Genome editing method and method for producing genome-edited plant

Abstract

This genome editing method includes a step of shooting fine particles coated with at least one nucleic acid and at least one protein into the stem top of a plant by using a gene gun equipped with a stopping plate, where a value P represented by (Equation 1): P = (A / 2)5×B×104 / C3 is 0.8 to 5,000 or less. In equation 1, A represents the "average particle diameter (μm) of the fine particles", B represents the "gas pressure (psi) of the gene gun", and C represents the "distance (mm) between the stopping plate of the gene gun and the stem top".

Description

Genome editing method and method for producing genome-edited plants

[0001] The present invention relates to a genome editing method and a method for producing a genome-edited plant.

[0002] A method using a gene gun is known as a plant genome editing method.Patent Document 1 describes a plant genome editing method, including the steps of: coating microparticles with at least one type of nucleic acid and / or at least one type of protein; shooting the coated microparticles into the shoot apex of the embryo of a mature seed or the shoot apex of the young shoot of a tuber using a gene gun; growing the shoot apex into which the coated microparticles have been shot to obtain a plant; and selecting a genome-edited plant from the plant.However, a fully satisfactory technology capable of highly efficiently carrying out genome editing in plants has not yet been provided.

[0003] Japanese Patent Application Laid-Open No. 2017-205104

[0004] The present invention aims to solve the above-mentioned problems in the prior art and to achieve the following object: That is, the present invention aims to provide a method for highly efficient genome editing or production of genome-edited plants.

[0005] As a result of intensive research conducted by the present inventors to achieve the above-mentioned object, they have found that a genome editing method that includes a step of shooting microparticles coated with at least one type of nucleic acid and at least one type of protein into the shoot apex of a plant using a gene gun equipped with a stopping plate, in which the value P represented by the following formula 1 is 0.8 to 5,000, or a method for producing a genome-edited plant that includes a step of shooting microparticles coated with at least one type of nucleic acid and at least one type of protein into the shoot apex of a plant using a gene gun equipped with a stopping plate and growing the shoot apex into which the microparticles have been shot, in which the value P represented by the following formula 1 is 0.8 to 5,000, can be provided, which enables highly efficient genome editing or the production of genome-edited plants: P = (A / 2) ５ ×B×10 ４ / C ３... (Equation 1) In equation 1, A represents the "average particle size of the microparticles (μm)", B represents the "gas pressure of the gene gun (psi)", and C represents the "distance between the stopping plate and the shoot apex in the gene gun (mm)".

[0006] The present invention is based on the above findings by the inventors, and provides the following means for solving the above problems: <1> A genome editing method, comprising a step of shooting microparticles coated with at least one type of nucleic acid and at least one type of protein into the apex of a plant using a gene gun equipped with a stopping plate, wherein the value P represented by the following formula 1 is 0.8 or more and 5,000 or less: P = (A / 2) ５ ×B×10 ４ / C ３ ... (Equation 1) In equation 1, A represents the "average particle size of the microparticles (μm)," B represents the "gas pressure of the gene gun (psi)," and C represents the "distance between the stopping plate of the gene gun and the shoot apex (mm)." <2> A method for producing a genome-edited plant, comprising the steps of: shooting microparticles coated with at least one type of nucleic acid and at least one type of protein into the shoot apex of a plant using a gene gun equipped with a stopping plate; and growing the shoot apex into which the microparticles have been shot, wherein the value P represented by the following equation 1 is 0.8 or more and 5,000 or less. P = (A / 2) ５ ×B×10 ４ / C ３ ... (Equation 1) In equation 1, A represents the "average particle size of the microparticles (μm)", B represents the "gas pressure of the gene gun (psi)", and C represents the "distance between the stopping plate and the shoot apex in the gene gun (mm)".

[0007] According to the present invention, the above-mentioned conventional problems can be solved, the above-mentioned object can be achieved, and a method for highly efficient genome editing or production of genome-edited plants can be provided.

[0008] FIG. 1 shows the T ０ FIG. 2 shows an example of an electrophoresis photograph analyzing whether or not target gene mutation was introduced into lower leaves. ０FIG. 3 shows an example of an electrophoresis photograph analyzing whether or not target gene mutations were introduced into upper compound leaves. １ 4 is a schematic diagram for explaining "1. Preparation of donor plasmid used for introduction" in Example 16. FIG. 5 is a schematic diagram for explaining "5. T" in Example 16. １ FIG. 10 shows an example of the results of "Confirmation of gene introduction into target site in next generation plants."

[0009] (Genome Editing Method) The genome editing method includes a step of shooting microparticles coated with at least one type of nucleic acid and at least one type of protein into the apex of a plant using a gene gun equipped with a stopping plate, and the value P represented by the following formula 1 is 0.8 or more and 5,000 or less: P = (A / 2) ５ ×B×10 ４ / C ３ ... (Formula 1) In Formula 1, A represents the "average particle size of the microparticles (μm)", B represents the "gas pressure of the gene gun (psi)", and C represents the "distance between the stopping plate and the shoot apex in the gene gun (mm)". The genome editing method can further include another step A.

[0010] The genome editing method is preferably an in planta genome editing method, which generally does not include a tissue dedifferentiation step (callus formation, adventitious buds, or multiple buds), and involves genome editing of cells at the meristem (adventitious buds and lateral buds) while the plant is still growing.

[0011] Genome editing is part of a technology known as New Breeding Technique (NBT), which involves disrupting genes by cleaving specific genes in the genome and introducing mutations using meganucleases, CRISPR-CAS, etc., or by site-specifically inserting or replacing DNA fragments. Alternatively, an artificial enzyme complex is constructed by removing the nuclease activity from the CRISPR system and adding a deaminase, a deaminase enzyme, and expressing it in cells to efficiently introduce targeted point mutations and modify gene function. This includes, but is not limited to, any technology capable of editing genomes. Using genome editing technology, targeted genes can be disrupted with high efficiency. In the case of gene disruption, only the targeted gene can be disrupted without leaving any traces of genetic recombination, so some countries do not classify it as a recombinant plant. Genome editing also enables efficient site-specific insertion or replacement of DNA fragments by linking fragments homologous to the sequences on both sides of the cleavage sequence to both sides of the DNA fragment to be introduced at that site.

[0012] -At least one type of nucleic acid and at least one type of protein- Genome editing technology is characterized by cleaving genomic DNA using a nuclease or deaminase capable of targeting the cleavage site, or a guide RNA and a nuclease or deaminase, and can be distinguished from conventional transformation methods that do not use such targetable nucleases or deaminase, or a guide RNA and a nuclease or deaminase. Here, "using a nuclease or deaminase, or a guide RNA and a nuclease or deaminase" means that a nuclease protein or a deaminase protein is used as one of the at least one type of protein and introduced into a cell. However, it also means that in addition to the protein, DNA and / or RNA encoding a nuclease gene or a deaminase gene may be used as one of the at least one type of nucleic acid and introduced into a cell to express the nuclease protein or deaminase protein. Regarding guide RNA, RNA may be introduced into cells, or DNA capable of expressing guide RNA may be introduced to express the guide RNA.

[0013] The nuclease or deaminase and guide RNA may be naturally occurring (combined) or non-naturally occurring (combined). In the present invention, expression of two or more gene products may be altered or modified. The guide RNA may comprise a guide sequence fused to a tracr sequence.

[0014] The lower limit of the length (number of bases) of the guide RNA is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 15 or more, more preferably 16 or more, even more preferably 17 or more, even more preferably 18 or more, particularly preferably 19 or more, and most preferably 20 or more. The upper limit of the length (number of bases) of the guide RNA is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 30 or less, more preferably 25 or less, even more preferably 22 or less, and particularly preferably 20 or less.

[0015] The nucleic acid may include the guide RNA, DNA capable of expressing the guide RNA, DNA and / or RNA encoding the nuclease gene or deaminase gene, or a gene of interest to be introduced into the genome of the plant.

[0016] The nucleic acid is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include RNA, DNA, a conjugate of RNA and DNA, and a mixture of RNA and DNA. Among these, circular RNA, linear RNA, circular DNA, linear DNA, and the like are preferred. The nucleic acid may be single-stranded or double-stranded. The number of nucleic acids is also not particularly limited and can be appropriately selected depending on the purpose. The nucleic acid may be modified. The modification is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include nuclease resistance modification and modification that improves integration into genomic DNA.

[0017] The length of the nucleic acid is not particularly limited, and any length can be used depending on the method used.

[0018] The nucleic acid may be a vector. The vector is not particularly limited and can be appropriately selected depending on the purpose. Examples of the vector include pAL series (pAL51, pAL156, etc.), pUC series (pUC18, pUC19, pUC9, etc.), pBI series (pBI121, pBI101, pBI221, pBI2113, pBI101.2, etc.), pPZP series, pSMA series, intermediate vector series (pLGV23Neo, pNCAT, etc.), cauliflower mosaic virus (CaMV), bean mosaic virus (BGMV), tobacco mosaic virus (TMV), etc. The vector may also contain the gene of interest.

[0019] The target gene is not particularly limited, as long as its expression or inhibition is desired, and may be an endogenous gene of the target plant or a foreign gene. The foreign gene may be from a different biological species, such as an animal, plant, microorganism, or virus. Examples of such genes include sugar metabolism-related genes, lipid metabolism-related genes, genes related to the production of useful substances (medicines, enzymes, pigments, aromatic components, etc.), genes related to plant growth regulation (promotion / inhibition), genes related to flowering regulation, genes related to disease and pest resistance (resistance to insect feeding, resistance to nematodes, mold (fungi), and bacterial diseases, resistance to viruses (diseases), etc.), genes related to tolerance to environmental stresses (low temperature, high temperature, drought, salt, light damage, ultraviolet light), transporter-related genes, genes related to flour milling properties, bread-making properties, and noodle-making properties, and site-specific nuclease genes. Furthermore, the target gene may be introduced so as to express an antisense strand, a ribozyme, RNAi, or the like, depending on the purpose of gene introduction, in addition to the sense strand.

[0020] In addition to the above, the vector may contain, for example, a promoter, an enhancer, an insulator, an intron, a terminator, a poly A addition signal, a selection marker gene, and the like.

[0021] The target gene and the like may be of multiple types per vector, and the recombinant vectors coated on the microparticles may also be of multiple types per microparticle. For example, a recombinant vector containing the target gene and a recombinant vector containing the selection marker gene may be prepared separately, mixed, coated on microparticles, and then injected into plant tissue.

[0022] The promoter does not have to be derived from a plant, as long as it is DNA that functions in a plant body or plant cells and is constitutively expressed or capable of inducing expression in specific plant tissues or at specific developmental stages. Specific examples include the cauliflower mosaic virus (CaMV) 35S promoter, the El2 35S omega promoter, the nohaline synthase gene promoter (Pnos), the maize ubiquitin promoter, the rice actin promoter, the tobacco PR protein promoter, the ADH promoter, and the RuBisco promoter. Translation efficiency can be increased by using a sequence that enhances translation activity, such as the tobacco mosaic virus omega sequence. Furthermore, proteins can be translated from multiple coding regions by inserting an IRES (internal ribosomal entry site) as a translation initiation region 3'-downstream of the promoter and 5'-upstream of the translation initiation codon.

[0023] The terminator may be any sequence that can terminate transcription of a gene transcribed by the promoter and has a poly A addition signal, and examples thereof include the nopaline synthase (NOS) gene terminator, the octopine synthase (OCS) gene terminator, and the CaMV 35S terminator.

[0024] Examples of the selection marker gene include herbicide resistance genes (bialaphos resistance gene, glyphosate resistance gene (EPSPS), sulfonylurea resistance gene (ALS)), drug resistance genes (tetracycline resistance gene, ampicillin resistance gene, kanamycin resistance gene, hygromycin resistance gene, spectinomycin resistance gene, chloramphenicol resistance gene, neomycin resistance gene, etc.), fluorescent or luminescent reporter genes (luciferase, β-galactosidase, β-glucuronidase (GUS), green fluorescent protein (GFP), etc.), enzyme genes such as neomycin phosphotransferase II (NPTII) and dihydrofolate reductase. However, according to the present invention, it is possible to produce genome-edited plants without introducing a selection marker gene.

