Method for producing umbilical cord-derived mesenchymal cells highly expressing vascular endothelial growth factor, and pharmaceutical composition for treating pulmonary disease

Abstract

The present invention provides: a method for producing umbilical cord-derived mesenchymal cells that highly express a vascular endothelial growth factor, the method comprising a step for culturing an umbilical cord-derived mesenchymal stem cell on a collagen gel; and a pharmaceutical composition that is for treating pulmonary diseases, and that contains, as an active ingredient, the produced umbilical cord-derived mesenchymal cells that highly express a vascular endothelial growth factor.

Description

Method for producing umbilical cord-derived mesenchymal cells that highly express vascular endothelial growth factor, and pharmaceutical composition for treating lung diseases

[0001] The present invention relates to a method for producing umbilical cord-derived mesenchymal cells that highly express vascular endothelial growth factor, and a pharmaceutical composition for treating pulmonary diseases that contains the produced umbilical cord-derived mesenchymal cells as an active ingredient.

[0002] Chronic obstructive pulmonary disease (COPD), formerly known as chronic bronchitis or emphysema, is a progressive pulmonary inflammatory disease primarily caused by airflow obstruction due to smoking and air pollution. COPD is a leading cause of death in Japan and around the world, with a high incidence rate. Pharmacological therapy for COPD is effective in improving symptoms, reducing the risk and severity of exacerbations, maintaining lung function, and improving patients' quality of life; however, there is currently no cure for COPD.

[0003] Non-Patent Document 1 reports that systemic administration of mesenchymal stem cells (MSCs) may be useful in suppressing inflammation in COPD patients. Non-Patent Document 2 discloses the results of administering bone marrow-derived MSCs to COPD patients, reporting a decrease in systemic inflammation and oxidative stress-related biomarkers. Specifically, the inflammation level was most significantly reduced approximately 12 to 24 hours after MSC administration and returned to baseline levels within a few days of MSC administration, suggesting that weekly administration of MSCs is important for clinical benefit.

[0004] Eur Respir J. 2018 Mar 1;51(3):1702369. doi: 10.1183 / 13993003.02369-2017.STEM CELLS Transl Med. 2021; 10: 1470-1481. DOI: 10.1002 / sctm.21-0024

[0005] An objective of the present invention is to provide a method for producing umbilical cord-derived mesenchymal cells that are effective in treating pulmonary diseases and that survive in the lungs for a long period of time, and a pharmaceutical composition for treating pulmonary diseases.

[0006] In order to solve the above-mentioned problems, the present invention encompasses the following inventions: [1] A method for producing umbilical cord-derived mesenchymal cells that highly express vascular endothelial growth factor, comprising the step of culturing umbilical cord-derived mesenchymal stem cells on a collagen gel. [2] The production method according to [1] above, wherein the collagen gel contains laminin α4β1γ1 or laminin α4β1γ1E8 fragment. [3] A method for producing umbilical cord-derived mesenchymal cells that highly express vascular endothelial growth factor, comprising the step of culturing umbilical cord-derived mesenchymal stem cells on a collagen gel. [4] A method for producing umbilical cord-derived mesenchymal cells that highly express vascular endothelial growth factor, wherein the collagen gel contains laminin α4β1γ1 or laminin α4β1γ1E8 fragment at a concentration of 0.1 μg / cm per culture area. 2 ~1.5μg / cm 2 [4] The method according to [1] above, wherein the culture period is 2 to 10 days. [5] A pharmaceutical composition for treating a pulmonary disease, comprising as an active ingredient umbilical cord-derived mesenchymal cells produced by the method according to any one of [1] to [4] above. [6] The pharmaceutical composition according to [5] above, wherein the pulmonary disease is chronic obstructive pulmonary disease, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, interstitial pneumonia, radiation pneumonitis, hypersensitivity pneumonitis, or eosinophilic pneumonia. [7] A pharmaceutical composition for treating a comorbid disease induced by a pulmonary disease, comprising as an active ingredient umbilical cord-derived mesenchymal cells produced by the method according to any one of [1] to [4] above. [8] The pharmaceutical composition according to [7] above, wherein the comorbid disease is cardiovascular disease, diabetes, nutritional disorder, osteoporosis, or skeletal muscle dysfunction. [9] The pharmaceutical composition according to [7], wherein the pulmonary disease is chronic obstructive pulmonary disease, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, interstitial pneumonia, radiation pneumonitis, hypersensitivity pneumonitis, or eosinophilic pneumonia.

[0007] The present invention provides a method for producing umbilical cord-derived mesenchymal cells that are effective in treating pulmonary diseases and that survive in the lungs for a long period of time, and also provides a pharmaceutical composition for treating pulmonary diseases that contains, as an active ingredient, umbilical cord-derived mesenchymal cells produced by the method.

[0008] 3 shows the results of screening for extracellular matrices that enhance gene expression of vascular-related factors in umbilical cord-derived mesenchymal stem cells. This figure shows the results of flow cytometry analysis of the extracellular matrices used to culture umbilical cord-derived mesenchymal stem cells and the changes in expression of angiogenic surface marker proteins. Umbilical cord-derived mesenchymal stem cells cultured on collagen gel, on a mixed gel of collagen and laminin 411E8, or on a non-coated plate were administered to emphysema model mice, and lung tissue specimens were prepared and observed by hematoxylin-eosin staining. This figure shows the results of measuring alveolar wall area using the tissue specimens in FIG. 3 and comparing the average values ​​for each group. Umbilical cord-derived mesenchymal stem cells transfected with luciferase-GFP were cultured on collagen gel, on a mixed gel of collagen and laminin 411E8, or on a non-coated plate, and administered to emphysema model mice. This figure shows the results of preparing lung tissue specimens and observing GFP-positive cells that had engrafted in the lungs. Luciferase-GFP-transfected umbilical cord-derived mesenchymal stem cells were cultured on collagen gel, collagen and laminin 411E8 mixed gel, or uncoated plate, and administered to emphysema model mice. Lung tissue specimens were prepared and immunostained with anti-F4 / 80 antibody (top row). The expression of GFP and CD206 in the recovered lung cells was analyzed by flow cytometry (bottom row). Luciferase-GFP-transfected umbilical cord-derived mesenchymal stem cells were cultured on collagen gel, collagen and laminin 411E8 mixed gel, or uncoated plate, and administered to emphysema model mice. Lung tissue specimens were prepared and immunostained with anti-elastin and anti-α-SMA antibodies (top row), anti-CD34 and anti-CD31 antibodies (middle row), and anti-HO-1 / HMOX1 and anti-SP-C antibodies (bottom row).

