Identification method of Acacia mangium tree species from Acacia wood by using a single nucleotide polymorphism marker
A single nucleotide polymorphism marker for the trnK_Acacia region of the chloroplast gene enables accurate identification of Acacia mangium, addressing the challenge of anatomical confusion and supporting the domestic timber industry by preventing illegal logging.
Patent Information
- Application Number
- KR1020240189421
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-12-18
- Publication Date
- 2026-07-21
- Estimated Expiration
- 2044-12-18
AI Technical Summary
Existing methods struggle to accurately identify Acacia mangium species in imported hardwoods due to anatomical similarities with other woods, necessitating the development of DNA-based species identification technology.
A single nucleotide polymorphism marker composition using a primer set specific to the trnK_Acacia region of the chloroplast gene is developed, enabling accurate identification of Acacia mangium through PCR amplification and sequencing.
The marker composition allows precise identification of Acacia mangium from wood samples, addressing the challenge of illegal logging by ensuring accurate species verification and supporting the domestic timber industry.
Smart Images

Figure R1020240189421_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a method for identifying the species of Acacia mangium from wood using a single nucleotide polymorphism marker, and more specifically, to a single nucleotide polymorphism marker composition for identifying the species of Acacia mangium from DNA isolated from Acacia wood, a major hardwood imported into Korea, a kit for identifying Acacia mangium from DNA isolated from wood containing the composition, and a method for identifying Acacia mangium from wood using the composition. Background Technology
[0003] A Forest Action Plan to address illegal logging was adopted to mitigate climate change and preserve forests worldwide (G8 Summit, 1998). The Asia-Pacific Economic Partnership (APEC) recommended the introduction of laws and systems to prevent the trade of illegally harvested timber or timber products (APEC, 2012). Accordingly, the Korea Forest Service amended the Act on Sustainable Use of Timber (Timber Use Act) and has been operating the 'Legal Timber Trade Promotion System' in earnest since 2018. The Legal Timber Trade Promotion System is a system in which documents proving that timber and timber products were legally harvested are submitted prior to customs clearance when importing them.
[0004] According to the Korea Forest Service's survey on timber utilization, Korea imported 73.8% of its total timber consumption as of 2022, indicating a high dependence on imports. In the case of logs, 46.1% of purchased logs were imported, with imported hardwood logs accounting for 6.2% of this total. Regarding wood products, it was found that 80.4% of sawn timber, 100% of plywood, and 92.1% of preservative-treated timber were imported hardwoods, revealing a high proportion of imported hardwoods in wood products such as sawn timber.
[0005] Under the Legal Timber Trade Promotion System, the legality of imported timber and wood products is generally verified through document inspection. However, there are limitations to proving legality solely through documentation when tree species names are incorrectly listed or when the documentation is incomplete. Korea’s timber self-sufficiency rate stands at 15% as of 2022, and imported logs are reprocessed into pulp, boards, sawn timber, and plywood for export. Therefore, the development of timber species identification technology is necessary to prevent damage to the domestic industry and establish a foundation for smooth exports by verifying the consistency between declared document information and the actual timber, thereby identifying risks of illegal logging—such as inadequate oversight in importing countries.
[0006] Techniques for identifying wood species include anatomical methods, genetic methods (DNA barcoding, population genetics, phytogeography, and DNA profiling), and chemical methods (mass spectrometry and near-infrared spectroscopy). Among these, DNA barcoding, a genetic method, is a DNA sequence-based technology that identifies plant species in an efficient and accurate manner by identifying species-specific regions within the DNA sequence. Chloroplast DNA information is utilized in DNA barcoding species identification technology. Chloroplast DNA is haploid with no genetic recombination and a very low mutation rate; therefore, it is primarily used in species identification research because genetic variations that occurred prior to speciation are inherited conservedly within the species after speciation. In particular, single nucleotide variations resulting from differences in a single base sequence within specific DNA regions, such as genes, have low mutation rates and can provide stable information for species identification.
