Medicine for treating cancer
Patent Information
- Application Number
- JP2024537246
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Filing Date
- 2024-05-28
- Publication Date
- 2025-06-10
AI Technical Summary
Current radioprotective agents can weaken the therapeutic effect of radiation on cancer cells while trying to reduce side effects on normal cells, and there is a need for a compound that promotes radiation-induced DNA damage in malignant tumor cells while suppressing it in normal cells.
Nicaraben, with both radical scavenger and PARP inhibitory activities, is used to enhance radiation-induced DNA damage in tumor cells while minimizing damage in normal cells by inhibiting DNA repair in tumor cells and scavenging radicals in normal cells.
Nicaraben effectively promotes radiation-induced DNA damage in malignant tumor cells while suppressing radiation-induced DNA damage in normal cells, potentially enhancing cancer treatment efficacy while reducing side effects.
Abstract
Description
Medicines for treating cancer
[0001] The present invention relates to a medicament for treating cancer.
[0002] Radiation therapy, which inhibits the growth or kills malignant tumor (cancer) cells by damaging their DNA, is an effective cancer treatment option. However, because radiation therapy damages the DNA of not only malignant tumor (cancer) cells but also normal cells, research into radioprotectors is also underway. Specifically, development is underway to develop radioprotectors that can reduce the side effects of radiation by scavenging radicals generated by the indirect action of radiation, adding hydrogen, and reducing the oxygen effect.
[0003] However, there is concern that the radioprotective effect may also weaken the therapeutic effect of radiation on malignant tumor (cancer) cells in the first place, and there is a strong desire to develop drugs that promote the therapeutic effect of radiation and suppress side effects.
[0004] JP 6-145057
[0005] Watanabe M, Akiyama N, Sekine H, et al.: Inhibition of poly (ADP-ribose) polymerase as a protective effect of nicaraven in ionizing radiation- and ara-C-induced cell death. Anticancer Res, 2006;26.3421-3428Yoshino Y, Endo S, Chen Z, et al.: Evaluation of site-specific homologous recombination activity of BRCA1 by direct quantitation of gene editing efficiency. Sci Rep, 2019;9.1644Yong Xu, Da Zhai, Shinji Goto, Xu Zhang, Keiichi Jingu andTao-Sheng Li, Nicaraven mitigates radiation-induced lung injury by downregulating the NF-κB and TGF-β / Smad pathways to suppress the inflammatory response. J RadRes, 202263(2). 158-165
[0006] An objective of the present invention is to provide a pharmaceutical agent that suppresses radiation-induced DNA damage in normal cells while promoting radiation-induced DNA damage in malignant tumor (cancer) cells.
[0007] Under these circumstances, the present inventors conducted extensive research and found that, among a wide variety of compounds, nicaraven possesses both radical scavenging activity and PARP inhibitory activity. The present inventors discovered that nicaraven exhibits a radiosensitizing effect in cells with a fast cell cycle (tumor cells) in which radiation-induced DNA damage accumulates due to its PARP inhibitory activity, while its radical scavenging function is more pronounced in cells with a slow cell cycle (normal cells), thereby enabling it to simultaneously promote radiation-induced DNA damage in malignant tumor cells and suppress radiation-induced DNA damage in normal cells. The present invention is based on this novel finding. Accordingly, the present invention provides the following: Item 1. A pharmaceutical having both radical scavenging activity and PARP inhibitory activity, comprising nicaraven as an active ingredient.
[0008] Item 2. A pharmaceutical comprising nicaraven as an active ingredient, which suppresses radiation-induced DNA damage in normal cells through its radical scavenger function, and inhibits the repair of DNA damage in malignant tumor (cancer) cells through its PARP inhibitory effect.
[0009] Item 3. The pharmaceutical agent according to Item 1 or 2, which is used in combination with radiation therapy to treat cancer.
[0010] Item 4. The pharmaceutical agent according to Item 3, which is administered to a subject prior to irradiation.
