Method for editing plant genome, plant body and plant seed genome-edited using same, and production method thereof

Abstract

Provided is a simple and efficient method of plant genome editing that does not involve the incorporation of a gene cassette for the expression system of a site-specific DNA modification protein. The method of the present invention comprises: (i) a step for mixing plant cells or a tissue containing plant cells together with a site-specific DNA modification protein and a needle-shaped inorganic compound in a liquid medium and making a disturbance to perforate the cells with the needle-shaped inorganic compound, thereby introducing the site-specific DNA modification protein into the cells; and (ii) a step for culturing the plant cells or the tissue containing the plant cells, into which the site-specific DNA modification protein has been introduced in step (i), thereby causing a DNA mutation specific to a target site in the genome of the plant cells.

Description

Method for editing the genome of a plant, genome-edited plants and plant seeds using the method, and methods for producing them

[0001] The present invention relates to a method for editing the genome of a plant, a plant and a plant seed that have been genome-edited using the method, and methods for producing the same.

[0002] It is known that site-specific DNA modification proteins are used as genome editing techniques. Known site-specific DNA modification proteins include Cas proteins, zinc finger nucleases, and TAL effector nucleases (TAL effector nucleases: TALLENs). An example of a Cas protein is Cas9 nuclease. Cas9 nuclease is generally used in a complex with a guide RNA. By introducing such a complex of Cas9 nuclease and guide RNA into cells, target genes can be mutated in various animals and plants. It is also known that multiple genes can be simultaneously disrupted by simultaneously acting multiple guide RNAs, and that various protein engineering modifications to Cas9 can be used to induce epigenetic dynamic changes.

[0003] Currently common methods for introducing foreign genes into plants are roughly divided into two types: the Agrobacterium method, which indirectly introduces foreign genes into in vitro cultured callus or tissue fragments via a vector, and the in planta transformation method or protoplast-PEG method, which directly introduce foreign genes.

[0004] The Agrobacterium method, a representative example of the former indirect introduction method, is a method of indirectly introducing a foreign gene into a plant cell by transforming the plant cell with Agrobacterium tumefaciens containing the foreign gene. However, this transformation method is only applicable to limited plants and lacks versatility. Furthermore, when Cas9 nuclease is introduced into cells or tissues using the Agrobacterium method, the introduced Cas9 DNA is incorporated into the genome of the plant cell, and the Cas9 nuclease is constantly expressed in the plant cell, increasing the possibility of mutations occurring in DNA other than the target DNA (off-target). Furthermore, the final plant is treated as a transformant, and its use is limited. For this reason, it is more advantageous to use a direct introduction method, which does not incorporate the Cas9 DNA into the genome of the plant cell, to create a genome-edited plant.

[0005] One example of a direct introduction method is the in planta transformation method, in which genes are directly introduced into exposed immature embryos or shoot tips using a particle gun (Patent Document 1, Patent Document 2, Non-Patent Document 1). However, the methods described in these documents have in common that they are highly dependent on the techniques of the experimenter, resulting in low gene introduction efficiency and leaving room for improvement in terms of reproducibility.

[0006] Another example of a direct introduction method is the protoplast-PEG method, which involves introducing polyethylene glycol (PEG) into plant protoplasts (Patent Document 3). However, this method requires a lot of time and effort to prepare the target object, and obtaining a genome-edited plant requires time-consuming and laborious processes such as callus formation and regeneration.

[0007] JP 2017-205104 A JP 2019-180373 A JP 2020-022455 A

[0008] Hamada et al. (2017) An in planta biolistic method for stable wheat transformation. Sci. Rep. 7 (1), 11443.

[0009] An objective of the present invention is to provide a simple and efficient method for producing a genome-edited plant that does not involve the integration of an expression system gene cassette for a site-specific DNA modification protein.

[0010] As a result of intensive research into solving the above-mentioned problems, the inventors have discovered that by mixing plant cells or tissues with a site-specific DNA-modifying protein and a needle-shaped inorganic compound (and optionally a guide RNA) in a liquid medium, or by mixing plant cells or tissues in which a site-specific DNA-modifying protein is constitutively or inducibly expressed with a guide RNA and a needle-shaped inorganic compound in a liquid medium and then subjecting the mixture to agitation, the needle-shaped inorganic compound will perforate the cells, allowing the site-specific DNA-modifying protein or guide RNA to be introduced into the cells, thereby making it possible to easily and efficiently obtain genome-edited plants, and have completed the present invention.

[0011] That is, the present invention includes the following: [Item 1] A method for editing the genome of a plant, comprising the steps of: (i) mixing plant cells or tissues containing plant cells with a site-specific DNA-modifying protein and a needle-shaped inorganic compound in a liquid medium and applying agitation to perforate the cells with the needle-shaped inorganic compound, thereby introducing the site-specific DNA-modifying protein into the cells; and (ii) culturing the plant cells or tissues containing plant cells into which the site-specific DNA-modifying protein has been introduced in step (i), thereby generating a specific DNA mutation at a target site in the genome of the plant cells. [Item 2] The method according to Item 1, wherein a guide RNA is also mixed during the mixing in step (i). [Item 3] A method for editing a plant genome, comprising: (i) mixing plant cells or tissues containing plant cells in which a site-specific DNA-modifying protein is constitutively or inducibly expressed with a guide RNA and a needle-shaped inorganic compound in a liquid medium, and applying agitation to perforate the plant cells with the needle-shaped inorganic compound to introduce the guide RNA into the cells; and (ii) culturing the plant cells or tissues containing the plant cells into which the guide RNA has been introduced, thereby generating a specific DNA mutation at a target site in the genome of the plant cells. [Item 4] The method of any one of Items 1 to 3, wherein the site-specific DNA-modifying protein is selected from the group consisting of a Cas protein, a zinc finger motif, and a TAL effector. [Item 5] The method of Item 4, wherein the site-specific DNA-modifying protein exists in the form of a ribonucleoprotein (RNP) containing a nucleic acid sequence recognition module and / or a guide RNA. [Item 6] The method according to any one of Items 1 to 5, wherein the concentration of the ribonucleoprotein complex is 20 to 800 picomoles (pmol). [Item 7] The method according to any one of Items 1 to 6, wherein the maximum diameter of the plant cells or tissue containing plant cells is 1 mm or less. [Item 8] The method according to any one of Items 1 to 7, wherein the disturbance in step (i) is carried out by centrifugation and ultrasonic treatment. [Item 9] The ultrasonic treatment in step (i) is carried out at a frequency of 10 to 60 kHz and an intensity of 0.1 to 1 W / cm. ２Item 8. The method according to Item 8, wherein the mixing is carried out by irradiating the mixture with ultrasound of 100 nm or more for 30 seconds to 2 minutes. [Item 10] The method according to any one of Items 1 to 9, wherein a plasmid containing a selectable marker gene is mixed in during the mixing in step (i). [Item 11] The method according to any one of Items 1 to 10, wherein the culturing in step (ii) is carried out at a temperature of 25 to 40°C for 1 to 72 hours. [Item 12] A method for producing a genome-edited plant, the method comprising a step of genome editing a plant cell using the method according to any one of Items 1 to 11. [Item 13] A method for producing genome-edited plant seeds, the method comprising a step of genome editing a plant cell using the method according to any one of Items 1 to 11. [Item 14] A genome-edited plant obtained by the method according to Item 12. [Item 15] A genome-edited plant seed obtained by the method according to Item 13.

[0012] According to the present invention, it is possible to simply and efficiently produce genome-edited plants without incorporating an expression system gene cassette for a site-specific DNA modification protein.

