Long non-coding RNA LETN as a tumor marker and therapeutic target

Inhibiting the expression of lncRNA RP11-196G18.22 (LETN) using specific agents addresses the limited treatment options for hepatocellular carcinoma by reducing cancer cell proliferation and tumorigenicity, offering a novel therapeutic approach.

KR102993217B1Active Publication Date: 2026-07-21TSINGHUA UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
KR1020227023330
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2019-12-11
Publication Date
2026-07-21
Estimated Expiration
2039-12-11

AI Technical Summary

Technical Problem

Current treatments for hepatocellular carcinoma, such as sorafenib, are expensive and have limited efficacy, and there is a lack of understanding about the molecular functions of long non-coding RNAs (lncRNAs) in cancer progression, particularly for lncRNA RP11-196G18.22 (LETN), which is overexpressed in cancer cells and associated with poor prognosis.

Method used

The use of lncRNA RP11-196G18.22 (LETN) as a diagnostic marker and therapeutic target by detecting its expression levels and inhibiting its function through agents like capmers, antisense RNA, siRNA, and CRISPR to reduce cancer cell proliferation and progression.

Benefits of technology

Inhibiting LETN expression significantly reduces cancer cell growth and tumorigenicity, providing a novel therapeutic strategy for hepatocellular carcinoma and other solid tumors, with potential synergistic effects when combined with chemotherapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 112022070767588-PCT00006_ABST
    Figure 112022070767588-PCT00006_ABST
Patent Text Reader

Abstract

The present invention relates to a long non-coding RNA (LETN) useful as a diagnostic and therapeutic target for cancer. In particular, the present invention discloses that lncRNA RP11-196G18.22 (LETN) is overexpressed in cancer cells, and that such overexpression can promote the proliferation of cancer cells and is associated with a short prognostic survival time in cancer patients. Since reducing the expression of this lncRNA inhibits cancer cell growth, the inhibition of the expression of this lncRNA presents a new strategy for cancer therapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to the field of cancer. More specifically, the present invention relates to the use of long non-coding RNA LETN as a tumor marker and therapeutic target. Background Technology

[0002] In recent years, rapid advancements in sequencing technology have led to research discovering that long, non-coding RNAs (lncRNAs) lacking translational activity are transcribed in many non-coding regions of the human genome in far greater numbers than proteins. Hundreds of lncRNAs associated with various diseases or physiological functions in humans have been identified. Particularly in cancer, there is increasing evidence that lncRNAs play a synergistic role in tumor suppression or oncogenesis [1]. However, for the majority of lncRNAs, little is known about their molecular and biological functions.

[0003] Hepatocellular carcinoma is the sixth most common cancer in the world and ranks fifth in cancer incidence globally, with approximately 841,000 new cases and 782,000 deaths annually[2], where morbidity and mortality are 2 to 3 times higher in men and rank second among male deaths. China is a high-risk country for hepatocellular carcinoma, primarily caused by chronic HBV infection and aflatoxin exposure. However, despite the increasing incidence of hepatocellular carcinoma, there are few available treatments. Apart from physical therapies such as radiation, transplantation, and surgery, there is only one approved drug for advanced hepatocellular carcinoma, sorafenib, which is very expensive, extends life by only an average of 2.8 months, and causes various side effects, such as diarrhea and nausea[3].

[0004] The nucleolus is a non-membrane subnuclear compartment located in the nucleus and is a critical organelle for fundamental processes such as rDNA transcription and ribosomal biogenesis. NPM1 (also known as B23) is a protein that is abundantly expressed in the nucleolus, and its protein sequence contains three distinct domains, where the N-terminal domain can influence its biological function by regulating NPM1 oligomerization and interactions with other proteins. Numerous studies have shown that NPM1 exerts corresponding functions by forming a pentamer. The intermediate region of NPM1 is an inherently disordered region marked by the presence of a highly acidic region and is involved in binding to histones. The C-terminal region provides a sufficient platform to enable binding to nucleic acids [4]. As an important cellular protein, NPM1 has been found to be involved in a series of biological processes such as ribosomal biogenesis, chromatin remodeling, and centrosome replication. Abnormal expression or mutations of it will lead to abnormal embryonic development and oncogenesis.