[0025] The vector may be a circular plasmid, a linear DNA obtained by cleaving a plasmid with a restriction enzyme or the like, a nucleic acid cassette fragment obtained by excising only the DNA fragment to be introduced, or a DNA fragment to which nucleic acid of 0.1 kb or more and 1.2 kb or less has been added to one or both ends of the cassette fragment. These DNA fragments may also be DNA fragments amplified by PCR. In this case, the added nucleic acid is not particularly limited and may be a sequence derived from the vector, but the sequence of the target site for introduction is more preferred. The lower limit of the length of the nucleic acid to be added to the end of the cassette fragment is preferably 0.05 kb or more, more preferably 0.1 kb or more, and even more preferably 0.2 kb or more. The upper limit of the length of the nucleic acid to be added to the end of the cassette fragment is preferably 1.5 kb or less, more preferably 1.0 kb or less, and even more preferably 0.5 kb or less.

[0026] The protein is not particularly limited and can be appropriately selected depending on the purpose. Examples thereof include site-specific nucleases or deaminases, modifying enzymes, and antibodies.

[0027] The site-specific nuclease is not particularly limited and can be appropriately selected depending on the purpose. Examples thereof include Cas proteins (Cas nucleases) such as Cas9, zinc finger nucleases, proteins that express zinc finger nuclease activity, and TAL effector nucleases (TALENs).

[0028] The Cas protein may contain one or more nuclear localization signals (NLS). The Cas protein is not particularly limited and can be selected appropriately depending on the purpose. A type II CRISPR enzyme is preferred, and a Cas9 protein is more preferred. The Cas9 protein is not particularly limited and can be selected appropriately depending on the purpose. Examples of the Cas9 protein include Streptococcus pneumoniae (S. pneumoniae) Cas9, Streptococcus pyogenes (S. pyogenes) Cas9, and S. thermophilus (S. thermophilus) Cas9. The Cas9 protein may be a mutant Cas9, a Cas9 homolog, or a Cas9 ortholog. The Cas protein may be codon-optimized for expression in eukaryotic cells. The Cas protein may direct cleavage of one or two strands at the target sequence location.

[0029] The molecular weight of the protein is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 300 kDa or less, more preferably 200 kDa or less, and even more preferably 150 kDa or less.

[0030] The number of nucleic acids and proteins to be used is not particularly limited and can be appropriately selected depending on the purpose.

[0031] In addition to the nucleic acids and proteins, the microparticles can also be coated with biomolecules such as polysaccharides, lipids, organelles, metal ions, compounds, and the like.

[0032] - Fine particles - The fine particles are not particularly limited and can be selected appropriately depending on the purpose, and examples thereof include metal fine particles and ceramic fine particles. Among these, metal fine particles are preferred. The metal fine particles are not particularly limited and can be selected appropriately depending on the purpose, and examples thereof include elemental metal fine particles and alloy fine particles. Among these, elemental metal fine particles are preferred. The fine particles may be obtained by aggregating nanoparticles made of a single material or a composite material. The metal is not particularly limited and can be selected appropriately depending on the purpose, and examples thereof include gold, tungsten, and iron oxide, and gold is more preferred.

[0033] The lower limit of the average particle size (diameter) of the fine particles is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 0.3 μm or more, more preferably 0.5 μm or more, even more preferably 0.6 μm or more, even more preferably 0.8 μm or more, and particularly preferably 1.0 μm or more. The upper limit of the average particle size (diameter) of the fine particles is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 10 μm or less, more preferably 5.0 μm or less, even more preferably 4.0 μm or less, even more preferably 3.0 μm or less, particularly preferably 2.0 μm or less, and most preferably 1.8 μm or less. Among these, 0.3 μm to 10 μm is preferred, 0.3 μm to 5.0 μm is more preferred, 0.3 μm to 4.0 μm is even more preferred, 0.3 μm to 3.0 μm is even more preferred, 0.5 μm to 2.0 μm is particularly preferred, and 0.5 μm to 1.8 μm is most preferred. In the present invention, the average particle size of the microparticles refers to the number-average particle size. The average particle size of the microparticles can be measured, for example, by laser diffraction / scattering. Note that the average particle size of the microparticles refers to the average particle size of the microparticles before they are coated with at least one type of nucleic acid and at least one type of protein, i.e., the average particle size of the microparticles themselves.

[0034] The density of the fine particles is not particularly limited and can be appropriately selected depending on the purpose. However, from the viewpoint of high efficiency, it is preferably 5,000 kg / m ３More than 100,000kg / m ３ Preferably, less than 10,000 kg / m ３ More than 50,000kg / m ３ More preferably, 15,000 kg / m or less ３ 25,000kg / m or more ３ The following are particularly preferred:

[0035] The coating method is not particularly limited and can be appropriately selected depending on the purpose. For example, the coating method may be a method of washing and sterilizing the microparticles, and then coating the microparticles, at least one type of nucleic acid and at least one type of protein, CaCl ２ Examples of suitable methods include stirring spermidine using a vortex mixer. Furthermore, when coating microparticles with proteins, amphipathic molecules and basic compounds can be used. Amphipathic molecules (compounds) have a hydrophilic (water-soluble) portion and a hydrophobic (water-insoluble) portion. A hydrophilic group is a chemical residue that prefers water. Examples of hydrophilic groups include, but are not limited to, carbohydrates, polyoxyethylene, peptides, oligonucleotides, and groups containing amines, amides, alkoxyamides, carboxylic acids, sulfur, or hydroxyl groups. Examples of amphipathic molecules (compounds) include, but are not limited to, lipid molecules, liposomes, and lipopolyplexes. Lipopolyplexes may contain, for example, 1,4-bis(3-oleoylamidopropyl)piperazine. The coating may cover the entire surface of the microparticles, or only a portion of the surface.

[0036] The fine particles can be applied as uniformly as possible to the macrocarrier film using a pipette or the like, and then dried in a sterile environment such as a clean bench.

[0037] When the protein-coated microparticles are shot into the microcarrier film, it is preferable to use a hydrophilic macrocarrier film.

[0038] The hydrophilic macrocarrier film is not particularly limited and can be appropriately selected depending on the purpose. A hydrophilic film may be attached to the macrocarrier film, or a hydrophilic coating may be applied. Methods for making the film hydrophilic include methods using surfactants, photocatalysts, and hydrophilic polymers.

[0039] The hydrophilic polymer is not particularly limited and can be appropriately selected depending on the purpose. Examples thereof include polymers of hydrophilic monomers such as polyester, polyethylene glycol, hydroxyethyl methacrylate, hydroxypropyl methacrylate, dihydroxyethyl methacrylate, diethylene glycol methacrylate, triethylene glycol methacrylate, polyethylene glycol methacrylate, vinylpyrrolidone, acrylic acid, acrylamide, dimethylacrylamide, glucoxyoxyethyl methacrylate, 3-sulfopropylmethacryloxyethyldimethylammonium betaine, 2-methacryloyloxyethyl phosphorylcholine, and 1-carboxydimethylmethacryloyloxyethylmethaneammonium.

[0040] The mass of the fine particles (mass per fine particle) is not particularly limited and can be appropriately selected depending on the purpose. －１５ kg or more 3.54×10 －１３ kg or less is preferred.

[0041] -Gene gun- The gene gun (also called particle gun) is not particularly limited as long as it is a gene gun equipped with a stopping plate, and can be appropriately selected depending on the purpose. Commercially available gene guns can be used. Examples of commercially available gene guns include Biolistic (registered trademark) PDS-1000 / He Particle Delivery System (Bio-RAD).

[0042] The macrocarrier film and the plate on which the target shoot apex is placed are placed in a particle gun device (gene gun) equipped with a stopping plate, and high-pressure helium gas is fired from a gas acceleration tube toward the macrocarrier film. The macrocarrier film is stopped by the stopping plate, but the particles pass through the stopping plate and penetrate into the target placed below the stopping plate.

[0043] The gas pressure of the gene gun (the set value of the gas pressure during bombardment) is not particularly limited and can be selected appropriately depending on the purpose. The lower limit of the gas pressure of the gene gun is not particularly limited and can be selected appropriately depending on the purpose, but from the viewpoint of high efficiency, it is preferably 200 psi or more, more preferably 400 psi or more, and particularly preferably 600 psi or more. The upper limit of the gas pressure of the gene gun is not particularly limited and can be selected appropriately depending on the purpose, but from the viewpoint of high efficiency, it is preferably 2,000 psi or less, more preferably 1,900 psi or less, and particularly preferably 1,800 psi or less. Among these, from the viewpoint of high efficiency, it is preferably 200 psi or more and 2,000 psi or less, more preferably 400 psi or more and 1,900 psi or less, and most preferably 600 psi or more and 1,800 psi or less.

[0044] The distance between the stopping plate and the shoot apex in the gene gun is not particularly limited and can be selected appropriately depending on the purpose, for example, from the range of 20 mm to 90 mm. Among these, from the viewpoint of highly efficient implementation, 20 mm to 75 mm is preferred, 25 mm to 60 mm is more preferred, 25 mm to 50 mm is even more preferred, and 25 mm to 45 mm is particularly preferred. In this specification, the distance between the stopping plate and the shoot apex in the gene gun refers to a value determined as follows. The position of the "stopping plate in the gene gun" is the position where the macrocarrier film stops when shot into the shoot apex of the plant, and refers to the surface of the stopping filter on the stopping plate facing the shoot apex or a line extending from the surface. The position of the "shoot apex" refers to the surface of the shoot apex placed on the plate. A perpendicular line is drawn from the surface of the stalk apex to the surface of the stopping filter on the stalk apex side or a line on its extension, and the distance to the position where the perpendicular line intersects with the surface of the stopping filter on the stalk apex side or a line on its extension is defined as the distance between the stopping plate in the gene gun and the stalk apex.

[0045] In the gene gun, the distance between the placement position of the shoot apex and the center of the plate is not particularly limited and can be selected appropriately depending on the purpose. From the viewpoint of highly efficient operation, however, the distance is preferably 3 mm to 15 mm, more preferably 6 mm to 14 mm, and particularly preferably 8 mm to 12 mm.

[0046] The number of times that microparticles are shot into the shoot apex using the gene gun is not particularly limited and can be appropriately selected depending on the purpose, for example, once, twice, three times, four times, etc. In this specification, the "number of times that microparticles are shot into the shoot apex" refers to the number of times that the microparticle-coated macrocarrier film collides with the stopping plate due to gas pressure (the number of times that microparticles are released from the macrocarrier film).

[0047] The lower limit of the amount of microparticles per shot is not particularly limited and can be selected appropriately depending on the purpose, but from the viewpoint of high efficiency, it is preferably 100 μg or more, more preferably 150 μg or more, even more preferably 200 μg or more, and particularly preferably 250 μg or more. The upper limit of the amount of microparticles per shot is not particularly limited and can be selected appropriately depending on the purpose, but from the viewpoint of high efficiency, it is preferably 1,000 μg or less, more preferably 900 μg or less, even more preferably 800 μg or less, and particularly preferably 700 μg or less. Among these, it is preferably 100 μg or more to 1,000 μg or less, more preferably 150 μg or more to 900 μg or less, even more preferably 200 μg or more to 800 μg or less, and even more preferably 250 μg or more to 700 μg or less.

