Method for producing corneal endothelial cells

Abstract

The present invention provides a method for producing corneal endothelial cells, the method comprising a step for culturing periocular neural crest cells by using a culture medium containing a fibroblast growth factor. The present invention makes it possible to provide corneal endothelial cells having characteristics close to that of corneal endothelial cells in a living body and having a quality enabling transplantation into a human.

Description

Method for producing corneal endothelial cells

[0001] The present invention relates to a method for producing corneal endothelial cells.

[0002] The cornea is a transparent tissue located at the front of the eyeball and has a five-layer structure. The corneal endothelial cell layer is a single cell layer located in the deep cornea. It has barrier and pump functions, and plays a role in maintaining corneal transparency by maintaining a constant corneal moisture content. Corneal endothelial diseases, including bullous keratopathy, are serious conditions that can lead to blindness. Therefore, corneal transplants are necessary, which require corneas donated by patients. However, the current situation for corneal transplants is characterized by a chronic donor shortage, resulting in thousands of patients waiting annually, as well as problems such as rejection of donor corneal transplants. While alternative methods, such as corneal epithelial sheet transplants using stem cells, have been developed, new therapies targeting corneal endothelial cells have yet to be fully developed.

[0003] Inducing human corneal endothelial cells from human pluripotent stem cells requires inducing periocular neural crests and then inducing corneal endothelial cells from them. Although several methods have been proposed, they only result in the induction of corneal endothelial-like cells (Non-Patent Document 1), and a method for inducing human corneal endothelial cells that can be evaluated as scientifically and clinically sufficient has not yet been developed.

[0004] The present inventors have developed a two-dimensional culture system that reproduces the development of the entire eye from human pluripotent stem cells (Non-Patent Documents 2 and 3). It is known that the concentric zone-like structures obtained in this culture system (self-formed ectodermal autonomous multi-zones: SEAMs) contain the major cell groups that make up the developing eye (corneal epithelium, retina, lens epithelium, etc.) at specific locations. Currently, first-in-human clinical studies are being conducted using corneal epithelial cell sheets prepared using the SEAM method.

[0005] The present inventors have reported that the transcription factor TFAP2B (Transcription Factor AP-2 Beta; AP-2β) is important for the differentiation of neural crest into corneal endothelial cells and for maintaining the high proliferation ability of corneal endothelial cells (Non-Patent Document 4).

[0006] Jiagang J. Zhao and Natalie A. Afshari, Invest Ophthalmol Vis Sci. 2016 Dec; 57(15): 6878-6884.Hayashi et al. Nature. 2016 Mar 17;531(7594):376-380.Hayashi et al. Nature Protocols, 2017, 12(4), 683-696.Hara et al. J Biol Chem. 2019, 294(7), 2460-2469.

[0007] An object of the present invention is to provide a method for producing corneal endothelial cells having properties closer to those of living corneal endothelial cells than corneal endothelial-like cells produced by conventional methods.

[0008] In order to solve the above-mentioned problems, the present invention encompasses the following inventions. [1] A method for producing corneal endothelial cells, comprising the step of culturing periocular neural crest cells in a medium containing a fibroblast growth factor. [2] The method according to [1] above, wherein the medium further contains a glycolytic inhibitor. [3] The method according to [2] above, wherein the glycolytic inhibitor is 2-deoxy-D-glucose. [4] The method according to any one of [1] to [3] above, wherein the periocular neural crest cells are periocular neural crest cells induced to differentiate from pluripotent stem cells. [5] The method according to any one of [1] to [3] above, wherein the periocular neural crest cells are periocular neural crest cells induced to differentiate from pluripotent stem cells via a SEAM cell population. [6] The method according to [4] or [5] above, wherein the pluripotent stem cells are human iPS cells. [7] A method for producing periocular neural crest cells, comprising the steps of forming a SEAM cell population from pluripotent stem cells and culturing cells from the SEAM cell population, including neural crest cells, in a medium containing a fibroblast growth factor. [8] The method according to [7], wherein the step of culturing cells from the SEAM cell population, including neural crest cells, in a medium containing a fibroblast growth factor comprises dispersing the cells of the SEAM cell population. [9] The production method according to [7], wherein the pluripotent stem cells are human iPS cells.

[0009] According to the present invention, it is possible to produce corneal endothelial cells having properties closer to those of living corneal endothelial cells compared to corneal endothelial-like cells produced by conventional methods, and to provide corneal endothelial cells of a quality suitable for transplantation into humans.