[0013] FIG. 1 is a schematic diagram showing an outline of genome editing of plant cells using needle-shaped inorganic compounds (whiskers). FIG. 2 is a photograph of a rice plant in which genome editing was performed on the OsPDS gene. FIG. 3(a) is a photograph of rice callus in which genome editing was performed on the OsLCYβ gene, and FIG. 3(b) is a photograph of non-genome-edited rice callus. FIG. 4 is a photograph of a rice plant in which genome editing was performed on the OsLCYβ gene. FIG. 5 is a diagram showing the DNA sequence of the genome-edited OsLCYβ gene.

[0014] The present invention will be described in detail below with reference to specific embodiments, but the present invention is not limited to the following embodiments and can be embodied in any form without departing from the spirit of the present invention.

[0015] All patent documents (such as published patent applications and patent publications) and non-patent documents cited in this specification are hereby incorporated in their entirety for all purposes.

[0016] - Target plant cells and tissues: The targets of genome editing in the present invention are plant cells and / or tissues containing plant cells (e.g., part of a plant tissue) (hereinafter, these will be collectively referred to as "plant cells and tissues" as appropriate).

[0017] Plants are not particularly limited as long as they are capable of genome editing using site-specific DNA modification proteins. Examples include rice, wheat, barley, corn, oats, turfgrass, sorghum, sugarcane, banana, etc. Dicotyledonous plants include Arabidopsis thaliana, rapeseed, cabbage, radish, soybean, adzuki bean, kidney bean, pea, alfalfa, tomato, eggplant, potato, tobacco, chili pepper, cucumber, melon, watermelon, rose, strawberry, apple, rubber tree, cotton, lettuce, cyclamen, stevia, torenia, etc.

[0018] Examples of plant cells include dedifferentiated cultured cells such as callus and suspension cells, and somatic embryos, while examples of tissues containing plant cells include leaves, roots, stems, embryos, growing points, anthers, pollen, etc., with preferred examples being plant cells such as callus and suspension cells. The cultured cells used in the present invention may be any plant-derived explants, including those derived from scutellum, growing points, pollen, anthers, leaf blades, stems, petioles, and roots.

[0019] The tissue containing a plant cell is not particularly limited, but is usually a part of a plant body. Specific examples include pollen, leaves, stems, roots, buds, flowers, fruits, seeds, etc. The part of a plant body may be in a state where it is not separated from the plant body, or may be in a state where it is separated from the plant body.

[0020] The cultured cells used in the present invention can be obtained by culturing the above-described explants on a callus formation medium, such as MS medium (Murashige et al., Physiologia Plantarum, 1962, Vol. 15, pp. 473-497), R2 medium (Ojima et al., Plant and Cell Physiology, 1973, Vol. 14, pp. 1113-1121), or N6 medium (Chu et al., 1978, In Proc. Symp. Plant Tissue Culture, Science Press, Beijing, pp. 43-50), which contains inorganic salts and vitamins as essential ingredients, and to which is added 0.1 to 10 mg / L of 2,4-dichlorophenoxyacetic acid (2,4-D) as a plant hormone and 10 to 60 g / L of sucrose and 1 to 5 g / L of Gelrite as carbon sources.

[0021] The culture period from the time the explant is placed on the callus formation medium until the cultured cells used in the present invention are obtained is not particularly limited, but when attempting to obtain a genome-edited plant, it is important that plant regeneration from the cultured cells is possible, that is, that the plant cells have the ability to regenerate plants. Furthermore, the cultured cells used in the present invention may be suspension cells in a liquid medium medium, as long as they have the ability to regenerate plants.

[0022] Plant cells or tissues that constitutively or inducibly express guide RNA or site-specific DNA-modifying proteins may be used as genome editing targets. In this case, there is no need to add guide RNA or site-specific DNA-modifying proteins from the outside. These aspects will be described later.

[0023] Genome editing: In the present invention, "genome editing" refers to a technology for editing a genome by introducing a desired modification into a target site on the genome in various cells using a site-specific DNA modification protein, etc. Here, "modification" is not limited, but examples include cleaving a specific gene on the genome to disrupt the gene, inserting or substituting a DNA fragment at a target site on the genome, and introducing point mutations with high efficiency to modify gene function.

[0024] Here, "target site" refers to a specific site in the genome of a plant cell that is the target of genome editing. Such a target site can be appropriately selected depending on the type of site-specific DNA-modifying protein, as described below. For example, when using Cas9, a type of Cas protein, as the site-specific DNA-modifying protein, the target site for genome editing is preferably a site on genomic DNA consisting of a DNA strand (target strand) and its complementary DNA strand (non-target strand) consisting of a PAM (Proto-Spacer Adjacent Motif) sequence and a specific base length adjacent to the 5' side of the PAM sequence (not limited to, but not limited to, for example, 18 bases or more, particularly 19 bases or more, and for example, 25 bases or less, particularly 22 bases or less, and particularly preferably about 20 bases). The number of bp upstream or downstream of the PAM sequence that is cleaved varies depending on the bacterial species from which the Cas9 is derived, but most Cas9s, including Cas9 derived from Streptococcus pyogenes, cleave three bases upstream of the PAM sequence.

[0025] The target site on the plant cell genome that is the subject of genome editing of the present invention is not particularly limited, and examples include a part or all of a gene on the plant cell genome that is desired to be modified, disrupted, etc., or a region overlapping or adjacent to that gene, etc. Specific examples of such genes include genes related to primary metabolism (amino acids, etc.), genes related to secondary metabolism (flavonoids, polyphenols, etc.), genes related to sugar metabolism, genes related to lipid metabolism, genes related to the production of useful substances (medicines, enzymes, pigments, aromatic components, etc.), yield (number, size, etc.), genes related to flowering, genes related to disease and pest resistance, genes related to environmental stress (low temperature, high temperature, drought, salt, light damage, ultraviolet light), etc.

[0026] Site-specific DNA-modifying protein: The genome editing method of the present invention uses a site-specific DNA-modifying protein. According to one aspect of the present invention, a site-specific DNA-modifying protein and a guide RNA are added to and mixed with plant cells / tissues and needle-shaped inorganic compounds. On the other hand, in another aspect, for example, when the plant cells / tissues to be genome-edited express a guide RNA constitutively or inducibly, it is not necessary to add the guide RNA from the outside, and only the site-specific DNA-modifying protein is added to and mixed with the plant cells / tissues and needle-shaped inorganic compounds. Furthermore, in yet another aspect, for example, when the plant cells / tissues to be genome-edited express a site-specific DNA-modifying protein constitutively or inducibly, it is not necessary to add the site-specific DNA-modifying protein from the outside, and only the guide RNA is added to and mixed with the plant cells / tissues and needle-shaped inorganic compounds.

[0027] Site-specific DNA modification proteins used in genome editing include, but are not limited to, Cas proteins, zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), etc. Details of each will be described later.

[0028] The site-specific DNA-modifying protein may be a wild-type or known modified version of the various proteins described below. Alternatively, a mutant protein having one or more mutations relative to the wild-type or known modified protein may also be used, as long as its activity is not impaired. Specifically, such a mutant site-specific DNA-modifying protein preferably has an amino acid sequence in which one or more amino acids are substituted, deleted, added, or inserted relative to the amino acid sequence of its parent site-specific DNA-modifying protein, and has activity equivalent to or greater than that of the parent protein. In particular, such a mutant site-specific DNA-modifying protein preferably has an amino acid sequence that has, for example, 90% or more, 95% or more, 97% or more, 98% or more, or 99% or more sequence identity with the amino acid sequence of its parent site-specific DNA-modifying protein. The above-mentioned "activity" can be evaluated in vitro or in vivo according to known methods.