[0048] - Value P - The value P is the fifth power of half the average particle diameter (μm) of the microparticles, the gas pressure (psi) of the gene gun, and 10 ４ This is the value obtained by multiplying ... ５ ×B×10 ４ / C ３ ... (Equation 1) In equation 1, A represents the "average particle size of the microparticles (μm)", B represents the "gas pressure of the gene gun (psi)", and C represents the "distance between the stopping plate and the shoot apex in the gene gun (mm)".

[0049] The average particle size (μm) of the microparticles is the average particle size (μm) of the microparticles themselves. The gas pressure (psi) of the gene gun is the set value (psi) of the gas pressure when shooting into the shoot apex of the plant. The distance (mm) between the stopping plate of the gene gun and the shoot apex is as described above.

[0050] The lower limit of the value P is not particularly limited as long as it is 0.8 or more and can be selected appropriately depending on the purpose, but from the viewpoint of achieving higher efficiency, it is preferably 1 or more, more preferably 3 or more, even more preferably 5 or more, and particularly preferably 10 or more. The upper limit of the value P is not particularly limited as long as it is 5,000 or less and can be selected appropriately depending on the purpose, but from the viewpoint of achieving higher efficiency, it is preferably 4,500 or less, more preferably 800 or less, even more preferably 700 or less, even more preferably 250 or less, particularly preferably 180 or less, and most preferably 150 or less. The range of the value P is not particularly limited as long as it is 0.8 or more and 5,000 or less and can be selected appropriately depending on the purpose, for example, 0.8 or more and 250 or less, more than 250 and 5,000 or less, etc. Furthermore, from the viewpoint of carrying out the process with higher efficiency, the range of the value P is preferably 1 or more and 4,500 or less, more preferably 3 or more and 5,000 or less, even more preferably 4 or more and 800 or less, even more preferably 5 or more and 700 or less, particularly preferably 10 or more and 250 or less, particularly more preferably 10 or more and 180 or less, and most preferably 10 or more and 150 or less.

[0051] The plant is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include angiosperms such as monocotyledonous plants and dicotyledonous plants, gymnosperms, etc. Among these, angiosperms are preferred, and dicotyledonous plants are more preferred, from the viewpoint of highly efficient implementation.

[0052] The monocotyledonous plant is not particularly limited and can be appropriately selected depending on the purpose. Examples thereof include grasses, lilies, Musaceae, Bromeliaceae, and orchids.

[0053] Examples of the Gramineae plants include rice, wheat, barley, corn, oats, turfgrass, sorghum, rye, foxtail millet, and sugarcane. Examples of the Liliaceae plants include leeks and asparagus. Examples of the Musaceae plants include bananas. Examples of the Bromeliaceae plants include pineapples. Examples of the Orchidaceae plants include orchids.

[0054] The dicotyledonous plant is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include Brassicaceae plants, Leguminosae plants, Solanaceae plants, Cucurbitaceae plants, Convolvulaceae plants, Rosaceae plants, Moraceae plants, Malvaceae plants, Asteraceae plants, Amaranthaceae plants, Polygonaceae plants, etc. Among these, from the viewpoint of highly efficient implementation, Leguminosae plants are preferred, Glycine max plants, Phaseolus vulgaris plants, Pisum sativus plants, and Vigna spp. plants are particularly preferred.

[0055] Examples of the Brassicaceae family include Arabidopsis thaliana, Chinese cabbage, rapeseed, cabbage, cauliflower, and Japanese radish. Examples of the Leguminaceae family include soybean, adzuki bean, kidney bean, pea, cowpea, and alfalfa. Among these, soybean is preferred from the viewpoint of high efficiency. Examples of the Solanaceae family include tomato, eggplant, potato, tobacco, and chili pepper. Examples of the Cucurbitaceae family include oriental melon, cucumber, melon, and watermelon. Examples of the Convolvulaceae family include morning glory, sweet potato (sweet potato), and bindweed. Examples of the Rosaceae family include rose, strawberry, and apple. Examples of the Moraceae family include mulberry, fig, and rubber tree. Examples of the Malvaceae family include cotton and kenaf. Examples of the Asteraceae family include lettuce. Examples of the Amaranthaceae family include sugar beet. Examples of the Polygonaceae plant include buckwheat.

[0056] Examples of gymnosperms include pine, cedar, ginkgo, and cycad.

[0057] The shoot apex includes the growing point at the tip of the stem (shoot apical meristem) and tissue consisting of the growing point and several leaf primordia arising from the growing point. In the present invention, only the hemispherical (dome-shaped) growing point from which the leaf primordia have been removed may be used as the shoot apex, or a shoot apex including the growing point and leaf primordia or plant tissue including the shoot apex may be used. Virus-free tissue can be obtained by using only the growing point from which the leaf primordia have been removed.

[0058] The shoot apex is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include the shoot apex of the embryo of a ripe seed, the shoot apex of the embryo of an immature seed, the shoot apex of the rhizome bud, the shoot apex of a lateral bud thereof, the shoot apex of the terminal bud or lateral bud of the plant body, the shoot apex of the terminal bud or lateral bud of the rhizome, etc. When a plant hormone or the like is treated to promote the growth of the shoot apex, the shoot apex is included in the shoot apex as long as a dedifferentiation and redifferentiation process is not performed.

[0059] The seeds include not only natural seeds obtained by cultivating (or culturing) plants under natural or similar conditions, but also artificial seeds, preferably natural seeds. However, if artificial seeds from which genome-editable shoot tips can be obtained are developed, they can also be used. Natural seeds include not only seeds obtained from outdoor fields, but also seeds obtained by greenhouse cultivation and seeds obtained from tissue cultures such as in vitro seedlings. Seeds obtained by direct reprogramming or the like can also be used as seeds of the present invention as long as they can obtain shoot tips.

[0060] "Fully matured seeds" refer to seeds that have completed the maturation process after pollination and are fully matured as seeds. "Immature seeds" refer to seeds that are in the maturation process after pollination. The stage (maturity period) of the immature seeds used in the method of the present invention is not particularly limited, and the seeds may be harvested at any time after pollination. "Embryo" refers to tissues that differentiate into leaves, stems, and roots before germination, and includes the shoot, hypocotyl, and radicle after germination.

[0061] The rhizome is a general term for stems located underground. The rhizome is not particularly limited and can be appropriately selected depending on the purpose, and examples include tubers, corms, and bulbs. The tuber is a tubular rhizome with many buds, the corm is a spherical rhizome with a large terminal bud, and the bulb is a spherical rhizome with enlarged scale leaves attached to a shortened stem. The bud is a bud at the apex of the embryo of a higher plant, and can be identified by the fact that it grows after germination to become an aboveground stem.

[0062] The size of the growing point at the tip of the stem (shoot apical meristem) at the shoot apex is not particularly limited and can be appropriately selected depending on the purpose, but from the viewpoint of high efficiency, the diameter of the growing point at the tip of the stem (shoot apical meristem) is preferably 100 to 500 μm, more preferably 120 to 450 μm, and particularly preferably 140 to 400 μm. Examples of plants whose growing point at the tip of the stem (shoot apical meristem) has a diameter within the above range include dicotyledonous plants. Examples of dicotyledonous plants include legumes such as soybean plants, Phaseolus plants, Pisum plants, and Vigna plants.

[0063] An example (average value) of the size of the growing point (shoot apical meristem) at the tip of the stem is shown below. Note that the size of the growing point (shoot apical meristem) at the tip of the stem varies slightly between individuals, even within the same plant species. [Dicotyledonous plants] (Fabaceae) <Glycine genus> - Soybean (Glycine max) - Osuzu... 324 μm (average value of 12 measured shoot apices) Yukihomare... 317 μm (average value of 10 measured shoot apices) Suzumaru... 279 μm (average value of 12 measured shoot apices) Natto Kozu... 212 μm (average value of 12 measured shoot apices)

[0064] <Phaseolus> - Common bean (Phaseolus vulgaris) - ・ Otebou bean... 287 μm (average value of 12 measured shoot apices)

[0065] <Pisum> - Pea (Pisum sativum) - Large green... 176 μm (average value of 11 measured shoot apices)

[0066] <Vigna> - Adzuki bean (Vigna angularis) - Miyabi: 198 μm (average value of 11 measured shoot apices)

[0067] [Monocotyledonous plants] (Poaceae family) <Zea> -Zea mays- A188... 72 μm (average value of 10 measured shoot apices)

[0068] <Triticum> - Wheat (Triticum aestivum) - Fielder: 104 μm (average value of 10 measured shoot apices)

[0069] The state of the shoot apex is not particularly limited and can be appropriately selected depending on the purpose, but an exposed shoot apex is preferred.

[0070] The shoot apical cells to be bombarded are not particularly limited and can be selected appropriately depending on the purpose, but L2 cells in the L2 layer, the second outer cell layer of the shoot apical meristem, are preferred. The type of cell is not particularly limited and can be selected appropriately depending on the purpose, but shoot apical stem cells, which transition into the germ cell lineage, are preferred. The germ cell lineage is a general term for germ cells ranging from primordial germ cells, which are the source of germ cells, to the final products, egg cells and sperm cells.

[0071] Genome editing is a process of introducing nucleic acids, proteins, etc. into the shoot apex cells, and the nucleic acids may or may not be integrated into chromosomes. Genome-edited cells, genome-edited plants, and genome-edited progeny seeds can be obtained from this process. Genome editing may also be performed by introducing nucleic acids encoding genome editing tools such as zinc finger nucleases, TALENs, and CRISPR-Cas into the shoot apex cells in addition to proteins. Genome editing is a form of transformation. Genome editing efficiency is measured by extracting DNA from cells and / or grown individuals after genome editing treatment and detecting whether genome editing has occurred using PCR, electrophoresis, or Southern blotting. Genome editing efficiency is calculated from the number of shoot apices used in genome editing and the number of genome-edited grown individuals.

[0072] The expression efficiency of a target gene is determined by examining the presence or absence of RNA or protein expressed from the target gene. The presence or absence of RNA can be confirmed, for example, by RT-PCR. Detection may also be performed by Northern blotting. The presence or absence of protein can be confirmed, for example, by staining plant sections, electrophoresis, ELISA, RIA, dot immunohistochemistry, and / or Western blotting. The expression efficiency of a target gene is calculated from the number of shoot apices used in genome editing and the number of grown individuals in which the presence of RNA or protein expressed from the target gene was confirmed.

[0073] <Other Steps A> The other steps A are not particularly limited and can be selected appropriately depending on the purpose. Examples include a step of allowing seeds to absorb water, a step of exposing the shoot apex, a step of bringing the shoot apex into contact with a high osmotic pressure medium, a step of growing the shoot apex bombarded with microparticles, and a step of selecting genome-edited plants from the grown plants.

[0074] - Step of allowing seeds to absorb water - The method of absorbing water is not particularly limited and can be appropriately selected depending on the purpose. For example, a method of soaking seeds in water and incubating them can be mentioned.

[0075] The incubation temperature is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 10°C or higher and 40°C or lower, more preferably 15°C or higher and 35°C or lower, even more preferably 15°C or higher and 30°C or lower, and particularly preferably 15°C or higher and 25°C or lower.

[0076] The water absorption time is not particularly limited and can be appropriately selected depending on the purpose and the condition of the seeds, but is preferably 3 hours or more, more preferably 6 hours or more, even more preferably 12 hours or more, particularly preferably 14 hours or more, and most preferably 16 hours or more. The upper limit of the water absorption time is not particularly limited and can be appropriately selected depending on the purpose and the condition of the seeds, but is preferably 240 hours or less, more preferably 120 hours or less, even more preferably 48 hours or less, particularly preferably 36 hours or less, and most preferably 24 hours or less.

[0077] The seeds can be softened by the water absorption, which makes it easier to expose the shoot apex. In the step of allowing the seeds to absorb water, the water may be exchanged one or more times.

