PROMOTER OF Eno1 GENE

Abstract

Provided is a promoter having high foreign gene expression enhancement activity in a host cell such as a mammalian cultured cell. As a means for increasing the production amount of a foreign protein to be used as a proteinaceous pharmaceutical product by using said promoter, provided is a polynucleotide which is a promoter of a gene derived from a Chinese hamster, and contains: a nucleotide sequence that is selected from among SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, or shares a sequence identity of at least 85% with the sequences thereof; or a partial sequence of said nucleotide sequence.

Description

Eno1 gene promoter

[0001] The present invention relates to a mammalian transformed cell in which the transcription activity of a foreign protein is enhanced, obtained by using a foreign gene expression vector having an Eno1 gene promoter, and a method for producing the foreign protein using the same.

[0002] With the advancement of recombinant DNA technology, the market for protein-based pharmaceuticals such as therapeutic proteins and antibody drugs is rapidly expanding. Among these, antibody drugs are considered to have a low risk of inducing harmful immune reactions when administered to the human body, and their high specificity has led to active development.

[0003] Hosts for producing proteinaceous pharmaceuticals, such as antibody pharmaceuticals, include microorganisms, yeast, animal and plant cells, insects, transgenic plants and animals, etc. Since post-translational modifications such as correct folding and glycosylation are often essential for the physiological activity and antigenicity of proteinaceous pharmaceuticals, microorganisms that cannot perform glycosylation and plants with significantly different glycosylation structures are unsuitable as hosts. Currently, mammalian cultured cells such as CHO (Chinese Hamster Ovary) cells are mainstream, as they have glycosylation structures similar to those of humans, are capable of post-translational modification, and, due to their extensive use, are free from safety concerns.

[0004] When mammalian cultured cells are used as hosts, problems such as slow growth rate, low productivity, and high cost are encountered compared to microorganisms (Non-Patent Document 1). Furthermore, because large doses are required for clinical use of antibody drugs, a lack of production capacity is a global issue. Because the production costs of protein drugs using mammalian cultured cell expression systems are higher than those of synthetic small molecule drugs, efforts have been made to reduce production costs by improving each production process. However, improving production yields in mammalian cultured cell expression systems is also an effective method for reducing production costs (Non-Patent Documents 2 and 3). Therefore, many approaches have been tried and tested to improve the productivity of foreign proteins in mammalian cultured cells, including promoters, enhancers, drug selection markers, gene amplification, and culture engineering techniques.

[0005] When CHO cells are used as host cells, the virus-derived human cytomegalovirus major immediate early promoter (hereinafter referred to as the CMV promoter) is commonly used for the expression of foreign genes, i.e., the production of proteinaceous pharmaceuticals (Non-Patent Documents 4, 5, and 6). It is also known that polynucleotides (promoter regions) upstream of the transcription start sites of elongation factor-1 alpha (EF1α) (Patent Document 1, Non-Patent Document 7) and human ribosomal protein genes RPL32 and RPS11 can be used alone or in combination with other heterologous promoters for protein expression in CHO cells (Non-Patent Document 8, Patent Documents 2 and 3). In mammalian cells, promoters of the heat shock protein A5 (Hspa5 / GRP78) gene and heat shock protein A8 (Hspa8) are known to improve the productivity of foreign proteins (Patent Documents 4 and 5).

[0006] Patent No. 3051411 International Publication No. 2006 / 123097 International Publication No. 2013 / 080934 International Publication No. 2018 / 066492 International Publication No. 2020 / 032153

[0007] Florian M. Worm. , Nat. Biotechnol. 22(11):1393-1398, 2004 Farid SS. , J Chromatogr B Analyt Technol Biomed Life Sci. 848(1):8-18, 2007 Werner RG. Economic aspects of commercial manufacture of biopharmaceuticals. J Biotechnol. 113(1-3):171-182, 2004 Durocher Y et al. , Curr Opin Biotechnol. 20(6):700-707, 2009 Boshart M et al. , Cell. 41(2):521-530, 1985 Foecking MK et al. , Gene. 45(1):101-105, 1986 Deer JR. and Allison DS., Biotechnol. Prog. 20:880-889, 2004 Hoeksema F. et al. , Biotechnology Research International, Volume2011, Article ID 492875, 11pages

[0008] The present invention aims to provide a promoter that has high activity in enhancing the expression of foreign genes in host cells such as cultured mammalian cells, and to provide a means for using said promoter to enhance the production of foreign proteins that can be used as proteinaceous pharmaceuticals.

[0009] To solve the above problems, the present invention provides the following [1] to

[34] . [1] A polynucleotide that is a promoter of a gene derived from Chinese hamster, and that comprises a nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, or a nucleotide sequence having at least 85% or more sequence identity thereto, or a partial sequence of said nucleotide sequence. [2] The polynucleotide of [1] that comprises a nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, or a nucleotide sequence having at least 85% or more sequence identity thereto, or a partial sequence of said nucleotide sequence. [2a] The polynucleotide of [1] or [2] that comprises the nucleotide sequence of SEQ ID NO: 18, or a nucleotide sequence having at least 85% or more sequence identity thereto. [3] The polynucleotide of [1] that consists of a nucleotide sequence having at least 99% or more sequence identity to the nucleotide sequence of SEQ ID NO: 1. [4] The polynucleotide of [1], consisting of a nucleotide sequence having at least 99% or more sequence identity with the nucleotide sequence of SEQ ID NO: 3. [5] The polynucleotide of [1], consisting of a nucleotide sequence having at least 99% or more sequence identity with the nucleotide sequence of SEQ ID NO: 4. [6] The polynucleotide of [1], consisting of a nucleotide sequence having at least 99% or more sequence identity with the nucleotide sequence of SEQ ID NO: 10. [7] The polynucleotide of [1], consisting of a nucleotide sequence having at least 99% or more sequence identity with the nucleotide sequence of SEQ ID NO: 11. [8] The polynucleotide of [1], consisting of a nucleotide sequence having at least 99% or more sequence identity with the nucleotide sequence of SEQ ID NO: 12. [9] The polynucleotide of [1], consisting of a nucleotide sequence having at least 99% or more sequence identity with the nucleotide sequence of SEQ ID NO: 13.

[10] The polynucleotide of [1], consisting of a nucleotide sequence having at least 99% or more sequence identity with the nucleotide sequence of SEQ ID NO: 14.[10a] A polynucleotide which is a promoter of a gene derived from a Chinese hamster, and which comprises the nucleotide sequence of SEQ ID NO: 18, or a nucleotide sequence having at least 85% or more sequence identity to said sequence. [10b] The polynucleotide of [10a], which comprises a nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13, or a nucleotide sequence having at least 85% or more sequence identity to any of these sequences, or a partial sequence of said nucleotide sequence.

[0010]

[11] A polynucleotide which is a promoter of a gene derived from a mouse, and which comprises a nucleotide sequence selected from SEQ ID NO: 2, SEQ ID NO: 17, and SEQ ID NO: 16, or which has at least 85% or more sequence identity to any of these sequences, or a partial sequence of said nucleotide sequence. [11a] The polynucleotide of

[11] , which comprises a nucleotide sequence which has at least 85% or more sequence identity to the nucleotide sequence of SEQ ID NO: 18.

[12] The polynucleotide of

[11] , which consists of a nucleotide sequence which has at least 99% or more sequence identity to the nucleotide sequence of SEQ ID NO: 2.

[13] The polynucleotide of

[11] , which consists of a nucleotide sequence which has at least 99% or more sequence identity to the nucleotide sequence of SEQ ID NO: 17.

[14] The polynucleotide of

[11] , which consists of a nucleotide sequence which has at least 99% or more sequence identity to the nucleotide sequence of SEQ ID NO: 16. [14a] A polynucleotide which is a promoter of a gene derived from a mouse, and which comprises a nucleotide sequence which has at least 85% or more sequence identity to the nucleotide sequence of SEQ ID NO: 18. [14b] The polynucleotide of [14a], comprising a nucleotide sequence selected from SEQ ID NO: 2, SEQ ID NO: 17, and SEQ ID NO: 16, or a subsequence of said nucleotide sequence having at least 85% sequence identity thereto.

[0011]

[15] A polynucleotide having promoter activity, comprising a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 2, SEQ ID NO: 17, or SEQ ID NO: 16 of [1] or

[11] , or a partial sequence of said nucleotide sequence.

[16] A polynucleotide having promoter activity, comprising a nucleotide sequence having 95% or more sequence identity to the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 2, SEQ ID NO: 17, or SEQ ID NO: 16 of [1] or

[11] , or a partial sequence of said nucleotide sequence.

[17] A polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 2, SEQ ID NO: 17, or SEQ ID NO: 16 of [1] or

[11] , and has promoter activity. [17a] A polynucleotide of any of [1] to

[17] , having a length of 1 kbp to 10 kbp, 2 kbp to 6 kbp, 2.6 kbp to 5 kbp, 2.7 kbp to 4.5 kbp, or 2.8 kbp to 4 kbp.