[0029] The site-specific DNA-modifying protein may be further linked to one or more other elements such as one or more peptides or proteins. For example, the site-specific DNA-modifying protein may have one or more nuclear localization sequences (NLS) at its N-terminus and / or C-terminus.

[0030] Cas protein: A "Cas protein" is a protein belonging to the Cas protein family, which constitutes the adaptive immune system that provides acquired resistance to invading foreign nucleic acids in bacteria and archaea. It is a target-specific endonuclease that recognizes PAM sequences and cleaves double-stranded DNA upstream or downstream of them. The Cas protein is an RNA-guided nuclease (RGN) that, together with a guide RNA (gRNA), constitutes a CRISPR (clustered regularly interspaced short palindromic repeat) / Cas system. By introducing or constructing the CRISPR / Cas system into a target cell, the guide RNA binds to a target site in the genome, and the DNA at the target site can be cleaved by the Cas protein that has been recruited to the binding site. The Cas protein and guide RNA may be naturally occurring or may be a combination that does not exist in nature.

[0031] Examples of the Cas protein family include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Examples of the Cas protein include Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. Among these, the Cas protein used in the present invention is preferably Cas9, Cas12, homologs thereof, or modified versions thereof, with Cas9 being particularly preferred.

[0032] Examples of bacterial species from which Cas proteins are derived include Streptococcus pyogenes (S. pyogenes), Staphylococcus aureus (S. aureus), Franciscilla novicida, Streptococcus thermophilus, Nocardiopsis dassonbiei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus serenityredosens, and Exiguobacterium sibiricum. sibiricum), Lactobacillus delbrueckii, Lactobacillus salivarius, Microcilla marina, Burkholderia bacteria, Polaromonas naphthalenivorans, Polaromonas species, Crocosphaera watsonii, Cyanoseis spp., Microcystis aeruginosa, Synechococcus spp., Acetohalobium arabaticum, Ammonifex degensii, Caldicellulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus thermophilusm), Perotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter spp., Nitrosococcus halophilus, Nitrosococccus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemophilusracemifer), Methanohalbium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc genus, Arthrospira maxima, Arthrospira platensis, Arthrospira genus, Lyngbya genus, Microcoleus chthonoplastes, Oscillatoria genus, Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, etc. Among these, the bacterial species from which Cas9 is derived is preferably Streptococcus pyogenes (S. pyogenes).

[0033] For details of the CRISPR / Cas system and Cas proteins, for example, WO 2014 / 093595, WO 2014 / 093635, WO 2015 / 089473, WO 2019 / 060469, WO 2019 / 217336, WO 2019 / 217336, WO 2013 / 176772, and WO 2013 / 142578 and the like can be referenced.

[0034] Furthermore, technologies derived from the CRISPR / Cas system include the CRISPR / Cpf1 system, which uses the Cpf1 (Cas12a) protein, a DNA endonuclease involved in the class 2V CRISPR / Cas system, and the CRISPR / dCAS9-BE system, which uses a base editor (BE) in which deaminase, a deaminating enzyme, is fused to Cas9 (dCas9) whose nuclease activity has been inactivated. The proteins that constitute these systems are also encompassed by the "Cas protein" of the present invention.

[0035] Zinc finger nuclease (ZFN): A zinc finger nuclease (ZFN) is a fusion protein of several zinc finger motifs that recognize specific bases and FokI nuclease. Zinc finger nucleases typically contain a zinc finger domain that binds to a specific target site in a nucleic acid molecule and a nucleic acid cleavage domain that cleaves the nucleic acid molecule within or proximal to the target site bound by the binding domain. For more information, see Curtin et al., Plant Physiol., (2011), 156[2]:466-73.

[0036] TAL effector nuclease (TALLEN): TALLEN is a fusion protein of a transcription activator-like (TAL) effector and a FokI nuclease. TAL effector nuclease (TALLEN) is an artificial nuclease (TALE) that contains a transcription activator-like effector DNA-binding domain in a DNA cleavage domain (e.g., a FokI domain), and is an effector protein that contains a DNA-binding domain with a highly conserved 33-34 amino acid sequence. For details, see Li et al., Nat. Biotechnol., (2012), 30[5]:390-2, WO 2020 / 045281, etc.

[0037] Guide RNA: A guide RNA is an RNA that functions to guide a site-specific DNA-modifying protein to a target site on a genome. The site-specific DNA-modifying protein usually binds to such a guide RNA to form a ribonucleoprotein or ribonucleoprotein (RNP). Here, the guide RNA targets the target site on a genome, and the site-specific DNA-modifying protein cleaves the DNA at the target site on a genome, thereby changing or modifying the DNA sequence at the target site on a genome.

[0038] The structure of the guide RNA is usually selected depending on the type of site-specific DNA-modifying protein. For example, when a Cas protein is used as the site-specific DNA-modifying protein, the guide RNA usually contains a crRNA (CRISPR RNA) sequence involved in the activity of the CRISPR / Cas system and a tracrRNA (trans-activating crRNA) sequence that binds to a target site on the genome. In this case, the guide RNA may be a single-stranded RNA (sgRNA) containing a crRNA sequence and a tracr RNA sequence, or an RNA complex formed by complementary binding of an RNA containing a crRNA sequence and an RNA containing a tracrRNA sequence. The tracrRNA sequence is not particularly limited, but is typically an RNA consisting of a sequence of about 50 to 100 bases long that can form multiple stem loops. Neither the crRNA sequence nor the tracr RNA sequence is limited, and RNA with an appropriate sequence can be appropriately selected and used depending on the target site on the genome to be edited and the type of Cas protein used in combination.

[0039] The length of the guide RNA is not limited, but is preferably, for example, 15 nucleotides or more, or 18 nucleotides or more, and is preferably, for example, 30 nucleotides or less, or 25 nucleotides or less, or 22 nucleotides or less. Of these, the length of the guide RNA is preferably about 20 nucleotides.

[0040] As mentioned above, according to one aspect of the present invention, it is preferable to add guide RNA to plant cells / tissues and needle-shaped inorganic compounds together with the site-specific DNA-modifying protein and mix them. Meanwhile, in another aspect, for example, when the plant cells / tissues to be genome-edited express guide RNA constitutively or inducibly, it is not necessary to add guide RNA from the outside, and the use of guide RNA is not essential. Furthermore, in yet another aspect, for example, when the plant cells / tissues to be genome-edited express site-specific DNA-modifying protein constitutively or inducibly, it is not necessary to add site-specific DNA-modifying protein from the outside, and only guide RNA can be added to the plant cells / tissues and needle-shaped inorganic compounds and mixed.

[0041] Ribonucleoprotein (RNP): Site-specific DNA-modifying proteins usually bind to guide RNAs or other RNAs (e.g., transfer RNA (tRNA) or messenger RNA (mRNA)) to form ribonucleoproteins (RNPs). This allows the construction of an appropriate genome editing system in plant cells (e.g., a CRISPR / Cas system when a Cas protein is used as the site-specific DNA-modifying protein) depending on the type of site-specific DNA-modifying protein, making it possible to make desired modifications to target sites in the plant cell genome.