[0078] -Step of exposing the shoot apex- The method for exposing the shoot apex of the embryo of the ripe seed and the immature seed is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include a method for removing the coleoptile and leaf primordia, a method for removing the seed coat and cotyledons, etc. The method for exposing the shoot apex of the rhizome young shoot is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include a method for removing the leaf primordia, etc. The method for exposing the shoot apex of the apical bud or lateral bud is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include a method for removing the leaf primordia, etc.

[0079] Specifically, in the case of wheat, barley, rice, or corn, the shoot apex can be exposed by removing the coleoptiles and leaf primordia; in the case of soybean, the shoot apex can be exposed by removing the seed coat and cotyledons; in the case of potato, the shoot apex can be exposed by sprouting from the seed potato and removing the leaf primordia from the excised shoot; and in the case of apple, the shoot apex can be exposed by removing the leaf primordia from the seed embryo or an excised terminal or lateral bud.

[0080] The exposure means is not particularly limited as long as it can remove the coleoptile, leaf primordia, seed coat, and / or cotyledons under a stereomicroscope, and can be appropriately selected depending on the purpose. Examples include a drilling tool such as a needle with a diameter of approximately 0.2 mm, tweezers, a pipette, a syringe, and a cutting tool such as a scalpel or cutter. To obtain a virus-free shoot apex, the scalpel may be replaced with a new, sterile scalpel at the final stage of cutting the shoot apex. In this case, a virus-free genome-edited plant can be obtained.

[0081] After exposing the shoot apex, the endosperm and excess scutellum can be removed using a cutting tool such as a scalpel, and the embryo and scutellum containing the exposed shoot apex can be placed on an agar medium with the shoot apex facing upward.

[0082] - Step of contacting the shoot apex with a high osmotic pressure medium - The step of contacting the shoot apex with a high osmotic pressure medium is a step of subjecting the shoot apex to high osmotic pressure treatment.

[0083] The method for contacting the plant with the high osmotic pressure medium is not particularly limited and can be appropriately selected depending on the purpose. Examples of the method include a method of immersing the shoot tip of the plant in the high osmotic pressure medium, a method of placing the shoot tip of the plant in the high osmotic pressure medium, and a method of spraying the high osmotic pressure medium onto the shoot tip of the plant.

[0084] The environment for the high osmotic pressure treatment may be a light place or a dark place, but from the viewpoint of germination efficiency, a dark place is preferable for dark-germinating seeds, and a light place is preferable for light-germinating seeds.

[0085] The hyperosmotic medium may be a medium containing a sugar or a sugar alcohol. Examples of the sugar or sugar alcohol include sorbitol, mannitol, and sucrose. From the viewpoint of efficient hyperosmotic treatment, the medium preferably contains sorbitol, mannitol, and sucrose. The osmotic potential of the hyperosmotic medium may be at least equal to the osmotic potential of an 11% sucrose solution.

[0086] Various gelling agents can be added to the hyperosmotic medium. The gelling agent is not particularly limited and can be selected appropriately depending on the purpose. Examples include agarose, agar, gellan gum, Gelrite, and phytagel. The concentration of the gelling agent in the hyperosmotic medium is not particularly limited and can be selected appropriately depending on the type of gelling agent. For example, in the case of phytagel, the concentration is preferably 1.0 g / L to 10.0 g / L, and more preferably 2.0 g / L to 8.0 g / L. The osmotic pressure of the hyperosmotic medium before the addition of the gelling agent is not particularly limited and can be selected appropriately depending on the purpose. However, it is preferably 400 mOsmol / kg to 2,000 mOsmol / kg, and more preferably 400 mOsmol / kg to 1,500 mOsmol / kg.

[0087] The timing of the high osmotic pressure treatment is not particularly limited and can be appropriately selected depending on the purpose, and can be, for example, before, after, or before or after the step of shooting the nucleic acid- and protein-coated microparticles into the shoot apex of a plant using a gene gun equipped with a stopping plate. Among these, from the viewpoint of high efficiency, the high osmotic pressure treatment is preferably performed before or after the step of shooting the nucleic acid- and protein-coated microparticles into the shoot apex of a plant using a gene gun equipped with a stopping plate.

[0088] The time for the high osmotic pressure treatment is not particularly limited and can be appropriately selected depending on the purpose. Before the step of shooting the nucleic acid- and protein-coated microparticles into the plant shoot apex using a gene gun equipped with a stopping plate, the time is preferably 1 hour to 60 hours, more preferably 1 hour to 48 hours, and even more preferably 2 hours to 48 hours. Furthermore, after the step of shooting the nucleic acid- and protein-coated microparticles into the plant shoot apex using a gene gun equipped with a stopping plate, the time is preferably 1 hour to 60 hours, more preferably 1 hour to 48 hours, and even more preferably 2 hours to 48 hours. Being within the above-mentioned preferred range is advantageous in that transformation, etc. can be performed with high efficiency.

[0089] - Step of growing the shoot tips bombarded with microparticles - The growing method is not particularly limited and can be selected appropriately depending on the purpose. For example, there is a method in which the shot tips are grown on an agar medium for about one month after bombardment and then transplanted into soil.

[0090] -Step of selecting genome-edited plants from grown plants- In the genome editing method, genome-edited plants can be obtained by growing them in a normal medium without applying selective pressure using chemicals or the like (containing no antibiotics or the like), but cells whose genomes have been edited using chemicals can also be selectively cultured. When applying selective pressure using chemicals or the like, a drug resistance gene can be further introduced in addition to the gene of interest. The chemical is not particularly limited and can be selected appropriately depending on the purpose, and examples include the sulfonylurea herbicide chlorosulfuron (resistance can be acquired by introducing a mutant ALS gene (acetobutyrate synthase gene)).

[0091] (Method for producing a genome-edited plant) The method for producing a genome-edited plant includes the steps of shooting microparticles coated with at least one type of nucleic acid and at least one type of protein into the shoot apex of a plant using a gene gun equipped with a stopping plate, and growing the shoot apex into which the microparticles have been shot, wherein the value P represented by the following formula 1 is 0.8 or more and 5,000 or less: P=(A / 2) ５ ×B×10 ４ / C ３ ... (Formula 1) In Formula 1, A represents the "average particle size of the microparticles (μm)", B represents the "gas pressure of the gene gun (psi)", and C represents the "distance between the stopping plate and the shoot apex in the gene gun (mm)". The method for producing a genome-edited plant can further include another step B.

[0092] The step of shooting the microparticles coated with at least one nucleic acid and at least one protein into the shoot apex of a plant using a gene gun equipped with a stopping plate is as described above in (Genome editing method). The step of growing the shoot apex into which the microparticles have been shot is as described above in <Other step A> in (Genome editing method).

[0093] <Other Steps B> The other steps B are not particularly limited and can be selected appropriately depending on the purpose, and examples include a step of allowing seeds to absorb water, a step of exposing the shoot apex, a step of contacting the shoot apex with a high osmotic pressure medium, a step of selecting a genome-edited plant from the grown plants, etc. The steps of allowing seeds to absorb water, a step of exposing the shoot apex, a step of contacting the shoot apex with a high osmotic pressure medium, and a step of selecting a genome-edited plant from the grown plants are as described in <Other Steps A> in (Genome Editing Method) above.

[0094] Examples of the present invention will be described below, but the present invention is not limited to these examples in any way.

[0095] (Comparative Example 1) Targeted Mutation Introduction by Guide RNA (gRNA) and Cas9 Protein Introduction 1 To create genome-edited individuals, a complex of gRNA and Cas9 protein was introduced into the shoot apex using a particle gun method, and the subsequent efficiency of genome-edited individuals was investigated. To verify this, a complex of gRNA and Cas9 protein targeting the Glyma.08g116300 gene was introduced into the soybean shoot apex.

[0096] 1. T ０ (1) Preparation of mature soybean seeds Mature soybean (Yukihomare) seeds were sterilized by immersing them in Kitchen Haiter (6% hypochlorous acid, Kao Corporation) and shaking at room temperature for 2 minutes, and then washed with tap water. The sterilized mature seeds were transferred to a sealed container and immersed in sterilized water to absorb water. They were incubated in an incubator at 20°C for approximately 24 hours and used in the following experiments.

[0097] (2) Exposure of the shoot apex in mature seed embryos Under a stereomicroscope, all seed coats and cotyledons were removed using a sterilized knife (or a sterilized scalpel) to leave only the hypocotyl. The primary leaves and base of the hypocotyl were then removed using the tip of a needle (0.20 mm diameter) to completely expose the shoot apex. Approximately 20 seedlings per plate were then placed on BM medium (4.3 g / L MS salt, MS vitamin, 3% sucrose, 0.50 g / L MES, 3% PPM (plant preservative mixture, Nacalai Tesque Inc.), 6.0 g / L Phytagel (registered trademark, Sigma-Aldrich), pH 5.7).

[0098] (3) gRNA and Cas9 protein introduction gRNA and Cas9 protein were introduced into the shoot apex of mature embryos using the particle gun method as follows. 30 mg of gold particles with an average particle size of 0.6 μm were weighed as microparticles, 500 μL of 70% ethanol was added, and the mixture was thoroughly suspended using a vortex mixer. The gold particles were then precipitated by centrifugation, and the ethanol was removed. 250 μL of sterile water was then added to prepare a sterile gold particle solution.

[0099] A mixture (1.0 μg / μL) of crRNA and tracrRNA (Fasmac Co., Ltd.) was used as the gRNA. Cas9 protein was derived from Streptococcus pyogenes (Takara Bio Inc.).

[0100] crRNA: ACCCAAGUAAAGUACCAAGGguuuuagagcuaugcuguuuug (SEQ ID NO: 1) tracrRNA: aaacagcauagcaaguuaaaauaaaggcuaguccguuaucaacuugaaaaaaguggcaccgagucggugcu (SEQ ID NO: 2)

[0101] 5 μL of the above gRNA mixture, 13 μg of Cas9 protein, 4 μL of 10x Cut Smart® Buffer (New England Biolabs), and 1.0 μL of Ribolock RNase Inhibitor (ThermoFisher) were added, and the total volume was filled up to 20 μL with sterile distilled water. After leaving the mixture at room temperature for 10 minutes, 5 μL of 1,4-bis(3-oleoylamidopropyl)piperazine / histone H1 protein mixture (3:1, 1,330 μg / mL) was added and the mixture was left at room temperature for 5 minutes. 1,800 μg of gold particles were added and the mixture was left on ice for 10 minutes. After discarding the supernatant, 24 μL of Nuclease-Free Water was added, and this was used as the gold particle / Cas9 complex. The amount of gold particles was 450 μg per shot. A 1.5 cm square hydrophilic film (3M, SH2CLHF) was attached to the center of the macrocarrier in a clean bench. 6 μL of the gold particle / Cas9 complex was poured onto the film and allowed to air dry.

[0102] The particle gun used was a Biolistic (registered trademark) PDS-1000 / He Particle Delivery System (Bio-RAD). The pressure (gas pressure) during firing was 1,350 psi (approximately 94.9 kgf / cm ２ ) and the distance from the stopping plate to the target tissue (shoot apex) was 50 mm. At this time, the value P expressed by Equation 1 was 0.26. One shot was made per petri dish, and then the dish was left to stand overnight in a dark place.

[0103] 2. T ０2. Investigation using genomic PCR as an indicator in first-generation plants (1) Growth of individuals treated with gRNA and Cas9 protein introduction Individuals treated with gRNA and Cas9 protein introduction that had been left overnight were transplanted into disposable plant cell culture vessels (Sigma-Aldrich) containing RM medium (4.3 g / L MS salt, MS vitamin, 3% sucrose, 0.50 g / L MES, 3% PPM (plant preservative mixture, Nacalai Tesque), 3.0 g / L gelrite, pH 5.7) and grown in an incubator (25 ° C, 16-hour day length). When root growth and leaf differentiation from the shoot apex were observed, the plants were transplanted into cell trays containing horticultural seedling soil. They were then grown in the same incubator until the third leaf.