[0023] Figure 1 shows the results of flow cytometry analysis of CD11b and CD206 expression in lung cells recovered from luciferase-GFP-transfected umbilical cord-derived mesenchymal stem cells cultured on collagen gel, a mixed gel of collagen and laminin 411E8, or on a non-coated plate, and administered to emphysema model mice (top row). Lung tissue specimens were prepared and immunostained with anti-F4 / 80 and anti-CD206 antibodies (bottom row). Umbilicus-derived mesenchymal stem cells cultured on collagen gel, a mixed gel of collagen and laminin 411E8, or on a non-coated plate were administered to emphysema model mice, bone marrow cells were collected from the tibia, and the cells were induced to differentiate into osteoclasts. These cells were stained with TRAP (tartrate-resistant acid phosphatase) and observed. Figure 2 shows the results of quantitative RT-PCR measurement of IL-6 expression levels in osteoclasts obtained by differentiation induction. FIG. 1 shows the results of administering umbilical cord-derived mesenchymal stem cells cultured on a non-coated plate alone or together with a collagen pseudopeptide or a laminin-derived peptide to a mouse model of emphysema, and then preparing lung tissue specimens and observing them with hematoxylin and eosin staining.

[0009] [Method for producing umbilical cord-derived mesenchymal cells that highly express vascular endothelial growth factor] The present invention provides a method for producing umbilical cord-derived mesenchymal cells that highly express vascular endothelial growth factor (hereinafter referred to as the "production method of the present invention"). The production method of the present invention is characterized by comprising a step of culturing umbilical cord-derived mesenchymal stem cells on a collagen gel.

[0010] Umbilical cord-derived mesenchymal stem cells may be derived from any mammalian source, but human umbilical cord-derived mesenchymal stem cells are preferred. Umbilical cord-derived mesenchymal stem cells can be obtained, for example, from the Umbilical Cord Blood and Cord Bank of the Institute of Medical Science, The University of Tokyo Hospital (IMSUT CORD). Umbilical cord-derived mesenchymal stem cells are highly useful because they can be collected non-invasively, do not express HLA II, and can be transplanted allogeneically (allogeneically), and because banking is underway, a stable supply is possible.

[0011] The method for culturing umbilical cord-derived mesenchymal stem cells on collagen gel is not particularly limited, and any known collagen gel culture method can be used. Examples include the culture methods described in Junpei Enami et al., "Collagen Gel Culture Method (I)," Tissue Culture 13(1), 26-30, 1987, and Junpei Enami et al., "Collagen Gel Culture Method (II)," Tissue Culture 13(2), 64-68, 1987. Collagen gels can be prepared using commercially available reagents or kits. For example, Nitta Gelatin's cell culture collagen (product name: Cell Matrix Type IA) and collagen gel culture kit (kit contents: Cell Matrix Type IA, concentrated culture medium, and reconstitution buffer) can be used. Cell Matrix Type IA is acid-extracted collagen (collagen concentration: 3 mg / mL [pH 3]) derived from porcine tendon and is commercially available as a product optimized for collagen gel culture. Alternatively, Nippi's collagen gel cell culture kit Tri-D (kit contents: collagen reagent, dilution water, 3x concentrated medium) can be used. The collagen reagent in this kit can be selected from bovine dermis-derived type I collagen (acid extracted), bovine dermis-derived type I collagen (pepsin solubilized), and porcine dermis-derived type I collagen (pepsin solubilized), all of which have a collagen concentration of 3 mg / mL.

[0012] The collagen concentration in the collagen gel is not particularly limited. It is preferable to conduct a preliminary test to measure the expression level of vascular endothelial growth factor (VEGF) in cultured umbilical cord-derived mesenchymal stem cells and select the optimal collagen concentration. The collagen concentration may be, for example, 0.5 mg / mL to 3 mg / mL, 0.5 mg / mL to 2.5 mg / mL, or 0.5 mg / mL to 2 mg / mL. Examples of VEGF include, but are not limited to, VEGF (vascular endothelial growth factor), VEGFR1 (vascular endothelial growth factor receptor-1), VEGFR2 (vascular endothelial growth factor receptor-2), and PDGFα (platelet-derived growth factor α). VEGF is preferred.

[0013] The collagen gel used in the manufacturing method of the present invention may contain laminin α4β1γ1 or laminin α4β1γ1E8 fragment. Laminin is a major cell adhesion molecule in basement membranes. It is a heterotrimer consisting of three subunit chains: an α chain, a β chain, and a γ chain. It is a large glycoprotein with a molecular weight of approximately 800,000. The three subunit chains associate at their C-termini to form a coiled-coil structure, stabilizing the heterotrimeric molecule through disulfide bonds. Five types of α chains (α1-α5), three types of β chains (β1-β3), and three types of γ chains (γ1-γ3) are known, and at least 12 isoforms exist that combine these. Laminin α4β1γ1 (laminin 411) is a heterotrimeric molecule consisting of an α4 chain, a β1 chain, and a γ1 chain.

[0014] The laminin E8 fragment is a heterotrimeric fragment obtained by digesting mouse laminin-111 with elastase and has been identified as a fragment with strong cell adhesion activity (Edgar D et al., J. Cell Biol., 105:589-598, 1987). The laminin 411E8 used in the method of the present invention may be any laminin 411 fragment with a similar structure and cell adhesion activity to mouse laminin-111E8. Laminin 411E8 is a trimer formed from a C-terminal fragment of the α4 chain (α4 chain E8) lacking globular domains 4 and 5, a C-terminal fragment of the β1 chain (β1 chain E8), and a C-terminal fragment of the γ1 chain (γ1 chain E8).

[0015] Laminin 411 and laminin 411E8 can be produced by appropriately using known genetic recombination techniques. The nucleotide sequence information of the genes encoding the α4, β1, and γ1 chains that make up laminin 411 from major mammals, as well as the amino acid sequence information of each chain, can be obtained from known databases (e.g., NCBI). Commercially available products can be used for laminin 411 and laminin 411E8. For example, human recombinant laminin 411 manufactured by BioLamina can be used as laminin 411. For laminin 411E8, iMatrix-411 manufactured by Nippi can be used.

[0016] The amount of laminin 411 or laminin 411E8 added to the collagen gel is not particularly limited. For example, the amount is 0.1 μg / cm 2 per culture area of ​​the culture vessel. 2 More than 0.2μg / cm 2 More than 0.3μg / cm 2 More than 0.4μg / cm 2 It may be added so that the concentration is 1.5 μg / cm or more. 2 Below, 1.0μg / cm 2 Below, 0.8μg / cm 2 Below, 0.6μg / cm 2The laminin 411 solution or laminin 411E8 solution may be added so that the thickness is as follows: The laminin 411 solution or laminin 411E8 solution is added to the cooled collagen solution, mixed, dispensed into culture vessels, and heated (e.g., at 25°C to 37°C) to form a gel. The thickness of the gel is not particularly limited and may be, for example, 0.2 mm or more, 0.4 mm or more, 0.6 mm or more, 0.8 mm or more, 1.0 mm or more, 1.5 mm or more, or 2.0 mm or more.