[0011] Item 5. A method for treating cancer by suppressing radiation-induced DNA damage in normal cells through its radical scavenger function and inhibiting repair of DNA damage in malignant tumor (cancer) cells through its PARP inhibitory effect, comprising the step of administering an effective amount of nicaraven to a subject in need thereof.
[0012] Item 6. The method according to Item 5, comprising the step of irradiating the subject.
[0013] Item 7. The method according to Item 6, wherein nicaraven is administered to the subject prior to radiation exposure.
[0014] Item 8. Nicaraven for use in the treatment of cancer by suppressing radiation-induced DNA damage in normal cells through its radical scavenging function and inhibiting the repair of DNA damage in malignant tumor (cancer) cells through its PARP inhibitory effect.
[0015] Item 9. The use of nicaraven according to Item 8, wherein the cancer treatment is carried out in combination with radiation therapy.
[0016] Item 10. Nicaraven for use according to Item 9, wherein Nicaraven is administered to a subject prior to radiation exposure.
[0017] Item 11. A pharmaceutical composition for use in treating cancer by suppressing radiation-induced DNA damage in normal cells through its radical scavenging function and inhibiting the repair of DNA damage in malignant tumor (cancer) cells through its PARP inhibitory effect, comprising nicaraven and a pharmaceutical carrier.
[0018] Item 12. The pharmaceutical composition for use according to Item 11, wherein the cancer treatment is carried out in combination with radiation therapy.
[0019] Item 13. The pharmaceutical composition for use according to Item 12, wherein nicaraven is administered to a subject prior to irradiation.
[0020] Item 14. Use of nicaraven for producing an agent for treating cancer by suppressing radiation-induced DNA damage in normal cells through its radical scavenger function and inhibiting the repair of DNA damage in malignant tumor (cancer) cells through its PARP inhibitory effect.
[0021] Item 15. The use according to Item 14, wherein the agent is used to treat cancer in combination with radiation.
[0022] Item 16. The use according to Item 15, wherein nicaraven is administered to a subject prior to radiation exposure.
[0023] The pharmaceutical of the present invention can simultaneously suppress radiation-induced DNA damage in normal cells and promote radiation-induced DNA damage in malignant tumor (cancer) cells.
[0024] Previously, there have been separate reports on the use of nicaraven for radiation protection (Patent Document 1) and its PARP inhibitory activity, which is involved in cell death (Non-Patent Document 1). However, generally, the reduction of radiation-induced side effects and the promotion of cell death are contradictory effects. Therefore, it was expected that nicaraven would reduce radiation-induced side effects but also suppress the therapeutic effects of radiation. However, as mentioned above, the present inventors have surprisingly demonstrated that nicaraven can simultaneously exhibit both radical scavenging and PARP inhibitory activity. Specifically, they found that PARP inhibitory activity is stronger in cells with a fast cell cycle (tumor cells) and its radical scavenging function is stronger in cells with a slow cell cycle (normal cells). Therefore, they found that nicaraven simultaneously exhibits the seemingly contradictory effects of suppressing radiation-induced DNA damage in normal cells while promoting radiation-induced DNA damage in tumor cells. Until now, there has been no compound that exhibits PARP inhibitory activity in tumor cells and is expected to function as a radical scavenger to reduce radiation-induced side effects in normal cells. Therefore, such an effect of the present invention could not be predicted from the prior art.