[0005] summation

[0006] By combining theoretical research and experimental means, the inventors conducted a comprehensive analysis and exploration of lncRNAs that may have potential functions in relation to cancer using multi-omics data mining tools. For hepatocellular carcinoma (LIHC), the inventors investigated lncRNA functions using data from the Cancer Genome Atlas (TCGA) through laboratory-designed algorithms and discovered a previously unstudied lncRNA RP11-196G18.22 (designated as LETN). It is predicted to regulate 191 pairs of transcription factors and target genes and may have broad and potent regulatory potential in the carcinogenesis and progression of hepatocellular carcinoma, which is verified by experiments.

[0007] Accordingly, the present invention relates to a long non-coding RNA (lncRNA RP11-196G18.22, designated herein as LETN) useful as a diagnostic and therapeutic target for cancer. This RNA is overexpressed in cancer cells, and such overexpression can promote the proliferation of cancer cells and is associated with short prognostic survival times in cancer patients; thus, it acts as a tumor marker and a diagnostic marker. Since reducing the expression of this lncRNA inhibits cancer cell growth, the inhibition of the expression of this lncRNA presents a novel strategy for cancer therapy. In the present invention, the mechanism of action of LETN was also investigated and found that LETN functions by binding to NPM1, and by binding to NPM1, it influences the production of rRNA and the assembly function of nucleosomes, thereby promoting the carcinogenesis and progression of cancer (e.g., hepatocellular carcinoma).

[0008] According to one aspect of the present invention, the use of an agent for detecting the expression level of lncRNA RP11-196G18.22 (LETN) in the manufacture of a diagnostic agent or diagnostic kit for cancer is provided. Detecting the expression level of RP11-196G18.22 (LETN) may refer to detecting its DNA or RNA level.

[0009] In one embodiment, the present invention provides a method for diagnosing cancer, comprising detecting the expression level of lncRNA RP11-196G18.22 (LETN) in a sample from a subject, wherein overexpression of LETN in the subject's sample compared to a control (healthy or normal sample) indicates that the subject is at (high) risk of cancer or has cancer.

[0010] In one embodiment, the present invention provides an agent for detecting the expression level of lncRNA RP11-196G18.22 (LETN) for use in diagnosing cancer.

[0011] In one embodiment, the agonist is a specific probe, gene chip, or PCR primer for lncRNA RP11-196G18.22.

[0012] In another embodiment, the cancer is preferably a solid tumor selected from the group consisting of hepatocellular carcinoma, lung cancer, prostate cancer, breast cancer, prostate cancer, pancreatic cancer, kidney cancer, gastric cancer, soft tissue cancer, biliary tract cancer, bladder cancer, rectal cancer, endometrial cancer, head and neck cancer, colon cancer, esophageal cancer, and thyroid cancer.

[0013] In another preferred embodiment, lncRNA RP11-196G18.22 has the nucleotide sequence presented in SEQ ID NO: 1 (Ensembl accession number: ENST00000564237.1).

[0014] According to another aspect of the present invention, the use of an agent for reducing or inhibiting the expression of lncRNA RP11-196G18.22 (LETN) in the manufacture of a drug for treating cancer is provided.

[0015] In one embodiment, the present invention provides an agent for reducing or inhibiting the expression of lncRNA RP11-196G18.22 (LETN) for use as a medicine, particularly as a medicine for treating cancer.

[0016] In another embodiment, the present invention provides a method for treating cancer comprising administering an effective amount of an agent that reduces or inhibits the expression of lncRNA RP11-196G18.22 (LETN) to a subject requiring treatment for cancer.

[0017] The nature of the agent that reduces or inhibits the expression of lncRNA RP11-196G18.22 (LETN) is not important to the present invention insofar as it reduces or inhibits the expression of lncRNA RP11-196G18.22 (LETN).

[0018] According to a preferred embodiment, an agent for reducing or inhibiting the expression of lncRNA RP11-196G18.22 (LETN) is selected from the group consisting of capmers, antisense RNA, siRNA, esiRNA, shRNA, miRNA, RNA aptamers, TALEN, CRISPR, and zinc finger nucleases. In a particularly preferred embodiment, specific sequences for antisense RNA, siRNA, shRNA, and CRISPR are those used in the examples of the detailed description of this application.

[0019] In another embodiment, the cancer is preferably a solid tumor selected from the group consisting of hepatocellular carcinoma, lung cancer, prostate cancer, breast cancer, prostate cancer, pancreatic cancer, kidney cancer, gastric cancer, soft tissue cancer, biliary tract cancer, bladder cancer, rectal cancer, endometrial cancer, head and neck cancer, colon cancer, esophageal cancer, and thyroid cancer.