[0017] The medium used is not particularly limited, and can be appropriately selected from known media that can be used to culture umbilical cord-derived mesenchymal stem cells. Examples include Dulbecco's modified Eagle's medium-low glucose (LG-DMEM) supplemented with serum and antibiotics, and α-MEM supplemented with serum and antibiotics. When producing umbilical cord-derived mesenchymal cells for human administration using the production method of the present invention, it is preferable to use a medium that does not contain animal-derived components (xeno-free medium). For example, commercially available xeno-free medium for mesenchymal stem cells, such as R:STEM Medium (Rohto Pharmaceutical), can be suitably used.

[0018] The number of cells to be seeded is not particularly limited and may be increased or decreased as appropriate depending on the size of the culture vessel used. 4 pieces / cm 2 That's it, 1.5 x 10 4 pieces / cm 2 That's it, 2 x 10 4 pieces / cm 2 It may be more than 6 x 10 4 pieces / cm 2 Below, 5 x 10 4 pieces / cm 2 Below, 4 x 10 4 pieces / cm 2 It may be the following:

[0019] The culture period is not particularly limited and may be, for example, 2 to 10 days, or 3 to 7 days. The medium may be changed during the culture period. The frequency of medium change is not particularly limited and may be, for example, once every 3 to 4 days. Cells cultured on collagen gel can be recovered by dissolving the gel with collagenase according to standard methods.

[0020] Since the umbilical cord-derived mesenchymal cells produced by the production method of the present invention are umbilical cord-derived mesenchymal cells that highly express vascular endothelial growth factor, the expression of vascular endothelial growth factor, such as VEGF, may be measured in cells recovered after the completion of the culture period. Furthermore, since the umbilical cord-derived mesenchymal cells produced by the production method of the present invention preferably have stem cell properties, the expression levels of mesenchymal stem cell markers may also be measured. Examples of positive cell surface markers for mesenchymal stem cells include CD73, CD90, and CD105, and examples of negative cell surface markers include CD45, CD34, CD19, and HLA-DR.

[0021] The umbilical cord-derived mesenchymal cells produced by the production method of the present invention can be frozen and stored by suspending them in a medium containing a cryoprotectant according to a standard method, preferably using liquid nitrogen for cryopreservation.

[0022] It has been confirmed that umbilical cord-derived mesenchymal cells produced by the production method of the present invention can engraft in the lung for a longer period of time than umbilical cord-derived mesenchymal cells obtained by culturing on plates coated with extracellular matrix other than collagen gel. More specifically, umbilical cord-derived mesenchymal cells produced by the production method of the present invention can efficiently induce blood vessels, downregulate inflammatory cytokine production, and suppress apoptosis. Furthermore, umbilical cord-derived mesenchymal cells produced by the production method of the present invention can enhance adhesion to alveolar tissue via integrin β1, promote M2 macrophage polarization, and contribute to the repair of collapsed alveolar walls by the formation of smooth muscle fibers.

[0023] [Pharmaceutical Composition] The present invention provides a pharmaceutical composition for treating pulmonary disease, comprising as an active ingredient umbilical cord-derived mesenchymal cells produced by the production method of the present invention. Pulmonary diseases to be treated include, but are not limited to, chronic obstructive pulmonary disease, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, interstitial pneumonia, radiation pneumonitis, hypersensitivity pneumonitis, and eosinophilic pneumonia. Chronic obstructive pulmonary disease is preferred.

[0024] The present invention also provides a pharmaceutical composition for treating comorbidities induced by chronic obstructive pulmonary disease (COPD), comprising as an active ingredient umbilical cord-derived mesenchymal cells produced by the production method of the present invention. Comorbidities induced by COPD include, but are not limited to, cardiovascular disease, diabetes, nutritional disorders, osteoporosis, and skeletal muscle dysfunction. Cardiovascular diseases include, for example, angina pectoris, arrhythmia, and heart failure.

[0025] The umbilical cord-derived mesenchymal cells produced by the production method of the present invention highly express vascular endothelial growth factor and can be engrafted in the lungs for a long period of time, which is advantageous in that they alleviate chronic inflammation over the long term and allow for a longer administration interval compared to the clinical trial described in Non-Patent Document 2. Furthermore, the umbilical cord-derived mesenchymal cells produced by the production method of the present invention are advantageous in that they can promote differentiation into vascular endothelial cells and smooth muscle cells, thereby contributing to a high therapeutic effect.

[0026] Furthermore, the present invention provides a pharmaceutical composition for treating pulmonary diseases, which contains as an active ingredient the following (a), (b), or (c) (hereinafter referred to as "mixtures (a) to (c)"): (a) a mixture of umbilical cord-derived mesenchymal cells and collagen, a collagen-derived peptide, or a collagen pseudo-peptide; (b) a mixture of umbilical cord-derived mesenchymal cells and laminin or a laminin-derived peptide; or (c) a mixture of umbilical cord-derived mesenchymal cells, collagen, a collagen-derived peptide, or a collagen pseudo-peptide, and laminin or a laminin-derived peptide.

[0027] Examples of lung diseases to be treated include diseases similar to those exemplified in the pharmaceutical composition for treating lung diseases containing, as an active ingredient, umbilical cord-derived mesenchymal cells produced by the production method of the present invention, and preferably chronic obstructive pulmonary disease.

[0028] Collagen-derived peptides and collagen pseudo-peptides are not particularly limited as long as they have a repeating sequence of three amino acids, glycine (Gly)-Xaa-Yaa (Xaa and Yaa represent any amino acid). Xaa may be proline, and Yaa may be 4(R)hydroxyproline. Examples of collagen pseudo-peptides include GFOGER peptide (SEQ ID NO: 15), which specifically binds to integrin α2β1.

[0029] The laminin-derived peptide is preferably a peptide that consists of a partial sequence present in laminin and is capable of participating in cell adhesion, such as the YIGSR peptide (SEQ ID NO: 16) present in the laminin β1 chain.

[0030] A pharmaceutical composition containing the mixtures (a) to (c) of the present invention as an active ingredient can stably engraft umbilical cord-derived mesenchymal cells into the alveolar wall, and can therefore exhibit an alveolar wall repair ability equivalent to or superior to that of a pharmaceutical composition for treating pulmonary disease containing umbilical cord-derived mesenchymal cells produced by the production method of the present invention as an active ingredient.

[0031] The pharmaceutical composition of the present invention may be any composition containing, as an active ingredient, umbilical cord-derived mesenchymal cells or mixtures (a) to (c) produced by the production method of the present invention, and a pharmaceutically acceptable vehicle. The pharmaceutical composition of the present invention may be formulated as an injectable preparation, a transplant preparation in the form of a cell mass or sheet structure, or a gel preparation mixed with any biocompatible gel. When formulated as an injectable preparation, the administration method may include, for example, subcutaneous injection, intralymph node injection, intravenous injection, intravenous drip injection, intraperitoneal injection, intrathoracic injection, and local direct injection. When formulated as a transplant preparation or gel preparation, the administration method is preferably local direct administration.