[0025] Although the mechanism by which nicaraven suppresses radiation-induced DNA damage in normal cells while promoting radiation-induced DNA damage in tumor cells is not fully understood, the following is thought to be possible: 1. Nicaraven inhibits the repair of DNA single-strand breaks (SSBs) by inhibiting PARP, which functions in DNA single-strand break repair. SSBs are converted to more severe DNA damage, such as DNA double-strand breaks (DSBs), during DNA replication as the cell cycle progresses. In normal cells, DSBs are repaired by homologous recombination (HR) repair, so PARP inhibition is not fatal. On the other hand, in malignant tumor (cancer) cells with impaired HR repair, DSBs accumulate without being repaired, triggering apoptosis and cell death. Nicaraven also inhibits PARP, which is necessary for NF-κB transcription, and inhibits BCL-2, an apoptosis inhibitor downstream of NF-κB transcription, thereby inducing apoptosis. As mentioned in Section 2.1, SSBs accumulated by PARP inhibition are converted to DSBs during DNA replication, etc., so PARP inhibition increases the number of DSBs in tumor cells with actively progressing cell cycles. Meanwhile, nicaraven's radical scavenging activity is thought to be unaffected by the cell cycle. Therefore, nicaraven exhibits a radiation-protective effect in normal cells with a slow cell cycle, while in malignant tumor (cancer) cells with a fast cell cycle and abnormalities in HR repair activity, its PARP inhibitory effect converts radiation-induced SSBs into more severe DSBs, potentially resulting in radiation sensitization. 3. Radiation activates NF-κB. In addition, malignant tumors have elevated levels of NF-κB, which increases the activity of the NFκB-heparanase pathway, causing cell adhesions to break down, facilitating metastasis. Nicaraven inhibits the activity of NF-κB, thereby suppressing the downstream heparinase enzyme activity, thereby inhibiting metastasis.4. On the other hand, by using the same pathway as in 3, inhibition of NF-κB-heparanase activity suppresses the induction and release of inflammatory signals (TNF-α, IL-6), thereby suppressing inflammation induced by anticancer drugs and radiation.
[0026] In Example 1, the experimental protocol and experimental results for testing the PARP inhibitory activity of nicaraven are shown. In Example 2, the experimental protocol and experimental results for testing the effect of nicaraven treatment on HR activity are shown. In Example 3, the experimental protocol and experimental results for testing the effect of nicaraven treatment on DNA double-strand breaks during the DNA repair process are shown. In Example 4, the experimental protocol and experimental results for testing the effect of nicaraven treatment on IR-induced DNA double-strand breaks are shown. An overview of the method for measuring homologous recombination repair (HR) activity (Assay for site-specific HR activity (ASHRA)) performed in the Examples is shown. In this method, the CRISPR / Cas9 system, which is used in genome editing as a site-specific DNA cleavage enzyme, is used to create site-specific DNA double-strand breaks in the target endogenous gene, and HR occurs between a DNA fragment that serves as an HR substrate containing a reporter and the target endogenous gene, resulting in a fusion gene between the reporter and the target gene. The efficiency of creating this fusion gene between the reporter and the target gene is quantified as the cellular HR repair activity in the cells. Fusion gene detection can be performed using methods such as flow cytometry, Western blotting, and quantitative PCR by modifying the reporter. Step 1: A Cas9 / guide RNA expression vector and a donor vector are introduced into cells. Step 2: The Cas9 / gRNA complex creates a DNA double-strand break specifically in the target gene. Step 3: The DNA double-strand break is repaired by HR using the donor vector as a template, resulting in knock-in of the marker sequence. Step 4: Marker knock-in efficiency is detected ((1) Western blotting, (2) flow cytometry, (3) quantitative PCR). 1. Genomic DNA. 2. Target gene. 3. Guide RNA. 4. Cas9. 5. Donor vector. 6. Marker sequence. 7. Fusion gene of marker and target gene. The experimental protocol and experimental results for testing the PARP inhibitory activity of nicaraven in Example 5 are shown. The experimental protocol and experimental results for testing the PARP inhibitory activity of nicaraven in Example 5 are shown.
[0027] Pharmaceutical for promoting radiation-induced DNA damage in malignant tumor (cancer) cells while suppressing radiation-induced DNA damage in normal cells The present invention provides a pharmaceutical for promoting radiation-induced DNA damage in malignant tumor (cancer) cells while suppressing radiation-induced DNA damage in normal cells, comprising nicaraven as an active ingredient.