[0020] According to a preferred embodiment, lncRNA RP11-196G18.22 has the nucleotide sequence presented in sequence identification number: 1 (ensemble accession number: ENST00000564237.1).

[0021] In another embodiment, the drug further comprises additional anticancer agents, such as chemotherapy agents, such as agents that reduce or inhibit the expression or mutation of NPM1 or agents that inhibit the binding of LETN to NPM1. Alternatively, the drug is used in combination with a method that reduces or inhibits the expression or mutation of NPM1, or a method that inhibits the binding of LETN to NPM1. Even if inhibition of lncRNA RP11-196G18.22 (LETN) is sufficient to achieve an effect of cancer treatment, when combined with other anticancer drugs, such as chemotherapy agents, it is expected that an agent that reduces or inhibits the expression of lncRNA RP11-196G18.22 (LETN) can achieve a stronger and even synergistic anticancer effect. Since the present invention has discovered that LETN functions by binding to NPM1 and affects the production of rRNA and the assembly function of nucleosomes by binding to NPM1, thereby promoting the carcinogenesis and progression of cancer (e.g., hepatocellular carcinoma), this is particularly true in the case of anticancer drugs or chemotherapy agents that reduce or inhibit the expression or mutation of NPM1.

[0022] According to another aspect of the present invention,

[0023] 1) A step of determining the expression level of lncRNA RP11-196G18.22 (LETN) in cells overexpressing lncRNA RP11-196G18.22 (LETN);

[0024] 2) A step of contacting the candidate compound with the cell from step 1);

[0025] 3) A step to determine the expression level of lncRNA RP11-196G18.22 (LETN) in cells after step 2); and

[0026] 4) A step of comparing the expression levels of lncRNA RP11-196G18.22 (LETN) determined in steps 1) and 3), wherein a reduced expression level of lncRNA RP11-196G18.22 (LETN) indicates that the candidate compound has anticancer potential.

[0027] A method for screening anticancer drugs comprising is provided. Preferably, the cell is a cancer cell.

[0028] According to another aspect of the present invention,

[0029] 1) A step of determining whether the expression of LETN in tumor or tumor cell samples is increased compared to a control group (normal or healthy tissue / cells);

[0030] 2) A step for determining whether the tumor is susceptible to treatment, where increased expression indicates susceptibility to treatment using an inhibitor of LETN expression.

[0031] A method is provided to determine whether a tumor is susceptible to treatment using an inhibitor of LETN expression, including

[0032] According to another aspect of the present invention, a method for evaluating the effect of an agent in the treatment and / or prevention of cancer is provided, comprising testing whether the agent can reduce the expression of LETN in a tumor or tumor cell sample, and if so, that the agent is suitable for the treatment and / or prevention of cancer. In a preferred embodiment, the cancer is preferably a solid tumor selected from the group consisting of hepatocellular carcinoma, lung cancer, prostate cancer, breast cancer, prostate cancer, pancreatic cancer, renal cancer, gastric cancer, soft tissue cancer, biliary tract cancer, bladder cancer, rectal cancer, endometrial cancer, head and neck cancer, colon cancer, esophageal cancer, and thyroid cancer. According to a preferred embodiment, LETN has the nucleotide sequence presented in Sequence Identification No.: 1 (Ensemble Accession No.: ENST00000564237.1). Brief explanation of the drawing