[0042] As mentioned above, in one aspect of the present invention, when a site-specific DNA-modifying protein and a guide RNA are added to and mixed with plant cells / tissues and needle-shaped inorganic compounds, the site-specific DNA-modifying protein and the guide RNA bind to form a ribonucleoprotein (RNP), and the RNP is taken up into the plant cell through holes in the cell wall made by the needle-shaped inorganic compound (in this case, of course, unbound site-specific DNA-modifying protein and / or guide RNA may also be taken up into the plant cell).

[0043] In another embodiment, when plant cells or tissues that constitutively or inducibly express a guide RNA are used and mixed with a needle-shaped inorganic compound and a site-specific DNA-modifying protein, the site-specific DNA-modifying protein is taken up into the plant cell through holes in the cell wall made by the needle-shaped inorganic compound, and binds to the guide RNA that is constitutively or inducibly expressed within the plant cell to form a ribonucleoprotein (RNP).

[0044] In yet another embodiment, when plant cells or tissues that constitutively or inducibly express a site-specific DNA-modifying protein are used and mixed with a needle-shaped inorganic compound and a guide RNA, the guide RNA is taken up into the plant cell through holes in the cell wall perforated by the needle-shaped inorganic compound, and binds to the site-specific DNA-modifying protein that is constitutively or inducibly expressed in the plant cell to form a ribonucleoprotein (RNP).

[0045] - Needle-shaped inorganic compound: In the present invention, the term "acicular inorganic compound" refers to a single-crystal inorganic compound having a fine needle-like structure. In the present invention, by mixing plant cells / tissues with the acicular inorganic compound in a liquid medium and then agitating the mixture, the acicular inorganic compound penetrates the plant cells and perforates the cell wall, allowing the site-specific DNA-modifying protein and / or guide RNA and / or ribonucleoprotein (RNP) to be introduced into the plant cells through the perforations.

[0046] The type of acicular inorganic compound is not particularly limited as long as it can penetrate into plant cells and perforate the cell wall when disturbed. An example of such an acicular inorganic compound is an acicular inorganic compound called a whisker. Whiskers are needle-shaped single crystals known as industrial materials, and details thereof can be found in, for example, "Whiskers: An Introduction to Ultra-High Strength Single Crystals," by Yoshinori Fujiki and Mamoru Mitomo, Sangyo Tosho, 1993.

[0047] When whiskers are used as the acicular inorganic compound, the material thereof is not particularly limited, but specific examples include potassium titanate, calcium carbonate, aluminum borate, silicon nitride, zinc oxide, basic magnesium sulfate, magnesia, magnesium borate, titanium diboride, carbon graphite, calcium sulfate, sapphire, silicon carbide, etc., and preferred are potassium titanate, calcium carbonate, and aluminum borate.

[0048] When whiskers are used as the acicular inorganic compound, their size is not particularly limited, but for example, their diameter is preferably usually 0.01 μm or more, or 0.5 μm or more, and usually 10 μm or less, or 1 μm or less, and their length is preferably usually 1 μm or more, more preferably 3 μm or more, and usually 100 μm or less, or 40 μm or less.

[0049] When whiskers are used as the needle-shaped inorganic compound, the whiskers can be used as they are, but it is preferable to use whiskers that have been surface-treated with a surface treatment agent, and it is particularly preferable to have basic functional groups on their surfaces. The use of such surface-treated whiskers makes it possible to more efficiently drill holes into the plant tissue, thereby increasing the rate of introduction of site-specific DNA-modifying proteins and / or guide RNAs and / or ribonucleoproteins (RNPs). Examples of basic functional groups include basic functional groups derived from primary to quaternary amines, divalent metal complexes, etc., but preferably an amino group is used.

[0050] When surface-treated whiskers are used as the acicular inorganic compound, the surface treatment agent is not particularly limited as long as it is a compound that can be covalently bonded to the whisker surface, and examples include silane coupling agents. Among these, silane coupling agents having a basic functional group are preferred. Specific examples of such silane coupling agents include, but are not limited to, basic silane coupling agents such as 3-(2-aminoethoxylaminopropyl)-trimethoxysilane and 3-aminopropyl-triethoxysilane.

[0051] Selection marker gene: In the present invention, a plasmid containing a selection marker gene can be used together with the RNP and the needle-shaped inorganic compound, and in this case, the plasmid expression vector is not particularly limited, and for example, pUC series (pUC18, pUC19, pUC9, etc.), pBI series (pBI121, pBI101, pBI221, pBI2113, pBI101.2, etc.) can be used. An expression vector for a drug resistance gene may also be constructed.

[0052] Examples of drug resistance genes include drug resistance genes (tetracycline resistance gene, ampicillin resistance gene, kanamycin resistance gene, hygromycin resistance gene, spectinomycin resistance gene, chloramphenicol resistance gene, neomycin resistance gene, etc.), herbicide resistance genes (bialaphos resistance gene, glyphosate resistance gene (EPSPS), sulfonylurea resistance gene (ALS)), fluorescent or luminescent reporter genes (luciferase, β-galactosidase, β-glucuronidase (GUS), green fluorescent protein (GFP), etc.), and the like.

[0053] Plant genome editing method: A genome editing method according to one embodiment of the present invention comprises at least the following steps: (i) mixing plant cells or tissues with a site-specific DNA-modifying protein, a guide RNA, and a needle-shaped inorganic compound in a liquid medium, and then agitating the mixture to allow the needle-shaped inorganic compound to perforate the cells and introduce the site-specific DNA-modifying protein into the cells; and (ii) culturing the plant cells or tissues containing the plant cells into which the site-specific DNA-modifying protein has been introduced in step (i), thereby generating a specific DNA mutation at a target site in the genome of the plant cells. Each step is described in detail below.

[0054] Step (i): Mixing This step involves mixing and agitating plant cells and tissues together with a site-specific DNA-modifying protein, a guide RNA, and a needle-shaped inorganic compound in a liquid medium.

[0055] Any liquid medium can be used as the liquid medium in this step, and examples include distilled water, buffer solutions, isotonic solutions, tissue culture media, etc. Examples of buffer solutions include phosphate buffer, Tris buffer, MES buffer, etc. Examples of isotonic solutions include liquid media prepared by adding inorganic salts such as KCl, NaCl, CaCl, and MgCl to distilled water to adjust the concentration to, for example, 0.01 M or more, or 0.5 M or more, or, for example, 7 M or less, or 2 M or less. Examples of tissue culture media include MS medium, Gamborg's B5 medium, R2 medium, White medium, Nitsch-Nitsch medium, and N6 medium. The pH of the liquid medium is not limited, but is preferably, for example, 6 to 8, with 7.5 being particularly preferred.

[0056] In this step, the amount of plant cells / tissues in the liquid medium is not particularly limited, but is, for example, 1 × 10 per mL of the liquid medium. 3 1 x 10 or more 4 1 x 10 or more 5 or more, for example, 1×10 8 10 or less, or 1 x 10 7 10 or less, or 1 x 10 6 The amount of the culture medium can be adjusted to contain no more than 100 plant cells.

[0057] In this step, the concentration of the acicular inorganic compound in the liquid medium is not particularly limited, but is usually adjusted appropriately depending on the type of acicular inorganic compound and the type and amount of plant cells and tissues. For example, it is preferable to adjust the concentration so that the acicular inorganic compound is usually 1 mg or more, or 4 mg or more, and usually 100 mg or less, or 40 mg or less per mL of PCV (packed cell volume, hereinafter abbreviated as "PCV") of plant cells.