[0007] An analysis of timber import declarations submitted to the Korea Forest Service from 2019 to 2021 revealed that out of a total of 37,883 import declarations for hardwoods, 10,085 (approximately 27%) had unclear tree species. Compared to conifers, hardwoods often lack clear species names and are frequently listed using common names such as acacia, meranti, or albizia. In particular, when multiple species are mixed, such as in imported hardwood plywood, tariff rates vary by species; however, there are technical difficulties in clearly identifying the specific species of hardwoods.
[0008] Although several DNA markers for identifying coniferous tree species have been developed (Patent Registration Nos: 10-1634346, 10-1718707, 10-1793911), there is a need for the development of DNA markers using species-specific genetic information for imported hardwoods.
[0009] Acacia wood is a high-quality timber that is widely imported into Korea. An analysis of import declaration documents by country of origin and species reveals that Vietnam is the largest importing country, and among the species imported from Vietnam, acacia is the most imported single species. While it was originally imported as wood products such as laminated panels, recently it is used as raw logs or processed into flooring or boards. It is primarily useful for display cabinets, furniture, and flooring. The Vietnamese acacia wood mainly imported into Korea is primarily Acacia mangium ( Acacia mangiumIt is known as a species. Native to Australia, Indonesia, and Papua New Guinea, it was introduced and bred in Vietnam and is utilized as a major export timber resource. Anatomically, acacia wood is similar to other imported woods, such as albigia and mahogany, in terms of color characteristics and anatomical identification features. This presents limitations in accurately identifying wood species using anatomical identification, which is the standard method for identifying wood species, and thus requires the development of DNA-based species identification analysis technology. The problem to be solved
[0011] Accordingly, the inventors continued their research to develop a DNA marker for identifying Acacia mangium, a species of hardwood that is mainly imported. As a result, they discovered a single nucleotide polymorphism marker in the chloroplast DNA of Acacia mangium that distinguishes it from other species, and developed a primer that is specific to this marker and can be amplified from DNA isolated from wood, thereby completing the present invention.
[0012] Therefore, the object of the present invention is to provide a single nucleotide polymorphism marker composition for identifying Acacia mangium in DNA isolated from wood.
[0013] The object of the present invention is to provide a kit for identifying Acacia mangium in DNA isolated from wood comprising the single nucleotide polymorphism marker composition.
[0014] The object of the present invention is to provide a method for identifying acacia mangium from wood using the single base polymorphism marker composition or kit. means of solving the problem
[0016] To achieve the objective of the present invention, a single nucleotide polymorphism marker composition for identifying Acacia mangium in DNA isolated from wood is provided.
[0017] In the present invention, the single nucleotide polymorphism marker composition is trnIt includes a primer set of forward primer of SEQ ID NO. 1 and reverse primer of SEQ ID NO. 2 that are specific to the acacia mangium species-specific single nucleotide polymorphism marker trnK_Acacia within the K chloroplast gene.
[0018] The inventors [have] a method for distinguishing tree species, particularly species of the genus Acacia and Acacia mangium. trn A novel single nucleotide polymorphism marker, trnK_Acacia, was discovered within the K chloroplast gene, and primers (sequence numbers 1 and 2) that specifically amplify this single nucleotide polymorphism marker were discovered (Table 2, Figure 2).
[0019] In the present invention, the term 'single nucleotide polymorphism marker' may refer to a single polymorphic nucleotide (SNP) that indicates polymorphism occurring within a nucleotide sequence and enables identification of species, or a primer capable of amplifying it.
[0020] In the present invention, the term 'primer' refers to a short nucleic acid sequence having a short free 3' terminal hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template strand replication. A 'primer set (pair)' refers to a combination of a forward primer and a reverse primer.
[0021] In the present invention, the primer can initiate DNA synthesis in the presence of a reagent for a polymerization reaction (i.e., DNA polymerase or reverse transcriptase) and four different deoxyribonucleotides at an appropriate buffer solution and temperature. Additionally, the base sequence of the primer can be modified using a label that can provide a detectable signal directly or indirectly. Examples of labels include radioactive isotopes, fluorescent molecules, and biotin.