[0033] The aforementioned features and advantages of the present invention will become more apparent from the following detailed description together with the accompanying drawings. The results shown in Figures 1A to 1J indicate that LETN can promote the carcinogenesis and progression of hepatocellular carcinoma. A shows the expression status of LETN in various cancers and associated paracancerous tissues in the TCGA database (CHOL: biliary tract cancer; LIHC: hepatocellular carcinoma; LUAD: lung adenocarcinoma; KIRC: renal clear cell carcinoma; BLCA: bladder cancer; BRCA: breast cancer; PRAD: prostate cancer; READ: rectal cancer; LUSC: lung squamous cell carcinoma; UCEC: endometrial cancer; PAAD: pancreatic cancer; HNSC: head and neck squamous cell carcinoma; KIRP: papillary renal cell carcinoma; COAD: colon cancer; STAD: gastric cancer; SARC: soft tissue carcinoma; ESCA: esophageal cancer; THCA: thyroid cancer; THYM: thymoma; KICH: renal chromophore cell carcinoma; PCPG: adrenal carcinoma; CESC: cervical squamous cell carcinoma), where LETN expression in most human cancer tissues (solid tumors) is higher than that in the corresponding paracancerous tissues It is observed; B shows CRISPR-Cas9 knockout of LETN in the HUH7 cell line, where the cell proliferation rate in the LETN knockout group (sgLETN) is observed to be much lower than that of the control group (sgEV); C shows the knockdown of LETN in hepatocellular carcinoma cell lines HUH7 and SMMC-7721, lung cancer cell line HCC827, and prostate cancer cell lines PC3 and DU145, respectively, where the cell proliferation rate in the LETN knockdown group is detected to be much lower than that of the cells in the control group (siNC and siLMNA are two different negative controls; to prevent off-target effects, the following two types of siRNA were designed for LETN knockdown: siLETN-1 and siLETN-2); D and E show that after stable knockdown / knockout of LETN in HUH7 and HCC827 cells, the colony-forming ability of the cells is significantly destroyed;F shows the overexpression of LETN in hepatocellular carcinoma cell lines HUH7 and SMMC-7721, where the proliferation rate of cells in the LETN overexpression group is detected to be significantly higher than that of cells in the control group; G shows that after stable overexpression of LETN in HUH7 and SMMC-7721 cells, the colony-forming ability of the cells is significantly enhanced; H shows that after stable knockdown of LETN in the hepatocellular carcinoma cell line HUH7, the subcutaneous tumorigenic ability of the LETN knockdown group is observed to be significantly reduced; and I showed that after stable overexpression of LETN in the hepatocellular carcinoma cell line HUH7, the subcutaneous tumorigenic ability of the LETN overexpression group is observed to be significantly enhanced (the LETN-OE group is the LETN overexpression group, and the EV group is the control group).; The results shown in A to E in Figure 2 demonstrate that LETN functions by binding to NPM1. Specifically, A shows that in vivo hybridization experiments reveal that LETN is primarily located in the nucleus and appears in clusters; B shows that nucleocytoplasmic separation experiments demonstrate that most LETN is located in the nucleus and that GAPDH and LaminA / C are markers for the cytoplasm and nucleus, respectively; C shows that mass spectroscopic analysis of proteins interacting with LETN reveals that NPM1 is the protein with the strongest binding ability in both experiments; D shows that cell fluorescence co-localization experiments further confirm that LETN binds to NPM1 and is localized to the nucleolus; and E shows RNA pull-down by NPM1 in formaldehyde-crosslinked or non-crosslinked states, where it was also revealed that NPM1 can indeed pull down lncRNA LETN (MALAT1 represents the negative control in the figure). The results presented in Figures 3A to 3C demonstrate that LETN promotes the carcinogenesis and progression of hepatocellular carcinoma by affecting the production of rRNA and the assembly function of nucleosomes through binding to NPM1 (detection antibody: mouse anti-human NPM1 antibody (ab10530, abcam), histone H2A (EPR17470, ab177308, abcam), histone H2B (EP957Y, ab52599, abcam), histone H3 (17168-1-AP, proteintech), histone H4 (16047-1-AP, proteintech)). Specifically, A shows that knockdown of LETN or NPM1, respectively, in HUH7 and HCC827 cell lines can significantly reduce the expression of various rRNAs and that the functions of LETN and NPM1 are congruent; B shows that knockdown of LETN can affect nucleosome assembly by weakening NPM1's binding ability to histones; C shows an analysis of survival times in clinical data of patients with hepatocellular carcinoma in the TCGA database, where the prognostic survival times of patients individually divided into LETN or NPM1 high expression groups are shorter than those of patients in the low expression groups; and when further subdivided into the following four groups: NPM1-low+LETN-low, NPM1-low+LETN-high, NPM1-high+LETN-low, and NPM1-high+LETN-high, it was found that the survival times of patients with high expression of both NPM1 and LETN are significantly shorter than those of patients with low expression of both NPM1 and LETN. The results presented in A to D in Figure 4 demonstrate the various knockdown and overexpression efficiencies of LETN. A shows the knockdown of LETN by siRNA in five cell lines, where the knockdown efficiency is detected by RT-qPCR; B shows the knockdown of LETN by lentivirus shRNA in two cell lines, where the knockdown efficiency is detected by RT-qPCR; C shows the knockout of LETN by CRISPR-Cas9 technology, where the knockdown efficiency is detected by RT-qPCR; and D shows the overexpression of LETN by a lentivirus overexpression system in two cell lines, where the overexpression efficiency is detected by RT-qPCR. Figure 5 shows the effect of knockdown of the corresponding lncRNA on the proliferation of the hepatocellular carcinoma cell line HUH7. Specific details for implementing the invention

[0034] Description of the embodiment

[0035] Unless otherwise indicated, the terms used herein have the ordinary technical meaning as understood by a person skilled in the art. For definitions and terms in the relevant art, a person skilled in the art should specifically refer to the literature [Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999)].