[0028] Examples of cancers that can be treated by the medicament of the present invention include skin cancer, mesothelioma, lung cancer, stomach cancer, liver cancer, colon cancer, breast cancer, esophageal cancer, pancreatic cancer, uterine cancer (cervical cancer, endometrial cancer, etc.), ovarian cancer, skin cancer, urinary tract cancer, head and neck cancer, hematopoietic tumors (leukemia, lymphoma, etc.), bone and soft tissue sarcoma, etc.
[0029] In the present invention, nicaraven itself may be used as a medicine, or it may be used as a pharmaceutical composition in combination with various pharmaceutically acceptable carriers (e.g., isotonicity agents, chelating agents, stabilizers, pH adjusters, preservatives, antioxidants, solubilizers, thickeners, etc.).
[0030] Examples of isotonic agents include sugars such as glucose, trehalose, lactose, fructose, mannitol, xylitol, and sorbitol; polyhydric alcohols such as glycerin, polyethylene glycol, and propylene glycol; and inorganic salts such as sodium chloride, potassium chloride, and calcium chloride.
[0031] Examples of chelating agents include edetate salts such as disodium edetate, calcium disodium edetate, trisodium edetate, tetrasodium edetate, and calcium edetate, ethylenediaminetetraacetate, nitrilotriacetic acid or a salt thereof, sodium hexametaphosphate, and citric acid.
[0032] The stabilizer may, for example, be sodium hydrogen sulfite.
[0033] Examples of pH adjusters include acids such as hydrochloric acid, carbonic acid, acetic acid, and citric acid, as well as alkali metal hydroxides such as sodium hydroxide and potassium hydroxide, alkali metal carbonates or hydrogen carbonates such as sodium carbonate, alkali metal acetates such as sodium acetate, alkali metal citrates such as sodium citrate, and bases such as trometamol.
[0034] Examples of preservatives include sorbic acid, potassium sorbate, parahydroxybenzoic acid esters such as methyl parahydroxybenzoate, ethyl parahydroxybenzoate, propyl parahydroxybenzoate, and butyl parahydroxybenzoate, quaternary ammonium salts such as chlorhexidine gluconate, benzalkonium chloride, benzethonium chloride, and cetylpyridinium chloride, alkylpolyaminoethylglycine, chlorobutanol, polyquad, polyhexamethylene biguanide, and chlorhexidine.
[0035] Antioxidants include, for example, sodium bisulfite, dry sodium sulfite, sodium pyrosulfite, concentrated mixed tocopherols, and the like.
[0036] Examples of solubilizing agents include sodium benzoate, glycerin, D-sorbitol, glucose, propylene glycol, hydroxypropylmethylcellulose, polyvinylpyrrolidone, macrogol, D-mannitol, etc., and examples of thickening agents include polyethylene glycol, methylcellulose, ethylcellulose, carmellose sodium, xanthan gum, sodium chondroitin sulfate, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, polyvinyl alcohol, etc.
[0037] Furthermore, the pharmaceutical composition may further contain, in addition to nicaraven, a compound known to have an antitumor effect.
[0038] In an embodiment of the pharmaceutical composition, the content of nicaraben in the composition is not particularly limited and can be appropriately set based on conditions such as, for example, 90% by mass or more, 70% by mass or more, 50% by mass or more, 30% by mass or more, 10% by mass or more, 5% by mass or more, or 1% by mass or more.
[0039] The dosage form is not particularly limited, and examples thereof include various dosage forms such as orally administered agents such as tablets, pills, capsules, powders, granules, syrups, and sublingual agents; and parenterally administered agents such as injections (intravenous injection, intramuscular injection, local injection, intraperitoneal injection, etc.), mouthwashes, infusions, topical agents (ointments, creams, patches, inhalants), and suppositories. Of the above dosage forms, preferred are orally administered agents and injections.