[0058] In this step, when a site-specific DNA-modifying protein and a guide RNA are used in a liquid medium, the amount of the guide RNA is not particularly limited, but is preferably adjusted so that a predetermined amount of ribonucleoprotein (RNP) is formed. Specifically, it is preferable to adjust the amount of the site-specific DNA-modifying protein and / or the guide RNA so that the amount of ribonucleoprotein (RNP) formed in the liquid medium is typically 20 pmol or more, or 100 pmol or more, and typically 800 pmol or less, or 600 pmol or less.

[0059] In this step, the plant cells / tissues, site-specific DNA-modifying protein, guide RNA, and needle-shaped inorganic compound are mixed together with the liquid medium in the same container. The container is not particularly limited as long as it can handle plant cells / tissues in a sterile manner. Examples include microtubes, centrifuge tubes, glass test tubes, polypropylene test tubes, petri dishes, flasks, etc. Typically, the container is shaken and stirred so that the plant cells / tissues, site-specific DNA-modifying protein, guide RNA, and needle-shaped inorganic compound placed in the container are uniformly mixed and dispersed in the liquid medium. In this way, a mixture of plant cells / tissues, needle-shaped inorganic compound, and ribonucleoprotein (RNP) (formed by binding of the site-specific DNA-modifying protein and guide RNA) dispersed in the liquid medium can be obtained.

[0060] As mentioned above, in another embodiment of the genome editing method of the present invention, when using plant cells or tissues that constitutively or inducibly express a site-specific DNA-modifying protein or guide RNA, it is not necessary to add and mix the site-specific DNA-modifying protein or guide RNA from outside in this step. Therefore, when using plant cells or tissues that constitutively or inducibly express a site-specific DNA-modifying protein, the needle-shaped inorganic compound and guide RNA can be added to the plant cells or tissues in the same container and mixed in a liquid medium. On the other hand, when using plant cells or tissues that constitutively or inducibly express a guide RNA, the needle-shaped inorganic compound and site-specific DNA-modifying protein can be added to the plant cells or tissues in the same container and mixed in a liquid medium.

[0061] Step (i): Agitation In this step, the mixture is subsequently agitated. The agitation method is not limited, and any method can be used. Specific examples include one type of treatment selected from centrifugation, ultrasonic treatment, vortex mixer treatment, etc., or a combination of two or more types of treatments.

[0062] In the genome editing method of the present invention, in this step, perforation of the cell wall of a plant cell is achieved by perturbing the cell wall in the presence of a needle-shaped inorganic compound, which is presumed to form holes in the cell wall sufficient to allow site-specific DNA-modifying proteins and / or guide RNAs and / or ribonucleoproteins (RNPs) to enter the cell without causing significant damage to the cell. This is also presumed to reduce off-target effects compared to conventional genome editing methods, as well as enable simultaneous editing of multiple target sites and improved genome editing efficiency for large numbers of cells.

[0063] In particular, it is preferable to carry out centrifugation and ultrasonic treatment in this step in sequence. According to this embodiment, by attaching the acicular inorganic compound to the plant cells by centrifugation and then vibrating the acicular inorganic compound by ultrasonic treatment, it becomes possible to more efficiently realize perforation of the cell walls of the plant cells by the acicular inorganic compound.

[0064] When centrifugation is performed, the conditions are not limited, but examples are as follows: The centrifugal acceleration is usually 3,000 x g or more, or 10,000 x g or more, and preferably, for example, 50,000 x g or less, or 30,000 x g or less. The centrifugation time is usually 10 seconds or more, or 5 minutes or more, and preferably, 20 minutes or less, or 10 minutes or less. Furthermore, centrifugation needs to be performed at least once, but in order to increase the amount of acicular inorganic compound attached to plant cells, it is preferable to repeat the same centrifugation process two or more times, or three or more times. The upper limit of the number of repetitions is not limited, but is usually 10 times or less.

[0065] When ultrasonic treatment is performed, the conditions are not limited, but it is preferable to use milder conditions than those used in the various conventional techniques described above. Examples are as follows. The ultrasonic frequency is preferably usually 1 kHz or more, or 10 kHz or more, and usually 1 MHz or less, or 60 kHz or less. The ultrasonic irradiation time is preferably usually 0.2 seconds or more, or 30 seconds or more, and usually 20 minutes or less, or 2 minutes or less. The ultrasonic intensity is usually 0.01 W / cm 2 or more, or 0.1 W / cm 2 Above 10 W / cm 2 or less than 1 W / cm 2 It is preferable to do the following:

[0066] Step (ii): Culturing After the mixing and agitation treatment in step (i), the resulting mixture is preferably allowed to stand. This allows the site-specific DNA-modifying protein and / or guide RNA and / or ribonucleoprotein (RNP) to sufficiently penetrate and diffuse into the cells through the holes in the cell walls of the plant cells perforated by the acicular inorganic compound. The conditions for standing are not limited, but examples are as follows: The temperature during standing is preferably typically 0°C or higher, or 4°C or higher, and typically 40°C or lower, or 35°C or lower. The standing time is preferably typically 1 minute or longer, or 5 minutes or longer, and typically 3 hours or shorter, or 1 hour or shorter.

[0067] After the mixing and agitation treatment in step (i), preferably the mixture is allowed to stand as described above and then cultured. However, it is preferable to wash the mixture before culturing in order to remove the acicular inorganic compounds from the mixture. The washing solution used in this step is not particularly limited, but typically, as with the examples of liquid media described above, distilled water, isotonic solution, buffer solution, culture medium, etc. are preferred, with isotonic solution or culture medium being preferred. The washing method is not particularly limited, but for example, the liquid phase may be removed from the mixture, followed by adding a washing solution to the container and mixing, and this washing operation may be repeated several times. In addition, when removing the liquid phase, the solid phase containing plant cells and tissues may be more efficiently separated from the liquid phase by using a procedure such as filtration.

[0068] The plant cells and tissues thus obtained are then cultured. This allows the genome editing system constructed using the site-specific DNA-modifying protein and guide RNA to be expressed in the plant cells, resulting in genome editing of the target site in the plant cell genome. Culture conditions are not particularly limited, but examples are as follows:

[0069] The type of culture medium is not limited, and any medium suitable for culturing plant cells and tissues can be used. The medium may be a liquid medium or a solid medium. Specific examples of liquid media include MS medium, Gamborg's B5 medium, R2 medium, White medium, Nitsch-Nitsch medium, and N6 medium, which are all listed above as examples of liquid media. Solid media include media obtained by solidifying the liquid media with agar or the like. Various additives may also be added to these media as needed. Examples of additives include plant hormones and carbon sources. Plant hormones include auxins such as 2,4-D, naphthaleneacetic acid, and indoleacetic acid, and cytokinins such as benzyladenine and kinetin. Carbon sources include sucrose and glucose. The type and combination of these media and additives may be selected according to the target plant species.

[0070] The temperature during cultivation is not particularly limited, but can be generally 15°C or higher, or 20°C or higher, and generally 40°C or lower, or 35°C or lower.

[0071] The culture time is not particularly limited, but can be, for example, 1 hour or more, 3 hours or more, 12 hours or more, or 24 hours or more. The upper limit is also not particularly limited, but can be, for example, 14 days or less, 7 days or less, 120 hours or less, or 72 hours or less.

[0072] Other steps: The above procedure results in the production of a divided cell mass (callus) containing genome-edited cells. However, such a cell mass contains a mixture of genome-edited and non-genome-edited cells. To efficiently obtain genome-edited cells and plants, it is desirable to select and separate genome-edited cells from the divided cells.