[0036] The term "long non-coding RNA" (abbreviated as lncRNA) refers to a transcript longer than 200 nucleotides that does not code for a protein.

[0037] The terms "lncRNA RP11-196G18.22" or "LETN" refer to the gene having ensemble accession number: ENST00000564237.1 and the mRNA transcribed from this gene. Since this is a non-protein-coding gene, no protein product exists. In the present invention, its sequence may be denoted by sequence identification number: 1 (presented below). The present invention also takes into account variations in non-coding exons that may exist in the aforementioned gene, which are considered to belong to the corresponding transcript; that is, unless otherwise specified, the terms "lncRNA RP11-196G18.22" or "LETN" encompass different isoforms.

[0038]

[0039]

[0040] Regarding the expression of lncRNA RP11-196G18.22 (LETN), this implies expression at two levels: one is expression at the DNA level; and the other is expression at the RNA level.

[0041] The term "overexpression" refers to a case where, when strict control of gene expression (transcription) is disrupted, a gene may be improperly "turned off" or transcribed at a high rate. High-rate transcription leads to the production of large amounts of mRNA. In the case of overexpression of "lncRNA RP11-196G18.22" or "LETN" of the present invention, this means that its DNA or RNA expression level is at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, or 300% higher than that of a control (normal or healthy tissue / cell), or even 4, 5, 6, 7, 8, 9, or 10 times higher than the expression level of LETN in the control.

[0042] Techniques and reagents for detecting gene expression levels are widely known to those skilled in the art. In the present invention, the reagent is preferably selected from a specific probe (preferably, a nucleic acid probe having a detection label complementary to the target gene, typically) used in a PCR-specific amplification reaction for lncRNA RP11-196G18.22, a gene chip, or a PCR primer.

[0043] The term "reducing or inhibiting the expression of lncRNA RP11-196G18.22 (LETN)" refers to reducing the expression level of lncRNA RP11-196G18.22 (LETN) to 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 15% or less, or 10% or less, e.g., 5% or less, 2% or less, 1% or less, or even 0%. In one embodiment, the expression of lncRNA RP11-196G18.22 (LETN) may be reduced or inhibited by gene knockout or knockdown.

[0044] The term "knockout" refers to a genetic engineering technique that uses an exogenous mutated gene to replace an endogenous normal homologous gene through homologous recombination, thereby inactivating the endogenous gene and allowing the mutant to exhibit performance.

[0045] The term "knockdown" refers to the effect of preventing gene expression by degrading the mRNA of a target gene having a homologous sequence. This involves using double-stranded small RNA to efficiently and specifically degrade homologous mRNA in cells, thereby blocking the expression of the target gene in vivo and presenting a cellular phenotype characterized by a target gene deletion. Unlike gene knockout, which permanently silences the expression of a target gene, this prevents gene expression by degrading the mRNA of a target gene having a different homologous sequence.

[0046] Techniques for gene knockout or knockdown are widely known in the relevant technical field and include, but are not limited to, gene transfer and mutation by retroviruses, such as point mutations, insertions, deletions, frameshifts, or the generation of missense mutations. Another means for gene knockout is by the use of zinc finger nucleases. Zinc finger nucleases (ZFNs) are artificial restriction enzymes produced by fusing a zinc finger DNA binding domain with a DNA cutting domain. The zinc finger domain is engineered to target DNA sequences of interest, allowing the zinc finger nuclease to target unique sequences within a complex genome. Other genome customization techniques useful for gene knockout include TAL effector nucleases (TALENs). Another technique involves CRISPR / Cas systems for genome editing that can be used to achieve RNA-guided genome manipulation.

[0047] Techniques for achieving "reduction or inhibition of expression of lncRNA RP11-196G18.22 (LETN)" may also include the use of gapmers, antisense RNA, siRNA, esiRNA, shRNA, miRNA, or RNA aptamers.