[0040] The content of nicaraben of the present invention in the formulation cannot be generally defined as it varies depending on the route of administration, the age, weight, symptoms, etc. of the patient, but it is sufficient to set the amount so that the daily dose of the compound of the present invention is usually about 10 to 5000 mg, more preferably about 100 to 1000 mg. When administered once a day, this amount needs to be contained in one formulation, and when administered three times a day, one third of this amount needs to be contained in one formulation.
[0041] The pharmaceutical agent of the present invention is administered to patients such as mammals, including humans, monkeys, mice, rats, rabbits, cats, dogs, pigs, cows, horses, and sheep.
[0042] PARP inhibitor for inhibiting PARP in malignant tumor (cancer) cells while suppressing radiation-induced DNA damage in normal cells. The pharmaceutical of the present invention inhibits PARP in malignant tumor (cancer) cells, causing accumulation of DNA damage and a radiation-sensitizing effect while suppressing radiation-induced DNA damage in normal cells. Therefore, in another embodiment, the present invention provides a PARP inhibitor for inhibiting PARP in malignant tumor (cancer) cells while suppressing radiation-induced DNA damage in normal cells, comprising nicaraven as an active ingredient. Poly(ADP-ribose) polymerase (PARP) is a family of proteins involved in many cellular processes, such as DNA repair, genome stability, and programmed cell death. For example, PAR polymerase 1 (PARP1) binds to damaged sites in DNA and repairs DNA damage by poly(ADP-ribosyl)ation (adding poly(ADP-ribose)) using NAD as a substrate. Therefore, the PARP inhibitor of the present invention can suppress the growth of or kill malignant tumor (cancer) cells by inhibiting PARP. The active ingredient, formulation, dosage, etc. of the PARP inhibitor are the same as those of the medicament of the present invention.
[0043] Specific embodiments of the present invention will be described in detail below using examples, but the present invention is not limited to these examples.
[0044] Test Methods Cell Culture HeLa cells (human cervical cancer cell line) were purchased from ATCC (Manassas, VA, USA). HeLa cells were cultured in DMEM medium (Nissui Pharmaceutical Co., Ltd., Tokyo, Japan) supplemented with 8% fetal bovine serum (FBS) (Biowest Inc., Nuaille, France) and 3% L-glutamine at 37°C in the presence of 5% CO2. KYSE270 and KYSE30 cells (human esophageal squamous cell carcinoma cell lines) were purchased from the JCRB Cell Bank of the National Institutes of Biomedical Innovation, Health and Nutrition (Osaka, Japan). KYSE270 and KYSE30 cells were cultured in a mixture of equal volumes of RPMI1640 and Ham's F12 medium (both Fujifilm Wako Pure Chemical Industries, Osaka, Japan) supplemented with 5% FBS at 37°C in the presence of 5% CO2. Nicaraven stock solution was prepared by dissolving nicaraven in DMEM medium to a final concentration of 40 mM and filter-sterilizing. Olaparib stock solution was prepared by dissolving olaparib (Adooq Bioscience, Irvine, CA, USA) in DMSO (Fujifilm Wako Pure Chemical Industries, Osaka, Japan) to a final concentration of 50 mM. Edaravone stock solution was prepared by dissolving edaravone (Fujifilm Wako Pure Chemical Industries, Osaka, Japan) in DMSO (Fujifilm Wako Pure Chemical Industries, Osaka, Japan) to a final concentration of 100 mM.
[0045] The vectors used to express the plasmid DNA Cas9 and guide RNA were LentiCRISPRv2-ACTB-C1 (Addgene ID: #169796), which expresses guide RNA targeting the ACTB gene, and LentiCRISPRv2-scr (Addgene ID: #169795), which expresses a control guide RNA sequence. The HR donor vector for the ACTB gene was pBS-ACTB-200-GFPfr1 (Addgene ID: #169798).