[18] A polynucleotide comprising a polynucleotide of any of [1] to

[17] and [17a] and a foreign gene.

[0012]

[19] A foreign gene expression unit comprising a polynucleotide of any of [1]-

[18] and [17a] and a foreign gene. [19a] The foreign gene expression unit of

[19] , further comprising a transcription terminator region.

[20] The foreign gene expression unit of

[19] or [19a], wherein the foreign gene is a gene encoding a protein.

[21] The foreign gene expression unit of

[20] , wherein the foreign gene is a gene encoding a heteromultimeric protein.

[22] The foreign gene expression unit of

[21] , wherein the foreign gene is a gene encoding an antibody or an antigen-binding fragment thereof.

[23] A foreign gene expression vector comprising the foreign gene expression unit of any of

[19] -

[22] and [19a].

[24] A foreign gene expression vector comprising a foreign gene expression unit of any one of

[19] to

[22] and [19a] and one or more polynucleotides selected from the following (a) to (e): (a) the nucleotide sequence of SEQ ID NO: 5, or a partial sequence thereof, (b) the nucleotide sequence of SEQ ID NO: 6, or a partial sequence thereof, (c) the nucleotide sequence of SEQ ID NO: 7, or a partial sequence thereof, (d) a polynucleotide comprising a nucleotide sequence having 80% or more sequence identity to the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, or a partial sequence of said nucleotide sequence, and having foreign gene expression enhancing activity, (e) a polynucleotide comprising a nucleotide sequence having 85% or more sequence identity to the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, or a partial sequence of said nucleotide sequence, and having foreign gene expression enhancing activity. [24a] A foreign gene expression vector comprising a foreign gene expression unit of any of

[19] -

[22] and [19a] and a polynucleotide of (b) or (d) below: (b) the nucleotide sequence of SEQ ID NO: 6, or a partial sequence thereof, (d) a polynucleotide comprising a nucleotide sequence having 80% or more sequence identity to the nucleotide sequence of SEQ ID NO: 6, or a partial sequence of said nucleotide sequence, and having foreign gene expression enhancing activity.

[25] A transformed cell into which the foreign gene expression vector of

[23] ,

[24] or [24a] has been introduced.

[26] The transformed cell of

[24] , which is a cultured cell derived from a mammal.

[27] The transformed cell of

[25] , which is a COS-1 cell, a 293 cell, or a CHO cell.

[0013]

[28] A method for producing a protein, comprising culturing a transformed cell according to any one of

[25] to

[27] and obtaining a protein derived from a foreign gene from the culture.

[29] The production method according to

[28] , wherein the protein derived from a foreign gene is a monomeric protein or a multimeric protein.

[30] The production method according to

[29] , wherein the multimeric protein is a heteromultimeric protein.

[31] The production method according to

[30] , wherein the heteromultimeric protein is an antibody protein. [31a] The production method according to any one of

[28] to

[31] , wherein the culture of the transformed cells is a fed-batch culture. [31b] ​​The production method according to any one of

[28] to

[31] and [31a], wherein the culture of the transformed cells is a fed-batch culture.

[0014]

[32] Use of the polynucleotide of any one of [1] to

[18] for expressing a foreign gene in a transformed cell.

[33] Use of the foreign gene expression vector of

[23] or

[24] for expressing a foreign gene in a transformed cell.

[0015]

[34] A method for producing a transformed cell that expresses a foreign gene by introducing the foreign gene vector of

[23] ,

[24] or [24a].

[0016] The present invention provides a promoter that has high activity in enhancing the expression of foreign genes in host cells such as cultured mammalian cells, and a means for using said promoter to enhance the production of foreign proteins that can be used as proteinaceous pharmaceuticals.

[0017] Schematic diagram of humanized antibody gene Y expression vectors pDSLH3.1-Eno1-Y and pDSLH3.1-hEF1α-Y, which use the Eno1 gene or human EF1α gene-derived promoters as promoters for the antibody heavy chain (HC) and light chain (LC) genes. Figure 2-A shows a comparison of antibody production levels expressed using the Chinese hamster-derived Eno1 gene promoter with those expressed using the human EF1α gene promoter in fed-batch culture using a humanized antibody Y-expressing stable pool. In Figure 2-A, the vertical axis indicates the number of viable cells on each sampling day. hEF1α indicates the human EF1α gene promoter, and Eno1 indicates the Chinese hamster-derived Eno1 gene promoter (similar to Figure 2-B). Figure 2-A shows a comparison of antibody production levels expressed using the Chinese hamster-derived Eno1 gene promoter with those expressed using the human EF1α gene promoter in fed-batch culture using a humanized antibody Y-expressing stable pool. In Figure 2-B, the vertical axis shows the production amount on each sampling day. This figure compares the expression level of firefly luciferase transiently expressed using the region approximately 5.0 kbp to 2.5 kbp upstream from the start codon of the Chinese hamster-derived Eno1 gene as a promoter, for each chain length. The vertical axis shows the luminescence intensity of Firefly-derived luciferase on pGL4.10 divided by the luminescence intensity of Renilla-derived luciferase on pGL4.74. In the figure, the regions extending from the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon sequence of the Chinese hamster Eno1 gene to approximately 5.0 kbp upstream (SEQ ID NO: 10), approximately 4.5 kbp (SEQ ID NO: 11), approximately 4.0 kbp (SEQ ID NO: 4), approximately 3.5 kbp (SEQ ID NO: 12), approximately 3.0 kbp (SEQ ID NO: 1), approximately 2.8 kbp (SEQ ID NO: 3), approximately 2.7 kbp (SEQ ID NO: 13), approximately 2.6 kbp (SEQ ID NO: 14), and approximately 2.5 kbp (SEQ ID NO: 15) are represented as Eno1 5k, Eno1 4.5k, Eno1 4k, Eno1 3.5k, Eno1 3.0k, Eno1 2.8k, Eno1 2.7k, Eno1 2.6k, and Eno1 2.5k, respectively. A graph comparing antibody production yields in fed-batch culture of stable pools expressing humanized antibody Y, which were prepared using Eno1 gene promoters derived from various species.Eno1 and mEno1 represent the results for the Chinese hamster Eno1 gene promoter and mouse Eno1 gene promoter, respectively. In Figure 4-A, the vertical axis shows the number of viable cells on each sampling day. In the figure, the regions from the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon of the Chinese hamster Eno1 gene to approximately 4.0 kbp upstream (SEQ ID NO: 4), approximately 3.5 kbp upstream (SEQ ID NO: 12), approximately 3.0 kbp upstream (SEQ ID NO: 1), and approximately 2.8 kbp upstream (SEQ ID NO: 3) are denoted as Eno1 4kb, Eno1 3.5kb, Eno1 3kb, and Eno1 2.8kb, respectively. The regions from the nucleotide immediately preceding the start codon of the mouse-derived Eno1 gene up to approximately 4.0 kbp upstream (SEQ ID NO: 16), up to approximately 3.5 kbp (SEQ ID NO: 17), and up to approximately 3.0 kbp (SEQ ID NO: 2) are designated mEno1 4k, mEno1 3.5k, and mEno1 3k, respectively (the same applies in Figure 4-B). This figure compares antibody production yields in fed-batch culture of stable pools expressing humanized antibody Y prepared using Eno1 gene promoters derived from various species. Eno1 and mEno1 represent the results for the Chinese hamster-derived Eno1 gene promoter and the mouse-derived Eno1 gene promoter, respectively. In Figure 4-B, the vertical axis indicates production yields on each sampling day. This figure compares antibody production yields in fed-batch culture of stable pools expressing humanized antibody Y prepared using a combination of Eno1 gene promoters derived from various species and DNA element A7. Eno1 and mEno1 show the results for the Chinese hamster-derived Eno1 gene promoter and mouse-derived Eno1 gene promoter, respectively. In Figure 5-A, the vertical axis shows the number of viable cells on each sampling day. In the figure, each Eno1 gene promoter is labeled in the same way as in Figure 4-A, with A7(+) when combined with DNA element A7 and A7(-) when A7 is absent (the same applies to Figure 5-B). This figure compares the antibody production yields in fed-batch culture of stable pools expressing humanized antibody Y, which were prepared using a combination of Eno1 gene promoters derived from various organisms and DNA element A7. In Figure 5-B, the vertical axis shows the production yields on each sampling day. Sequence Table.

[0018] Preferred embodiments for carrying out the present invention will be described below. Note that the embodiment described below is an example of a typical embodiment of the present invention, and the scope of the present invention should not be construed as being narrow.