[0022] The present invention, in order to develop a DNA marker for identifying *Acacia mangium* from DNA isolated from wood, compared and analyzed the chloroplast DNA of 21 species of the genus *Acacia*, and found that among the chloroplast genes trn A single nucleotide polymorphism (SNP) marker capable of distinguishing *Acacia mangium* from species of the genus *Acacia* was discovered in the K region and selected as the target gene (Table 1). Specifically, trn It was confirmed that a species-specific sequence variation exists, as only the acacia mangium gene consists of the base 'C' at the 524 bp position of the K chloroplast gene sequence (sequence no. 3) (Table 1, Fig. 2).
[0023] The forward primer sequence of SEQ ID NO. 1 and the forward primer sequence of SEQ ID NO. 2, which are specific to the above single nucleotide polymorphism marker, can be usefully used as markers for identifying the Acacia mangium species in DNA isolated from wood (Fig. 4).
[0024] In the single nucleotide polymorphism marker composition for identifying Acacia mangium in the present invention, the set of forward primer of SEQ ID NO. 1 and reverse primer of SEQ ID NO. 2 is Acacia mangium trn K specifically amplifies a single nucleotide polymorphism site within the chloroplast gene (346 bp, Table 2, Fig. 1).
[0025] According to another object of the present invention, the present invention provides a kit for identifying Acacia mangium in DNA isolated from wood comprising the single nucleotide polymorphism marker composition.
[0026] The kit of the present invention may be a PCR kit. The kit may additionally include DNA polymerase, deoxynucleotides (dNTPs), PCR buffer solution, test tubes, suitable containers, etc. Additionally, it may include a set of primers specific to a gene used as a quantitative control.
[0027] The kit of the present invention may additionally include a user guide describing optimal reaction execution conditions. The guide is a printed document explaining the use of the kit, for example, the method of preparing PCR buffer, the presented reaction conditions, etc. The guide includes instructions in the form of a pamphlet or leaflet, a label attached to the kit, and on the surface of a package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media such as the Internet.
[0028] According to another object of the present invention, the present invention provides a method for identifying acacia mangium from wood using the single base polymorphism marker composition or kit.
[0029] The above method
[0030] i) Step of isolating DNA from wood;
[0031] ii) a step of performing a PCR reaction using the isolated DNA and the single nucleotide polymorphism marker composition or the kit; and
[0032] iii) a step of analyzing the amplified product of the PCR reaction; includes.
[0033] Step i) Isolation of wood DNA
[0034] DNA is isolated from wood.
[0035] Wood is detached from the sapwood, more preferably from the sapwood adjacent to the bark, to prepare a wood sample for use in DNA isolation.
[0036] In the present invention, 'sapwood' refers to the sapwood portion of wood. When looking at the cross-section of a felled tree, there is a darker colored part from the pith and a lighter colored part outside of it; the wood in the center, which is darker colored, is called heartwood, and the wood in the lighter colored part is called sapwood.
[0037] The method of preparing wood samples can be to produce them in powder form by freezing and crushing the wood after removing it, to produce them in the form of wood chips using a drill with a blade diameter of 2 to 6 mm, or to produce them in the form of sawdust by grinding the wood with sandpaper after removing it.
[0038] DNA can be isolated from wood samples using a DNA extraction kit.
[0039] In the present invention, 'DNA extraction kit' refers to a DNA extraction kit for plants. A DNA extraction kit typically includes a lysis buffer, a DNA purification means, a DNA concentration means, a DNA washing means, and a DNA elution means, and is commercially readily available. For example, the DNeasy plant mini kit (Qiagen) may be used, but is not limited thereto.
[0040] Step ii) PCR reaction
[0041] A PCR reaction is performed using the isolated DNA and the single nucleotide polymorphism marker composition or the kit.