[0046] BRCA1 siRNA was generated using the BRCA1 3'-UTR (5'-GCUCCUCUCACUCUUCAGUTT-3') as the target sequence (JBioS, Saitama, Japan) and used at 15 nM. RAD51 (hs.Ri.RAD51.13.1) siRNA was purchased from Integrated DNA Technologies (Coralville, IA, USA) and used at 5 nM. Control siRNA was generated using the Silencer™ negative control siRNA template set included with Silencer® Select siRNA (Thermo Fischer Scientific, MO, USA).
[0047] Gene transfection: siRNA was delivered to cells using the TransIT-X2 Dynamic Delivery System (Mirus Bio LLC, Madison, WI, USA), and plasmid DNA was delivered to cells using PEI MAX (Polysciences, Inc, Warrington, PA, USA).
[0048] HeLa cells were seeded at 100 μl per well of a 96-well plate at a concentration of 5000 cells / ml. The following day, siRNA was transfected and olaparib or nicaraven was added. 120 hours after transfection and olaparib addition, the HeLa cells were incubated at 37°C for 1 hour in the presence of 5% CO2 with Presto Blue assay (Thermo-Fisher Scientific, Waltham, MA, USA). Fluorescence was measured using a GloMax® Explorer Multimode Microplate Reader (Promega, Madison, WI, USA) at an excitation wavelength of 520 nm and an emission wavelength of 580–640 nm.
[0049] Western blot: Cells seeded in 3.5 cm dishes were washed with 1x PBS and directly lysed in 1x sodium dodecyl sulfate (SDS) sample buffer (2% SDS, 1% 2-mercaptoethanol [2-ME], 50 mM Tris-HCl [pH 6.8], 12% glycerol, 1% bromophenol blue [BPB]). The cells were then sonicated using a Vibra cell (Sonics & Materials Inc., CT, USA) and heated at 95°C for 5 minutes to obtain whole-cell extracts. Western blots were electrophoresed on 6% and 10% SDS polyacrylamide gels, transferred to PVDF membranes (Millipore Corporation, Darmstadt, Germany) for 1.5 hours, and then blocked with 5% skim milk-PBS for 3–16 hours. After blocking, primary antibodies diluted in 0.5% BSA / TBS-T or Can get signal solution (TOYOBO, Osaka, Japan) were incubated overnight at 4°C. After three 10-minute washes with PBS-T, secondary antibodies diluted in 0.5% BSA / TBS-T were incubated at room temperature for 1–3 hours. After three 10-minute washes with PBS-T, detection was performed using Ez West Lumi plus (ATTO), Immuno® StarLD (FUJIFILM Wako Pure Chemical Co., Osaka, Japan), or ECL solution (10 mM Tris-HCl [pH 8.8], 0.015% H2O2, 0.5 mM 4-(Imidazol-1-yl) phenol, 0.625 mM luminol) on a LAS-4000 mini (GE Healthcare, WI, USA).
[0050] Antibodies Primary antibodies Anti-BRCA1 antibody: Polyclonal antibody raised against amino acids 1528-1863 x3000 Anti-RAD51 antibody N1C2, GTX100469 (Gene Tax, Irvine, CA, USA) x2000 Anti-β-actin antibody 6D1 (Fujifilm Wako purechemicals) x2000 Anti-γ-H2AX antibody JBW301 (Merck, Darmstadt, Germany) x1000 Anti-Histon H3 antibody DAM 1776159 (Merck) x1000 Anti-α-tubulin antibody DM1A (Merck) x5000 The secondary antibody was ImmPRESS Rabbit HRP (MP-7444, Vector Laboratories, CA, USA) or ImmPRESS Mouse HRP (Vector Laboratories) diluted 2000 times.