[0019] As used herein, the term "gene" refers to a portion that is transcribed into mRNA and translated into a protein, and includes not only DNA but also its mRNA, cDNA, and its RNA. As used herein, the term "polynucleotide" is used synonymously with "nucleic acid" and includes DNA, RNA, probes, oligonucleotides, and primers. As used herein, "polypeptide" and "protein" are used interchangeably. As used herein, "gene expression" refers to the phenomenon in which a gene is transcribed into mRNA and / or the phenomenon in which a protein is translated from the mRNA. As used herein, the term "foreign gene" refers to a gene artificially introduced into a host cell. As used herein, the term "foreign protein" refers to a protein encoded by a foreign gene. As used herein, the term "gene expression unit" refers to a polynucleotide that, in the direction of the reading frame of transcription, contains at least a promoter region, a foreign gene, and a transcription terminator region (polyA addition signal). As used herein, the term "promoter" refers to a region to which a transcription factor involved in the initiation of transcription from DNA to RNA binds. As used herein, the term "promoter region" is also used. An example of a promoter is a polynucleotide ranging from a nucleotide approximately 3 kbp upstream of the start codon to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon, and may include a 5'UTR and an intron. As used herein, "promoter activity" refers to the activity of a transcription factor binding to a promoter, initiating transcription, and producing a protein encoded by the gene. This activity can be assayed using the activity of a protein encoded by a reporter gene, such as firefly luciferase, as an indicator. As used herein, "having promoter activity" means that antibody expression is observed under the same conditions as in the evaluation of promoter activity using the antibody expression level in fed-batch culture described below (Example 2) as an indicator, or that firefly luciferase activity is exhibited under the same conditions as in the method described below (Example 3).As used herein, the term "DNA element" refers to a polynucleotide that has the activity of enhancing foreign gene expression when placed near a gene expression unit or on a foreign gene expression vector containing a gene expression unit. As used herein, the term "antigen-binding fragment of an antibody" refers to a partial fragment of an antibody that has antigen-binding activity, including Fab, F(ab'), etc., but is not limited to these molecules as long as it has the ability to bind to the antigen. As used herein, "sequence identity" refers to the relationship between two or more nucleotide sequences or amino acid sequences, as determined by sequence comparison, as known in the art. In the art, "sequence identity" refers to the degree of sequence relatedness between nucleic acid molecules or polypeptides, as determined by the match between two or more nucleotide sequences or two or more amino acid sequences, as the case may be. "Sequence identity" can be assessed by calculating the percent of identical matches between the smaller of two or more sequences and a gap alignment, if any, addressed by a particular mathematical model or computer program (i.e., "algorithm"). Specifically, this can be evaluated using software such as ClustalW2 provided by the European Molecular Biology Laboratory-European Bioinformatics Institute (EMBL-EBI), but is not limited to such software as long as it is used by those skilled in the art. As used herein, "hybridizing under stringent conditions" refers to conditions under which a specific hybrid is formed and a nonspecific hybrid is not formed. Examples of such conditions include conditions under which a complementary strand of a nucleic acid consisting of a nucleotide sequence with a sequence identity of 80% or more, preferably 90% or more, more preferably 95% or more, and most preferably 99% or more to a certain nucleic acid hybridizes, but a complementary strand of a nucleic acid consisting of a nucleotide sequence with lower sequence identity does not hybridize.More specifically, this refers to hybridization at 68°C in a commercially available hybridization solution, ExpressHyb Hybridization Solution (manufactured by Clontech), or hybridization using a filter on which DNA is immobilized in the presence of 0.7 to 1.0 M NaCl at 68°C, followed by washing at 68°C using a 0.1 to 2x SSC solution (1x SSC consists of 150 mM NaCl and 15 mM sodium citrate), or hybridization under conditions equivalent thereto.

[0020] As used herein, "about" refers to a value that varies by plus or minus 10%, 8%, 6%, 5%, 4%, 3%, 2%, or 1%, respectively, from the reference value. Preferably, the term "about" refers to a range of plus or minus 10%, 5%, or 1%, respectively, from the reference value.

[0021] 1. Promoter Used to Enhance Expression of Foreign Genes The promoter used to enhance expression of foreign genes of the present invention (hereinafter sometimes referred to as the "promoter of the present invention") is the promoter of the α-enolase (hereinafter referred to as "Eno1") gene.

[0022] The origin of the Eno1 gene promoter is not particularly limited, and it may be derived from a mammal, such as an Eno1 gene promoter derived from a Chinese hamster, human, mouse, etc. The promoter of the present invention is preferably a rodent-derived Eno1 gene promoter, more preferably a Chinese hamster or mouse-derived Eno1 gene promoter, and even more preferably a Chinese hamster-derived Eno1 gene promoter.

[0023] Examples of promoters for the Chinese hamster Eno1 gene include sequences comprising nucleotides from 2.0 kbp, 2.5 kbp, 2.6 kbp, 2.7 kbp, 2.8 kbp, 3.0 kbp, 3.5 kbp, 4.0 kbp, 4.5 kbp, 5.0 kbp, 5.5 kbp, and 6.0 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. More specific examples of promoters for the Chinese hamster Eno1 gene include the polynucleotides set forth in SEQ ID NOs: 1, 3, 4, 10, 11, 12, 13, and 14. The nucleotide sequence of SEQ ID NO: 1 is a sequence consisting of nucleotides from about 3.0 kbp upstream of the start codon of the Chinese hamster Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. The nucleotide sequence of SEQ ID NO:3 consists of nucleotides approximately 2.8 kbp upstream of the start codon of the Chinese hamster-derived Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. The nucleotide sequence of SEQ ID NO:4 consists of nucleotides approximately 4.0 kbp upstream of the start codon of the Chinese hamster-derived Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. The nucleotide sequence of SEQ ID NO:10 consists of nucleotides approximately 5.0 kbp upstream of the start codon of the Chinese hamster-derived Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. The nucleotide sequence of SEQ ID NO:11 consists of nucleotides approximately 4.5 kbp upstream of the start codon of the Chinese hamster-derived Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. The nucleotide sequence of SEQ ID NO:12 consists of nucleotides approximately 3.5 kbp upstream of the start codon of the Chinese hamster-derived Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. The nucleotide sequence of SEQ ID NO: 13 is a sequence consisting of nucleotides from about 2.7 kbp upstream of the start codon of the Chinese hamster Eno1 gene to the nucleotides immediately preceding the nucleotide sequence corresponding to the start codon.The nucleotide sequence of SEQ ID NO: 14 is a sequence consisting of nucleotides from about 2.6 kbp upstream of the start codon of the Chinese hamster Eno1 gene to the nucleotides immediately preceding the nucleotide sequence corresponding to the start codon.

[0024] Due to its dominant transcriptional activity, the promoter of the Eno1 gene can be a region extending from the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon sequence to approximately 2.8 kbp upstream of the start codon sequence or longer. Therefore, from the viewpoint of dominant promoter activity, the Chinese hamster-derived Eno1 gene promoter is preferably a polynucleotide represented by SEQ ID NO: 1, 3, 4, 10, 11, or 12. More preferably, the Chinese hamster-derived Eno1 gene promoter is a polynucleotide represented by SEQ ID NO: 1, 3, 4, or 12, and even more preferably, the polynucleotide represented by SEQ ID NO: 1 or 3.

[0025] Examples of mouse-derived Eno1 gene promoters include sequences comprising nucleotides from 2.0 kbp, 2.5 kbp, 3.0 kbp, 3.5 kbp, 4.0 kbp, 4.5 kbp, 5.0 kbp, 5.5 kbp, and 6.0 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. More specific examples of mouse-derived Eno1 gene promoters include the polynucleotides of SEQ ID NOs: 2, 17, and 16. The nucleotide sequence of SEQ ID NO: 2 is a sequence consisting of nucleotides from about 3.0 kbp upstream of the start codon of the mouse-derived Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. The nucleotide sequence of SEQ ID NO: 17 is a sequence consisting of nucleotides from about 3.5 kbp upstream of the start codon of the mouse-derived Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. The nucleotide sequence of SEQ ID NO: 16 is a sequence consisting of nucleotides from about 4.0 kbp upstream of the start codon of the mouse-derived Eno1 gene to the nucleotides immediately preceding the nucleotide sequence corresponding to the start codon.

[0026] Furthermore, the promoter of the present invention may be a nucleotide sequence having 80% or more, preferably 85% or more, 86% or more, 87% or more, 88% or more, or 89% or more, more preferably 90% or more, 91% or more, 92% or more, 93% or more, or 94% or more, even more preferably 95% or more, 96% or more, 97% or more, or 98% or more, and most preferably 99% or more, or 100% sequence identity to any one of the nucleotide sequences of SEQ ID NOs: 1, 2, 17, 3, 4, 10, 11, 12, 13, 14, and 16, or a polynucleotide comprising a partial sequence of the nucleotide sequence and having promoter activity.