[0104] (2) T ０ Confirmation of target gene mutation introduction in lower leaves The resulting plants were examined using the CAPS method to determine whether mutations had been introduced into the target gene. Three independent leaves up to the third leaf were selected and pooled, and genomic DNA was extracted using the benzyl chloride method. Using this as a template, PCR was performed using primers specific to the Glyma. 08g116300 gene. Primer sequence: ATGTGTCGCAGCAAATCAAAATGG (SEQ ID NO: 3) Primer sequence: ACGCCCCAACCGCTTCCTATA (SEQ ID NO: 4)

[0105] The PCR reaction solution contained 20 ng of the above genomic DNA, 0.2 U of KOD FX Neo (Toyobo Co., Ltd.), 5 μL of 2× attached buffer, 2 μL of 2 mM dNTPs, and 0.2 μM each of the primer pairs, and was filled up to a total of 10 μL with sterile distilled water.

[0106] PCR was performed using a ProFlex PCR System (Trademark, ThermoFisher) with 35 cycles consisting of 2 minutes at 94°C, followed by 10 seconds at 98°C and 30 seconds at 68°C. After PCR, 1.7 μL of each PCR product, 0.5 μL of the 10x buffer provided, and 5 U of the appropriate restriction enzyme were added, and the total volume was filled up to 5 μL with sterile distilled water. After 3 hours of reaction at the optimal temperature, the samples were subjected to 2.0% agarose electrophoresis and stained with GelRed.

[0107] In wild-type plants, the PCR product (505 bp) is completely cleaved by the restriction enzyme (120 bp and 385 bp), whereas in individuals with mutations introduced, residual PCR product remains (see Figure 1; in Figure 1, individuals with mutations introduced into the target gene by genome editing have residual PCR product, as in the sample indicated by an asterisk). In this example, of the 40 shoot apices, no individuals had mutations introduced into the target gene, and no genome-edited individuals were identified under these conditions.

[0108] (Example 1) Targeted mutagenesis by introduction of gRNA and Cas9 protein 2 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0109] (2) Exposure of shoot apex in fully mature seed embryos The procedure was the same as in 1(2) of Comparative Example 1, except that hypocotyls with completely exposed shoot apex portions were placed on BM medium at approximately 16 pieces per plate.

[0110] (3) gRNA and Cas9 protein introduction The pressure (gas pressure) during impact was 1,550 psi (approximately 108.9 kgf / cm ２ The experiment was carried out in the same manner as in 1(3) of Comparative Example 1, except that the stopping plate was set at 1.0 mm and the distance from the stopping plate to the target tissue (shoot apex) was set at 35 mm. The value P expressed by Equation 1 was 0.88.

[0111] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0112] (2) T ０ Confirmation of target gene mutation introduction in lower leaves The obtained plants were examined for the presence or absence of mutations in the target gene according to the method described in 2(2) of Comparative Example 1. As a result, in this example, genome editing was confirmed in 18 of 192 shoot apex individuals (mutation introduction efficiency: 9.3%) (see Figure 1).

[0113] (3) T０ Confirmation of target gene mutation introduction in upper compound leaves Eighteen individuals in which target gene mutations were confirmed were transplanted from the cell tray to 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0114] As a result, target gene mutations were detected in multiple upper compound leaves of 10 individuals (see Figure 2). The efficiency of mutation introduction per 192 shoot apices was 5.2%. Individuals in which target mutations were detected in the upper compound leaves were grown and used to produce the next generation, T １ The plants were then checked to see if the mutation was inherited.

[0115] 3. T １ Confirmation of target gene mutation introduction in plant leaves T ０ T harvested from the plant １ Seeds were sown, primary leaves were sampled, and genomic DNA was extracted using the benzyl chloride method. The subsequent introduction of target gene mutation was confirmed by CAPS analysis according to the method described in 2(2) of Comparative Example 1. As a result, T １ About the first generation １ Target gene introduction in the primary leaves of the next generation was confirmed (mutation introduction efficiency: 0.52%) (see Figure 3). In Figure 3, the samples indicated by asterisks are T １ It is a plant body.

[0116] (Example 2) Targeted mutagenesis by introduction of gRNA and Cas9 protein 3.1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0117] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 1, 1(2).

[0118] (3) gRNA and Cas9 protein introduction The pressure (gas pressure) during impact was 1,800 psi (approximately 126.5 kgf / cm ２The procedure was the same as in Item 1(3) of Example 1, except that the value P represented by Equation 1 was 1.0.

[0119] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0120] (2) T ０ Confirmation of target gene mutation introduction in lower leaves The resulting plants were examined for the presence or absence of mutations in the target gene according to the method described in 2(2) of Comparative Example 1. As a result, in this example, genome editing was confirmed in 21 of 176 shoot apices (mutation introduction efficiency 11.9%) (see Figure 1).

[0121] (3) T ０ Confirmation of target gene mutation introduction in upper compound leaves Twenty-one individuals in which target gene mutation was confirmed were transplanted from the cell tray to 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0122] As a result, target gene mutations were detected in multiple upper compound leaves of 12 individuals (see Figure 2). The efficiency of mutation introduction per 176 shoot apices was 6.8%. Individuals in which target mutations were detected in the upper compound leaves were grown and used to produce the next generation, T １ The plants were then checked to see if the mutation was inherited.

[0123] 3. T １ Confirmation of target gene mutation introduction in plant leaves T ０ T harvested from the plant １ Seeds were sown, primary leaves were sampled, and genomic DNA was extracted using the benzyl chloride method. The subsequent introduction of target gene mutation was confirmed by CAPS analysis according to the method described in 2(2) of Comparative Example 1. As a result, T １ About the first generation １Target gene introduction into the primary leaves of the next generation was confirmed (mutation introduction efficiency: 0.57%) (see FIG. 3).

[0124] (Example 3) Targeted mutagenesis by introduction of gRNA and Cas9 protein 4 (hyperosmotic pressure treatment 1) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0125] (2) Exposure of shoot apex in mature seed embryos Before bombardment, hypocotyls with completely exposed shoot apex portions were placed on osmotic bombardment medium (SOY-OSMO: 4.3 g / L MS salt, MS vitamin, 2% sucrose, 3.64% mannitol, 3.64% sorbitol, 0.70 g / L L-proline, 3% PPM (plant preservative mixture, Nacalai Tesque), 2.0 mL / L meropenem trihydrate, 4.0 g / L phytagel, pH 5.8) at approximately 16 pieces per plate, and incubated at 20°C for 4 hours in the dark. The procedure was the same as in 1(2) of Comparative Example 1.

[0126] (3) gRNA and Cas9 protein introduction The pressure (gas pressure) during impact was 1,800 psi (approximately 126.5 kgf / cm ２ The procedure was the same as in Item 1(3) of Example 1, except that the value P represented by Equation 1 was 1.0.

[0127] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0128] (2) T ０ Confirmation of target gene mutation introduction in lower leaves The resulting plants were examined for the presence or absence of mutations in the target gene according to the method described in 2(2) of Comparative Example 1. As a result, in this example, genome editing was confirmed in 23 of 128 shoot apices (mutation introduction efficiency: 17.9%) (see Figure 1).

[0129] (3) T ０Confirmation of target gene mutation introduction in upper compound leaves Twenty-three individuals in which target gene mutation was confirmed were transplanted from the cell tray to 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0130] As a result, target gene mutations were detected in multiple upper compound leaves of 16 individuals (see Figure 2). The efficiency of mutation introduction per 128 shoot apices was 12.5%. Individuals in which target mutations were detected in the upper compound leaves were grown and used to produce the next generation, T １ The plants were then checked to see if the mutation was inherited.

[0131] 3. T １ Confirmation of target gene mutation introduction in plant leaves T ０ T harvested from the plant １ Seeds were sown, primary leaves were sampled, and genomic DNA was extracted using the benzyl chloride method. The subsequent introduction of target gene mutation was confirmed by CAPS analysis according to the method described in 2(2) of Comparative Example 1. As a result, T １ About the 3 generations １ Target gene introduction in the primary leaves of the next generation was confirmed (mutation introduction efficiency: 2.3%) (see FIG. 3).

[0132] (Example 4) Targeted mutagenesis by introduction of gRNA and Cas9 protein 5 (hyperosmotic pressure treatment 2) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0133] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0134] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.0 μm were used, and the pressure (gas pressure) during impact was set to 1,800 psi (approximately 126.5 kgf / cm ２ The procedure was the same as in Item 1(3) of Example 1, except that the value P represented by Equation 1 was 13.

[0135] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0136] (2) T ０ Confirmation of target gene mutation introduction in lower leaves The obtained plants were examined for the presence or absence of mutations in the target gene according to the method described in 2(2) of Comparative Example 1. As a result, in this example, genome editing was confirmed in 47 of 96 shoot apex individuals (mutation introduction efficiency: 49%) (see Figure 1).

[0137] (3) T ０ Confirmation of target gene mutation introduction in upper compound leaves Forty-seven individuals in which target gene mutations were confirmed were transplanted from the cell tray to 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0138] As a result, target gene mutations were detected in multiple upper compound leaves of 29 individuals (see Figure 2). The efficiency of mutation introduction per 96 shoot apices was 30.2%. Individuals in which target mutations were detected in the upper compound leaves were grown and used to produce the next generation, T １ The plants were then checked to see if the mutation was inherited.

[0139] 3. T １ Confirmation of target gene mutation introduction in plant leaves T ０ T harvested from the plant １ Seeds were sown, primary leaves were sampled, and genomic DNA was extracted using the benzyl chloride method. The subsequent introduction of target gene mutation was confirmed by CAPS analysis according to the method described in 2(2) of Comparative Example 1. As a result, T １ About Generation 14 １ Target gene introduction in the primary leaves of the next generation was confirmed (mutation introduction efficiency: 14.6%) (see FIG. 3).

[0140] (Example 5) Targeted mutagenesis by introduction of gRNA and Cas9 protein 6 (hyperosmotic pressure treatment 3) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0141] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0142] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.6 μm were used, and the pressure (gas pressure) during impact was set to 900 psi (approximately 63.2 kgf / cm ２ The procedure was the same as in Item 1(3) of Example 1, except that the value P represented by Equation 1 was 69.

[0143] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0144] (2) T ０ Confirmation of target gene mutation introduction in lower leaves The obtained plants were examined for the presence or absence of mutations in the target gene according to the method described in 2(2) of Comparative Example 1. As a result, in this example, genome editing was confirmed in 9 of 32 shoot apex individuals (mutation introduction efficiency: 28.1%) (see Figure 1).

[0145] (3) T ０ Confirmation of target gene mutation introduction in upper compound leaves Nine individuals in which target gene mutations were confirmed were transplanted from the cell tray to 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0146] As a result, target gene mutations were detected in multiple upper compound leaves of three individuals (see Figure 2). The efficiency of mutation introduction per 32 shoot apices was 9.3%. Individuals in which target mutations were detected in upper compound leaves were grown and used to produce the next generation, T１ The plants were then checked to see if the mutation was inherited.

[0147] 3. T １ Confirmation of target gene mutation introduction in plant leaves T ０ T harvested from the plant １ Seeds were sown, primary leaves were sampled, and genomic DNA was extracted using the benzyl chloride method. The subsequent introduction of target gene mutation was confirmed by CAPS analysis according to the method described in 2(2) of Comparative Example 1. As a result, T １ About the first generation １ Target gene introduction into the primary leaves of the next generation was confirmed (mutation introduction efficiency: 3.1%) (see FIG. 3).

[0148] (Example 6) Targeted mutagenesis by introduction of gRNA and Cas9 protein 7 (hyperosmotic pressure treatment 4) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0149] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0150] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.6 μm were used, and the pressure (gas pressure) during impact was set to 1,800 psi (approximately 126.5 kgf / cm ２ The experiment was carried out in the same manner as in Item 1(3) of Example 1, except that the stopping plate was set at 100°C, and the distance from the stopping plate to the target tissue (shoot apex) was set at 50 mm. The value P expressed by Equation 1 was 47.