[0051] Measurement of HR activity: HeLa cells were seeded in 3.5 cm dishes and transfected with siRNA the following day. After 24 hours of culture, LentiCRISPRv2-ACTB-C1 and pBS-ACTB-200-GFPfr1 (ASHRA assay vector) were transfected, and nicaraven was added at the same time. After an additional 48 hours of culture, genomic DNA was purified using the Blood Genomic DNA Extraction Mini Kit (Favorgen, Ping-tung, Taiwan). Genomic quantitative PCR was performed using Go Taq qPCR master mix (Promega, Madison, WI, USA) on a CFX96 Touch Real-time PCR detection system (BioRad, Hercules, CA, USA). Knock-in efficiency was calculated using the △△Ct method. The sequences of the primers for detecting the knock-in allele and the reference allele are shown below. For knock-in allele detection: Forward GTCCTGCTGGAGTTCGTGACCG Reverse GTGCAATCAAAGTCCTCGGC For reference allele detection: Forward AGTTGCGTTACACCCTTTCTTG Reverse GTGCAATCAAAGTCCTCGGC Reference paper: Non-patent document 2.
[0052] Example 1: PARP Inhibitory Activity of Nicaraven (Figure 1) Figure 1A shows the experimental protocol for analyzing cell viability in cells with reduced homologous recombination activity following treatment with nicaraven or olaparib. Control, BRCA1, and RAD51 siRNAs were transfected into HeLa cells, and nicaraven or olaparib was added 24 hours later. Cell viability was measured after 96 hours of culture. Figures 1B and 1C show the results of cell viability measurements. Treatment with nicaraven resulted in a concentration-dependent decrease in cell viability. Suppression of BRCA1 and RAD51, key factors involved in homologous recombination, further reduced cell viability. Since reduced homologous recombination activity inhibits PARP and causes synthetic lethality, this suggests that nicaraven has PARP inhibitory activity. Treatment with olaparib, a PARP inhibitor used as a positive control, also reduced cell viability in cells with BRCA1 and RAD51 suppression compared to the control.
[0053] HeLa cells were transfected with control, BRCA1, or RAD51 siRNA. 48 hours later, whole-cell extracts were prepared and Western blots were performed with anti-BRCA1, anti-RAD51, and anti-β-actin antibodies. The results are shown in Figure 1D. The transfection of BRCA1 and RAD51 siRNAs confirmed the suppression of their expression.
[0054] Example 2: Effect of Nicaraven Treatment on Homologous Recombination Activity (Figure 2) Figure 2A shows the experimental protocol for analyzing the effect of Nicaraven treatment on homologous recombination activity. HeLa cells were transfected with control, BRCA1, and RAD51 siRNA. 24 hours later, a vector for measuring homologous recombination activity was transfected and Nicaraven was added. After 48 hours of culture, DNA was collected and homologous recombination activity was measured. Figure 2B shows the results of the homologous recombination activity assay. Nicaraven treatment did not affect homologous recombination activity in control cells or cells in which BRCA1 and RAD51 expression was suppressed and homologous recombination activity was reduced. Homologous recombination activity was analyzed using the Assay for Site-Specific Homologous Recombination Activity (ASHRA) (Yoshino et al. Scientific Reports 2019, method shown in Figure 5).
[0055] Example 3: Effect of Nicaraven Treatment on DNA Double-Strand Breaks in the DNA Repair Process (Figure 3) Figure 3A shows the experimental protocol for analyzing the effect of Nicaraven treatment on the repair of DNA damage after ionizing radiation (IR). HeLa cells were transfected with control or RAD51 siRNA, and after seeding, Nicaraven was added. 30 minutes later, cells were irradiated with 1.5 Gy X-rays. 2 and 24 hours later, the cells were fixed and immunostained with anti-γ-H2AX antibody. Figure 3B shows representative photographs for each experimental condition. γ-H2AX staining is green. DNA is shown in blue.