[0027] The partial sequence may be 80% or more, preferably 85% or more, 86% or more, 87% or more, 88% or more, or 89% or more of the entire length of any one of the nucleotide sequences of SEQ ID NOs: 1, 2, 17, 3, 4, 10, 11, 12, 13, 14, or 16, more preferably 90% or more, 91% or more, 92% or more, 93% or more, or 94% or more, even more preferably 95% or more, 96% or more, 97% or more, 98% or more, and most preferably 99% or more, or 100% of the entire length. The partial sequence may be a fragment on the 5' (upstream) or 3' (downstream) side of the entire length, or may be a fragment formed by joining multiple regions of the entire length.

[0028] The promoter of the present invention may be a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of a nucleotide sequence complementary to a polynucleotide consisting of any one of the nucleotide sequences of SEQ ID NOs: 1, 2, 17, 3, 4, 10, 11, 12, 13, 14, and 16, and has promoter activity.

[0029] The promoter of the present invention preferably comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence having at least 85% sequence identity thereto, more preferably comprises a sequence having 90% or more, 91% or more, 92% or more, 93% or more, or 94% or more identity thereto, even more preferably comprises a sequence having 95% or more, 96% or more, 97% or more, or 98% or more identity thereto, particularly preferably comprises a sequence having 99% or more identity thereto, and most preferably comprises a sequence having 100% identity thereto. In particular, the Chinese hamster-derived Eno1 promoter preferably contains the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence having at least 85% or more sequence identity thereto, more preferably a sequence having 90% or more, 91% or more, 92% or more, 93% or more, or 94% or more identity thereto, even more preferably a sequence having 95% or more, 96% or more, 97% or more, or 98% or more identity thereto, particularly preferably a sequence having 99% or more identity thereto, and most preferably a sequence having 100% identity thereto.

[0030] The length of the promoter of the present invention is not particularly limited as long as it is between 1 kbp and 10 kbp, and is preferably between 2 kbp and 6 kbp, more preferably between 2.6 kbp and 5 kbp, even more preferably between 2.7 kbp and 4.5 kbp, and particularly preferably between 2.8 kbp and 4 kbp, and is typically about 3 kbp. In terms of promoter length, the shorter the promoter length that provides sufficient promoter performance, the more likely it is to be effective in terms of gene transfer efficiency.

[0031] The promoter of the present invention may be a modified polynucleotide consisting of a nucleotide sequence in which one or more, preferably 1 to 300, more preferably 1 to 200, even more preferably 1 to 100, and particularly preferably 1 to 30, nucleotides have been deleted, substituted, and / or added in any one of the nucleotide sequences of SEQ ID NOs: 1, 2, 17, 3, 4, 10, 11, 12, 13, 14, and 16, and which has promoter activity.

[0032] The introduction of modifications (deletions, substitutions, and / or additions) into the nucleotide sequence can be carried out by methods known in the art, such as the Kunkel method or the gapped duplex method, or methods equivalent thereto. For example, a mutation introduction kit using site-directed mutagenesis (e.g., Mutant-K (manufactured by Takara Bio Inc.) or Mutant-G (manufactured by Takara Bio Inc.), Takara Bio Inc.'s LA PCR in vitro Mutagenesis series kit, etc. can be used. Such modified polynucleotides can also be used as the promoter of the present invention.

[0033] The exogenous gene expression-enhancing activity of the promoter of the present invention can be assayed using the activity of a protein encoded by a reporter gene such as firefly luciferase or the amount of antibody produced in fed-batch culture as an indicator. When the activity of a protein encoded by a reporter gene of a vector containing the promoter of the present invention (e.g., the amount of firefly luciferase luminescence) is at least 1-fold, preferably at least 20-fold, more preferably at least 30-fold, even more preferably at least 40-fold, even more preferably at least 45-fold, and particularly preferably at least 50-fold higher than the activity of a protein encoded by a reporter gene of a control vector (e.g., the amount of Renilla luciferase luminescence), the promoter can be determined to have exogenous gene expression-enhancing activity. When the antibody production in fed-batch culture using the human EF1α promoter is increased to the same or higher level, preferably at least 1.2-fold, more preferably at least 1.3-fold, even more preferably at least 1.5-fold, and particularly preferably at least 1.8-fold, 1.9-fold, or 2.0-fold, compared to the human EF1α promoter using the promoter of the present invention, the promoter can be determined to have exogenous gene expression-enhancing activity. Even an increase of about 1.2 times or more is expected to reduce the cell culture scale, culture time, and purification process, resulting in improved yield and reduced culture costs. An improved yield makes it possible to stably supply foreign proteins as pharmaceuticals. Furthermore, reduced culture costs reduce the cost of foreign proteins as pharmaceuticals.

[0034] 2. Foreign Gene Expression Unit The foreign gene expression unit of the present invention (hereinafter sometimes referred to as the "gene expression unit of the present invention") comprises, in the direction of the reading frame of transcription, at least the promoter of the present invention described in 1 above, a foreign gene, and a transcription terminator region (poly A addition signal). The poly A addition sequence may be any sequence that has the activity of causing transcription termination for transcription from the promoter, and may be from the same gene as or a different gene from the promoter gene.

[0035] 3. DNA Elements Used to Enhance Expression of Foreign Genes By combining a DNA element with the gene expression unit of the present invention described in 2. above, the expression of foreign genes can be further enhanced. The DNA element to be used in combination can be obtained using its interaction with acetylated histone H3 as an indicator. It is generally believed that acetylation of histones (H3, H4) is involved in transcription activation, and two main theories are considered. One theory is that acetylation of histone tails neutralizes their charge, loosening the binding between DNA and histones, resulting in a change in the three-dimensional structure of the nucleosome (Mellor J. (2006) Dynamic nucleosomes and gene transcription. Trends Genet. 22(6):320-329), and the other is that acetylation is involved in the recruitment of various transcription factors (Nakatani Y. (2001) Histone acetylases - versatile players. Genes Cells. 6(2):79-86). In either theory, histone acetylation is likely to be involved in transcriptional activation, and DNA elements that interact with acetylated histone H3 can be enriched by chromatin immunoprecipitation (ChIP) using an anti-acetylated histone H3 antibody.

[0036] Examples of DNA elements used in combination with the promoter of the present invention to enhance expression of foreign genes include A2, A7, and A18. A7 is a preferred DNA element. A2 is located at positions 80966429-80974878 on human chromosome 15 and is a polynucleotide with an AT content of 62.2% and 8,450 bp. The nucleotide sequence of A2 is set forth in SEQ ID NO:5 in the Sequence Listing. A7 is located at positions 88992123-89000542 on human chromosome 11 and is a polynucleotide with an AT content of 64.52% and 8,420 bp. The nucleotide sequence of A7 is set forth in SEQ ID NO:6 in the Sequence Listing. A18 is located at positions 111275976-111284450 on human chromosome 4 and is a polynucleotide with an AT content of 62.54% and 8,475 bp. The nucleotide sequence of A18 is set forth in SEQ ID NO:7 in the Sequence Listing.

[0037] The activity of the DNA element used in combination with the promoter of the present invention to enhance expression of a foreign gene can be assayed using the activity of a protein encoded by a reporter gene such as secretory alkaline phosphatase (SEAP) as an indicator.

[0038] When used in combination with the promoter of the present invention, any one of the above DNA elements may be used alone, or two or more copies of one DNA element may be used, or two or more DNA elements may be used in combination.

[0039] The DNA element used in the present invention may be a nucleotide sequence having 80% or more, preferably 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, more preferably 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, more preferably 95% or more, 96% or more, 97% or more, 98% or more, and most preferably 99% or more, 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 5 to 7, and having the activity of enhancing the expression of a foreign gene.

[0040] The DNA element used in the present invention may be a modified polynucleotide consisting of a nucleotide sequence in which one or more, preferably 1 to 1,000 or 1 to 500, more preferably 1 to 100 or 1 to 50, even more preferably 1 to 10 or 1 to 5, and particularly preferably 4, 3, 2 or 1 nucleotide(s) have been deleted, substituted and / or added in the nucleotide sequence of any one of SEQ ID NOs: 5 to 7, and which has the activity of enhancing the expression of a foreign gene.

[0041] The introduction of modifications (deletions, substitutions, and / or additions) into the polynucleotide can be carried out by techniques known in the art, such as the Kunkel method or the gapped duplex method, or methods equivalent thereto. For example, a mutation introduction kit using site-directed mutagenesis (e.g., Mutant-K (manufactured by Takara Bio Inc.) or Mutant-G (manufactured by Takara Bio Inc.), Takara Bio Inc.'s LA PCR in vitro Mutagenesis series kit, etc. can be used. Such mutant polynucleotides can also be used as the DNA element of the present invention.

[0042] The DNA element used in the present invention may be a partial sequence consisting of at least 3,000 or at least 2,000 consecutive nucleotides of the polynucleotide sequence set forth in any one of SEQ ID NOs: 5 to 7. Such partial sequences may be, for example, those described in International Publication No. 2012 / 005378, and examples of the partial sequence of A2 include A2-1 to A2-17, examples of the partial sequence of A7 include A7-1 to A7-18, and examples of the partial sequence of A18 include A18-1 to A18-4.