[0073] In this procedure, a plasmid carrying a drug resistance gene serving as a selection marker (selection marker plasmid) may be mixed into the liquid medium during the mixing step (i). This allows dividing cells into which a site-specific DNA-modifying protein and / or guide RNA and / or ribonucleoprotein (RNP) have been introduced together with the selection marker plasmid to be selected by utilizing the drug resistance effect, thereby enabling efficient selection of genome-edited cells.

[0074] The drug resistance gene used as a selection marker is not particularly limited, and any conventionally known drug resistance gene can be selected and used depending on the type of plant, the type of modification introduced by genome editing, etc. Examples include known antibiotic resistance genes such as hygromycin and kanamycin. The method for constructing a selection marker plasmid is also not limited, and various known techniques can be appropriately selected and used.

[0075] After the mixing and agitation in step (i) is carried out in the presence of a selectable marker plasmid, followed by the culturing in step (ii), the resulting divided cell masses are plated or suspended in a solid or liquid selective medium and cultured. The selective medium may be the aforementioned plant tissue culture medium supplemented with an appropriate drug, such as hygromycin or kanamycin, depending on the resistance substance of the selectable marker. The drug concentration is not limited and may be selected depending on the type of plant and the type of drug. For example, the drug concentration may be 1 mg / L or more, 300 mg / L or less, 25 mg / L or more, or 50 mg / L or less. The culture time is also not particularly limited, but may be, for example, 1 day or more, 3 days or more, or 60 days or less, or 40 days or less.

[0076] - Generation of genome-edited plants and plant seeds Genome-edited plant cells and tissues can be obtained by the genome editing method of the present invention described above, and genome-edited plants or plant seeds can be obtained by further culturing the obtained genome-edited plant cells and tissues.

[0077] Specifically, genome-edited plant cells and tissues obtained as described above can be placed on a known plant regeneration medium and cultured to obtain genome-edited plants. Culture conditions are not limited and may be selected depending on the type of plant and the type of modification introduced by genome editing. For example, the culture temperature can be typically 15°C or higher, or 20°C or higher, and typically 30°C or lower, or 28°C or lower. The light intensity used during culture can be typically 500 lux or higher, or 800 lux or higher, and typically 2,000 lux or lower, or 1,000 lux or lower. The culture period can be typically 20 days or longer, or 30 days or longer, and typically 60 days or shorter, or 40 days or shorter.

[0078] Furthermore, genome-edited plant seeds can be obtained by fertilizing and fructifying the genome-edited plant obtained in this way and collecting the seeds.

[0079] The present invention will be described in more detail below with reference to examples. However, these examples are merely examples shown for the convenience of explanation, and the present invention is not limited to these examples in any sense.

[0080] [Example 1] Genome editing operation on plant cells An outline of genome editing operation on plant cells using needle-shaped inorganic compounds (whiskers) is shown schematically in Figure 1. Specifically, the operation was carried out according to the following procedure.

[0081] (1) Preparation of Test Plant Cells. Fully ripened rice seeds (scientific name: Oryza sativa (Os); cultivar: Nipponbare) were threshed and sterilized by immersion in 70% ethanol for 10 seconds, followed by immersion in approximately 1% available chlorine sodium hypochlorite for 6 minutes, followed by rinsing with sterile water. A medium (pH 5.8) was prepared by adding 30 g / L sucrose, 2 mg / L 2,4-D, and 0.3 g / L Gelrite to the inorganic component composition of MS medium. This medium was placed in a 90 mm diameter Petri dish and allowed to solidify to prepare a solid medium. The seeds obtained above (9 per Petri dish) were placed on this solid medium and cultured at 28°C for 14 days in a bright location (2,000 lux, 16 hours of light per day) to obtain callus. A liquid medium (pH 5.8) was prepared by adding 30 g / L of sucrose, 2 mg / L of 2,4-D, and 2 g / L of casamino acids to the inorganic component composition of R2 medium. 50 mL of this liquid medium was placed in a 100 mL Erlenmeyer flask and sterilized by autoclaving to prepare a liquid medium (hereinafter, this liquid medium will be referred to as "R2D2 medium").

[0082] The calli obtained above were excised from the endosperm and transplanted onto this R2D2 medium, 10 per flask. They were cultured at 28°C in a bright location (2,000 lux, 16 hours of light per day) using a rotary shaker (100 rpm / min) with shaking to obtain suspension-cultured cells. Every 7 days, 3 mL of these suspension-cultured cells were transplanted onto fresh R2D2 medium and subcultured. After 28 days of subculture, rice calli were sieved through a 1 mm pore stainless steel mesh sieve to obtain 3 mL of calli measuring 1 mm or less per petri dish with PCV. The resulting rice calli measuring 1 mm or less were washed three times with R2D2 medium and subjected to testing.

[0083] (2) Preparation of Acicular Inorganic Compound 1 g of potassium titanate whisker (product "LS20"; Titan Kogyo Co., Ltd.) was placed in a 500 mL eggplant-shaped flask, 100 mL of toluene was added, and 1 g of 3-(2-aminoethoxylaminopropyl)-trimethoxysilane (coupling agent) was added and dissolved. The temperature of the toluene in the flask was then raised to 120°C, and the mixture was stirred to distill off the toluene, yielding a slurry. After the reaction, the slurry was washed with 90% methanol to remove excess coupling agent. The remaining methanol used for washing was then completely distilled off using a rotary evaporator, yielding surface-basic whiskers. 5 mg of the surface-basic whiskers obtained above were placed in a 1.5 mL tube (manufactured by Eppendorf), 0.5 mL of ethanol was added, and the mixture was left overnight. The ethanol was then completely evaporated, yielding sterilized whiskers. The whiskers were washed by adding 1 mL of sterilized water to the tube and stirring thoroughly. The mixture was then centrifuged at 3000 rpm for 5 minutes, discarding the supernatant and washing the whiskers. After repeating this washing procedure three times, 0.5 mL of R2D2 medium was added to the tube to obtain a whisker suspension.

[0084] (3) Preparation of RNP complex sgRNA is Guide-it TM RNP solutions were prepared by in vitro transcription using the sgRNA In Vitro Transcription Kit (Takara Bio). The RNP solutions were prepared by adjusting the concentrations of sgRNA and Cas9 in RNase-free gel filtration buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% (v / v) glycerol, 1 mM MgCl ). 2 ) and left at 25°C for 10 minutes to allow complex formation. 2 μL of 1 mg / mL polyornithine solution was then added per 98 μL of RNP solution, and the mixture was allowed to react for 10 minutes. The treated solution was filter-sterilized and used as the RNP solution for introduction.

[0085] (4) Introduction of RNP complexes: 250 μL of the 1 mm or less callus obtained in (1) above was added to a 1.5 mL tube containing the whisker suspension obtained in (2) above using PCV, stirred, and then centrifuged at 1,000 rpm / min for 10 seconds to precipitate the callus and whiskers. The supernatant was discarded to obtain a mixture of callus and whiskers. The RNP solution obtained in (3) above was added to the tube containing the mixture of callus and whiskers.

[0086] Next, the tube containing this mixture was centrifuged at 15,000 × g for 5 minutes, and after centrifugation, it was shaken again. This centrifugation and re-shaking procedure was repeated three times. The tube containing the mixture thus obtained was placed in the bath of an ultrasonic generator (bathtub type: water was used as the medium) so that the tube was fully immersed, and ultrasonic waves were applied at a frequency of 40 kHz and an intensity of 0.25 W / cm. 2 After irradiation, the mixture was left standing at 4°C for 10 minutes.