[0151] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0152] (2) T ０The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0153] As a result, target gene mutations were detected in multiple upper compound leaves of 12 individuals (see Figure 2). The mutation introduction efficiency per 64 shoot apices was 18.8%.

[0154] (Example 7) Targeted mutagenesis by introduction of gRNA and Cas9 protein 8 (hyperosmotic pressure treatment 5) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0155] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0156] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.6 μm were used, and the pressure (gas pressure) during impact was set to 650 psi (approximately 45.7 kgf / cm ２ The procedure was the same as in Item 1(3) of Example 1, except that the value P represented by Equation 1 was 49.

[0157] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0158] (2) T ０ The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0159] As a result, target gene mutations were detected in multiple upper compound leaves of 15 individuals (see Figure 2). The mutation introduction efficiency per 96 shoot apices was 15.6%.

[0160] (Example 8) Targeted mutagenesis by introduction of gRNA and Cas9 protein 9 (hyperosmotic pressure treatment 6) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0161] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0162] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.6 μm were used, and the pressure (gas pressure) during impact was set to 1,100 psi (approximately 77.3 kgf / cm ２ The same procedure as in Item 1(3) of Example 1 was carried out except that the value P represented by Equation 1 was 84.

[0163] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0164] (2) T ０ The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0165] As a result, target gene mutations were detected in multiple upper compound leaves of 10 individuals (see Figure 2). The mutation introduction efficiency per 64 shoot apices was 15.6%.

[0166] (Example 9) Targeted mutagenesis by introduction of gRNA and Cas9 protein 10 (hyperosmotic pressure treatment 7) 1. T ０Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0167] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0168] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.6 μm were used, and the pressure (gas pressure) during impact was set to 1,350 psi (approximately 94.9 kgf / cm ２ The procedure was the same as in Item 1(3) of Example 1, except that the value P represented by Equation 1 was 103.

[0169] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0170] (2) T ０ The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0171] As a result, target gene mutations were detected in multiple upper compound leaves of 14 individuals (see Figure 2). The mutation introduction efficiency per 64 shoot apices was 21.9%.

[0172] (Example 10) Targeted mutagenesis by introduction of gRNA and Cas9 protein 11 (hyperosmotic pressure treatment 8) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0173] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0174] (3) gRNA and Cas9 protein introduction The procedure was the same as in (3) of Example 1, except that gold particles with an average particle size of 1.6 μm were used. At this time, the value P represented by Equation 1 was 118.

[0175] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0176] (2) T ０ The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0177] As a result, target gene mutations were detected in multiple upper compound leaves of 13 individuals (see Figure 2). The mutation introduction efficiency per 64 shoot apices was 20.3%.

[0178] (Example 11) Targeted mutagenesis by introduction of gRNA and Cas9 protein 12 (hyperosmotic pressure treatment 9) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0179] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0180] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.6 μm were used, and the pressure (gas pressure) during impact was set to 1,800 psi (approximately 126.5 kgf / cm ２ The procedure was the same as in Item 1(3) of Example 1, except that the value P represented by Equation 1 was 137.

[0181] 2. T ０(1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0182] (2) T ０ The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0183] As a result, target gene mutations were detected in multiple upper compound leaves of 12 individuals (see Figure 2). The mutation introduction efficiency per 64 shoot apices was 18.8%.

[0184] (Example 12) Targeted mutagenesis by introduction of gRNA and Cas9 protein 13 (hyperosmotic pressure treatment 10) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0185] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0186] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.6 μm were used, and the pressure (gas pressure) during impact was set to 1,800 psi (approximately 126.5 kgf / cm ２ The experiment was carried out in the same manner as in Item 1(3) of Example 1, except that the stopping plate was set to 1 mm and the distance from the stopping plate to the target tissue (shoot apex) was set to 33 mm. The value P expressed by Equation 1 was 164.

[0187] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0188] (2) T ０The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0189] As a result, target gene mutations were detected in multiple upper compound leaves of seven individuals (see Figure 2). The mutation introduction efficiency per 58 shoot apices was 12.1%.

[0190] (Example 13) Targeted mutagenesis by introduction of gRNA and Cas9 protein 14 (hyperosmotic pressure treatment 11) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0191] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0192] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.6 μm were used, and the pressure (gas pressure) during impact was set to 1,800 psi (approximately 126.5 kgf / cm ２ The experiment was carried out in the same manner as in Item 1(3) of Example 1, except that the stopping plate was set to 27 mm and the distance from the stopping plate to the target tissue (shoot apex) was set to 27 mm. The value P expressed by Equation 1 was 299.

[0193] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0194] (2) T ０ The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0195] As a result, target gene mutations were detected in multiple upper compound leaves of two individuals (see Figure 2). The mutation introduction efficiency per 37 shoot apices was 5.4%.

[0196] (Example 14) Targeted mutagenesis by introduction of gRNA and Cas9 protein 15 (hyperosmotic pressure treatment 12) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0197] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0198] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.6 μm were used, and the pressure (gas pressure) during impact was set to 1,800 psi (approximately 126.5 kgf / cm ２ The experiment was carried out in the same manner as in Item 1(3) of Example 1, except that the stopping plate was set at 100°C, and the distance from the stopping plate to the target tissue (shoot apex) was set at 20 mm. The value P expressed by Equation 1 was 737.

[0199] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0200] (2) T ０ The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0201] As a result, target gene mutations were detected in multiple upper compound leaves of two individuals (see Figure 2). The mutation introduction efficiency per 28 shoot apices was 7.1%.

[0202] (Example 15) Targeted mutagenesis by introduction of gRNA and Cas9 protein 16 (hyperosmotic pressure treatment 13) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0203] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0204] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.6 μm were used, and the pressure (gas pressure) during impact was set to 1,350 psi (approximately 94.9 kgf / cm ２ The experiment was carried out in the same manner as in Item 1(3) of Example 1, except that the stopping plate was set at 10 mm, and the distance from the stopping plate to the target tissue (shoot apex) was set at 10 mm. The value P expressed by Equation 1 was 4,424.

[0205] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0206] (2) T ０ The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0207] As a result, target gene mutations were detected in multiple upper compound leaves of a single plant (see Figure 2). The mutation introduction efficiency per 30 shoot apices was 3.3%.

[0208] (Comparative Example 2) Targeted Mutation Introduction by Introduction of gRNA and Cas9 Protein 16 (Hyperosmotic Pressure Treatment 13) 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0209] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0210] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.6 μm were used, and the pressure (gas pressure) during impact was set to 1,800 psi (approximately 126.5 kgf / cm ２ The experiment was carried out in the same manner as in Item 1(3) of Example 1, except that the stopping plate was set at 10 mm, and the distance from the stopping plate to the target tissue (shoot apex) was set at 10 mm. The value P expressed by Equation 1 was 5,898.

[0211] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0212] (2) T ０ The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0213] As a result, in this example, of the 30 shoot apices, no individuals had mutations introduced into the target gene, and no genome-edited individuals could be confirmed under these conditions.

[0214] (Example 16) Gene transfer to target site by introduction of DNA, gRNA, and Cas9 protein We examined whether or not a DNA fragment incorporating a foreign gene into a sequence homologous to the target base sequence of the host is introduced when the cleavage site of the target gene is repaired by introducing a complex of gRNA and Cas9 protein into the shoot apex of soybean using the gene transfer method of the present invention.

[0215] 1. Preparation of donor plasmid used for introduction (1) Preparation of foreign gene A portion (443 bp) of the GUS gene sequence not present in plants was selected as the foreign gene. The selected sequence was fused with a homologous sequence to the target sequence using the In-Fusion® Cloning System (TaKaRa), and three inserts (foreign gene, homologous sequence) were cloned into one vector (see Figure 4).

[0216] The foreign gene was prepared by PCR using the following primers specific to the GUS expression vector: Primer sequence: ATTTGGAAACGGCAGAGAAG (SEQ ID NO: 5) Primer sequence: GAGCTCGGTAGCAATTCCC (SEQ ID NO: 6)

[0217] The PCR reaction solution used contained 1 ng of GUS expression vector, 25 μL of PrimeSTAR® Max (TaKaRa) Premix (2×), and 0.2 μM of each primer pair, and was filled up to a total of 50 μL with sterile distilled water.

[0218] PCR was performed using a ProFlex PCR System (trademark, ThermoFisher) with 30 cycles of 94°C for 1 minute, followed by 98°C for 10 seconds, 55°C for 5 seconds, and 72°C for 15 seconds. After the PCR reaction, 1.5% agarose gel electrophoresis was performed and stained with GelRed. DNA of the desired size was extracted and purified from the gel using NucleoSpin® Gel and PCR Clean-up (TaKaRa).

[0219] (2) Preparation of Homologous Sequences Primers were designed in which the 175 bp upstream from the cleavage site of the soybean target gene was used as a homologous sequence, and a homologous 15 bp (the portion in lowercase letters in the sequence below) for fusion with the vector and foreign gene was added. Primer sequence: gtgctggaattcaggTTGCTGACATCACTCCTCAAGAG (SEQ ID NO: 7) Primer sequence: ctgccgtttccaaatTGGTACTTTACTTGGGTGATGAC (SEQ ID NO: 8)

[0220] The PCR reaction solution used 100 ng of Yukihomare genome, and the homologous sequence was amplified, extracted from the gel, and purified in accordance with the method described in 1(1) of this Example 16.

[0221] Primers were designed in which the 255 bp downstream from the cleavage site of the soybean target gene was a homologous sequence, and a 15 bp homologous sequence (the portion in lowercase letters in the sequence below) for fusion with the vector and foreign gene was added. Primer sequence: attgctaccgagctcAGGGGGCTGTGGTATGTGAAACC (SEQ ID NO: 9) Primer sequence: tctgcagaattcaggTATCACATTTAACTTTTCAACG (SEQ ID NO: 10)

[0222] The PCR reaction solution used 100 ng of Yukihomare genome, and the homologous sequence was amplified, extracted from the gel, and purified in accordance with the method described in 1(1) of this Example 16.

[0223] (3) Cloning into Vector To clone the above three inserts into the pCR (registered trademark)-Blunt (ThermoFisher) vector, the inserts were mixed with the vector at the same molar concentration, 5x In-Fusion HD Enzyme Premix was added, and the mixture was filled up to a total of 10 μL with sterile distilled water. After reacting at 50 °C for 15 minutes, the mixture was transformed into E. coli by heat shock. To select transformed E. coli, the mixture was spread on LB agar medium containing kanamycin (50 μg / L) and subjected to static culture at 37 °C for 16 hours.

[0224] Colony PCR was performed on the resulting single colonies using primers on the vector to determine whether the desired insert was inserted. Primer sequences: GTAAAACGACGGCCAG (SEQ ID NO: 11) Primer sequences: CAGGAAACAGCTATGAC (SEQ ID NO: 12)

[0225] The PCR reaction mixture was prepared by adding 20 μL of 2x Quick Taq (registered trademark) HS DyeMix and 0.2 μM of each primer pair, filling up the mixture with sterile distilled water to a total of 40 μL, and suspending single colonies picked with a sterilized toothpick.

[0226] PCR was performed using a ProFlex PCR System (trademark, ThermoFisher) by treating at 94°C for 2 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 68°C for 1 minute 30 seconds. After the PCR reaction, 1.5% agarose gel electrophoresis was performed and stained with GelRed. E. coli in which a fragment of the desired size was detected was inoculated into LB liquid medium and cultured at 37°C for 16 hours with shaking.

[0227] E. coli cells were collected from the culture medium, and the plasmids were recovered using a QIAprep Spin Miniprep Kit (Qiagen) and subjected to sequence analysis. Those containing no PCR errors were frozen and stored as donor plasmids.