[0010] Figure 1 shows the results of immunofluorescence staining of the expression of human corneal endothelial cell markers (AP-2β, PITX2, and N-cadherin) in the cells obtained after detaching and dispersing a SEAM cell population induced from human iPS cells and culturing it on a Matrigel-coated culture dish using a differentiation medium containing basic fibroblast growth factor (bFGF), culturing the resulting spheroids in a corneal endothelial induction medium containing bFGF, and then cultured in the resulting cells. As a control for Figure 1, a SEAM cell population was detached and dispersing it on a Matrigel-coated culture dish using a differentiation medium lacking bFGF, culturing the resulting spheroids in a corneal endothelial induction medium containing bFGF, and then culturing the resulting cells in a corneal endothelial induction medium containing bFGF. Figure 1 shows the results of quantitative RT-PCR analysis of the expression of periocular neural crest (POM) cell markers (AP-2β, PITX2), corneal endothelial cell markers (ZP4, COL8A2), and neural retinal cell markers (MITF, CHX10) in the spheroids obtained after detaching and dissociating a SEAM cell population induced from human iPS cells and culturing it on Matrigel-coated culture dishes using bFGF-containing differentiation medium or bFGF-free differentiation medium. Figure 2 shows the results of immunofluorescence analysis of the expression of human corneal endothelial cell markers (AP-2β, PITX2, and N-cadherin) in the spheroids obtained after detaching and dissociating a SEAM cell population induced from human iPS cells and culturing it on Matrigel-coated culture dishes using bFGF-containing differentiation medium. As a control for Figure 4, a SEAM cell population induced from human iPS cells was detached and dispersed, and cultured on a Matrigel-coated culture dish using a differentiation medium containing bFGF. The resulting spheroids were cultured in a corneal endothelial induction medium containing no bFGF, and the expression of human corneal endothelial cell markers (AP-2β, PITX2, N-cadherin) in the resulting cells was observed by immunofluorescence staining.6 shows the results of immunofluorescence staining of the expression of human corneal endothelial cell markers (AP-2β, PITX2, and N-cadherin) in the cells obtained after detaching and dispersing a SEAM cell population induced from human iPS cells and culturing it on a type IV collagen-coated culture dish using a differentiation medium containing bFGF, culturing the resulting spheroids in a corneal endothelial induction medium containing bFGF, and then observing the expression of human corneal endothelial cell markers (AP-2β, PITX2, and N-cadherin) in the cells obtained. As a control for Fig. 6, a SEAM cell population induced from human iPS cells was detached and dispersing it on a type IV collagen-coated culture dish using a differentiation medium containing bFGF, culturing the resulting spheroids in a corneal endothelial induction medium without bFGF, and then observing the expression of human corneal endothelial cell markers (AP-2β, PITX2, and N-cadherin) in the cells obtained. 9 shows the results of immunofluorescence staining of the expression of human corneal endothelial cell markers (AP-2β, PITX2, and N-cadherin) in the cells obtained by detaching and dispersing a SEAM cell population induced from human iPS cells and culturing it on a type IV collagen-coated culture dish using a differentiation medium containing bFGF, and culturing the cells remaining on the culture dish using a corneal endothelial induction medium containing bFGF.

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097] [0098 FIG. 10 shows the results of immunofluorescence staining of the expression of human corneal endothelial cell markers (PITX2, N-cadherin) and retinal pigment epithelial cell marker (MITF) in cells cultured for 70 days using human iPS cells under the differentiation induction conditions of FIG.

[0011] [Method for producing corneal endothelial cells] The present invention provides a method for producing corneal endothelial cells. The method for producing corneal endothelial cells of the present invention may include a step of culturing periocular neural crest cells in a medium containing fibroblast growth factor (FGF). Herein, fibroblast growth factor may be abbreviated as "FGF." Periocular neural crest cells are also referred to as periocular mesenchymal (POM) cells. Herein, periocular neural crest may be abbreviated as "POM."

[0012] FGF is a type of growth factor involved in various vital phenomena such as embryonic development, angiogenesis, and wound healing, and 22 types of FGF (FGF1 to FGF14, FGF16 to FGF23) have been identified in humans. FGF1 is known as acidic FGF (aFGF), and FGF2 is known as basic FGF (bFGF). The FGF used in the method for producing corneal endothelial cells of the present invention is not particularly limited as long as it contributes to the induction of differentiation from periocular neural crest cells into corneal endothelial cells. The FGF used in the method for producing corneal endothelial cells of the present invention may be basic FGF. In this specification, basic FGF may be abbreviated as "bFGF."