[0048] "Antisense RNA" refers to an RNA molecule complementary to mRNA, and also includes RNA molecules complementary to other RNAs. Since double-stranded RNA cannot be translated in ribosomes, the specific complementary binding of antisense RNA to mRNA inhibits the translation of mRNA. An antisense construct can be delivered as an expression plasmid that produces RNA complementary to at least a specific portion of cellular lncRNA RP11-196G18.22 (LETN), for example, when expressed in cells.

[0049] Another specific form of the antisense RNA strategy is the gapmer. The gapmer is a chimeric antisense oligonucleotide containing a central block of deoxynucleotide monomers having a length sufficient to induce cleavage by RNase H. The design and synthesis of gapmers are widely known to those skilled in the art and can be achieved by commercial companies (e.g., Exiqon, Isis Pharmaceuticals).

[0050] "Small interfering RNA (siRNA)," sometimes referred to as short interfering RNA or silencing RNA, is a class of double-stranded RNA molecules having a length of approximately 20-25 base pairs that function by RNA interference (RNAi). It prevents translation by interfering with the expression of post-transcriptionally degraded mRNA for specific genes having complementary nucleotide sequences. The siRNA of the present invention can target any fragment of about 19 to 25 consecutive nucleotides in the lncRNA RP11-196G18.22 (LETN) target sequence, examples thereof are provided in this application. Techniques for selecting target sequences for siRNA are widely known in the art.

[0051] "Short hairpin RNA" (abbreviated as shRNA) is an RNA sequence containing two short inverted repeat sequences that can silence gene expression through RNA interference (RNAi).

[0052] The full English name for "esiRNA" is endoribonuclease-manufactured siRNA. This is a 18-25 bp long, E. coli ( E. coli It is a mixture of siRNA produced by cleaving long double-stranded RNA (dsRNA) by RNase III (ribonuclease) and can be used to efficiently knock down the expression level of a target gene.

[0053] The present invention is based on the unexpected discovery that lncRNA RP11-196G18.22 (LETN) can be used as a tumor marker and a therapeutic target. Accordingly, the present invention provides the use of an agent for detecting the expression level of lncRNA RP11-196G18.22 (LETN) in the manufacture of diagnostic agents or diagnostic kits for cancer. The present invention also provides the use of an agent for reducing or inhibiting the expression of lncRNA RP11-196G18.22 (LETN) in the manufacture of medicines for treating cancer. Additionally, the present invention also provides a method for screening anticancer drugs, comprising the step of determining whether a candidate compound can reduce or inhibit the expression of lncRNA RP11-196G18.22 (LETN).

[0054] The present invention is further illustrated in the following examples. These examples are for illustrative purposes only and are not intended to limit the scope of the invention. The chemicals used in the following reactions are all commercially available products unless otherwise indicated.

[0055] The independent samples Student's t-test is used for statistical analysis in this invention. Statistical calculations are performed using Microsoft Excel. When P < 0.05, the P value is significant.

[0056] Example 1 Screening of lncRNA RP11-196G18.22 (LETN)

[0057] For liver hepatocellular carcinoma (LIHC), lncRNA functions were investigated using data from The Cancer Genome Atlas (TCGA) (https: / / www.cancer.gov / about-nci / organization / ccg / research / structural-genomics / tcga), and lncRNAs capable of regulating transcription factors and their target genes were predicted through laboratory-designed algorithms. Twenty-two lncRNAs were finally selected through comprehensive screening based on three factors: regulatory logarithm, the presence or absence of expression differences between tumor and peritumoral tissues, and variability in genomic copy number (UBE2SP2, BMS1P8, RP11-443P15.2, LINC01296 / DUXAP10, LL22NC03-N14H11.1, RP11-284F21.10, DUXAP8, CRNDE, CTD-2227E11.1, LINC00853, LINC00665, RP11-196G18.22, GOLGA2P7, RP11-14N7.2, PVT1, LINC00511, RP11-396C23.2, MIR4435-2HG, AL450992.2, HCG25, PCAT6, LINC00152). After removing several lncRNAs with non-specific sequences (sequences located entirely in the exons of the gene, and specific siRNAs cannot be designed for functional verification), 16 types of lncRNAs remained, and the phenotypes of these lncRNAs were subsequently verified through experiments. Specifically, siRNAs specific to its transcript were designed (see Table 1 below), and the hepatocellular carcinoma cell line HUH7 (Shanghai Cell Bank, Chinese Academy of Sciences) was transfected with liposomal lipofectamine 2000 (Thermo Fisher, 11668019) to detect the knockdown effect of the corresponding lncRNA on cell proliferation.While only seven types of lncRNAs (DUXAP8, PCAT6, LINC00511, LINC00152, RP11-198G18.22, PVT1, and CRNDE, the seven lncRNAs on the right side of Fig. 5) were found to inhibit the proliferation of HUH7 cells, only one of these seven lncRNAs, namely lncRNA RP11-196G18.22 (designated as LETN), was found to be unreported to date (see Fig. 5). This was also the lncRNA possessing the largest number of regulated transcription factors and target genes, as previously discovered in algorithmic predictions, suggesting that it may possess extensive and potent regulatory potential in the oncogenesis and progression of hepatocellular carcinoma. Based on these findings, the expression levels of LETN were analyzed in hepatocellular carcinoma and peritumoral tissues from the TCGA database, and it was found that the expression levels of LETN in hepatocellular carcinoma tissue were significantly higher than those in peritumoral tissue; Additionally, in an extended analysis of other cancer tissues, it was found that the expression levels of LETN in most cancers were all higher than those in peritumoral tissues (Fig. 1, A).