[0228] 2. Preparation of donor DNA used for introduction On the day of bombardment, donor DNA was prepared by amplifying the donor DNA using the donor plasmid as a template and a high-fidelity PCR enzyme.

[0229] The PCR reaction mixture contained 1 ng of the above plasmid, 1 U of KOD-Plus-Neo, 5 μL of 10x attached buffer, 5 μL of 2 mM dNTPs, and 25 mM MgSO. ４ 3 μL of the solution, 0.2 μM of each primer pair was added, and the mixture was filled up to a total of 50 μL with sterile distilled water.

[0230] PCR was performed using a ProFlex PCR System (trademark, ThermoFisher) by treating at 94°C for 2 minutes, followed by 32 cycles of reaction at 98°C for 10 seconds, 55°C for 30 seconds, and 68°C for 30 seconds. After the PCR reaction, the DNA was purified using NucleoSpin (registered trademark) Gel and PCR Clean-up (TaKaRa) to obtain a donor DNA solution.

[0231] 3. T ０ Confirmation of gene introduction into target site in next generation plants (1) Preparation of mature soybean seeds This was carried out in the same manner as in 1(1) of Comparative Example 1.

[0232] (2) Exposure of shoot apex in mature seed embryo This was carried out in the same manner as in Example 3, 1(2).

[0233] (3) DNA, gRNA, and Cas9 protein introduction Coated microparticles were prepared in the same manner as in 1(3) of Comparative Example 1, except that 10 μg of DNA donor solution was also added when adding nuclease-free water, resulting in a final volume of 26 μL of gold particle / Cas9 complex and DNA donor solution. The pressure during bombardment with a particle gun was 650 psi (approximately 45.7 kgf / cm ２ ) or 900 psi (approximately 63.3 kgf / cm ２ The same procedure as in 1(3) of Example 5 was carried out except that the values ​​P represented by the formula 1 were 50 and 69, respectively.

[0234] 4. T ０ (1) Growth of individuals treated with introduction of DNA, gRNA, and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0235] (2) T ０ Confirmation of gene introduction into target site in lower leaves The resulting plants were examined for the presence or absence of introduction of a foreign gene into the target site according to the method described in 2(2) of Comparative Example 1. After the PCR reaction, 1.5% agarose gel electrophoresis was performed and stained with GelRed. As a result, while the PCR product was 505 bp in the wild-type strain, DNA close to the size of the 443 bp increased by the introduction of the foreign gene (948 bp) was detected (see Table 1).

[0236]

[0237] These DNAs were extracted and purified from agarose gel and subjected to sequence analysis to confirm whether the desired foreign gene had been introduced into the target gene sequence. In addition to individuals in which only 443 bp of the foreign gene had been inserted, individuals in which the donor had been introduced by non-homologous end joining were also confirmed.

[0238] (3) T ０Confirmation of gene introduction into target sites in upper leaves The plants were transplanted from the cell tray to 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of foreign gene introduction in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of the foreign gene was confirmed.

[0239] As a result, DNA close in size to the 443 bp increase (943 bp) due to gene introduction was detected in the upper compound leaves (see Table 2). Furthermore, in the case of a bombardment pressure of 900 psi, in individuals where introduction of the foreign gene was not detected until the second leaf, introduction was detected from the third leaf onwards. DNA was extracted and purified from the agarose gel of the bands of these two individuals, and sequence analysis revealed that only the 443 bp of the desired foreign gene had been inserted. Individuals in which the targeted mutation was detected in the upper compound leaves were grown, and the next generation, T １ The plants were then checked to see if the mutation was inherited.

[0240]

[0241] 5. T １ Confirmation of gene transfer to the target site in the next generation plants ０ T harvested from the plant １ Seeds were sown, and primary leaves were sampled and genomic DNA was extracted using the benzyl chloride method. The subsequent confirmation of foreign gene introduction into the target site was carried out according to the method described in 2(2) of Comparative Example 1. As a result, T １ Regarding the first generation lineage, T １ The introduction of the foreign gene into the target site in the primary leaves of the next generation was confirmed. DNA was extracted and purified from the agarose gel of this line band, and sequence analysis revealed that only the target foreign gene (443 bp) was clearly inserted (see Figure 5). In Figure 5, the sample indicated by an asterisk is the T in which the gene introduction into the target site by genome editing was inherited. １ It is a plant body.

[0242] The gene transfer efficiency per number of shoot tips subjected to gene transfer treatment (number of gene transferred individuals / number of shoot tips x 100) was calculated from the obtained number of gene transferred individuals, and was found to be 0.16%.

[0243] From the above, it was found that genome editing or genome-edited plants can be produced with high efficiency by setting the value P represented by Equation 1 within a predetermined range when microparticles coated with nucleic acids and proteins are shot into the apex of a plant shoot using a gene gun equipped with a stopping plate.

[0244] (Example 17) Introduction of DNA, gRNA, and Cas9 protein into corn shoot apical tissue 1. Introduction of DNA, gRNA, and Cas9 protein into corn shoot apical tissue (1) Preparation of mature corn seeds Mature seeds of corn (variety: A188) were soaked in 70% (w / w) ethanol for 1 minute, and then sterilized by shaking in a 2% (w / v) aqueous sodium hypochlorite solution for 10 minutes. The seeds were washed three times with sterile water, soaked in sterile water, incubated at 30 ° C. for 24 hours, and used in the following experiments.

[0245] (2) Exposure of the shoot apex in mature seed embryos Under a stereomicroscope, the endosperm and excess scutellum were removed from mature seeds using a sterilized knife (or a sterilized scalpel). The coleoptile and leaf primordia of the germinated seed embryo were then removed using the tip of a needle (0.20 mm diameter) to completely expose the shoot apex. The resulting seed was placed on an osmotic bombardment plate (MSOSM medium: MS inorganic salts, MS vitamins, 20 g / L sucrose, 36.4 g / L mannitol, 36.4 g / L sorbitol, 0.93 g / L MES, 3% PPM (plant preservative mixture, registered trademark, Nacalai Tesque), 7.0 g / L phytagel, pH 5.8) and left in the dark at 25°C for 24 hours.

[0246] (3) DNA, gRNA, and Cas9 protein introduction gRNA and Cas9 protein were introduced into the corn stalk apex using the particle gun method as follows. 30 mg of gold particles with an average particle size of 1.0 μm were weighed as microparticles, 500 μL of 70% ethanol was added, and the mixture was thoroughly suspended using a vortex mixer. The gold particles were then precipitated by centrifugation, and the ethanol was removed. 250 μL of sterile water was then added to prepare a sterile gold particle solution.

[0247] In this example, Alt-R CRISPR-Cas9 sgRNA (Integrated DNA Technologies) (1.0 μg / μL) containing the recognition sequence (SEQ ID NO: 13) was used as the gRNA. Cas9 protein derived from Streptococcus pyogenes (Takara Bio Inc.) was used.

[0248] Recognition sequence: UGAGCCAGAUGCGCUCCUCCG (SEQ ID NO: 13)

[0249] 5 μL of the gRNA, 12.8 μg of Cas9 protein, 3 μg of plasmid DNA (pZmUbi-sGFPS65T) containing the fluorescent reporter gene sGFP (S65T) sequence expressed under the control of the maize ubiquitin promoter and the first intron, 10 × Cut Smart (registered trademark) Buffer (new england biolabs) 4 μL, Ribolock RNase Inhibitor (ThermoFisher) 1.0 μL, 1,4-bis (3-oleoylamidopropyl) piperazine / histone H1 protein mixture (3:1, 1,330 μg / mL) A mixture consisting of 5 μL was added to 2,400 μg of gold particles. After discarding the supernatant, 24 μL of nuclease-free water was added, and this was used as the gold particle / Cas9 complex. The amount of gold particles was 600 μg per shot. A hydrophilic film (3M, SH2CLHF) cut into 1.5 cm squares was attached to the center of the macrocarrier in a clean bench. 6 μL of the above gold particle / Cas9 complex was poured onto each film and allowed to air dry.

[0250] The particle gun used was a Biolistic (registered trademark) PDS-1000 / He Particle Delivery System (Bio-RAD). The pressure (gas pressure) at the time of firing was 1,800 psi (approximately 126.5 kgf / cm ２ ) and the distance from the stopping plate to the target tissue (shoot apex) was 35 mm. The value P expressed by Equation 1 at this time was 13.12. Each dish was shot four times, and then left to stand overnight in a dark place.

[0251] 2. T ０ 1. Investigation of substance introduction in next-generation plants (1) Investigation of substance introduction in treated individuals GFP fluorescence was observed at the shoot apex under a fluorescent stereomicroscope (Olympus SZX7 stereomicroscope, U-HGLGPS fluorescent observation illuminator, SZX-MGFPA GFP mirror unit, DP73 CCD camera) to identify individuals in which the substance was successfully introduced. Among the individuals (treated individuals) that had undergone substance introduction treatment using the particle bombardment method, those in which one or more spots of GFP fluorescence were observed in the shoot apex tissue were designated as substance-introduced individuals. Of the 45 hypocotyls tested (hereinafter sometimes referred to as "treated individuals"), GFP fluorescence was confirmed at the shoot apex in only one hypocotyl (hereinafter sometimes referred to as "number of substance-introduced individuals").

[0252] (2) Growth of the introduced individuals The introduced individuals were grown in a germination medium (MS inorganic salts, MS vitamins, 20 g / L sucrose, 1 g / L MES, 3% PPM, 7.0 g / L phytagel, 5 μM AgNO ３ , 10 μM CuSO ４ The plants were then transferred to a medium containing 100 ml of PBS (pH 5.8) and cultured at 25°C in the light. After two weeks, plants with normal hypocotyl growth were designated as plants with viable substances introduced. The number of treated plants, the number of plants with substances introduced, and the number of plants with viable substances introduced were counted, and the results are shown in Table 3.

[0253] (Comparative Example 3) Introduction of DNA, gRNA, and Cas9 protein into corn shoot apical tissue 1. Introduction of DNA, gRNA, and Cas9 protein into corn shoot apical tissue (1) Preparation of mature corn seeds This was carried out in the same manner as in Example 17, 1(1).

[0254] (2) Exposure of shoot apex in mature seed embryos This was carried out in the same manner as in Example 17, 1(2).

[0255] (3) DNA, gRNA, and Cas9 protein introduction Gold particles with an average particle size of 0.6 μm were used as microparticles, and the pressure (gas pressure) during impact was 1,550 psi (approximately 108.9 kgf / cm ２ The procedure was the same as in 1(3) of Example 17, except that the stopping plate was set to 100 mm and the distance from the stopping plate to the target tissue (shoot apex) was set to 50 mm. The value P represented by Equation 1 in this case was 0.30.

[0256] 2. T ０ Investigation of substance introduction in first-generation plants (1) Investigation of substance introduction in treated individuals An investigation was carried out in the same manner as in Example 17-2(1), and GFP fluorescence was confirmed in the shoot apex of 19 hypocotyls out of 48 hypocotyls tested.

[0257] (2) Growth of Substance-Introduced Individuals The growth was carried out in the same manner as in 2(2) of Example 17. The number of treated individuals, the number of substance-introduced individuals, and the number of living substance-introduced individuals were counted, and the results are shown in Table 3.

[0258]

[0259] When substance introduction was performed on the shoot tips of 45 corn hypocotyls under conditions where the value P in Equation 1 was 13.12 (Example 17), only one individual was successfully introduced with the substance, and none of them grew. On the other hand, when substance introduction was performed on the shoot tips of 48 corn hypocotyls under conditions where the value P in Equation 1 was 0.30 (Comparative Example 3), 19 individuals were successfully introduced with the substance, and 12 of them grew. These results indicate that when introducing substances into the shoot tips of monocotyledonous plants such as corn, conditions where the value P in Equation 1 is 0.8 or higher make it difficult to introduce substances into shoot tip cells and also impair the growth of shoot tip tissues, making these conditions unsuitable for producing genome-edited cells or genome-edited plants. Additionally, in dicotyledonous plants such as soybean, conditions where the value P in Equation 1 is 0.8 or higher are suitable for substance introduction into the shoot tips, revealing a characteristic unique to dicotyledonous plants that is different from monocotyledonous plants.