[0042] PCR reactions may utilize methods known in the art, such as Polymerase Chain Reaction, multiplex Polymerase Chain Reaction (multiplex PCR), competitive Polymerase Chain Reaction, real-time Polymerase Chain Reaction, real-time quantitative Polymerase Chain Reaction, DNA chips, or loop-mediated isothermal amplification.
[0043] Step iii) Analysis of PCR reaction amplification products
[0044] Analyze the amplification product of the PCR reaction.
[0045] The above analysis is performed by sequencing analysis of the PCR product using the primer set of SEQ ID NO. 1 and SEQ ID NO. 2 according to the present invention.
[0046] DNA sequencing analysis may utilize methods known in the art. Effects of the invention
[0048] By using the single base polymorphism marker composition, kit, and method according to the present invention, the Acacia mangium species can be identified from wood.
[0049] Accordingly, the single nucleotide polymorphism marker composition, kit, and method according to the present invention can identify Acacia mangium, a species of Vietnamese acacia wood mainly imported into Korea that is difficult to accurately identify anatomically, thereby identifying the risk of illegal logging due to inadequate management in hardwood exporting countries and establishing a foundation for preventing damage to the domestic industry.
[0050] Acacia mangium, a major tree species recently imported from Vietnam and other places ( Acacia mangium As it is widely used in the fields of architecture, construction, and interior design for purposes such as display cabinets, furniture, and flooring, the single base polymorphism marker composition, kit, and method according to the present invention can identify Acacia mangium from wood, which is anatomically indistinguishable, thereby enabling the detection and eradication of the illegal distribution of imported hardwood. Accordingly, it can contribute to the development of the fields of architecture, construction, and interior design through the sound distribution of imported hardwood. Brief explanation of the drawing
[0052] Figure 1 shows the nucleotide sequence of the trnK region of the chloroplast gene of Acacia mangium. The total length is 802 bp. Figure 2 shows the single nucleotide polymorphism (SNP) locations in the Acacia mangium trnK chloroplast gene that identify the Acacia mangium species. Within the 802 bp nucleotide sequence of the trnK chloroplast gene, the 524th (bp) site, 'C', is the single nucleotide polymorphism location that identifies it from other species of the Acacia genus. In addition, the specific positions of the forward primer (SEQ No. 1) and reverse primer (SEQ No. 2) that amplify the region exhibiting single nucleotide polymorphism are indicated. The trnK-Acacia forward primer includes the sequence starting from the 249th nucleotide up to the 316th nucleotide. The trnK-Acacia reverse primer includes the sequence starting from the 619th nucleotide up to the 630th nucleotide. Figure 3 is the result of electrophoresis on an agarose gel to confirm the PCR amplification product for DNA isolated from a wood sample using a single nucleotide polymorphism marker composition according to the present invention. An amplified band of approximately 346 bp in length was observed. L: 1kb ladder, AM: Acacia mangium Figure 4 shows the results of base sequence analysis for PCR products amplified using a single nucleotide polymorphism marker composition according to the present invention. While the 'C' nucleotide sequence appeared at the single nucleotide polymorphism position in Acacia mangium, the 'A' nucleotide sequence appeared in 15 other species of the genus Acacia. Figure 5 shows the results of DNA sequence analysis of PCR products amplified on Acacia mangium individual samples using a single nucleotide polymorphism marker composition according to the present invention. Specific details for implementing the invention
[0053] The present invention is further explained in detail by the following examples. These examples are intended to illustrate the invention and the scope of the invention should not be limited by them.