[0043] In the present invention, any one of the partial sequences of the DNA elements may be used alone, or two or more copies of one partial fragment may be used. Alternatively, two or more partial fragments may be used in combination. Furthermore, the full-length sequence and partial sequence of each DNA element may be used in combination. In such combinations, the partial sequences may be derived from the DNA elements of the full-length sequences that make up the combination, or from DNA elements of different full-length sequences.

[0044] 4. Obtaining Polynucleotides In the present invention, polynucleotides containing a foreign gene encoding a foreign protein whose production is to be enhanced, as described below, can be obtained by the following general method. For example, a cDNA library derived from cells or tissues expressing the foreign gene can be isolated by screening with a DNA probe synthesized based on the gene fragment. mRNA can be prepared by techniques commonly used in the art. For example, the cells or tissues can be treated with a guanidinium reagent, a phenol reagent, or the like to obtain total RNA. Poly(A)+ RNA (mRNA) can then be obtained by affinity column methods using an oligo(dT) cellulose column or poly U-Sepharose with Sepharose 2B as a carrier, or by batch methods. Poly(A)+ RNA can also be further fractionated by sucrose density gradient centrifugation, for example. Next, single-stranded cDNA is synthesized from the obtained mRNA as a template using an oligo(dT) primer and reverse transcriptase, and double-stranded cDNA is synthesized from the single-stranded cDNA using DNA polymerase I, DNA ligase, RNase H, or the like. The synthesized double-stranded cDNA is blunted with T4 DNA synthetase, then ligated with an adapter (e.g., EcoRI adapter), phosphorylated, and then incorporated into a λ phage such as λgt11 for in vivo packaging to prepare a cDNA library. Alternatively, a cDNA library can also be prepared using a plasmid vector other than the λ phage. Subsequently, strains (positive clones) containing the target DNA can be selected from the cDNA library.

[0045] Furthermore, when isolating a polynucleotide containing the promoter or terminator region used for protein production, or a polynucleotide containing the DNA element or foreign gene from genomic DNA, genomic DNA is extracted from a cell line of a source organism and the polynucleotide is selected according to a general method (Molecular Cloning (1989), Methods in Enzymology 194 (1991)). Genomic DNA can be extracted, for example, according to the method of Cryer et al. (Methods in Cell Biology, 12, 39-44 (1975)) and the method of P. Philippsen et al. (Methods Enzymol., 194, 169-182 (1991)).

[0046] Polynucleotides containing the desired promoter, DNA element, or foreign gene can also be obtained by, for example, PCR (PCR Technology, Henry A. Erlich, Atockton Press (1989)). Amplification of polynucleotides using PCR uses 20-30 mer synthetic single-stranded DNA as a primer and genomic DNA as a template. The amplified gene is used after confirming the polynucleotide sequence. Genomic DNA libraries such as bacterial artificial chromosomes (BAC) can be used as PCR templates.

[0047] On the other hand, polynucleotides containing foreign genes with unknown sequences can be obtained by (a) preparing a gene library by conventional methods, and (b) selecting desired polynucleotides from the prepared gene library and amplifying the polynucleotides. A gene library can be prepared by partially digesting chromosomal DNA obtained by conventional methods from a cell line of a source organism with an appropriate restriction enzyme to fragment it, ligating the resulting fragments to an appropriate vector, and introducing the vector into an appropriate host. Alternatively, a gene library can be prepared by extracting mRNA from cells, synthesizing cDNA from it, ligating it to an appropriate vector, and introducing the vector into an appropriate host. The vector used in this case can be a plasmid, a commonly known vector for preparing gene libraries, or a phage vector or cosmid, among others. The host to be transformed or transduced can be selected depending on the type of vector. Polynucleotides containing foreign genes can be selected from the gene library by colony hybridization, plaque hybridization, or other methods using a labeled probe containing a sequence specific to the foreign gene.

[0048] Alternatively, a polynucleotide containing a foreign gene can be totally synthesized chemically, for example, by preparing two pairs of complementary oligonucleotides and annealing them, by ligating several annealed DNA strands with DNA ligase, or by preparing several partially complementary oligonucleotides and filling the gaps by PCR.

[0049] Polynucleotide sequences can be determined by conventional methods, such as the dideoxy method (Sanger et al., Proc. Natl. Acad. Sci., USA, 74, 5463-5467 (1977)). Furthermore, polynucleotide sequences can be easily determined using commercially available sequencing kits.

[0050] 5. Foreign Gene Expression Vector The foreign gene expression vector of the present invention is provided as a vector comprising the foreign gene expression unit described in 2. above, which contains the promoter described in 1. above. The foreign gene expression vector of the present invention may comprise one of the DNA elements described in 3. above, two or more copies of one of the DNA elements, or a combination of two or more DNA elements. When expressing a foreign gene in a host cell using the foreign gene expression vector, the DNA element may be positioned immediately before or after the gene expression unit, or may be positioned at a location distant from the gene expression unit. Alternatively, a single foreign gene expression vector comprising multiple DNA elements may be used. The orientation of the DNA element may be either forward or reverse relative to the gene expression unit.

[0051] Examples of foreign genes include, but are not limited to, reporter genes such as secretory alkaline phosphatase (SEAP), green fluorescent protein (GFP), and luciferase; various enzyme genes such as α-amylase and α-galactosidase; various interferon genes such as interferon α and interferon γ, which are medicamentarily useful physiologically active proteins; various interleukin genes such as IL1 and IL2; various cytokine genes such as erythropoietin (EPO) and granulocyte colony-stimulating factor (G-CSF) genes; growth factor genes; and genes encoding multimeric proteins, for example, genes encoding heteromultimers that are antibodies or antigen-binding fragments thereof. These genes may be obtained by any method.

[0052] The term "antigen-binding fragment of an antibody" refers to a partial fragment of an antibody that has antigen-binding activity, and includes Fab, F(ab')2, Fv, scFv, diabodies, linear antibodies, and multispecific antibodies formed from antibody fragments. Also included in the antigen-binding fragment of an antibody is Fab', a monovalent fragment of the variable region of an antibody obtained by treating F(ab')2 under reducing conditions. However, the antigen-binding fragment is not limited to these molecules, as long as it has the ability to bind to an antigen. Furthermore, these antigen-binding fragments include not only those obtained by treating the full-length antibody protein molecule with an appropriate enzyme, but also proteins produced in appropriate host cells using genetically engineered antibody genes.

[0053] Furthermore, the foreign gene expression vector of the present invention can contain a selection marker for selecting transformants. For example, transformants can be selected using a drug resistance marker that confers resistance to drugs such as cerulenin, aureobasidin, zeocin, canavanine, cycloheximide, hygromycin, puromycin, blastocidin, tetracycline, kanamycin, ampicillin, and neomycin. Transformants can also be selected using markers that confer solvent resistance to ethanol and the like, osmotic pressure resistance to glycerol and salts, and metal ion resistance to copper and the like.

[0054] The foreign gene expression vector of the present invention may be a vector that does not integrate into chromosomal DNA. Generally, foreign gene expression vectors are randomly integrated into chromosomes after gene transfer into host cells. However, by using components derived from mammalian viruses such as simian virus 40 (SV40), papillomavirus (BPV, HPV), and EBV, the vector can be used as an episomal vector capable of self-replicating in the introduced host cell. For example, vectors having sequences encoding an SV40-derived replication origin and the SV40 large T antigen, which is a trans-acting factor, and vectors having sequences encoding EBV-derived oriP and EBNA-1 are widely used. The effect of the DNA element can be exhibited by enhancing foreign gene expression, regardless of the type of vector or whether or not it is integrated into a chromosome.

[0055] 6. Transformed Cells The transformed cells of the present invention are transformed cells introduced using the foreign gene expression vector described in 5. above. Host cells to be transformed are eukaryotic cells, preferably mammalian cells, more preferably cells derived from humans, mice, rats, hamsters, monkeys, or cows. Examples of mammalian cells include, but are not limited to, COS-1 cells, 293 cells, and CHO cells (e.g., CHO-K1, CHO-O1, CHO DG44, CHO dhfr-, CHO-S, etc.). In the present invention, any method for introducing an expression vector into a host cell may be used as long as the introduced gene is stably present in the host and can be appropriately expressed. Examples of commonly used methods include the calcium phosphate method (Ito et al., (1984) Agric. Biol. Chem., 48, 341), electroporation (Becker, D.M. et al. (1990) Methods. Enzymol., 194, 182-187), spheroplast method (Creggh et al., Mol. Cell. Biol., 5, 3376 (1985)), lithium acetate method (Itoh, H. (1983) J. Bacteriol. 153, 163-168), and lipofection. In the transformed cells of the present invention, the foreign gene may be expressed transiently or stably, but is preferably expressed in a stable expression system. A stable expression system is a method in which an expression vector is incorporated into a chromosome using the calcium phosphate method, electroporation, lipofection, or other methods to allow expression. The introduced gene is maintained on the chromosome, and expression of the introduced gene can be maintained for a long period of time, for example, several weeks. Furthermore, the introduction of a selection marker into the plasmid enables drug selection, allowing efficient selection of cells in which the introduced gene is maintained on the chromosome.

