or unsubstituted C ２ -C ６ Alkenyl group, substituted or unsubstituted C ２ -C ６ Alkynyl group or substituted or unsubstituted C ３ -C ７ is a non-aromatic carbocyclic group; R ８ , R ９ and R １０ is a hydrogen atom; Or, R ３ and R ７ may, together with the atom to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ３ and R ８ may, together with the atom to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ５ and R ６ may, together with the atom to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ６ and R ７ may, together with the atom to which they are attached, form a substituted or unsubstituted non-aromatic heterocycle; R ８ and R ９ may, together with the atoms to which they are attached, form a substituted or unsubstituted non-aromatic carbocyclic ring or a substituted or unsubstituted non-aromatic heterocyclic ring, where k is 1 or 2; R ７ and R ８ is R ５ and R ６ when they form a ring, they may be taken together with the atoms to which they are attached to form a substituted or unsubstituted non-aromatic heterocycle; Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)-, -OC(=O)N(R)-, -N(R)C(=O)N(R)-, -N(R)C(=O)O-, -C(=S)N(R)-, -N(R)C(=S)-, -C(=O)S-, -SC(=O)-, -N(R)S(=O) ２ -, -OS(=O) ２ -, -OP(=O)(-OR)O-, -OP(=S)(-OR)O-, -OS(=O) ２ -O-, -S(=O) ２ -N(R)-, -OP(=O)(-NR)O-, -C(=S)O- or -OC(=S)-; X is O or S; p, q, s, and k are each independently an integer from 0 to 2; r is an integer from 0 to 5; Each R is independently a hydrogen atom or a substituted or unsubstituted C １ -C ６ is an alkyl group; R ３ ~R ７ and C of R. １ -C ６ Alkyl group and R ６ and R ７ C ２ -C ６ Alkenyl group or C ２ -C ６ The substituents in the alkynyl group are each independently selected from the substituent group β1; The substituent group β1 is a halogen atom, an oxo group, a hydroxyl group, a cyano group, a sulfanyl group, an amino group, C １ -C ６ Alkoxy group, C １ -C ６ Alkylsulfanyl group, C １ -C ６ Alkylamino group, diC １ -C ６ Alkylamino group and C １ -C ７ The group consisting of alkanoyl groups; R ３ and R ４ A ring formed by R ６ and R ７ C ３ -C ７ non-aromatic carbocyclic group, R ３ and R ７ A ring formed by R ３ and R ８ A ring formed by R ５ and R ６ A ring formed by R ６ and R ７ A ring formed by R ７ and R ８ The ring formed by and R ８ and R ９ Substituents in the ring formed by are each independently selected from substituent group β2; The substituent group β2 is a group including the substituent group β1, C １ -C ６ Alkyl groups and halogenated C １ -C ６ It is a group consisting of alkyl groups. or a pharmacologically acceptable salt thereof.

2. L １ The compound according to claim 1, wherein is -C(=O)O- or -OC(=O)-, or a pharmacologically acceptable salt thereof.

3. 3. The compound according to claim 1 or 2, wherein a and b are each independently an integer of 5 to 10, or a pharmacologically acceptable salt thereof.

4. R １ But, C １ -C １０ Formula: -(CH ２ ) ａ -L １ - (CH ２ ) ｂ -CH ３ The compound according to any one of claims 1 to 3, or a pharmacologically acceptable salt thereof,

5. R ２ is a substituted or unsubstituted formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ 5. The compound according to claim 1, wherein the compound is a pharmacologically acceptable salt thereof.

6. R ２ But, C １ -C １０ Formula: -(CH ２ ) ｃ -L ２ - (CH ２ ) ｄ -CH ３ 6. The compound according to claim 5, which is: or a pharmacologically acceptable salt thereof.

7. L ２ The compound according to claim 5 or 6, wherein is -C(=O)O- or -OC(=O)-, or a pharmacologically acceptable salt thereof.

8. The compound according to any one of claims 5 to 7, wherein c and d are each independently an integer of 5 to 10, or a pharmacologically acceptable salt thereof.

9. R ２ is a substituted or unsubstituted C ５ -C ２０ The compound according to any one of claims 1 to 4, which is an alkyl group, or a pharmacologically acceptable salt thereof.

10. Z is -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)N(R)-, -N(R)C(=O)O- or -N(R)C(=O)-, R is independently a hydrogen atom or an unsubstituted C １ The compound according to any one of claims 1 to 9, which is an alkyl group, or a pharmacologically acceptable salt thereof.

11. The compound according to any one of claims 1 to 9, wherein Z is -OC(=O)-, -C(=O)O- or -OC(=O)O-, or a pharmacologically acceptable salt thereof.

12. R ６ and R ７ each independently represents a substituted or unsubstituted C １ -C ６ The compound according to any one of claims 1 to 11, which is an alkyl group, or a pharmacologically acceptable salt thereof.

13. R ５ and R ６ and R 1 and R 2 are each independently selected from the group consisting of 1 and 2. The compound according to any one of claims 1 to 11, wherein R 1 and R 2 are each independently selected from the group consisting of 1 and 2.

14. R ６ and R ７ and R 1 and R 2 are each independently selected from the group consisting of 1 and 2. The compound according to any one of claims 1 to 11, wherein R 1 and R 2 are each independently selected from the group consisting of 1 and 2.

15. R ５ and R ６ together with the atoms to which they are attached form a substituted or unsubstituted non-aromatic heterocycle, while R ７ and R ８ and R 1 and R 2 are each independently selected from the group consisting of 1 and 2. The compound according to any one of claims 1 to 11, wherein R 1 and R 2 are each independently selected from the group consisting of 1 and 2.

16. The compound according to any one of claims 1 to 15, wherein r is an integer of 0 to 3, or a pharmacologically acceptable salt thereof.

17. The compound according to any one of claims 1 to 16, which is selected from the group consisting of compounds I-6, I-8, I-12, I-37, I-39, I-55, I-56, I-58, I-60, I-62, I-65, I-66, I-69, I-72, II-1, II-6 and II-7, or a pharmacologically acceptable salt thereof.

18. A lipid particle comprising the compound according to any one of claims 1 to 17 or a pharmacologically acceptable salt thereof.

19. A pharmaceutical composition comprising the compound according to any one of claims 1 to 17 or a pharmacologically acceptable salt thereof and a nucleic acid.

20. 20. The pharmaceutical composition of claim 19, wherein the nucleic acid is an siRNA or an mRNA.

Images