[0013] Periocular neural crest cells can be identified by the expression of periocular neural crest cell markers such as PITX2, AP-2β, and FOXC1. Corneal endothelial cells can be identified by the expression of corneal endothelial cell markers such as PITX2, AP-2β, and N-cadherin, or by their characteristic structure in which hexagonal cells are regularly arranged in a cobblestone-like pattern. In particular, by confirming the expression of AP-2β as a corneal endothelial cell marker, it can be inferred that the produced corneal endothelial cells have properties closer to those of in vivo corneal endothelial cells (Non-Patent Document 4), and are considered to have a quality that allows them to be transplanted into humans.

[0014] The medium containing fibroblast growth factor (FGF) is not particularly limited, and a medium containing FGF added to a known medium suitable for culturing animal cells can be used. Examples of known animal culture media include BME medium, BMJb medium, CMRL1066 medium, Glasgow MEM (GMEM) medium, Improved MEM Zinc Option medium, Neurobasal medium, IMDM medium, Medium 199 medium, Eagle MEM medium, αMEM medium, DMEM medium, F-12 medium, DMEM / F12 medium, IMDM / F12 medium, Ham's medium, RPMI1640 medium, Fischer's medium, and mixtures thereof. The medium may be a known endothelial cell culture medium containing FGF. The medium may also be serum-free. Suitable serum-free media include commercially available serum-free supplements such as KnockOut Serum Replacement (KSR), N2 supplement, and B27 supplement. When producing corneal endothelial cells for transplantation, it is preferable to use a xeno-free medium.

[0015] The FGF concentration in the medium is not particularly limited, but when bFGF is used, it may be 1 ng / mL or more, 2 ng / mL or more, 3 ng / mL or more, 4 ng / mL or more, 5 ng / mL or more, or 10 ng / mL or less, 9 ng / mL or less, 8 ng / mL or less, 7 ng / mL or less, or 6 ng / mL or less. The bFGF concentration in the medium may be 2 ng / mL or 4 ng / mL.

[0016] The FGF-containing medium used in the method for producing corneal endothelial cells of the present invention may further contain a glycolytic inhibitor. The glycolytic inhibitor may be any inhibitor that inhibits glycolysis and inhibits ATP production, such as 2-deoxy-D-glucose (2DG). The concentration of 2DG in the medium is not particularly limited, but may be 2 mM or more, 4 mM or more, 6 mM or more, or 8 mM or more, or 20 mM or less, 18 mM or less, 16 mM or less, 14 mM or less, or 12 mM or less. The concentration of 2DG in the medium may be 10 mM.

[0017] The culture period is not particularly limited and can be appropriately set by observing the characteristic structure of cells expressing corneal endothelial cell markers and corneal endothelial cells. The culture period may be, for example, 5 weeks or more, 6 weeks or more, 7 weeks or more, 8 weeks or more, 9 weeks or more, or 10 weeks or more.

[0018] The periocular neural crest cells used in the method for producing corneal endothelial cells of the present invention are not particularly limited, and periocular neural crest cells obtained by known methods can be used, such as the method described by Atkinson-Leadbeater et al. (Dev Dyn. 2014 May;243(5):663-75. doi: 10.1002 / dvdy.24113. Epub 2014 Feb 24.) and the method described by Chen et al. (Invest Ophthalmol Vis Sci. 2018 Jun 1;59(7):3028-3036. doi: 10.1167 / iovs.17-23627.).

[0019] The periocular neural crest cells used in the method for producing corneal endothelial cells of the present invention are preferably periocular neural crest cells induced to differentiate from pluripotent stem cells via a SEAM cell population. Methods for inducing SEAM cell populations from pluripotent stem cells are known, and the methods described in Non-Patent Documents 2 or 3 can be used, for example. Known methods for inducing periocular neural crest cells from pluripotent stem cells via a SEAM cell population include, for example, the method described by Okubo et al. (J Biol Chem. 2020 Mar 13;295(11):3456-3465. doi: 10.1074 / jbc.RA119.010713. Epub 2020 Feb 7.).

[0020] Examples of pluripotent stem cells include embryonic stem (ES) cells, cloned embryonic stem (ntES) cells obtained by nuclear transfer, sperm stem (GS) cells, embryonic germ (EG) cells, induced pluripotent stem (iPS) cells, and pluripotent cells derived from cultured fibroblasts or bone marrow stem cells (Muse cells). ES cells, ntES cells, and iPS cells are preferred, with iPS cells being more preferred. Pluripotent stem cells are preferably mammalian pluripotent stem cells. Mammals include, but are not limited to, humans, non-human primates, dogs, cats, mice, rats, cows, pigs, sheep, and the like. Humans are particularly preferred. Using human pluripotent stem cells allows for the production of safe cell populations suitable for use in human regenerative medicine.