[0056] 7. Method for Producing Foreign Proteins The foreign protein of the present invention can be produced by culturing the transformed cells described in Section 6 above using known methods, collecting the protein from the culture, and purifying it. The term "culture" refers to both the culture supernatant, cultured cells, and cell lysates. It should be noted that the foreign protein that can be produced using the transformed cells described in Section 6 can be not only monomeric proteins but also multimeric proteins. To produce a heteromultimeric protein composed of multiple different subunits, multiple genes encoding these subunits must be introduced into the host cells described in Section 6. The transformed cells can be cultured according to a conventional method used for culturing the host cells. When the transformed cells are mammalian cells, they can be cultured, for example, at 37°C under 5% or 8% CO2 conditions for a culture time of approximately 24 to 1,000 hours. Culture can be performed by batch culture, fed-batch culture, perfusion culture, or continuous culture under static, shaking, stirring, or aeration. Fed-batch culture is preferred. The period for which the transformed cells are cultured in a fed-batch culture may be from 3 to 20 days, more preferably from 5 to 18 days, and particularly preferably from 6 to 15 days. The expression product of the foreign protein gene from the culture (culture solution) can be confirmed by SDS-PAGE, Western analysis, ELISA, or the like.

[0057] 8. Method for Producing Antibody Proteins Examples of heteromultimeric proteins produced using the production method described in Section 7 above include antibody proteins. Antibody proteins are tetrameric proteins consisting of two heavy chain polypeptide molecules and two light chain polypeptide molecules. Therefore, to obtain antibody proteins in a form that maintains antigen-binding ability, both heavy and light chain genes must be introduced into the transformed cells described in Section 6 above. In this case, the heavy and light chain gene expression units may be present on the same expression vector or on different expression vectors. If present on the same expression vector, they may be present in the order of light chain gene expression unit and heavy chain gene expression unit, based on the gene reading direction, or preferably in the order of DNA element, light chain gene expression unit, and heavy chain gene expression unit. Furthermore, it is more preferable that a selection marker is included after the DNA element, light chain gene expression unit, and heavy chain gene expression unit. Antibodies produced in the present invention include antibodies produced by immunizing laboratory animals such as rabbits, mice, and rats with a desired antigen. Chimeric antibodies and humanized antibodies made from the above-mentioned antibodies are also examples of antibodies produced in the present invention. Furthermore, human antibodies obtained from genetically modified animals or by phage display methods are also included in the antibodies produced in the present invention. The antibody gene used to produce the antibody is not limited to an antibody gene having a specific polynucleotide sequence, as long as the combination of heavy and light chain polypeptides transcribed and translated from the antibody gene retains the activity of binding to any antigen protein. Furthermore, the antibody gene does not necessarily have to encode the full-length antibody molecule; genes encoding antigen-binding fragments of the antibody can also be used. Genes encoding these antigen-binding fragments can be obtained by genetically modifying a gene encoding the full-length antibody protein molecule.

[0058] 9. Methods for Producing Other Foreign Proteins Examples of foreign proteins that can be produced by the production method of the present invention include, in addition to the antibodies described above, various proteins derived from humans or non-human animals, their antigen-binding fragments, and modified forms thereof. Examples of such proteins include peptide hormones such as atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), C-type natriuretic peptide (CNP), vasopressin, somatostatin, growth hormone (GH), insulin, oxytocin, ghrelin, leptin, adiponectin, renin, calcitonin, osteoprotegerin, and insulin-like growth factor (IGF), interleukins, chemokines, interferons, tumor necrosis factors (TNFα / β) and other TNF-stimulating factors (TNF-α / β), and the like. Examples of the protein include, but are not limited to, the following: neurotrophic factors (neuronal growth factors, etc.), nerve growth factor (NGF), cell growth factors (EGF, FGF, PDGF, HGF, TGF, etc.), hematopoietic factors (CSF, G-CSF, erythropoietin, etc.), cytokines such as adipokines, receptors such as TNF receptor, enzymes such as lysozyme, proteases, proteinases, peptidases, functional fragments thereof (fragments that retain some or all of the biological activity of the original protein), and fusion proteins comprising these proteins.

[0059] The present invention will be specifically described below using examples. However, these examples are not intended to limit the technical scope of the present invention in any way. Plasmids, restriction enzymes, DNA modifying enzymes, etc. used in the examples of the present invention are commercially available and can be used according to standard methods. Furthermore, the procedures used for DNA cloning, polynucleotide sequence determination, host cell transformation, transformed cell culture, protein collection and purification from the resulting culture, etc. are well known to those skilled in the art or can be found in the literature.

[0060] (Example 1) Cloning of the promoter region of the Eno1 gene The promoter region of Eno1 was determined based on the mRNA sequence registered in GenBank under XM_027398299.1 and the scaffold sequence of the Chinese hamster genome registered under NC_048595.1. The sequence used was from the nucleotide approximately 3.0 kbp upstream of the start codon sequence of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon sequence.

[0061] The promoter region of the Eno1 gene was amplified by PCR using the genomic DNA of CHO cells as a template and the primer set shown below and PrimeSTAR Max DNA Polymerase (Takara Bio), and purified with a QIAquick PCR Purification kit (QIAGEN). The nucleotide sequence of the promoter region of the cloned Chinese hamster Eno1 gene is shown in SEQ ID NO: 1 in the Sequence Listing.

[0062] Primer set for Eno1 gene promoter K24 (Fw): TTCGCGGCCGCGGCACGCAGCGCGCAGG (SEQ ID NO: 8) K25 (Rev): TTCACTAGTTGTCTGTAGGGGAAAAAAAAAAAAAAC (SEQ ID NO: 9)

[0063] (Example 2) Evaluation of Chinese hamster-derived Eno1 gene promoter by fed-batch culture using antibody expression level as an index (2-1) Construction of antibody expression vector An antibody expression vector, pDSLH3.1-Eno1-Y, was constructed by replacing the nucleotide sequence corresponding to the Hspa5 gene promoter of the humanized antibody gene Y expression vector pDSLH3.1-Hspa5-Y described in Patent Document 4 with the nucleotide sequence of the Chinese hamster-derived Eno1 gene promoter using the DNA fragment amplified and purified in Example 1. A schematic diagram of the vector is shown in Figure 1. The pDSLH3.1-hEF1α-Y described in Patent Document 4 was used as a comparison.

[0064] (2-2) Preparation of a stable pool expressing humanized antibody Y CHO-K1 cells (ATCC) were adapted to enable suspension culture in serum-free medium to obtain host cells CHO-O1 cells. The antibody expression vector pDSLH3.1-Eno1-Y constructed in (2-1) or pDSLH3.1-hEF1α-Y described in Patent Document 4 was transfected into CHO-O1 cells using a gene transfection device Neon Transfection System (Invitrogen), and the cells were cultured in a T-25 flask at 5% CO and 37°C. One day after gene transfection, Geneticin (Life Technologies Corporation) was added to a final concentration of 800 μg / mL, and the cells were cultured for one week under drug selection. Thereafter, the cells were cultured in a 125 mL Erlenmeyer flask at 37°C in 5% CO 2 to prepare stable pools expressing humanized antibody Y (two pools for each vector).

[0065] (2-3) Evaluation of antibody production yield by fed-batch culture of humanized antibody Y-expressing stable pool. The humanized antibody Y-expressing stable pool prepared in (2-2) was subjected to fed-batch culture in a 125 mL Erlenmeyer flask for 14 days. The culture conditions were an initial seeding density of 0.3 x 10 ６ The culture medium was G13 (custom medium manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) as the basal medium and F13 (custom medium manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) as the feed medium. 3% (v / v) of the initial culture medium volume was added daily from day 3 of culture until day 13. Sampling was performed on days 7, 10, and 14, and the viable cell density, antibody production, etc. were measured.

[0066] The time courses of viable cell count and antibody production are shown in Figure 2-A and Figure 2-B, respectively. The average antibody production of the two pools prepared for each vector was calculated, and antibody productivity was compared. As a result, on day 14 of culture, the antibody production amount with the Eno1 promoter reached 2.0 times that of the human EF1α promoter, greatly exceeding the antibody production amount with promoters that are currently frequently used.