[0032] The pharmaceutical composition of the present invention can be administered to humans and other mammals (e.g., rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.), preferably humans. The dosage of the pharmaceutical composition of the present invention is not particularly limited, as long as it is an amount that provides a therapeutic effect to the subject. The specific dosage can be determined appropriately depending on the dosage form, administration method, purpose of use, age, weight, symptoms, etc. of the patient. When the pharmaceutical composition of the present invention is administered to humans, the single dosage of umbilical cord-derived mesenchymal cells is, for example, 10 4 pcs / kg or more, 10 5 pcs / kg or more, 10 6 It may be more than 10 pieces / kg. 9 pieces / kg or less, 10 8 pieces / kg or less, 10 7 It may be less than 1 / kg.

[0033] The pharmaceutical composition of the present invention can be stored in a frozen state until immediately before use. The frozen storage temperature may be -30°C or below, -40°C or below, -50°C or below, -80°C or below, -90°C or below, -100°C or below, -150°C or below, -180°C or below, or -196°C (liquid nitrogen temperature) or below. When administering the pharmaceutical composition of the present invention, it can be rapidly thawed in warm water (approximately 37°C) and used.

[0034] The present invention further includes the following inventions: A method for treating pulmonary disease, comprising the step of administering to a patient an effective amount of umbilical cord-derived mesenchymal cells produced by the production method of the present invention. Umbilical cord-derived mesenchymal cells produced by the production method of the present invention for use in treating pulmonary disease. Use of umbilical cord-derived mesenchymal cells produced by the production method of the present invention for producing a pharmaceutical composition for treating pulmonary disease. A method for treating comorbidities induced by chronic obstructive pulmonary disease, comprising the step of administering to a patient an effective amount of umbilical cord-derived mesenchymal cells produced by the production method of the present invention. Umbilical cord-derived mesenchymal cells produced by the production method of the present invention for use in treating comorbidities induced by chronic obstructive pulmonary disease. Use of umbilical cord-derived mesenchymal cells produced by the production method of the present invention for producing a pharmaceutical composition for treating comorbidities induced by chronic obstructive pulmonary disease. A method for treating a lung disease, comprising the step of administering to a patient: (a) a mixture of umbilical cord-derived mesenchymal cells and collagen, a collagen-derived peptide, or a collagen pseudo-peptide; (b) a mixture of umbilical cord-derived mesenchymal cells and laminin or a laminin-derived peptide; or (c) a mixture of umbilical cord-derived mesenchymal cells, collagen, a collagen-derived peptide, or a collagen pseudo-peptide, and laminin or a laminin-derived peptide.

[0035] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0036] Example 1: Investigation of extracellular matrix that enhances gene expression of vascular-related factors in umbilical cord-derived mesenchymal stem cells. 1-1 Experimental Method (1) Cells Used. Umbilical cord blood-derived mesenchymal stem cells (hereinafter referred to as "umbilical cord MSCs") were obtained from the Umbilical Cord Blood and Umbilical Cord Bank at the Institute of Medical Science, The University of Tokyo Hospital. The culture medium used was Dulbecco's modified Eagle's medium-low glucose (Sigma-Aldrich, D6046-500ML) supplemented with fetal bovine serum (FBS) (Nichirei, 175012-500ML) and penicillin-streptomycin-amphotericin B (Antibiotic-Antimycotic (100X), Sigma-Aldrich). Umbilical cord MSCs were thawed and passaged 4 to 6 times to obtain highly homogeneous cells.

[0037] (2) Culture Plate and Extracellular Matrix Six-well culture plates (Nunc Cell-Culture Treated Multidishes, 140685) were used for culture. Nitta Gelatin's Cellmatrix Type I-A (collagen concentration: 3 mg / mL [pH 3]) collagen gel was used. According to the "Collagen Gel Culture Method" described on the Nitta Gelatin website (https: / / www.nitta-gelatin.co.jp / ja / product / biomedical / Cellmatrix / cellmatrix.html), A: Cellmatrix Type IA, B: 10x concentrated culture medium (Nitta Gelatin), C: reconstitution buffer (Nitta Gelatin) were prepared. While cooling, A (8 volumes) and B (1 volume) were thoroughly mixed without foaming, and then C (1 volume) was added and mixed. 2 mL of the obtained collagen solution with a collagen concentration of 2.4 mg / mL was added to each well and heated at 37°C for 30 minutes to cause gelation (gel thickness: approximately 2 mm).

[0038] The collagen used for coating was Nitta Gelatin's Cellmatrix Type I-C (collagen concentration: 3 mg / mL [pH 3]). Following Nitta Gelatin's "Collagen Gel Culture Method" described above, Cellmatrix Type I-C was diluted with a 10-fold volume of hydrochloric acid solution (pH 3). One mL of the resulting collagen solution, with a collagen concentration of 0.3 mg / mL, was added to each well and left to stand at room temperature for 1 hour for coating (the coating concentration was approximately 30 μg / cm). 2 ).

[0039] Fibronectin solution (human) (PromoCell, C-43060) was used. It was diluted to 50 μg / mL, resulting in a coating concentration of 5 μg / cm. 2The wells were coated with laminin 211E8, laminin 411E8, and laminin 511E8 in the form of Nippi's iMatrix-211, iMatrix-411, and iMatrix-511 (all Nippi, 0.5 mg / mL). The coating concentration was adjusted to 0.5 μg / cm according to the product instructions. 2 As a control, a non-coated plate was used.

[0040] (3) Cell culture and measurement of gene expression level 1×10 5A cell suspension was prepared at 100 cells / mL and seeded at 2 mL per well. After 3 days of culture, umbilical cord MSCs were harvested. Umbilical cord MSCs cultured on collagen gel were harvested after dissolving the gel with collagenase. Umbilical cord MSCs cultured on other coated and non-coated plates were harvested by detachment with trypsin. RNA was extracted from each harvested umbilical cord MSC according to standard procedures, and cDNA was synthesized using ReverTra Ace qPCR RT Master Mix (Toyobo). The resulting cDNA was subjected to real-time PCR to measure the expression levels of vascular endothelial growth factor (VEGF), vascular endothelial growth factor receptor-1 (VEGFR1), vascular endothelial growth factor receptor-2 (VEGFR2), and platelet-derived growth factor α (PDGFα). The expression level of GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) was measured as an endogenous control. Quantitative RT-PCR was performed using Brilliant III Ultra-Fast SYBR QPCR MasterMix (Agilent #600882) and the AriaMx real-time PCR system (Agilent). The primers used are listed below.hGAPDH Fwd: GGAGTCCACTGGCGTCTTCAC (SEQ ID NO: 1) hGAPDH Rvs: GCTGATGATCTTGAGGCTGTTGTC (SEQ ID NO: 2) hVEGF Fwd: GGCCTTCGCTTACTCTCACC (SEQ ID NO: 3) hVEGF Rvs: CTGTCATGGGCTGCTTCTTC (SEQ ID NO: 4) hVEGFR-1 Fwd: CAGGCCCAGTTTCTGCCATT (SEQ ID NO: 5) hVEGFR-1 Rvs: TTCCAGCTCAGCGTGGTCGTA (SEQ ID NO: 6) hVEGFR-2 Fwd: CCAGCAAAAGCAGGGAGTCTGT (SEQ ID NO: 7) hVEGFR-2 Rvs: TGTCTGTGTCATCGGAGTGATATCCA (SEQ ID NO: 8) hPDGFα Fwd: GCAAGACCAGGACGGTCATTT (SEQ ID NO: 9) hPDGFα Rvs: GGCACTTGACACTGCTCGT (SEQ ID NO: 10).