[0021] The present inventors have reported that SEAM cell populations contain neural crest cells (Non-Patent Document 2). Therefore, corneal endothelial cells produced by the method for producing corneal endothelial cells of the present invention using periocular neural crest cells induced to differentiate from pluripotent stem cells via a SEAM cell population are corneal endothelial cells that have differentiated through the developmental process of the human eye, have properties equivalent to those of in vivo corneal endothelial cells, and are thought to be corneal endothelial cells that can be transplanted into humans.

[0022] [Method for producing periocular neural crest cells] The present invention provides a method for producing periocular neural crest (POM) cells. The method for producing POM cells of the present invention may include the steps of forming a SEAM cell population from pluripotent stem cells and culturing cells in the SEAM cell population, including neural crest cells, in a medium containing fibroblast growth factor. POM cells produced by the method for producing POM cells of the present invention can be suitably used as the POM cells in the method for producing corneal endothelial cells of the present invention. Furthermore, POM cells produced by the method for producing POM cells of the present invention can be suitably used to produce various somatic cells that differentiate via POM cells.

[0023] The step of forming a SEAM cell population from pluripotent stem cells can be carried out using known methods, for example, as described in Non-Patent Documents 2 or 3.

[0024] (1) First Embodiment The first embodiment of the method for producing POM cells of the present invention involves dissociating cells from a SEAM cell population. Specifically, this method can be carried out by detaching and dissociating a SEAM cell population, and then culturing the dispersed cells in a medium containing FGF. That is, in this first embodiment of the method for producing POM cells of the present invention, cells obtained by detaching and dissociating a SEAM cell population can be used as the "cells containing neural crest cells from the SEAM cell population." Because the present inventors have reported that SEAM cell populations contain neural crest cells (Non-Patent Document 2), the identification of neural crest cells in dispersed cells from a SEAM cell population may be omitted. The FGF is not particularly limited and may also be bFGF. Neural crest cells in dispersed cells from a SEAM cell population can be identified by expressing neural crest cell markers. Examples of neural crest cell markers include SOX10, SOX9, AP-2β, and p75NTR.

[0025] The medium containing FGF is not particularly limited, and a medium obtained by adding FGF to a known medium suitable for culturing animal cells can be used, similar to the medium used in the method for producing corneal endothelial cells of the present invention. The concentration of FGF in the medium is not particularly limited. For example, when bFGF is used, the concentration may be 1 ng / mL or more, 5 ng / mL or more, 7 ng / mL or more, 8 ng / mL or more, 9 ng / mL or more, or 10 ng / mL or more, or 20 ng / mL or less, 15 ng / mL or less, 13 ng / mL or less, 12 ng / mL or less, or 11 ng / mL or less. A suitable medium containing FGF is, for example, the differentiation medium described in Example 1 below supplemented with FGF.

[0026] For the culture, a culture dish coated with an extracellular matrix may be used. The extracellular matrix is ​​not particularly limited as long as it is a known extracellular matrix used for cell culture. Examples include Matrigel (trade name), type I collagen, type IV collagen, laminin, fibronectin, vitronectin, etc.

[0027] In the first embodiment, when dispersed cells of a SEAM cell population are cultured as adherent cells, they separate into cells that form floating spheroids during the culture period and cells that remain adherent without forming spheroids, but the present inventors have confirmed that POM cells are present among both the cells that form spheroids and the cells that remain adherent. Therefore, the spheroid cells may be collected and subjected to the method for producing corneal endothelial cells of the present invention, or the cells that remain adherent may be subjected to the method for producing corneal endothelial cells of the present invention, or the spheroid cells and adherent cells may be subjected to the method for producing corneal endothelial cells of the present invention without being separated.

[0028] The culture period is not particularly limited and can be appropriately set by confirming the appearance of cells expressing POM cell markers. The culture period may be 5 days or more, 1 week or more, 2 weeks or more, 3 weeks or more, 4 weeks or more, 5 weeks or more, 6 weeks or more, 7 weeks or more, or 15 weeks or less, 12 weeks or less, 10 weeks or less, 9 weeks or less, or 8 weeks or less.

[0029] (2) Second Embodiment A second embodiment of the method for producing POM cells of the present invention can be carried out by recovering spheroids formed from the second layer of a SEAM cell population and culturing the spheroids in a medium containing FGF. That is, in this second embodiment of the method for producing POM cells of the present invention, spheroids formed from the second layer of a SEAM cell population can be used as "cells containing neural crest cells in a SEAM cell population." The present inventors have reported that when a SEAM cell population is cultured, spheroids formed from cells in the second layer contain neural crest cells (Non-Patent Document 2), so the identification of neural crest cells in the spheroids may be omitted. The FGF is not particularly limited and may be bFGF.