[0087] [Example 2] Genome editing of OsPDS gene in cultured rice cells

[0088] (1) Preparation of test plant cells The test was carried out in accordance with the method described in Example 1(1).

[0089] (2) Preparation of needle-shaped inorganic compound The preparation was carried out in accordance with the method described in Example 1(2).

[0090] (3) Preparation of RNP complex The target sequence of the rice (Os) phytoene desaturase (PDS) gene was as shown in SEQ ID NO: 1. The procedure was carried out in accordance with the method described in Example 1 (3), except that the concentration of the RNP solution was 100 pmol. - Target sequence of the OsPDS gene (sequence of the region complementary to the sgRNA sequence) OsPDS: GTTGGTCTTTGCTCCTGCAG (SEQ ID NO: 1)

[0091] (4) Introduction of RNP complexes The procedure was carried out in accordance with the method described in Example 1(4).

[0092] (5) Cultivation of dividing cells and DNA sampling. The RNP-introduced calli cultured in (4) were cultured at 35°C for 1.24 hours and then sampled. The sampled calli were rapidly cooled to -80°C and mashed using a masher. 300 μL of DNA extract (100 mM Tris (pH 8.0), 50 mM EDTA (pH 8.0), 500 mM NaCl) was added to the mashed sample and mixed uniformly using a vortex mixer. 15 μL of 20% SDS solution was added to the mashed sample and incubated at 65°C for 10 minutes. After treatment, 90 μL of 5M potassium acetate was added, mixed gently, and centrifuged at 15,000 × g for 5 minutes. 400 μL of the supernatant was transferred to a new 1.5 mL tube, an equal volume of isopropanol was added, and the mixture was mixed by inversion. After leaving the mixture at room temperature for 2 minutes, it was centrifuged at 15,000 x g for 3 minutes. After discarding the supernatant, 500 μL of 70% ethanol was added, and the mixture was centrifuged at 15,000 x g for 2 minutes, and the supernatant was removed. The precipitate was air-dried for 10 minutes and then dissolved in 100 μL of sterile MilliQ water. Using the extracted DNA sample as a template, PCR was performed to amplify the target site. PCR was performed using primers (SEQ ID NOs: 2 and 3) and the extracted DNA sample. KOD one PCR enzyme was used. Amplification conditions were 98°C: 10 seconds, 55°C: 2 seconds, and 68°C: 1 second, for 35 cycles.

[0093] Primer sequences CsPDS_Fw: AGCTGTAACAAAAGGCCCAAAAG (SEQ ID NO: 2) CsPDS_Rv: ACCCTCCATCGAAGCCAAATATT (SEQ ID NO: 3)

[0094] (6) Genome editing efficiency study: While the PCR product of DNA fragments from unedited cells was completely cleaved by the restriction enzyme Pstl, the DNA fragments from mutated cells left uncleaved. DNA was extracted and purified from the uncleaved band and subjected to sequence analysis. Cells with mutations in the target gene sequence were determined to be target gene mutation-introduced cells. As a result, mutations were confirmed in the OsPDS target gene in the cells.

[0095]

[0096] [Example 3] Genome editing of the OsLCYε5 gene in cultured rice cells

[0097] (1) Preparation of test plant cells The test was carried out in accordance with the method described in Example 1(1).

[0098] (2) Preparation of needle-shaped inorganic compound The preparation was carried out in accordance with the method described in Example 1(2).

[0099] (3) Preparation of RNP complex The target sequence of the rice (Os) lycopene ε-cyclase (LCYε / LCYe5) gene was as shown in SEQ ID NO: 4. The same procedure as described in Example 1 (3) was followed, except that the concentration of the RNP solution was 100 to 600 pmol. - Target sequence (sgRNA sequence) of the OsLCYε gene: OsLCYε: GCTTCTCTACGTGCAAATGC (SEQ ID NO: 4)

[0100] (4) Introduction of RNP complexes The procedure was carried out in accordance with the method described in Example 1(4).

[0101] (5) Cultivation of dividing cells and DNA sampling The RNP-introduced calli cultured in (4) were cultured at 25°C for 48 hours and then sampled. The extracted DNA sample was used as a template to amplify the target site by PCR. PCR was performed using primers (SEQ ID NOs: 5 and 6) and the extracted DNA sample. Other procedures were performed in accordance with the method described in Example 2 (5). Primer sequences: OsLCYe5_Fw: AGGGAAGGAGCAGGAGGGTTGTG (SEQ ID NO: 5) OsLCYe5_Rv: GGAGTAGTGATATGATTTATTTACTGCTAC (SEQ ID NO: 6)

[0102] (6) Genome editing efficiency: DNA was extracted and purified, and sequenced without restriction enzyme digestion. Cells with mutations in the target gene sequence were determined to be target gene mutation-introduced cells. As a result, mutation introduction into the OsLCYε target gene in the cells was confirmed.

[0103]

[0104] [Example 4] Preparation of genome-edited plants containing OsPDS genes

[0105] (1) Preparation of test plant cells The test was carried out in accordance with the method described in Example 1(1).

[0106] (2) Preparation of needle-shaped inorganic compound The preparation was carried out in accordance with the method described in Example 1(2).

[0107] (3) Preparation of RNP complex This was carried out in accordance with the method described in Example 1(3).

[0108] (4) Preparation of a Resistance Gene-Carrying Plasmid pCH, which carries an expression cassette for the hygromycin resistance gene (hygromycin phosphotransferase gene), was used as the resistance gene-carrying plasmid. The plasmid (pCH) was dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) at a concentration of 1 mg / mL. 20 μL of pCH solution (containing 20 μg of hygromycin) was mixed with 10 μL of R2D2 medium, and the mixture was then added to the tube containing the callus, whiskers, and RNP mixture. The mixture was then thoroughly shaken to obtain a mixture.

[0109] (5) Introduction of RNP complexes This was carried out in accordance with the method described in Example 1(4).

[0110] (6) Cultivation of dividing cells The callus into which RNP had been introduced was placed in a 3.5 cm petri dish, and 3 mL of R2D2 medium was added. The callus was then cultured at 28°C in a bright place (2,000 lux, 16 hours of light per day) using a rotary shaker (50 rpm / min) to obtain dividing cells.

[0111] Culture was performed according to (5) above, and on the third day (72 hours) of culture, 3 mL of a suspension of these dividing cells was uniformly spread on a solid medium prepared by solidifying 30 mL of N6 medium (pH 5.8) containing 2 mg / L 2,4-D, 30 g / L sucrose, 3 g / L Gelrite, and 50 mg / L hygromycin in a 9 cm diameter Petri dish, and the liquid medium of the suspension was then aspirated with a pipette. This was cultured at 28°C in a bright place (2,000 lux, 16 hours of light per day) for 20 days to obtain hygromycin-resistant cells.

[0112] The resistant cells produced calli that were white due to mutations in the rice phytoene desaturase (PDS) gene, confirming that genome editing of the PDS gene had occurred. The editing efficiency of the genome-edited mutant cells in the RNP-introduced area relative to the original DNA sequence was calculated.

[0113]

[0114] (7) Plant regeneration from genome-edited cells The hygromycin-resistant and whitened cultured cells (1 cm in diameter) obtained in (6) above were placed in MS medium (pH 5.8) with a 1 / 2 inorganic salt concentration containing 30 g / L sucrose, 30 g / L sorbitol, 0.3 mg / L benzyladenine, 0.3 mg / L naphthaleneacetic acid, and 3 g / L gelrite at 6 calli per 9 cm diameter dish and cultured at 28°C in a bright place (2,000 lux, 16 hours of light per day) for 50 days, resulting in regeneration of shoots from the cultured cells.