[0054] Example 1. Acacia mangium ( Acacia mangium Development of specific DNA markers
[0055] We explored species identification regions capable of identifying *Acacia mangium*, an imported hardwood species, and more specifically, chloroplast genes that identify the *Acacia mangium* species. In detail, among 21 chloroplast genes, species-specific regions that distinguish *Acacia mangium* from other species of the genus *Acacia*, trn The K chloroplast gene [(tRNA-Lys(UUU)3'exon)] was identified (Fig. 1, Sequence No. 3). Among these chloroplast genes, the single nucleotide polymorphism (SNP) location that distinguishes *Acacia mangium* from species of the genus *Acacia* is trn It was confirmed that a species-specific sequence variation exists, as only the acacia mangium gene is composed of the base 'C' at the 524 bp position of the K chloroplast gene sequence (sequence no. 3) (Table 1, Fig. 2).
[0056] Species specificity SNP names 524bp Acacia mangium trnK_Acacia C
[0057] In plant cells trn The K chloroplast gene region is a long gene region of 1 kb or more. However, compared to leaf DNA, wood DNA degrades over time after felling, so the concentration and purity of the isolated DNA are low and fragmented. Therefore, a new primer capable of short amplification suitable for amplifying wood DNA while containing the aforementioned species-specific region was designed and is shown in Table 2 and Figure 2.
[0058] SNP Forward primer sequence 5'→3' (Sequence No. 1) Reverse primer sequence 5'→3' (Sequence No. 2) Amplification product size (bp) trnK-Acacia ACGAGCTTTTGTTTTGAATTTG AAACAAGTAAGACTCATCAACG 346
[0060] Example 2. DNA extraction from imported hardwood
[0061] As for imported hardwood samples, Acacia mangium, which has a large import volume among imported timber in Korea ( Acacia mangium Wood samples confirmed as ) were purchased from a domestic importer and used (Table 3).
[0062] Leaf samples of 15 other species of the same genus Acacia were obtained from the National Sejong Arboretum and used as comparative samples (Table 3).
[0063] number scientific name Sample area Country of Import and Source 1 Acacia mangium felled timber (original board) vietnam 2 Acacia rubida leaf Sejong Arboretum 3 Acacia dealbata 〃 〃 4 Acacia baileyana 〃 〃 5 Acacia boormanii 〃 〃 6 Acacia cardiophylla 〃 〃 7 Acacia cultriformis 〃 〃 8 Acacia covenyi 〃 〃 9 Acacia muelleriana 〃 〃 10 Acacia baileyana 'Purpurea' 〃 〃 11 Acacia spectabilis 〃 〃 12 Acacia adunca 〃 〃 13 Acacia aphylla 〃 〃 14 Acacia chinchillensis 〃 〃 15 Acacia podalyriifolia 〃 〃 16 Acacia pubifolia 〃 〃
[0064] For the wood sample of Acacia mangium No. 1, a 4g rectangular sample was detached from the sapwood adjacent to the bark. The detached sample was washed with 70% alcohol to remove surface contaminants, and to crush the large volume of the sample, it was placed in a Grinding Jar (Qiagen) along with beads. Liquid nitrogen was added using a TissueLyser II (Qiagen) and freeze-crushed to obtain wood powder. Leaf samples of other Acacia species (Nos. 2–16) were placed in 2ml tubes along with crushing beads. Liquid nitrogen was added using a TissueLyser II (Qiagen) and freeze-crushed to obtain leaf powder.
[0065] DNA extraction was performed on both wood and leaf samples using the column-type DNeasy platn mini kit (Qiagen), a plant-specific DNA extraction kit. Specifically, DNA was extracted from the wood powder (0.2g) and leaf powder (0.2g) prepared above, according to the manual provided by the kit. The concentration (ng / µl) and purity (A260 / 280) of the extracted wood DNA and leaf DNA were measured using a Nanodrop LITE spectrophotometer (Thermo Scientific), and the results are shown in Table 4.