[0056] As shown in Figure 3C, γ-H2AX is a marker for DNA double-strand breaks and is observed as nuclear foci by immunohistochemistry. Cells with five or more γ-H2AX nuclear foci were counted, and the percentages were calculated and plotted. Cells with fewer than five, between five and ten, between ten and twenty, and more than twenty γ-H2AX nuclear foci were counted, and the percentages were plotted (Figure 3D). After IR, γ-H2AX nuclear foci were observed in a greater number of cells at 2 hours. After 24 hours, the number of cells with nuclear foci and the number of nuclear foci per cell decreased due to DNA double-strand break repair. Inhibition of RAD51 expression inhibited DNA damage repair. Nicaraven treatment left DNA damage in both the control and RAD51-silenced conditions, but the persistence of DNA damage was more pronounced when RAD51 expression was silenced and homologous recombination repair activity was reduced. This is thought to be due to the PARP inhibitory effect, which led to the formation of more DNA damage. In this example, the measurement of γ-H2AX nuclear foci 24 hours after X-ray irradiation was performed in cells with a fast cell cycle. These results indicate that nicaraven inhibits the repair of DNA damage caused by X-ray irradiation in cells with a fast cell cycle, such as tumor cells, by inhibiting PARP, thereby promoting X-ray-induced DNA damage.
[0057] Example 4: Effect of Nicaraven Treatment on IR-Induced DNA Double-Strand Breaks (Figure 4) Figure 4A shows the experimental protocol for analyzing the effect of Nicaraven treatment on IR-induced DNA double-strand breaks. HeLa cells were seeded with Nicaraven the day after seeding, and 30 minutes later, they were irradiated with 10 Gy of X-rays. Cells were harvested 2 hours later. Cell extracts were prepared and analyzed by Western blotting. Figure 4B shows Western blotting using anti-γ-H2AX, anti-Histon H3, and anti-α-tubulin antibodies. IR increased the amount of γ-H2AX, a marker for DNA double-strand breaks, but this was reduced by Nicaraven treatment. This likely indicates Nicaraven's function as a radical scavenger. In this example, measurements taken 2 hours after X-ray irradiation showed that SSBs were converted to DSBs as the cell cycle progressed, reducing the impact of accumulating DNA damage. This demonstrates Nicaraven's function as a radical scavenger.
[0058] Example 5: PARP Inhibitory Activity of Nicaraven in Esophageal Cancer Cells (Figures 6 and 7) Figure 6A. Experimental protocol for analyzing cell viability in cells with reduced homologous recombination activity following treatment with olaparib, nicaraven, or edaravone. KYSE270 esophageal cancer cells were transfected with control or RAD51 siRNA, and 24 hours later, either olaparib or nicaraven was added. Cell viability was measured after 5 days of culture. Figure 6B. Cell viability measurements in KYSE270 cells. Nicaraven treatment further reduced cell viability by suppressing the expression of RAD51, an important factor in homologous recombination. Reduced homologous recombination activity inhibits PARP and causes synthetic lethality, suggesting that nicaraven has PARP inhibitory activity. Treatment with olaparib, a PARP inhibitor rather than a radical scavenger, used as a positive control also reduced cell viability in RAD51-silenced cells compared to the control. Figure 6C. KYSE270 cells were transfected with control or RAD51 siRNA. After 3 days, whole cell extracts were prepared and Western blots were performed with anti-RAD51 and anti-β-actin antibodies. Suppression of RAD51 expression was confirmed by transfection with RAD51 siRNA. Figure 7. KYSE30 cells were transfected with RAD51 siRNA and then treated with olaparib, nicaraven, or edaravone 24 hours later. Cell viability after nicaraven treatment was analyzed in cells with reduced homologous recombination activity, as described above. As shown in Figure 7, cell viability was also reduced in KYSE30 cells with RAD51 silencing compared to the control.
Claims
1. A malignant tumor cell proliferation inhibitor comprising nicaraven as an active ingredient, the malignant tumor cell proliferation inhibitor being used in combination with a treatment using radiation exposure.
2. A pharmaceutical for promoting DNA damage in malignant tumor cells by radiation therapy, comprising nicaraven as an active ingredient.
3. The agent according to claim 1 or the pharmaceutical according to claim 2, wherein the malignant tumor cells have an abnormality in homologous recombination repair activity.
4. The agent according to claim 1 or the medicament according to claim 2, which is administered to a subject prior to said radiation exposure.