[0115] The regenerated shoots (grown to a length of 3-5 mm) were individually transplanted into solid medium prepared by solidifying 30 mL of MS medium containing 30 g / L sucrose and 3 g / L Gelrite at a 1 / 2 inorganic salt concentration in a test tube (15 cm long x 4 cm diameter). After culturing for 30 days, plants were obtained in which roots had formed at the base of the grown shoots. A photograph of the resulting rice plants with genome editing of the OsPDS gene is shown in Figure 2.

[0116] (8) Confirmation of genome editing by genome analysis of regenerated plants To analyze mutations caused by genome editing, a region of approximately 400 bp around the gRNA target locus was amplified by short-strand DNA region PCR and subjected to next-generation sequencing analysis. 50 mg of leaves from the regenerated plant was placed in a 1.5 mL microtube, 300 μL of 20 mM Tris-HCl buffer (pH 7.5) containing 10 mM EDTA was added, and after grinding, 20 mL of 20% SDS was added and heated at 65 ° C for 10 minutes. 100 μL of 5 M potassium acetate was added to this, and the mixture was placed on ice for 20 minutes, followed by centrifugation at a centrifugal acceleration of 1,7000 × g for 20 minutes. 200 μL of isopropanol was added to the resulting supernatant, stirred by inversion, and centrifuged again at a centrifugal acceleration of 1,7000 × g for 20 minutes. The precipitate was dried under reduced pressure and dissolved in 100 μL of TE buffer to obtain DNA.

[0117] SEQ ID NOs: 2 and 3 were used as PCR primers. PCR was performed using the primers and extracted DNA samples. KOD one was used as the PCR enzyme. The amplification conditions were 98°C: 10 seconds, 55°C: 2 seconds, 68°C: 1 second, 35 cycles. The amplified products were used as samples for DNA sequence analysis using a next-generation sequencer (NGS). The amplified PCR products from each treatment group were subjected to NGS analysis using Miseq (Illmina) to confirm that DNA editing had occurred.

[0118] [Example 5] Preparation of genome-edited rice plants with β-carotene gene

[0119] (1) Preparation of test plant cells The test was carried out in accordance with the method described in Example 1(1).

[0120] (2) Preparation of needle-shaped inorganic compound The preparation was carried out in accordance with the method described in Example 1(2).

[0121] (3) Preparation of RNP complex This was carried out in accordance with the method described in Example 2(3).

[0122] (4) Preparation of a Plasmid Carrying a Resistance Gene This was carried out according to the method described in Example 3(4).

[0123] (5) Introduction of RNP complex The introduction procedure was carried out in accordance with the method described in Example 3 (5), except that the target sequence was as shown in SEQ ID NO: 7 and the concentration of the RNP solution was 100 pmol. Target sequence of OsLCYβ gene (sgRNA sequence) OsLCYb2: CTCCGTCTGCGCCATCGACC (SEQ ID NO: 7)

[0124] (6) Culturing of dividing cells was carried out according to the method described in Example 3(6). Calli that turned red due to mutations in the rice OsLCYβ gene were obtained from the resistant cells, confirming that genome editing of the LCYβ gene had occurred and that β-carotene had accumulated. A photograph of the resulting rice calli with genome editing of the OsLCYβ gene is shown in Figure 3(a), and a photograph of the non-genome-edited rice calli is shown in Figure 3(b).

[0125] (7) Plant regeneration from genome-edited cells This was carried out in accordance with the method described in Example 3(7). A photograph of the resulting rice plant in which the OsLCYβ gene had been genome-edited is shown in Figure 4.

[0126] (8) Confirmation of editing by genome analysis of regenerated plants To analyze mutations due to genome editing in the obtained plants, a region of approximately 400 bp around the gRNA target locus was amplified by short-strand DNA region PCR and subjected to next-generation sequencing analysis. The primer set used for PCR was a primer set having the DNA sequences of SEQ ID NOs: 8 and 9 below. LCYb2_Fw: TGCTCTCCCTCGACCTCC (SEQ ID NO: 8) LCYb2_Rv: TTGTGGAACGTGACGCCAT (SEQ ID NO: 9)

[0127] The PCR products from each treatment group were subjected to NGS analysis using Miseq (Illmina). The resulting DNA sequence of the OsLCYβ gene is shown in Figure 5. It was confirmed that one-base and four-base deletions had been introduced into the regenerated plants obtained from the red calli.

[0128] The present invention is widely applicable to various industrial fields involving plant genome variants, such as agriculture, the pharmaceutical industry, and the enzyme industry.

Claims

1. 1. A method for editing the genome of a plant, comprising: (i) mixing plant cells or tissues containing plant cells with a site-specific DNA-modifying protein and a needle-shaped inorganic compound in a liquid medium, and subjecting the cells to agitation to allow the needle-shaped inorganic compound to perforate the cells and introduce the site-specific DNA-modifying protein into the cells; and (ii) A step of inducing a specific DNA mutation at a target site in the genome of the plant cell by culturing the plant cell or a tissue containing the plant cell into which the site-specific DNA-modifying protein has been introduced in step (i). A method comprising:

2. 2. The method of claim 1, wherein guide RNAs are mixed together during the mixing in step (i).

3. 1. A method for editing the genome of a plant, comprising: (i) mixing plant cells or tissues containing plant cells in which a site-specific DNA-modifying protein is constitutively or inducibly expressed with a guide RNA and a needle-shaped inorganic compound in a liquid medium, and perturbing the plant cells with the needle-shaped inorganic compound to introduce the guide RNA into the cells; (ii) A step of generating a specific DNA mutation at a target site in the genome of a plant cell by culturing a plant cell or a tissue containing a plant cell into which a guide RNA has been introduced. A method comprising:

4. The method of any one of claims 1 to 3, wherein the site-specific DNA-modifying protein is selected from the group consisting of a Cas protein, a zinc finger motif, and a TAL effector.

5. The method of claim 4, wherein the site-specific DNA-modifying protein exists in a state in which it forms a ribonucleoprotein complex (RNP) containing a nucleic acid sequence recognition module and / or a guide RNA.

6. 6. The method of claim 5, wherein the concentration of the ribonucleoprotein complex is 20 to 800 picomolar (pmol).

7. The method according to any one of claims 1 to 3, wherein the maximum diameter of the plant cells or tissue containing plant cells is 1 mm or less.

8. 2. The method of claim 1, wherein the agitation in step (i) is performed by centrifugation and ultrasonication.

9. The ultrasonic treatment in the step (i) is carried out at a frequency of 10 to 60 kHz and an intensity of 0.1 to 1 W / cm 2 The method according to claim 8, wherein the method is carried out by irradiating the tissue with ultrasonic waves of the order of 1000 to 10000 for 30 seconds to 2 minutes.

10. The method according to any one of claims 1 to 3, wherein a plasmid containing a selectable marker gene is mixed together during the mixing in step (i).

11. The method according to any one of claims 1 to 3, wherein the culturing in step (ii) is carried out at a temperature of 25 to 40°C for 1 to 72 hours.

12. A method for producing a genome-edited plant, comprising a step of performing genome editing of a plant cell using the method of claim 1.

13. A method for producing genome-edited plant seeds, comprising a step of performing genome editing of plant cells using the method of claim 1.

14. A genome-edited plant obtained by the method of claim 12.

15. A genome-edited plant seed obtained by the method of claim 13.