[0041] 1-2 Results The results are shown in Figure 1. Culturing umbilical cord MSCs on collagen gels showed an approximately 14-fold increase in VEGF expression compared to culturing on non-coated plates. On the other hand, culturing on collagen-coated plates showed an approximately 1.5-fold increase compared to non-coated plates, with no significant increase observed. Umbilical cord MSCs cultured on laminin 411E8-coated plates showed an increase in expression of all genes more than twice that of non-coated plates.

[0042] Example 2: Examination of Extracellular Matrix Used in Umbilical Cord-Derived Mesenchymal Stem Cell Culture and Changes in Expression of Angiogenic Surface Marker Proteins 2-1 Experimental Method (1) Cells, Culture Plates, and Extracellular Matrix The same umbilical cord MSCs and 6-well culture plates were used as in Example 1. The following extracellular matrices were prepared: a collagen-coated plate, a plate coated with a mixture of collagen and laminin 411E8, a plate with collagen gel formed, and a plate with collagen gel containing laminin 411E8 formed. The collagen-coated plate and the collagen gel formed plate were the same as those prepared in Example 1. For the plate coated with a mixture of collagen and laminin 411E8, 9 μl of iMatrix-411 (0.5 mg / mL) was added to 1 mL of collagen solution (Cellmatrix Type I-A, Nitta Gelatin) diluted to a collagen concentration of 0.3 mg / mL, mixed, and added to the wells. The mixture was then left to stand at room temperature for 1 hour to coat the plate. Plates with laminin 411E8-added collagen gel were prepared by adding 9 μl of iMatrix-411 (0.5 mg / mL) to 2 mL of collagen solution (Cellmatrix Type I-A, Nitta Gelatin) diluted to a collagen concentration of 2.4 mg / mL, mixing, adding the mixture to the wells, and incubating at 37°C for 30 minutes to form a gel. Non-coated plates were used as controls.

[0043] (2) Cell culture and cell surface marker protein expression analysis As in Example 1, 1 × 10 5A cell suspension was prepared at 100 cells / mL and seeded at 2 mL / well. After 3 days of culture, the cells were harvested and washed twice with PBS as in Example 1 and subjected to flow cytometry analysis. A FACS Lyric (Becton-Dickinson) flow cytometer was used, and analysis was performed using FlowJo analysis software (Becton-Dickinson). First, mesenchymal stem cell marker CD90-positive / CD73-positive cells were sorted. Anti-human CD73 antibody (PE / Cyanine7 anti-human CD73 (Ecto-5'-nucleotidase) Antibody, BioLegend #344009) and anti-human CD90 antibody (Anti-CD90, Mouse-Mono (Thy-1A1), APC, R&D Systems #FAB2067A) were used. Isotype controls included anti-mouse IgG1 antibody (PE / Cyanine7 Mouse IgG1, κ Isotype Ctrl Antibody, BioLegend #400126) and anti-mouse IgG2A antibody (Mouse IgG2A-APC Isotype Control, R&D Systems #965667). The CD90+ / CD73+ cells were then analyzed for expression of the endothelial progenitor cell marker CD34 and the endothelial cell marker CD31. Anti-human CD34 antibody (CD34 Monoclonal Antibody (4H11), PE, eBioscience #12-0349-42) and anti-human CD31 antibody (Alexa Fluor 488 anti-human CD31 Antibody, BioLegend #303109) were used.

[0044] The results are shown in Figure 2. The upper panel shows the results of flow cytometry analysis of umbilical cord MSCs cultured on each extracellular matrix, stained with anti-CD90 and anti-CD73 antibodies, while the lower panel shows the results of flow cytometry analysis of CD90-positive / CD73-positive cells stained with anti-CD90 and anti-CD73 antibodies. The CD90-positive / CD73-positive cell rates were 86.4% and 87.3%, respectively, when cultured on collagen-coated and collagen + laminin 411E8-coated substrates. However, the CD90-positive / CD73-positive cell rates were significantly higher, at 96.2% and 98.6%, when cultured on collagen gel and collagen + laminin 411E8 gel. Furthermore, the CD31 positivity rates among CD90+ / CD73+ cells were 15.4% and 20.2% when cultured on collagen-coated and collagen + laminin 411E8-coated substrates, respectively, compared with 61.3% and 71.5% when cultured on collagen gel and collagen + laminin 411E8 gel, respectively. Furthermore, the CD31 / CD34 positivity rates among CD90+ / CD73+ cells were 1.2% and 1.6% when cultured on collagen and collagen + laminin 411E8-coated substrates, respectively, compared with 5.6% and 7.5% when cultured on collagen gel and collagen + laminin 411E8 gel, respectively. These results demonstrate that culturing umbilical cord MSCs on collagen gel efficiently generates MSCs with endothelial cell induction potential, and that the addition of laminin 411E8 increases the induction efficiency of MSCs with endothelial cell induction potential.

[0045] Example 3: Therapeutic effect of administration of umbilical cord-derived mesenchymal cells to elastase-induced emphysema model mice 3-1 Experimental method (1) Elastase-induced emphysema model mice 8-9 week-old C57BL / 6 male mice (CLEA Japan) were used. Mice were anesthetized with isoflurane and administered a single dose of 30 μg / 24 μL (physiological saline) of elastase (derived from porcine pancreas, Fujifilm Wako Pure Chemical Corporation #058-05361) intranasally. The mice were maintained for 4 weeks after administration to induce emphysema.

[0046] (2) Preparation and Administration of Umbilical Cord MSCs Umbilical cord MSCs were cultured on collagen gel, collagen and laminin 411E8 mixed gel, or non-coated plate for 3 days, and the cells were collected on the day of administration to mice (see Examples 1 and 2). 6 A cell suspension was prepared at 100 μL per cell and administered to the tail vein of mice. Control animals received 100 μL of PBS via the tail vein (Day 0). Three mice were used per group.

[0047] (3) Lung Tissue Collection and Histological Analysis Mice were euthanized on day 12, and lung tissue was collected. Lung tissue was fixed in 10% neutral buffered formalin (Kanto Chemical), embedded in paraffin according to standard procedures, sliced ​​to a thickness of 5 μm, and stained with hematoxylin and eosin (H&E). The pathology of emphysema was observed under a microscope, and alveolar wall area was measured using ImageJ. Alveolar wall area was measured in 20 fields per mouse.