[0066] number scientific name Concentration (ng / µl) Purity (A260 / 280) 1 Acacia mangium 34.5 1.59 2 Acacia rubida 117.5 1.86 3 Acacia dealbata 148.6 1.82 4 Acacia baileyana 301.8 1.86 5 Acacia boormanii 63.3 1.81 6 Acacia cardiophylla 230.8 1.85 7 Acacia cultriformis 359.3 1.86 8 Acacia covenyi 211.2 1.86 9 Acacia muelleriana 141.7 1.86 10 Acacia baileyana 'Purpurea' 211.1 1.86 11 Acacia spectabilis 102.6 1.85 12 Acacia adunca 50.3 1.85 13 Acacia aphylla 103.6 1.82 14 Acacia chinchillensis 46.4 1.9 15 Acacia podalyriifolia 33.1 1.9 16 Acacia pubifolia 151 1.82
[0067] The DNA isolated from the wood of Acacia mangium 1 had relatively lower concentration and purity compared to the DNA isolated from the leaves of other species 2 through 16.
[0069] Example 3. PCR amplification using a single nucleotide polymorphism marker composition
[0070] PCR amplification was performed on the wood DNA of Acacia mangium No. 1 isolated in Example 2 and the leaf DNA of other Acacia species No. 2 to 16 using the primer set of Table 2 under the PCR amplification conditions of Table 5.
[0071] PCR mixture composition (1 stock) ingredient Volume (µl) DNA 5ng / µl 2 ddH2O 10.6 10X Taq reaction buffer(25mM MgCl2) 1.5 10mM dNTP mix 0.3 Primer mix 0.3 Taq polymerase 5U / ㎕ 0.3
[0072] Specifically, 10 ng of each wood DNA and leaf DNA (template DNA), 1x reaction buffer, 2.5 mM MgCl2, 0.2 mM dNTPs, a mixture of 0.2 μM forward and reverse primers, and 0.1 U of Taq DNA polymerase (Biofact) were mixed, and distilled water was added to make the final reaction volume 15 μl to proceed with the PCR reaction. The PCR reaction conditions involved an initial DNA modification at 94°C for 5 minutes, followed by 40 cycles of modification, primer binding, and synthesis in the sequence of 94°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute. Finally, a final synthesis step was performed at 72°C for 8 minutes. The PCR amplification products of Acacia mangium wood DNA were fractionated using electrophoresis on a 1% agarose gel. A 1 kb ladder (L) was added during fractionation to verify the amplification size. The electrophoresis results are shown in Figure 3.
[0073] As shown in Fig. 3, an amplified band (AM) of 346 bp length is observed. This indicates that the DNA isolated from acacia mangium wood was successfully amplified with the primer set according to the present invention, even though the concentration and purity were relatively low.
[0075] Example 4. Identification of tree species through DNA sequencing analysis of amplified products
[0076] Sequence analysis was performed on each of the PCR products 1 through 16 amplified in Example 3. Sequence analysis was performed using the standard sequencing method, a segmental sequencing method, with the primer set in Table 2. For standard sequencing, 10 µl of PCR amplification product and at least 10 µl of a reaction solution of primers (forward primers and reverse primers) at a concentration of 5 to 10 pmol / µl were added to each sample.
[0077] The sequencing results were shown as arrangements of nucleotides that constitute DNA molecules. The nucleotide sequence information, which is nucleotide arrangement information, was analyzed using the Genious analysis program to align the nucleotide sequences and identify differences, and the results for regions containing single nucleotide polymorphism (SNP) locations are shown in Figure 4.
[0078] As shown in Fig. 4, the 'C' base appeared at the single nucleotide polymorphism position only in the nucleotide sequence of the amplification product of Acacia mangium no. 1, and the 'A' base appeared in the nucleotide sequences of the amplification products of 15 other species of the genus Acacia no. 2 to 16, confirming that Acacia mangium can be identified from wood when using the single nucleotide polymorphism marker composition of the present invention.
[0080] Example 5. Analysis of Single Nucleotide Polymorphism Marker Species Identification through Verification of Individual Variation
[0081] In order to analyze whether the single nucleotide polymorphism marker according to the present invention can be utilized as an identification marker for the species of *Acacia mangium* by verifying whether individual variations exist, five samples of *Acacia mangium* obtained from wood purchased from a domestic importer were PCR amplified using the primers in Table 2 in the same manner as in Examples 3 and 4, and nucleotide sequence analysis was performed on each amplification product. The results are shown in Figure 5.