[0260] (Example 18) Targeted mutagenesis by introduction of gRNA and Cas9 protein 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds The procedure was the same as in 1(1) of Comparative Example 1, except that the soybean variety used was “Osuzu.”

[0261] (2) Exposure of shoot apex in mature seed embryos This was carried out in the same manner as in 1(2) of Example 3. The size of the growing point at the tip of the stem (shoot apical meristem) was 324 μm in diameter (average value of 12 measured shoot apices).

[0262] (3) gRNA and Cas9 protein introduction Gold particles with an average particle size of 1.0 μm were used, and the pressure (gas pressure) during impact was set to 1,800 psi (approximately 126.5 kgf / cm ２ The procedure was the same as in Item 1(3) of Example 1, except that the value P represented by Equation 1 was 13.

[0263] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Comparative Example 1, 2(1).

[0264] (2) T ０ The resulting plants were transplanted from the cell trays into 3.5-inch pots and further grown in a glass greenhouse until the third and subsequent compound leaves developed. To confirm the presence or absence of mutations in the upper compound leaves, genomic DNA was extracted individually from three independent compound leaves according to the method described in Comparative Example 1, 2(2), and the presence or absence of target gene mutations was confirmed.

[0265] As a result, target gene mutations were detected in multiple upper compound leaves of 15 individuals (see Figure 2). The efficiency of mutation introduction per 128 shoot apices was 11.7%. Individuals in which target mutations were detected in upper compound leaves were grown and used to produce the next generation, T １ The plants were then checked to see if the mutation was inherited.

[0266] 3. T １ Confirmation of target gene mutation introduction in plant leaves T ０ T harvested from the plant１ Seeds were sown, primary leaves were sampled, and genomic DNA was extracted using the benzyl chloride method. The subsequent introduction of target gene mutation was confirmed by CAPS analysis according to the method described in 2(2) of Comparative Example 1. As a result, T １ About Generation 8 １ Target gene introduction in the primary leaves of the next generation was confirmed (mutation introduction efficiency: 6.3%) (see FIG. 3).

[0267] (Example 19) Targeted mutagenesis by introduction of gRNA and Cas9 protein 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds The same procedure as in 1(1) of Example 18 was carried out except that the soybean variety used was “Yukihomare.”

[0268] (2) Exposure of shoot apex in mature seed embryos This was carried out in the same manner as in 1(2) of Example 18. The size of the growing point at the tip of the stem (shoot apical meristem) was 317 μm in diameter (average value of 10 measured shoot apices).

[0269] (3) Introduction of gRNA and Cas9 protein This was carried out in the same manner as in Example 18, 1(3).

[0270] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Example 18, 2(1).

[0271] (2) T ０ Confirmation of target gene mutation introduction in upper compound leaves The same procedure as in Example 18, 2 (1) was carried out. As a result, target gene mutations were detected in multiple leaves of the upper compound leaves grown in 19 individuals (see Figure 2). The mutation introduction efficiency per 96 shoot apices individuals was 19.8%. Individuals in which target mutations were detected in the upper compound leaves were grown, and the next generation, T １ The plants were then checked to see if the mutation was inherited.

[0272] 3. T １ Confirmation of target gene mutation introduction in plant leaves was carried out in the same manner as in Example 18, section 3. As a result, T １ About Generation 14１ Target gene introduction in the primary leaves of the next generation was confirmed (mutation introduction efficiency: 14.6%) (see FIG. 3).

[0273] (Example 20) Targeted mutagenesis by introduction of gRNA and Cas9 protein 1. T ０ Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds The same procedure as in 1(1) of Example 18 was carried out except that the soybean variety used was "Suzumaru."

[0274] (2) Exposure of shoot apex in mature seed embryos This was carried out in the same manner as in 1(2) of Example 18. The size of the growing point at the tip of the stem (shoot apical meristem) was 279 μm in diameter (average value of 12 measured shoot apices).

[0275] (3) Introduction of gRNA and Cas9 protein This was carried out in the same manner as in Example 18, 1(3).

[0276] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Example 18, 2(1).

[0277] (2) T ０ Confirmation of target gene mutation introduction in upper compound leaves The same procedure as in Example 18, 2 (1) was carried out. As a result, target gene mutations were detected in multiple leaves of the upper compound leaves grown in 11 individuals (see Figure 2). The mutation introduction efficiency per 90 shoot apices individuals was 12.2%. Individuals in which target mutations were detected in the upper compound leaves were grown, and the next generation, T １ The plants were then checked to see if the mutation was inherited.

[0278] 3. T １ Confirmation of target gene mutation introduction in plant leaves was carried out in the same manner as in Example 18, section 3. As a result, T １ About Generation 6 １ Introduction of the target gene into the primary leaves of the next generation was confirmed (mutation introduction efficiency: 6.7%) (see FIG. 3).

[0279] (Example 20) Targeted mutagenesis by introduction of gRNA and Cas9 protein 1. T ０Confirmation of introduction of target gene mutation in next generation plants (1) Preparation of mature soybean seeds The same procedure as in 1(1) of Example 18 was carried out except that the soybean variety used was "Natto Kozuru."

[0280] (2) Exposure of shoot apex in mature seed embryos This was carried out in the same manner as in 1(2) of Example 18. The size of the growing point at the tip of the stem (shoot apical meristem) was 212 μm in diameter (average value of 12 measured shoot apices).

[0281] (3) Introduction of gRNA and Cas9 protein This was carried out in the same manner as in Example 18, 1(3).

[0282] 2. T ０ (1) Growth of individuals treated with introduction of gRNA and Cas9 protein The growth was carried out in the same manner as in Example 18, 2(1).

[0283] (2) T ０ Confirmation of target gene mutation introduction in upper compound leaves was carried out in the same manner as in Example 18, 2 (1). As a result, target gene mutations were detected in multiple leaves of the upper compound leaves that had grown in 11 individuals (see Figure 2). The mutation introduction efficiency per 144 shoot apices individuals was 7.6%. Individuals in which target mutations were detected in the upper compound leaves were grown, and the next generation, T １ The plants were then checked to see if the mutation was inherited.

[0284] 3. T １ Confirmation of target gene mutation introduction in plant leaves was carried out in the same manner as in Example 18, section 3. As a result, T １ About the 5th generation １ Target gene introduction into the primary leaves of the next generation was confirmed (mutation introduction efficiency: 3.5%) (see FIG. 3).

[0285] As shown in Examples 18 to 21, even if the size of the growing point at the tip of the stem (shoot apical meristem) of the plant varies, it was found that genome editing or genome-edited plants can be produced with high efficiency as long as the value P of Equation 1 is satisfied.

[0286] The present invention provides a genome editing method, which includes the step of shooting microparticles coated with at least one type of nucleic acid and at least one type of protein into the apex of a plant using a gene gun equipped with a stopping plate, wherein the value P represented by the following formula 1 is 0.8 to 5,000: P = (A / 2) ５ ×B×10 ４ / C ３ ... (Equation 1) In Equation 1, A represents the average particle diameter (μm) of the microparticles, B represents the gas pressure (psi) of the gene gun, and C represents the distance (mm) between the stopping plate of the gene gun and the shoot apex. <2> The genome editing method according to <1>, further comprising the step of contacting the shoot apex with a high osmotic pressure medium. <3> The genome editing method according to <1> or <2>, wherein the plant is a dicotyledonous plant. <4> The genome editing method according to <3>, wherein the dicotyledonous plant is a legume. <5> The genome editing method according to any one of <1> to <4>, comprising the step of growing the shoot apex bombarded with the microparticles. <6> The genome editing method according to any one of <1> to <5>, wherein the at least one nucleic acid comprises a gene of interest to be introduced into the plant genome. <7> The genome editing method according to any one of <1> to <6>, wherein the value P represented by Equation 1 is 0.8 or more and 250 or less. <8> A method for producing a genome-edited plant, comprising the steps of: shooting microparticles coated with at least one type of nucleic acid and at least one type of protein into the shoot apex of a plant using a gene gun equipped with a stopping plate; and growing the shoot apex into which the microparticles have been shot, wherein the value P represented by the following formula 1 is 0.8 or more and 5,000 or less: P = (A / 2) ５ ×B×10 ４ / C ３... (Formula 1) In Formula 1, A represents the average particle size (μm) of the microparticles, B represents the gas pressure (psi) of the gene gun, and C represents the distance (mm) between the stopping plate of the gene gun and the shoot apex. <9> The method for producing a genome-edited plant according to <8>, further comprising a step of contacting the shoot apex with a high osmotic pressure medium. <10> The method for producing a genome-edited plant according to <8> or <9>, wherein the plant is a dicotyledonous plant. <11> The method for producing a genome-edited plant according to <10>, wherein the dicotyledonous plant is a legume. <12> The method for producing a genome-edited plant according to any of <8> to <11>, wherein the at least one nucleic acid comprises a gene of interest to be introduced into the plant genome. <13> The method for producing a genome-edited plant according to any of <8> to <12>, wherein the value P represented by Formula 1 is 0.8 or more and 250 or less.

[0287] This application claims priority based on Japanese Patent Application No. 2023-177413 filed on October 13, 2023, the entire contents of which are incorporated herein by reference.

Claims

1. A genome editing method comprising a step of shooting microparticles coated with at least one type of nucleic acid and at least one type of protein into the shoot apex of a plant using a gene gun equipped with a stopping plate, wherein the value P represented by the following formula 1 is 0.8 or more and 5,000 or less: P = (A / 2) ５ ×B×10 ４ / C ３ In formula 1, A represents the "average particle diameter of microparticles (μm)", B represents the "gas pressure of the gene gun (psi)", and C represents the "distance between the stopping plate and the shoot apex in the gene gun (mm)".

2. The genome editing method of claim 1, further comprising a step of contacting the shoot tip with a high osmotic pressure medium.

3. The genome editing method described in claim 1, wherein the plant is a dicotyledonous plant.

4. The genome editing method described in claim 3, wherein the dicotyledonous plant is a legume.

5. The genome editing method described in claim 1, comprising a step of growing the shoot tip into which the microparticles have been bombarded.

6. The genome editing method of claim 1, wherein the at least one nucleic acid comprises a gene of interest to be introduced into the genome of a plant.

7. The genome editing method described in claim 1, wherein the value P represented by formula 1 is 0.8 or greater and 250 or less.

8. A method for producing a genome-edited plant, comprising the steps of: shooting microparticles coated with at least one type of nucleic acid and at least one type of protein into a shoot tip of a plant using a gene gun equipped with a stopping plate; and growing the shoot tip into which the microparticles have been shot, wherein the value P represented by the following formula 1 is 0.8 or more and 5,000 or less: P = (A / 2) ５ ×B×10 ４ / C ３ In formula 1, A represents the "average particle diameter of microparticles (μm)", B represents the "gas pressure of the gene gun (psi)", and C represents the "distance between the stopping plate and the shoot apex in the gene gun (mm)".

9. The method for producing a genome-edited plant described in claim 8, further comprising a step of contacting the shoot tip with a high osmotic pressure medium.

10. The method for producing a genome-edited plant described in claim 8, wherein the plant is a dicotyledonous plant.

11. The method for producing a genome-edited plant described in claim 10, wherein the dicotyledonous plant is a legume.

12. The method for producing a genome-edited plant described in claim 8, wherein the at least one nucleic acid comprises a gene of interest to be introduced into the genome of the plant.

13. A method for producing a genome-edited plant as described in claim 8, wherein the value P represented by formula 1 is 0.8 or more and 250 or less.