[0048] 3-2 Results The results are shown in Figures 3 and 4. Figure 3 shows representative H&E-stained images of lungs from each group, with the bottom panel showing an enlarged view of the area in the top panel. Figure 4 is a graph comparing the alveolar wall area of ​​each group. In the PBS group, extensive destruction of the alveolar wall was observed, and numerous alveolar enlargements were observed. Administration of umbilical cord MSCs resulted in the restoration of alveolar structure, with the collagen gel group and collagen + laminin 411E8 gel group showing more significant restoration than the non-coated group. These results demonstrate that administration of umbilical cord MSCs cultured on collagen gel or collagen + laminin 411E8 gel contributes to the restoration of alveolar walls in emphysema model mice.

[0049] Example 4: Evaluation of engraftment of umbilical cord-derived mesenchymal cells administered to elastase-induced emphysema model mice 4-1 Experimental method (1) Administration of umbilical cord MSCs to elastase-induced emphysema model mice Elastase-induced emphysema model mice were prepared in the same manner as in Example 3, except that luciferase-GFP-transfected umbilical cord MSCs (hereinafter referred to as "Luc-hUC") were used as umbilical cord MSCs. Luc-hUCs (3 x 10 cells) cultured for 3 days on collagen gel, a mixed gel of collagen and laminin 411E8, or a non-coated plate were then added to the umbilical cord. 6 The mice were administered 100 μL of PBS into the tail vein. Three mice were used per group.

[0050] (2) Lung Tissue Collection and Immunohistochemical Analysis: Mice were euthanized 24 hours after Luc-hUC administration, and lung tissue was collected. A portion of the lung tissue was used for flow cytometry analysis, while the remaining lung tissue was fixed in 4% paraformaldehyde overnight at 4°C to prepare paraffin blocks. Thin paraffin sections were deparaffinized and stained with DAPI (4',6-diamidino-2-phenylindole) for GFP-positive engrafted cells under a fluorescence microscope. Separately, thin paraffin sections were deparaffinized, antigen-retrieved, blocked at room temperature for 1 hour, and then stained with anti-F4 / 80 antibody (MCA497GA, Bio-Rad).

[0051] (3) Flow cytometry analysis. The percentages of CD206-positive and Luc-GFP-positive cells in lung tissue 24 hours after Luc-hUC administration were analyzed using flow cytometry as follows. (i) After mincing lung tissue, 15 mg / mL collagenase solution was added and enzymatically treated in a warm bath (37°C) for 2 hours with shaking. The resulting tissue lysate was passed through a cell strainer (100 μm nylon mesh filter, Falcon #352360). An equal volume of 2% EDTA-PBS was added to the collected tissue suspension and thoroughly mixed. The mixture was centrifuged at 1500 rpm for 10 minutes, and the supernatant was removed. (ii) The pellet was washed with PBS, and 2% FBS-containing 2 mM EDTA / PBS was added, followed by centrifugation at 1.0 × 10 6A cell suspension was prepared at 100 μL / mL. The resulting cell suspension was dispensed into 5 mL round-bottom tubes (Falcon #352058). (iii) The dispensed cell suspension was centrifuged, and 100 μL of 2% FBS-containing 2 mM EDTA / PBS was added to the resulting cell pellet. Anti-CD206 antibody (Proteintech #18704-1-AP) was then added. (iv) 2% FBS-containing 2 mM EDTA / PBS was added, and the cells were washed by centrifugation. The cells were then suspended in 2% FBS-containing 2 mM EDTA / PBS and passed through a cell strainer (35 μm nylon mesh filter, Corning #352235). (v) The collected cell suspension was analyzed using the All Event 20000 setting on a BD FACSLyri (Becton Dickinson Japan) to calculate the percentage of CD206-positive and Luc-GFP-positive cells.

[0052] 4-2 Results Representative fluorescence microscopic images of cells engrafted in the lung tissue of each group are shown in Figure 5. The administered Luc-hUC was shown to have engrafted in the lung tissue even 24 hours later. The number of engrafted cells increased in the following order: non-coated group < collagen gel group < collagen and laminin 411E8 mixed gel group.

[0053] The results are shown in Figure 6. The top panel shows representative fluorescence microscopy images of each group immunostained with anti-mouse F4 / 80 antibody, and the bottom panel shows the results of flow cytometry analysis. Fluorescence microscopy images demonstrated interactions between the administered Luc-hUC and macrophages (F4 / 80-positive cells). The interaction between Luc-hUC and macrophages (F4 / 80-positive cells) was observed in the following order: non-coated group, collagen gel group, and collagen and laminin 411E8 mixed gel group. Flow cytometry analysis demonstrated that the macrophage characteristics of the collagen gel and collagen and laminin 411E8 mixed gel groups were polarized toward anti-inflammatory macrophages (M2 macrophages, CD206-positive). This suggests that administration of umbilical cord MSCs from the collagen gel and collagen and laminin 411E8 mixed gel groups exerts an anti-inflammatory effect. The polarized change to M2 macrophages was higher in the collagen and laminin 411E8 mixed gel group than in the collagen gel group.

[0054] Example 5: Smooth muscle fiber formation by administration of umbilical cord-derived mesenchymal cells to a mouse model of elastase-induced emphysema 5-1 Experimental method The experiment was performed in the same manner as in Example 4, except that control animals (control group, wild-type mice) that were not administered elastase were included, and lung tissues were collected 12 days (Day 12) after Luc-hUC administration (Day 0). Tissue sections for immunostaining were prepared using the same method. The following primary antibodies were used: anti-elastin antibody (Abcam #ab21610), anti-alpha smooth muscle actin (α-SMA) antibody (Abcam #ab21027), anti-CD34 antibody (Abcam #ab81289), anti-CD31 antibody (LifeSpan BioSciences #LS-C348736), anti-HO-1 / HMOX1 antibody (proteintech #66743-1-IG), and anti-SP-C antibody (Bioss #bs-10067R). The secondary antibodies used were Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 (Invitrogen #A-11031), Donkey Anti-Rabbit IgG H&L (Alexa Fluor 488) (Abcam #ab150073), and Donkey Anti-Goat IgG H&L (Alexa Fluor 594) preadsorbed (Abcam #ab150136). Immunostained specimens were observed under a confocal microscope (LSM710, Carl Zeiss).

[0055] 5-2 Results The results are shown in Figure 7. The top row shows representative images stained with anti-elastin and anti-α-SMA antibodies, the middle row shows representative images stained with anti-CD34 and anti-CD31 antibodies, and the bottom row shows representative images stained with anti-HO-1 / HMOX1 and anti-SP-C antibodies. These results suggest that enhanced antioxidant activity in the collagen gel and collagen + laminin 411E8 gel groups activated elastin and promoted smooth muscle fiber formation in the alveolar wall. Specifically, the top row shows tissue damage in the PBS group, with low expression of the smooth muscle markers elastin and α-SMA. In contrast, both markers were strongly expressed in the collagen gel and collagen + laminin 411E8 gel groups, confirming smooth muscle induction. Similar trends were observed for angiogenesis markers (CD34 and CD31) in each group (middle row). The lower images show that the antioxidant marker HO-1 and the alveolar epithelial marker proSP-C (SP-C) are highly expressed in the lung tissue of the collagen gel and collagen + laminin 411E8 gel groups, suggesting that proSPC-positive type 2 alveolar epithelium is formed in these groups. Furthermore, proSPC and HO-1 are co-expressed (yellow signal) in the collagen gel and collagen + laminin 411E8 gel groups, suggesting that antioxidant activity directly contributed to the formation of type 2 alveolar epithelium. Thus, umbilical cord MSCs cultured on collagen gel and collagen + laminin 411E8 gel contribute to epithelial cell repair and have a therapeutic effect on alveolar damage.