[0067] Example 3: Examination of Chinese hamster Eno1 gene promoter length using luciferase luminescence intensity during transient expression as an indicator (3-1) Construction of luciferase expression vectors. Firefly-derived luciferase expression vectors were constructed by inserting Eno1 promoters of various lengths into pGL4.10 (Promega). The lengths examined were approximately 5.0 kbp upstream from the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon of the Eno1 gene (SEQ ID NO: 10), approximately 4.5 kbp upstream (SEQ ID NO: 11), approximately 4.0 kbp upstream (SEQ ID NO: 4), approximately 3.5 kbp upstream (SEQ ID NO: 12), approximately 3.0 kbp upstream (SEQ ID NO: 1), approximately 2.8 kbp upstream (SEQ ID NO: 3), approximately 2.7 kbp upstream (SEQ ID NO: 13), approximately 2.6 kbp upstream (SEQ ID NO: 14), and approximately 2.5 kbp upstream (SEQ ID NO: 15).

[0068] (3-2) Evaluation of luciferase luminescence in transient expression CHO-O1 cells were co-transfected with the firefly (Firefly)-derived luciferase expression vector constructed in (3-1) and the control vector pGL4.74 expressing Renilla luciferase using Lipofectamin 2000 CD (Thermo Fisher Scientific). 24 hours after transfection, the cells were centrifuged (1000 rpm, 3 min) and collected in a 1.5 mL tube and washed with PBS buffer. Luciferase luminescence was then measured using a Dual-Luciferase Reporter Assay System (Promega). Gene transfection was performed with N = 2 for each promoter length.

[0069] The promoter activity was determined by dividing the amount of luminescence produced by Firefly luciferase on pGL4.10 by the amount of luminescence produced by Renilla luciferase on pGL4.74 (Figure 3). Table 1 shows the average promoter activity calculated from the promoter activity obtained with N = 2. As a result, when the regions from the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon of the Chinese hamster Eno1 gene to approximately 5.0 kbp upstream of the start codon (SEQ ID NO: 10), approximately 4.5 kbp (SEQ ID NO: 11), approximately 4.0 kbp (SEQ ID NO: 4), and approximately 3.5 kbp (SEQ ID NO: 12) were used, promoter activity was 80% or more of that obtained when the region up to approximately 3.0 kbp (SEQ ID NO: 1) was used. Furthermore, when the region from the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon sequence to 2.8 kbp upstream of the start codon sequence (SEQ ID NO: 3) was used, promoter activity was approximately equivalent to that obtained when the region from the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon sequence to about 2.7 kbp upstream of the start codon sequence (SEQ ID NO: 13) and about 2.6 kbp upstream of the start codon sequence (SEQ ID NO: 14) was used, promoter activity was approximately 50% of that obtained when the region from the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon sequence to about 2.5 kbp upstream of the start codon sequence (SEQ ID NO: 15) was used, promoter activity was approximately 15% of that obtained when the region from the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon sequence to about 3.0 kbp upstream of the start codon sequence (SEQ ID NO: 1) was used. From the above, it was found that the transcription activity of the promoter of the Chinese hamster Eno1 gene was significantly high in a region extending from the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon sequence to approximately 2.8 kbp or more upstream of the start codon sequence. Furthermore, between SEQ ID NO: 3 (Eno1 2.8k) and SEQ ID NO: 13 (Eno1 2.7k), the transcription activity of the promoter was significantly higher for SEQ ID NO: 3 (Eno1 2.8k). This suggests that transcription activity is particularly improved when the promoter has SEQ ID NO: 18 (the differential sequence (100 bp) between SEQ ID NO: 3 (Eno1 2.8k) and SEQ ID NO: 13 (Eno1 2.7k)).

[0070]

[0071] Example 4 Evaluation of Mouse-Derived Eno1 Gene Promoter by Fed-Batch Culture Using Antibody Expression Level as an Indicator (4-1) Construction of Antibody Expression Vectors pDSLH3.1-mEno1-Y, pDSLH3.1-mEno1-3.5-Y, and pDSLH3.1-mEno1-4.0-Y were constructed by replacing the antibody H-chain and L-chain gene promoters of the humanized antibody gene Y expression vector pDSLH3.1-hEF1α-Y with the mouse Eno1 promoter. The mouse-derived Eno1 gene promoter used was the region from the nucleotide immediately preceding the nucleotide sequence corresponding to the Eno1 start codon sequence to approximately 3.0 kbp upstream of the start codon sequence (SEQ ID NO: 2), approximately 3.5 kbp upstream (SEQ ID NO: 17), or approximately 4.0 kbp upstream (SEQ ID NO: 16).

[0072] Similarly, pDSLH3.1-Eno1-4.0-Y, pDSLH3.1-Eno1-3.5-Y, and pDSLH3.1-Eno1-2.8-Y were constructed using the regions from the nucleotide immediately preceding the nucleotide sequence corresponding to the Eno1 start codon sequence of the Chinese hamster-derived Eno1 gene promoter to about 4.0 kbp upstream of the start codon sequence (SEQ ID NO: 4), about 3.5 kbp upstream of the start codon sequence (SEQ ID NO: 12), and about 2.8 kbp upstream of the start codon sequence (SEQ ID NO: 3) as the Eno1 gene promoter.

[0073] (4-2) Preparation of humanized antibody Y-expressing stable pools pDSLH3.1-hEF1α-Y (Patent Document 4), DSLH3.1-Eno1-Y constructed in (2-1), pDSLH3.1-mEno1-Y, pDSLH3.1-mEno1-3.5-Y, pDSLH3.1-mEno1-4.0-Y, pDSLH3.1-Eno1-2.8-Y, pDSLH3.1-Eno1-3.5-Y, and pDSLH3.1-Eno1-4.0-Y constructed in (4-1) were transfected into CHO-O1 cells by the method described in 2-2), followed by drug selection culture, to prepare humanized antibody Y-expressing stable pools (two pools for each vector).

[0074] (4-3) Evaluation of antibody production yield by fed-batch culture of humanized antibody Y-expressing stable pool Fed-batch culture was carried out in a 125 mL Erlenmeyer flask using the humanized antibody Y-expressing stable pool prepared in (4-2). G13 was used as the basal medium and F13 as the feed medium.

[0075] The time courses of viable cell counts and antibody production are shown in Figures 4-A and 4-B, respectively. The average antibody production of the two pools prepared for each vector was calculated, and antibody productivity was compared. As a result, the antibody production at day 14 of culture using the mouse-derived Eno1 gene promoters of 3.0 kbp (mEno1 3k), 3.5 kbp (mEno1 3.5k), and 4.0 kbp (mEno1 4k) was 1.3-fold, 1.8-fold, and 1.9-fold higher, respectively, than that of the human EF1α promoter (hEF1α), significantly exceeding the antibody production achieved with currently widely used promoters. The mouse-derived Eno1 gene promoter was found to have promoter activity equivalent to that of the Chinese hamster-derived Eno1 gene promoter. The Chinese hamster Eno1 gene promoters of 2.8 kbp (Eno1 2.8 kb), 3.0 kbp (Eno1 3 kb), 3.5 kbp (Eno1 3.5 kb), and 4.0 kbp (Eno1 4 kb) achieved antibody production levels 2.7-fold, 2.0-fold, 2.8-fold, and 3.1-fold higher than that of the human EF1α promoter (at day 14 of culture), significantly exceeding those achieved by currently widely used promoters. A comparison of antibody productivity between the mouse Eno1 gene promoter and the Chinese hamster Eno1 gene promoter revealed that the Chinese hamster Eno1 gene promoter was superior.

[0076] Furthermore, the antibody production amount (Qp) per cell per day was calculated using the following formula: Qp = [antibody production amount on day 10] ÷ [cumulative viable cell density on day 10] (The integral of the change in viable cell density over time calculated using the viable cell densities on days 0, 7, and 10 was taken as the "cumulative viable cell density on day 10").

[0077] The Chinese hamster Eno1 gene promoters of 2.8 kbp (Eno1 2.8 kb), 3.0 kbp (Eno1 3 kb), 3.5 kbp (Eno1 3.5 kb), and 4.0 kbp (Eno1 4 kb) were 2.7-, 2.3-, 3.0-, and 3.1-fold higher than the human EF1α promoter, respectively. The mouse Eno1 gene promoters of 3 kbp (mEno1 3 kb), 3.5 kbp (mEno1 3.5 kb), and 4 kb (mEno1 4 kb) were 1.9-, 2.2-, and 2.4-fold higher than the human EF1α promoter, respectively. The Chinese hamster Eno1 gene promoter was also superior to the mouse Eno1 gene promoter in terms of antibody production per cell (Qp).

[0078] (Example 5) Examination of the effect of combining Eno1 gene promoters derived from various biological species with A7, using the amount of antibody expression in fed-batch culture as an indicator (5-1) Construction of antibody expression vectors pDSLH3.1-Eno1-Y constructed in (2-1), pDSLH3.1-Eno1-3.5-Y, pDSLH3.1-Eno1-2.8-Y, pDSLH3.1-mEno1-Y, pDSLH3.1-mEno1-3.5-Y, pDSLH3.1-mEno1-4.0-Y, and pDSLH3.1-Eno1-4.0-Y were used as parent vectors, and antibody expression vectors were constructed by inserting the DNA element A7 (SEQ ID NO: 6) upstream of the expression cassettes in the same manner as in Patent Document 5.