[0082] In addition, the nucleotide sequence information of the trnK gene region of five individuals of the Acacia mangium species registered in the NCBI public data was compared, and the results are shown together in Figure 5.
[0083] As shown in Fig. 5, the nucleotides at the single nucleotide polymorphism positions within the trnK gene of five individuals of Acacia mangium and five individuals of Acacia mangium previously registered in public data all appear as 'C', confirming that the single nucleotide polymorphism marker according to the present invention can be used as an identification marker for the species of Acacia mangium without individual variation. Industrial applicability
[0085] Acacia mangium, a major tree species recently imported from Vietnam and other places ( Acacia mangium As it is widely used in the fields of architecture, construction, and interior design for purposes such as display cabinets, furniture, and flooring, the single base polymorphism marker composition, kit, and method according to the present invention can identify Acacia mangium from wood, which is anatomically indistinguishable, thereby enabling the detection and eradication of the illegal distribution of imported hardwood. Accordingly, it can contribute to the development of the fields of architecture, construction, and interior design through the sound distribution of imported hardwood.
Claims
Claim 1 A single nucleotide polymorphism marker composition for identifying a species of Acacia mangium, comprising a primer set consisting of a forward primer of SEQ ID NO. 1 and a reverse primer of SEQ ID NO.
2. Claim 2 A single nucleotide polymorphism marker composition for identifying the Acacia mangium species, wherein, in claim 1, the Acacia mangium species can be identified from DNA isolated from wood. Claim 3 A single base polymorphism marker composition for identifying the Acacia mangium species, wherein, in Clause 2, the wood is hardwood imported into the country. Claim 4 A single base polymorphism marker composition for identifying the Acacia mangium species, wherein, in claim 3, the broadleaf tree is a species of the genus Acacia. Claim 5 In claim 1 or 2, the primer set is of Acacia mangium trn A single nucleotide polymorphism marker composition for identifying Acacia mangium species, which is specific to the single nucleotide polymorphism marker trnK_Acacia that appears only in the K chloroplast gene. Claim 6 In claim 5, the single nucleotide polymorphism marker trnK_Acacia is of Acacia mangium of SEQ ID NO.
3. trn A single nucleotide polymorphism marker composition for identifying a species of Acacia mangium, wherein the 524 bp base of the K chloroplast gene is C. Claim 7 A kit for identifying Acacia mangium comprising a single nucleotide polymorphism marker composition according to claim 1. Claim 8 A kit for identifying Acacia mangium, wherein the kit is a PCR kit in claim 7. Claim 9 A kit for identifying Acacia mangium from wood comprising a single base polymorphism marker composition according to claim 2. Claim 10 In claim 9, the above kit is a PCR kit, a kit for identifying Acacia mangium from wood. Claim 11 A method for identifying acacia mangium from wood, the method comprising: i) a step of isolating DNA from wood; ii) a step of performing a PCR reaction using the isolated DNA and a single nucleotide polymorphism marker composition according to claim 2 or a kit according to claim 9; and iii) a step of analyzing the amplified product of the PCR reaction. Claim 12 A method for identifying Acacia mangium from wood, wherein, in Clause 11, the wood is hardwood imported into the country. Claim 13 A method for identifying Acacia mangium from wood, wherein in step i) wood DNA isolation is prepared by separating wood from the sapwood adjacent to the bark and isolating DNA.
Citation Information
Patent Citations
Method of distinguishing between the pitch pine and the loblolly pine using molecular marker
KR101634346B1
Method of distinguishing between the red pine and the scot pine by using PCR-RFLP marker
KR101718707B1
Primers for distinguishing between Hinoki Cypress and Sawara Cypress and method using the same
KR101793911B1
Methods for detecting pathogenicity of ganoderma SP.
WO2019117704A1