[0056] Example 6: Suppression of alveolar wall collapse by administration of umbilical cord-derived mesenchymal cells to a mouse model of elastase-induced emphysema 6-1 Experimental Method The experiment was performed in the same manner as in Example 5, except that the umbilical cord MSCs used in Example 1 were not transfected with luciferase-GFP. Lung tissue was collected 12 days (Day 12) after umbilical cord MSC administration (Day 0). A portion of the lung tissue was subjected to flow cytometry analysis, and the remaining lung tissue was used to prepare tissue sections for immunostaining. The primary antibodies used were anti-F4 / 80 antibody (Bio-Rad #MCA497GA) and anti-CD206 antibody (Proteintech #18704-1-AP). The secondary antibodies used were Donkey Anti-Mouse IgG H&L (Alexa Fluor 488) (Abcam #ab150105) and Goat Anti-Rabbit IgG H&L (Alexa Fluor 594) preadsorbed (Abcam #ab150084). Flow cytometry analysis was performed using the same procedures as in Example 4, except that the CD206 and CD11b positivity rates were calculated using anti-CD206 antibody (Proteintech #18704-1-AP) and anti-CD11b antibody (BioLegend #101206).

[0057] 6-2 Results The results are shown in Figure 8. The top panel shows the results of flow cytometry analysis, and the bottom panel shows representative fluorescence microscopy images of each group immunostained with anti-F4 / 80 antibody (Bio-Rad #MCA497GA) and anti-CD206 antibody (Proteintech #18704-1-AP). Flow cytometry analysis revealed an overall increase in CD11b expression in all elastase-treated mice (PBS group, uncoated group, collagen gel group, and collagen and laminin 411E8 mixed gel group). However, the expression level of M2 macrophages was elevated in mice treated with umbilical cord MSCs (uncoated group, collagen gel group, and collagen and laminin 411E8 mixed gel group), with the M2 macrophage level being significantly elevated in the collagen and laminin 411E8 mixed gel group. Fluorescence microscopy images showed the accumulation of F4 / 80 and CD206 co-positive M2 macrophages at the tissue repair site in the umbilical MSC-administered group. In particular, the collagen and laminin 411E8 mixed gel group showed a significant accumulation of M2 macrophages.

[0058] Example 7: Inhibition of osteoclast formation by administration of umbilical cord-derived mesenchymal cells to elastase-induced emphysema mouse model 7-1 Experimental method (1) Collection of bone marrow cells from elastase-induced emphysema mouse model administered with umbilical cord MSCs and induction of differentiation into osteoclasts The experiment was performed in the same manner as in Example 3. Mice were euthanized on day 12 and their tibiae were excised. Bone marrow cells were collected from the tibiae and cultured for 3 days in α-MEM (Fujifilm Wako Pure Chemical Industries, Ltd.) supplemented with M-CSF (Macrophage colony stimulating factor) to induce monocyte-macrophage cells. Subsequently, the cells were cultured for 3 days in α-MEM supplemented with RANKL (Receptor activator of NF-κB ligand) to induce differentiation into osteoclasts.

[0059] (2) Morphological Observation of Osteoclasts The osteoclasts obtained in (1) were stained with TRAP (Tartrate-Resistant Acid Phosphatase) and observed under a microscope. TRAP staining was performed according to the method described by Egusa et al. (Egusa, H. et al., Bone (2011) 49(2): 264-274). Cells were washed twice with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde, and incubated in TRAP solution (0.1 M sodium acetate, 0.1 M acetic acid, 10 mg / mL Naphtol AS-MX Phosphate (Sigma), 0.1% Triton X-100, 0.3 M potassium tartrate, 0.3 mg / mL Fast Red Violet LB Salt (Sigma)) at 37°C for 15 minutes.

[0060] (3) Analysis of IL-6 Expression in Osteoclasts RNA was extracted from the osteoclasts obtained in (1) according to standard methods, and cDNA was synthesized using ReverTra Ace qPCR RT Master Mix (product name, Toyobo). The obtained cDNA was subjected to real-time PCR to measure the expression level of IL-6. Quantitative RT-PCR was performed using Brilliant III Ultra-Fast SYBR QPCR MasterMix (Agilent #600882) and the analysis was performed using the AriaMx real-time PCR system (Agilent). The primers used are as follows: mGAPDH Fwd: TTGAGGTCAATGAAGGGGTC (SEQ ID NO: 11); mGAPDH Rvs: TCGTCCCGTAGACAAAATGG (SEQ ID NO: 12); mIL-6 Fwd: CCACTTCACAAGTCGGAGGCTTA (SEQ ID NO: 13); mIL-6 Rvs: GCAAGTGCATCATCGTTGTTCATAC (SEQ ID NO: 14).

[0061] 7-2 Results The results of osteoclast morphology observation using TRAP staining are shown in Figure 9. Abnormal osteoclast morphology due to elastase-induced emphysema was observed in the PBS group, but not in the collagen gel group or collagen + laminin 411E8 gel group. Therefore, administration of umbilical cord MSCs cultured on collagen gel or collagen + laminin 411E8 gel to emphysema patients suggested that the formation of abnormal osteoclasts was suppressed.

[0062] The results of quantitative RT-PCR analysis of IL-6 expression are shown in Figure 10. IL-6 expression was significantly suppressed in the collagen gel and collagen + laminin 411E8 gel groups compared to the PBS group. These results suggest that osteoclast-induced inflammation can be suppressed by administering umbilical cord MSCs cultured on collagen gel or collagen + laminin 411E8 gel to patients with emphysema.

[0063] Emphysema is a systemic inflammation that is known to induce many comorbidities, including osteoporosis. These results demonstrate that administering umbilical cord MSCs cultured on collagen gel or collagen plus laminin 411E8 gel to patients with emphysema can ameliorate emphysema-induced osteoporosis.

[0064] Example 8: Cell characteristics based on gene expression using microarray analysis 8-1 Experimental method (1) Preparation of RNA sample As in Example 1, umbilical cord MSCs were prepared at 1 × 10 5 A cell suspension was prepared to give a cell density of 1 / mL, and the cells were seeded at 2 mL per well in a 6-well culture plate. Three types of culture plates were used: non-coated plates, collagen gel, and collagen + laminin 411E8 gel. After 3 days of culture, umbilical cord MSCs were harvested. Umbilical cord MSCs cultured on collagen gel and collagen + laminin 411E8 gel were harvested by dissolving the gel with collagenase. Umbilical cord MSCs cultured on non-coated plates were harvested by detachment with trypsin. Cell Innovator, Inc. was commissioned to perform RNA extraction and microarray analysis on the harvested cells.