[0030] The FGF-containing medium may be a medium prepared by adding FGF to a known medium suitable for culturing animal cells, similar to the medium used in the method for producing corneal endothelial cells of the present invention. The FGF concentration in the medium is not particularly limited. For example, when bFGF is used, the concentration may be 1 ng / mL or more, 2 ng / mL or more, 3 ng / mL or more, 4 ng / mL or more, or 5 ng / mL or more, or 10 ng / mL or less, 9 ng / mL or less, 8 ng / mL or less, 7 ng / mL or less, or 6 ng / mL or less. The FGF-containing medium used in the second embodiment preferably further contains a ROCK inhibitor. For example, the periocular neural crest induction medium (POMM) described in Example 6 below can be used as an FGF-containing medium.

[0031] The culture dish preferably has a low-adhesion surface treatment, but is not limited thereto. The culture period is not particularly limited and can be appropriately set by confirming the appearance of cells expressing POM cell markers. The culture period may be 4 days or more, 5 days or more, 6 days or more, or 7 days or more, or 12 days or less, 11 days or less, 10 days or less, 9 days or less, or 8 days or less. Small spheroids containing neural crest cells at the start of culture proliferate and differentiate during the culture period, and can be recovered as large spheroids containing POM cells.

[0032] [Method for producing corneal endothelial cells from pluripotent stem cells] The present invention provides a method for producing corneal endothelial cells from pluripotent stem cells, which is a combination of the first embodiment of the method for producing POM cells of the present invention and the method for producing corneal endothelial cells of the present invention. The present invention also provides a method for producing corneal endothelial cells from pluripotent stem cells, which is a combination of the second embodiment of the method for producing POM cells of the present invention and the method for producing corneal endothelial cells of the present invention. These inventions make it possible to provide corneal endothelial cells that have been induced to differentiate via the developmental process of the human eye.

[0033] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0034] Example 1: Investigation of a method for inducing differentiation of human iPS cells into human corneal endothelial cells (1) Induction of differentiation of iPS cells into a SEAM cell population Human iPS cell line 201B7 was obtained from the RIKEN BioResource Center. Laminin 511E8 (iMatrix-511 silk, Nippi) was added at 0.5 μg / cm 2 The cells were seeded onto culture dishes coated with 10% DM1 at a concentration of 0.1% and maintained in StemFit medium (Ajinomoto) for 10 days, followed by 17 days of culture in differentiation medium (GMEM (Life Technologies) containing 10% knockout serum replacement (KSR, Life Technologies), 1 mM sodium pyruvate (Life Technologies), 0.1 mM non-essential amino acids (Life Technologies), 2 mM L-glutamine (Life Technologies), 55 μM monothioglycerol (Wako), penicillin, and streptomycin) to induce SEAM cell populations. Note that, because the present inventors have reported that SEAM cell populations contain neural crest cells (see Non-Patent Document 2), neural crest markers were not examined in Examples 1-5.

[0035] (2) Culture of Dispersed SEAM Cell Populations The obtained SEAM cell population was washed with PBS, and the cells were detached using Accutase. The detached cells were collected by centrifugation and suspended in differentiation medium (DM). Differentiation medium containing 10 ng / mL of bFGF (FUJIFILM) (FGF+) and differentiation medium without bFGF (FGF-) were used. 1.4 × 10 cells were cultured in a 12-well culture plate (containing 1 mL of DM) coated with 1% Matrigel. 6 Cells were seeded at 1000 cells / mL and cultured for 12 weeks. During the culture period, floating spherical cell clusters (spheroids) were formed in the culture dish, regardless of the presence or absence of bFGF.

[0036] (3) Recovery of spheroids and induction of differentiation into human corneal endothelial cells by adhesion culture After 12 weeks of culture, the spheroids were recovered from the culture dishes and subjected to adhesion culture for 6 weeks on a 24-well culture plate (Falcon) using corneal endothelial induction medium (HESFM; Human Endothelial SFM (Gibco) containing 5% FBS, 0.3 mM L-ascorbic acid 2-phosphate, 1 μM SB431542, 10 μM Y-27632, penicillin, streptomycin, and 2 ng / mL bFGF).