[0079] (5-2) Preparation of humanized antibody Y-expressing stable pools The parent vector and antibody expression vector A7 were transfected into CHO-O1 cells by the method described in (2-2), followed by drug selection culture to prepare humanized antibody Y-expressing stable pools (two pools for each vector).

[0080] 5-3) Evaluation of antibody production yield by fed-batch culture of humanized antibody Y-expressing stable pool. The humanized antibody Y-expressing stable pool prepared in (5-2) was cultured in a 125 mL Erlenmeyer flask. G13 was used as the basal medium, and F13 was used as the feed medium. The time courses of viable cell count and antibody production are shown in Figures 5A and 5B, respectively. The average antibody production yields of the two pools prepared for each vector were calculated, and antibody productivity was compared. On day 14 of culture, antibody production yields using antibody expression vectors containing A7 were 1.7 to 5.4 times higher than those of antibody expression vectors not containing A7. These results demonstrate that antibody productivity is significantly improved when DNA element A7 is used in combination with either the Chinese hamster-derived or mouse-derived Eno1 gene promoter.

[0081] SEQ ID NO: 1: Promoter of the Chinese hamster-derived Eno1 gene. A nucleotide sequence consisting of nucleotides from about 3.0 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. SEQ ID NO: 2: Promoter of the mouse-derived Eno1 gene. A nucleotide sequence consisting of nucleotides from about 3.0 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. SEQ ID NO: 3: Promoter of the Chinese hamster-derived Eno1 gene. A nucleotide sequence consisting of nucleotides from about 2.8 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. SEQ ID NO: 4: Promoter of the Chinese hamster-derived Eno1 gene. A nucleotide sequence consisting of nucleotides from about 4.0 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. SEQ ID NO: 5: Nucleotide sequence of DNA element A2. SEQ ID NO: 6: Nucleotide sequence of DNA element A7. SEQ ID NO: 7: Nucleotide sequence of DNA element A18. SEQ ID NO: 8: Eno1 gene promoter primer K24 SEQ ID NO: 9: Eno1 gene promoter primer K25 SEQ ID NO: 10: Chinese hamster-derived Eno1 gene promoter A nucleotide sequence consisting of nucleotides from about 5.0 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon SEQ ID NO: 11: Chinese hamster-derived Eno1 gene promoter A nucleotide sequence consisting of nucleotides from about 4.5 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon SEQ ID NO: 12: Chinese hamster-derived Eno1 gene promoter A nucleotide sequence consisting of nucleotides from about 3.5 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codonSEQ ID NO: 13: Promoter of Chinese hamster-derived Eno1 gene A nucleotide sequence consisting of nucleotides from about 2.7 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon SEQ ID NO: 14: Promoter of Chinese hamster-derived Eno1 gene A nucleotide sequence consisting of nucleotides from about 2.6 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon SEQ ID NO: 15: Promoter of Chinese hamster-derived Eno1 gene A nucleotide sequence consisting of nucleotides from about 2.5 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon SEQ ID NO: 16: Promoter of mouse-derived Eno1 gene A nucleotide sequence consisting of nucleotides from about 4.0 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon SEQ ID NO: 17: Promoter of mouse-derived Eno1 gene Nucleotide sequence consisting of nucleotides from approximately 3.5 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. SEQ ID NO: 18: differential sequence between SEQ ID NO: 3 (Eno1 2.8 kbp) and SEQ ID NO: 13 (Eno1 2.7 kbp)

Claims

1. It is a promoter of a gene derived from the Chinese hamster, Selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, or A nucleotide sequence having at least 85% sequence identity with those sequences, or a partial sequence of said nucleotide sequence, Polynucleotide.

2. Selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, or A nucleotide sequence having at least 85% sequence identity with those sequences, or a partial sequence of said nucleotide sequence, The polynucleotide according to claim 1.

3. The polynucleotide according to claim 1, comprising a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of Sequence ID No.

1.

4. The polynucleotide according to claim 1, comprising a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of Sequence ID No.

3.

5. The polynucleotide according to claim 1, comprising a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of Sequence ID No.

4.

6. The polynucleotide according to claim 1, comprising a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of sequence number 10.

7. The polynucleotide according to claim 1, comprising a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of sequence number 11.

8. The polynucleotide according to claim 1, comprising a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of sequence number 12.

9. The polynucleotide according to claim 1, comprising a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of sequence number 13.

10. The polynucleotide according to claim 1, comprising a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of sequence number 14.

11. A promoter of a mouse-derived gene, Selected from sequence number 2, sequence number 17, and sequence number 16, or A nucleotide sequence having at least 85% sequence identity with those sequences, or a partial sequence of said nucleotide sequence, Polynucleotide.

12. The polynucleotide according to claim 11, comprising a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of Sequence ID No.

2.

13. The polynucleotide according to claim 11, comprising a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of sequence number 17.

14. The polynucleotide according to claim 11, comprising a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of sequence number 16.

15. A nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 2, SEQ ID NO: 17, or SEQ ID NO: 16 as described in claim 1 or 11, or comprising a subsequence of said nucleotide sequence, Having promoter activity, Polynucleotide.

16. A nucleotide sequence having 95% or more sequence identity with the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 2, SEQ ID NO: 17, or SEQ ID NO: 16 as described in claim 1 or 11, or comprising a subsequence of said nucleotide sequence, Having promoter activity, Polynucleotide.

17. A polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 2, SEQ ID NO: 17, or SEQ ID NO: 16 as described in claim 1 or 11, and which has promoter activity.

18. The polynucleotide according to claim 17, comprising a promoter of a gene derived from a Chinese hamster, the nucleotide sequence of Sequence ID No. 18, or a nucleotide sequence having at least 85% sequence identity with said sequence.

19. An exogenous gene expression unit comprising a polynucleotide and an exogenous gene according to any one of claims 1 to 18.

20. The foreign gene expression unit according to claim 19, wherein the foreign gene is a gene that codes for a protein.

21. The foreign gene expression unit according to claim 20, wherein the foreign gene is a gene that encodes a heteromultimeric protein.

22. The foreign gene expression unit according to claim 21, wherein the foreign gene is a gene encoding an antibody or an antigen-binding fragment thereof.

23. An exogenous gene expression vector comprising the exogenous gene expression unit described in claim 19.

24. The foreign gene expression unit according to claim 19, An exogenous gene expression vector containing one or more polynucleotides selected from (a) to (e) below; (a) The nucleotide sequence of Sequence ID No. 5, or a partial sequence thereof, (b) The nucleotide sequence of Sequence ID No. 6, or a partial sequence thereof, (c) The nucleotide sequence of Sequence ID No. 7, or a partial sequence thereof, (d) A polynucleotide having 80% or more sequence identity with the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, or a partial sequence of said nucleotide sequence, and having exogenous gene expression enhancement activity. (e) A polynucleotide comprising a nucleotide sequence having 85% or more sequence identity with the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, or a partial sequence of said nucleotide sequence, and having exogenous gene expression-enhancing activity.

25. Transformed cells into which the foreign gene expression vector according to claim 23 has been introduced.

26. The transformed cells according to claim 25, which are cultured cells derived from mammals.

27. The transformed cells according to claim 26, which are COS-1 cells, 293 cells, or CHO cells.

28. A method for producing a protein, characterized by culturing the transformed cells described in claim 25 and obtaining a protein derived from an exogenous gene from the culture.

29. The manufacturing method according to claim 28, wherein the protein derived from the foreign gene is a monomeric protein or a polymeric protein.

30. The method for producing a protein according to claim 29, wherein the polymer protein is a heteropolymer protein.

31. The method for producing an antibody protein according to claim 30, wherein the heteromultimeric protein is an antibody protein.

32. Use of a polynucleotide according to any one of claims 1 to 18 for expressing an exogenous gene in transformed cells.

33. Use of the foreign gene expression vector according to claim 23 for expressing a foreign gene in transformed cells.

34. Transformed cells into which the foreign gene expression vector described in Claim 24 has been introduced.

35. The transformed cells according to claim 34, wherein the cultured cells are derived from mammals.

36. The transformed cell according to claim 35, which is a COS-1 cell, a 293 cell, or a CHO cell.

37. A method for producing a protein, characterized by culturing the transformed cells described in Claim 34 and obtaining a protein derived from an exogenous gene from the culture.

38. The manufacturing method according to claim 37, wherein the protein derived from the foreign gene is a monomeric protein or a polymeric protein.

39. The method for producing the product according to claim 38, wherein the polymer protein is a heteropolymer protein.

40. The method for producing an antibody protein according to claim 39, wherein the heteromultimeric protein is an antibody protein.

41. Use of the foreign gene expression vector according to claim 24 for expressing a foreign gene in transformed cells.