[0065] (2) Microarray Analysis For microarray analysis, a microarray for human gene expression analysis, "SurePrint G3 Human GE Microarray 8x60K v3.0" (Agilent Technology) was used.

[0066] 8-2 Results The analysis results are shown in Table 1. In Table 1, "Noncoat" refers to the non-coated group, "gel" refers to the collagen gel group, "gel-Lam" refers to the collagen + laminin 411E8 gel group, "compare 1" refers to the results of the collagen gel group compared to the non-coated group, "compare 2" refers to the results of the collagen + laminin 411E8 gel group compared to the non-coated group, and "compare 3" refers to the results of the collagen + laminin 411E8 gel group compared to the collagen gel group. The Z score represents the spread of values ​​relative to the mean and can be calculated by subtracting the mean from each value and then dividing by the standard deviation (SD); "ratio" refers to the ratio to the comparison group, and "signal" refers to the signal intensity in each group.

[0067]

[0068] Microarray analysis revealed elevated expression of genes involved in differentiation, cytoskeleton, and immunity in the collagen gel and collagen + laminin 411E8 gel groups (Table 1). Cytoskeletal genes included TUBA1C, TUBA1B, and CFL1, which contribute to cytoskeletal variability, a factor known to have a significant impact on stem cell differentiation. Expression of NFE2L1, which promotes differentiation by regulating oxidative stress through the induction of host defense enzymes, and VIM, which is expressed in mesenchymal cells and promotes differentiation into vascular and cardiomyocytes, were also elevated. Furthermore, immune genes included tumor suppressors TNFAIP3 and NFKBIA, and macrophage-stimulating factor CSF1. These findings suggest that cells grown in the collagen gel and collagen + laminin 411E8 gel groups possess properties that contribute to differentiation, cytoskeleton, and immune regulation.

[0069] Example 9: Therapeutic effect of administering a mixture of umbilical cord-derived mesenchymal cells and collagen pseudopeptides or laminin-derived peptides to elastase-induced emphysema model mice 9-1 Experimental method (1) Preparation of elastase-induced emphysema model mice Eight- to nine-week-old C57BL / 6 male mice were anesthetized in the same manner as in Example 3, and then a single dose of elastase was administered intranasally. The mice were then kept for four weeks to prepare elastase-induced emphysema model mice.

[0070] (2) Preparation and Administration of Umbilical Cord MSCs Umbilical cord MSCs were cultured on non-coated plates for 3 days and then harvested. The harvested umbilical cord MSCs were prepared and administered on the same day. VitroGel COL High Concentration (TheWell Bioscience, TWG009) was used as the collagen-mimetic peptide, and VitroGel YIGSR High Concentration (TheWell Bioscience, TWG008) was used as the laminin-derived peptide. 50 μL of gel containing each peptide was diluted with 120 μL of the included dilution solution (VitroGel Dilution Solution) to a cell count of 3 × 10 6 30 μL of the cell suspension was added to the mixture to prepare a cell concentration of 3 × 10 cells / 200 μL. 200 μL of the prepared mixture was administered into the tail vein of mice. Control animals received 3 × 10 cells / 200 μL. 6 A cell suspension was prepared in PBS at 200 μL per cell and administered into the tail vein on Day 0. Three mice were used per group.

[0071] (2) Collection of Lung Tissues and Histological Analysis The same procedures as in Example 3 were followed up to hematoxylin and eosin (H&E) staining, and the pathological condition of emphysema was observed under a microscope.

[0072] 9-2 Results The results are shown in Figure 11. Figure 11 shows representative H&E-stained images of lungs from each group. The scale bar is 500 μm. Compared to the uncoated group, slight repair of alveolar structure was observed in the collagen pseudopeptide group, while significant repair of alveolar structure was observed in the laminin-derived peptide group. These results demonstrate that the use of umbilical cord MSCs in conjunction with these peptides can contribute to alveolar wall repair in emphysema model mice, and that use in conjunction with laminin-derived peptides in particular can improve alveolar wall repair function.

[0073] The present invention is not limited to the above-described embodiments and examples, and various modifications are possible within the scope of the claims. The technical scope of the present invention also includes embodiments obtained by appropriately combining the technical means disclosed in different embodiments. Furthermore, all academic literature and patent documents described in this specification are incorporated herein by reference.

Claims

1. A method for producing umbilical cord-derived mesenchymal cells that highly express vascular endothelial growth factor, comprising the steps of seeding umbilical cord-derived mesenchymal stem cells on a collagen gel, culturing the umbilical cord-derived mesenchymal stem cells, and recovering the cultured umbilical cord-derived mesenchymal cells.

2. The method of claim 1 , wherein the collagen gel comprises laminin α4β1γ1 or laminin α4β1γ1 E8 fragment.

3. The concentration of laminin α4β1γ1 or laminin α4β1γ1E8 fragment was 0.1 μg / cm ２ ~1.5 μg / cm ２ The method according to claim 2, wherein

4. The method according to claim 1, wherein the culture period is from 2 to 10 days.

5. A pharmaceutical composition for treating a pulmonary disease, comprising umbilical cord-derived mesenchymal cells highly expressing vascular endothelial growth factor, produced by the method according to any one of claims 1 to 4, as an active ingredient.

6. The pharmaceutical composition according to claim 5, wherein the pulmonary disease is chronic obstructive pulmonary disease, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, interstitial pneumonia, radiation pneumonitis, hypersensitivity pneumonitis or eosinophilic pneumonia.

7. A pharmaceutical composition for treating a comorbid disease induced by a lung disease, comprising as an active ingredient umbilical cord-derived mesenchymal cells highly expressing vascular endothelial growth factor, the umbilical cord-derived mesenchymal cells being produced by the method according to any one of claims 1 to 4.

8. The pharmaceutical composition according to claim 7, wherein the comorbidity is cardiovascular disease, diabetes, nutritional disorders, osteoporosis or skeletal muscle dysfunction.

9. The pharmaceutical composition according to claim 7, wherein the pulmonary disease is chronic obstructive pulmonary disease, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, interstitial pneumonia, radiation pneumonitis, hypersensitivity pneumonitis or eosinophilic pneumonia.

10. A pharmaceutical composition for treating pulmonary diseases, comprising the following (a), (b) or (c) as an active ingredient: (a) a mixture of umbilical cord-derived mesenchymal cells and collagen, collagen-derived peptides, or collagen pseudo-peptides; (b) a mixture of umbilical cord-derived mesenchymal cells and laminin or a laminin-derived peptide; or (c) a mixture of umbilical cord-derived mesenchymal cells, collagen, collagen-derived peptides, or collagen pseudo-peptides, and laminin or laminin-derived peptides.