[0037] (4) Immunofluorescence staining. Immunofluorescence staining was performed on cells after 6 weeks of adherent culture. The medium was removed, and 4% paraformaldehyde was added to the wells to fix the cells. The wells were then washed three times for 10 minutes with Tris-buffered saline (TBS, TaKaRa Bio). To block nonspecific reactions, the wells were incubated for 1 hour with TBS containing 5% donkey serum and 0.3% Triton X-100. The wells were then incubated overnight at 4°C with a primary antibody for detecting human corneal endothelial cell markers. The wells were then washed three times for 10 minutes with TBS, incubated overnight at 4°C with a 1:500 dilution of Alexa Fluor 488-, 568-, or 647-conjugated secondary antibody (Life Technologies) and a 1:100 dilution of Hoechst 33342 (Molecular Probes), and washed three times for 10 minutes with TBS. The primary antibodies used were anti-AP-2β (Cell Signaling Technology, #2509, Rabbit), anti-PITX2 (Abcam, ab55599, Mouse), and anti-N-cadherin (R&D Systems, AF6426, Sheep). Observations were performed under a fluorescence microscope (Axio Observer.D1, Carl Zeiss).

[0038] (5) Results The results of immunofluorescent staining for the FGF+ group are shown in Figure 1, and the results for immunofluorescent staining for the FGF- group are shown in Figure 2. In the FGF+ group, a structure characterized by hexagonal cells arranged in a regular, cobblestone-like pattern, which is characteristic of human corneal endothelial cells, was observed (see phase-contrast microscope image), and the human corneal endothelial cell markers AP-2β, PITX2, and N-cadherin were all expressed. In contrast, in the FGF- group, neither the characteristic structure nor the expression of human corneal endothelial cell markers was observed.

[0039] Example 2: Investigation of a method for inducing differentiation of human iPS cells into human corneal endothelial cells 2 (1) Induction of differentiation of iPS cells into a SEAM cell population A SEAM cell population was induced using the same method as in Example 1 (1), except that the culture period was changed to 21 days.

[0040] (2) Culturing of Dispersed SEAM Cell Populations SEAM cell populations were detached using the same method as in Example 1(2), and cell suspensions were prepared in differentiation medium containing bFGF (FGF+) and differentiation medium lacking bFGF (FGF-), respectively. These cells were then seeded onto culture dishes coated with 1% Matrigel. After five days of adherent culture, spheroids were harvested from the culture dishes.

[0041] (3) Quantitative RT-PCR Total RNA was isolated from the recovered spheroids using Sepasol-RNA I Super G (Nacalai Tesque, Cat. 09379-55). Reverse transcription was performed using the SuperScript III First-Strand Synthesis System for RT-PCR (Thermo Fisher) according to the manufacturer's protocol, and PCR was performed using the resulting cDNA as a template. SYBR Green (Thermo Fisher) was used as a fluorescent probe. The thermocycling program consisted of an initial cycle at 95°C for 20 seconds, followed by 40 cycles of 95°C for 3 seconds, followed by 95°C for 15 seconds and 60°C for 60 seconds. The primers used are listed below. AP2β-F: TTCCTCCCAAATCGGTGACTT (SEQ ID NO: 1) AP2β-R: CGCCGGTGTTGACAGACAT (SEQ ID NO: 2) PITX2-F: GCCAAGGGCCTTACATCCG (SEQ ID NO: 3) PITX2-R: GGTGGGGAAAACATGCTCTG (SEQ ID NO: 4) ZP4-F: GACTGTGGCACCTGGATAAGA (SEQ ID NO: 5) ZP4-R: TCCCACTCAGTGACATAGCAG (SEQ ID NO: 6) COL8A2-F: GAGCCAGGAATACGAGGGGA (SEQ ID NO: 7) COL8A2-R: TCCAGGGATAGTAATGCCTGAG (SEQ ID NO: 8) MITF-F: AGAGTCTGAAGCAAGAGCACTG (SEQ ID NO: 9) MITF-R: TGCGGTCATTTATGTTAAATCTTC (SEQ ID NO: 10) CHX10-F: GGCGACACAGGACAATCTTTA (SEQ ID NO: 11) CHX10-R :GGCAGCTCCGTTTTCATGG (SEQ ID NO: 12)

[0042] (4) Results The results are shown in Figure 3. (A) AP-2β (a marker for primary retinal myocytes), (B) PITX2 (a marker for primary retinal myocytes), (C) ZP4 (a marker for corneal endothelial cells), (D) COL8A2 (a marker for corneal endothelial cells), (E) MITF (a marker for neural retinal cells), and (F) CHX10 (a marker for neural retinal cells). Cells in the FGF+ group expressed the POM markers AP-2β and PITX2, as well as the corneal endothelial cell markers ZP4 and COL8A2, but not the neural retinal cell markers MITF and CHX10. In contrast to the FGF+ group, cells in the FGF− group expressed neural retinal cell markers (MITF and CHX10), but barely expressed the POM markers (AP-2β and PITX2) and the corneal endothelial cell markers (ZP4 and COL8A2). These results demonstrated that FGF is essential for inducing differentiation of neural crest cells contained in the SEAM cell population into POM.

[0043] Example 3: Study 1 on the usefulness of FGF in inducing differentiation of spheroids formed in FGF-containing medium into corneal endothelial cells (1) (1) Recovery and culture of spheroids A SEAM cell population was induced in the same manner as in Example 1(1), except that the culture period was changed to 14 days. The SEAM cell population was detached in the same manner as in Example 1(2), and a cell suspension was prepared in a differentiation medium containing bFGF. The cells were then seeded onto a 12-well culture plate coated with 1% Matrigel and cultured for 12 weeks. After 12 weeks of culture, the spheroids were recovered from the culture dish and subjected to adhesion culture on a 24-well culture plate for 9 weeks using a corneal endothelial induction medium containing bFGF (FGF+) or a corneal endothelial induction medium not containing bFGF (FGF-).

[0044] (2) Immunofluorescence staining Immunofluorescence staining of the cells after 9 weeks of adherent culture was carried out in the same manner as in Example 1(4).

[0045] (3) Results The results of immunofluorescence staining for the FGF+ group are shown in Figure 4, and the results for the FGF- group are shown in Figure 5. In the FGF+ group, a structure characterized by hexagonal cells arranged in a regular, cobblestone-like pattern was observed (see phase-contrast microscopy image), and the human corneal endothelial cell markers AP-2β, PITX2, and N-cadherin were all expressed. In contrast, in the FGF- group, there were only a few cells with the characteristic structure of human corneal endothelial cells, and the expression levels of human corneal endothelial cell markers were also low. These results demonstrated that FGF is essential for inducing differentiation of POM into corneal endothelial cells.

[0046] Example 4: Study 2 on the usefulness of FGF in inducing differentiation of spheroids formed in an FGF-containing medium into corneal endothelial cells (1) Experimental method The same method as in Example 3 was used, except that the coating extracellular matrix was changed from Matrigel to type IV collagen (Cellmatrix Type IV, Nitta Gelatin). Cellmatrix Type IV (3 mg / mL) was diluted 20-fold with hydrochloric acid (pH 3) and used to coat a culture dish.

[0047] (2) Results The results of immunofluorescent staining for the FGF+ group are shown in Figure 6, and the results for immunofluorescent staining for the FGF- group are shown in Figure 7. In the FGF+ group, a structure characterized by hexagonal cells arranged in a regular, cobblestone-like pattern was observed (see phase-contrast microscopy image), and the human corneal endothelial cell markers AP-2β, PITX2, and N-cadherin were all expressed. In contrast, in the FGF- group, there were fewer cells with the characteristic structure of human corneal endothelial cells, and the expression levels of human corneal endothelial cell markers were also low. These results demonstrate that the same results can be obtained even if the extracellular matrix used for coating is changed.

[0048] Example 5: Induction of differentiation into corneal endothelial cells from remaining adherent cells after recovery of spheroids formed in a medium containing FGF (1) Experimental method Using the same method as in Example 4, a dispersed SEAM cell population was seeded onto a 12-well culture plate coated with type IV collagen and cultured for 12 weeks, and spheroids were recovered from the culture dish. Subsequently, the adherent cells remaining on the culture dish were cultured for 9 weeks in a corneal endothelial induction medium containing bFGF. The cells after 9 weeks of adhesion culture were subjected to immunofluorescence staining using the same method as in Example 1 (4).

[0049] (2) Results The results are shown in Figure 8. A structure characterized by hexagonal cells arranged in a regular, cobblestone-like pattern was observed (see phase-contrast microscope image), and the human corneal endothelial cell markers AP-2β, PITX2, and N-cadherin were all expressed. These results demonstrated that the differentiation of dispersed SEAM cell populations into POM cells, which are induced by culturing them in a differentiation medium containing FGF, is not limited to cells that form spheroids, but is also present in adherent cells that do not form spheroids.

[0050] Example 6: Examination of the utility of 2DG in inducing differentiation of POM into corneal endothelial cells. (1) Differentiation Induction Conditions. Figure 9 shows the conditions for inducing differentiation of human iPS cells into corneal endothelial cells used in this example. In this example, the 201B7 cell line and the AP2β-EGFP / PITX2-E2-Crimson reporter iPS cell line were used as human iPS cells. These reporter iPS cell lines were generated by transfecting iPS cells with a targeting gene containing a drug resistance gene via genome editing using CRISPER / Cas9. As in Example 1, human iPS cells were maintained in StemFit medium for 10 days (0 d) and then cultured for 1 day in differentiation medium (DM) supplemented with 3 μM CHIR99021. Subsequently, the cells were cultured in differentiation medium without CHIR99021 for 16 days to induce SEAM cell populations. Neural crest cell clusters that formed in zone 2 of the SEAM cell population were collected as spheroids (17 d). The recovered spheroids were transferred to low-adhesion culture dishes (Sumitomo Bakelite MS-1160R) and cultured in suspension in periocular neural crest induction medium (POMM; DMEM / F12 containing 20% ​​knockout serum replacement, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 2 mM L-glutamin, 55 μM monothioglycerol, 10 μM Y-27632, penicillin, streptomycin, and 4 ng / mL bFGF) for 7 days to induce POM. Spheroidal POM were then collected (24 d). The recovered spheroidal POM were seeded on culture dishes coated with type I collagen (Cellmatrix Type I-A, Nitta Gelatin) and cultured for 70 days (70 d) in the corneal endothelial induction medium described in Example 1(3) supplemented with 10 mM 2-deoxy-D-glucose (2DG).

[0051] (2) Immunofluorescence staining at 17d and 24d. AP-2β expression in 17d and 24d cells was confirmed by the expression of the AP2β-EGFP reporter gene (green fluorescence), and PITX2 expression was confirmed by the expression of the PITX2-E2-Crimson reporter gene (red fluorescence).

[0052] (3) Immunofluorescence staining at 70 days: Immunofluorescence staining of 70-day-old cells was performed using the same method as in Example 1(4). Anti-PITX2, anti-N-cadherin, and anti-MITF antibodies were used as primary antibodies. PITX2 and N-cadherin are corneal endothelial cell markers. MITF, a retinal pigment epithelial cell marker, was used as a negative control.

[0053] (4) Results. The results of reporter gene expression at 17 and 24 days are shown in Figure 10. AP-2β-positive neural crest cell clusters (spheroids) were observed in the SEAM cell population induced by culturing in DM medium for 17 days. Neural crest cell spheroids collected on 17 days were cultured in periocular neural crest induction medium, and the resulting spheroids at 24 days were positive for AP-2β and PITX2, indicating differentiation into POM.

[0054] The results of immunofluorescence staining at 70 days are shown in Figure 11. When POM spheroids recovered at 24 days were adherently cultured on type I collagen-coated culture dishes using corneal endothelial induction medium (HESFM) containing bFGF and 2DG, a structure characterized by a regular arrangement of hexagonal cells resembling cobblestones was observed, which is characteristic of human corneal endothelial cells. Furthermore, the human corneal endothelial cell markers PITX2 and N-cadherin were expressed, but the retinal pigment epithelial cell marker MITF was not.

[0055] The present invention is not limited to the above-described embodiments and examples, and various modifications are possible within the scope of the claims. The technical scope of the present invention also includes embodiments obtained by appropriately combining the technical means disclosed in different embodiments. Furthermore, all academic literature and patent documents described in this specification are incorporated herein by reference.

Claims

1. A method for producing corneal endothelial cells, comprising a step of culturing periocular neural crest cells in a medium containing fibroblast growth factor.

2. The method of claim 1, wherein the medium further contains a glycolytic inhibitor.

3. The method according to claim 2, wherein the glycolysis inhibitor is 2-deoxy-D-glucose.

4. The manufacturing method described in claim 1, wherein the periocular neural crest cells are periocular neural crest cells induced to differentiate from pluripotent stem cells.

5. The method of claim 1, wherein the periocular neural crest cells are periocular neural crest cells induced to differentiate from pluripotent stem cells via a SEAM cell population.

6. The method of claim 4 or 5, wherein the pluripotent stem cells are human iPS cells.

7. A method for producing periocular neural crest cells, comprising the steps of forming a SEAM cell population from pluripotent stem cells and culturing cells including neural crest cells in the SEAM cell population using a medium containing fibroblast growth factor.

8. The method of claim 7, wherein the step of culturing cells comprising neural crest cells in a SEAM cell population with a medium containing a fibroblast growth factor comprises dispersing the cells of the SEAM cell population.

9. The method of claim 7, wherein the pluripotent stem cells are human iPS cells.