[0058] Table 1

[0059]

[0060] Example 2 Study of lncRNA RP11-196G18.22 (LETN) at the cell level

[0061] Two hepatocellular carcinoma cell lines, namely HUH7 (Shanghai Cell Bank, Chinese Academy of Sciences) and SMMC-7721 (Shanghai Cell Bank, Chinese Academy of Sciences), were selected, and LETN was knocked down by siRNA (siRNA primers are presented below). Cells were seeded in 35 mm dishes for transfection after cell attachment. 2 μl of liposomal lipofectamine 2000 (Thermo Fisher, 11668019) and 20 nM siRNA were each diluted in 250 ml of medium. After thorough mixing, the mixture was incubated for 20 minutes, then slowly dropped into the dishes containing the cells, and knockdown levels were detected by RT-qPCR after 48 hours (see Table 2 below for primer pair sequences). Knockdown efficiency is presented in Figure 4A. LETN knockdown was found to significantly reduce cell proliferation (Fig. 1, C) (siNC and siLMNA are two different negative controls; to prevent off-target effects, the following two siRNAs were designed for LETN knockdown: siLETN-1 and siLETN-2).

[0062] siLETN-1 sense 5'-3' GCUGUCUCCAUGUCUUCUU (Sequence identification number: 34)

[0063] Antisense 5'-3' AAGAAGACAUGGAGACAGC (Sequence ID: 35)

[0064] siLETN-2 sense 5'-3' GCUCUCUGCUCAAGUAUUA (Sequence identification number: 36)

[0065] Antisense 5'-3' UAAUACUUGAGCAGAGAGC (Sequence ID: 37)

[0066] siNC (negative control) sense 5'-3' ACGUGACACGUUCGGAGAA (Sequence ID: 38)

[0067] Antisense 5'-3' UUCUCCGAACGUGUCACGU (Sequence ID: 39)

[0068] siLMNA sense 5'-3' AUCUCAUCCUGAAGUUGCUUC (Sequence identification number: 40)

[0069] Antisense 5'-3' GAAGCAACUUCAGGAUGAGAU (Sequence ID: 41)

[0070] Table 2

[0071]

[0072] Since two consecutive weeks of knockdown were required to detect colony formation, a stably screening cell line with LETN knockdown was constructed (see Example 3 for details). Knockdown levels were detected by RT-qPCR (see Table 3 below for primer pair sequences). Knockdown efficiency is presented in Figure 4B. It was found that LETN knockdown could significantly reduce cell colony formation (Figures 1, D, E). shNC was the negative control.

[0073] Table 3

[0074]

[0075] Additionally, LETN was knocked out by CRISPR-Cas9. Cells were seeded into 35 mm dishes for transfection after cell attachment. 2 μl of liposomal Lipofectamine 2000 (Thermo Fisher, 11668019) and 2 μg of px458-sgRNA plasmid (sgLETN sequence based on px458 (Addgene, catalog number 48138), specific method presented in reference [5]) were each diluted in 250 ml of medium. After thorough mixing, the mixture was incubated for 20 minutes with standing water, then slowly dropped into the dishes containing the cells, and knockdown levels were detected by RT-qPCR after 48 hours. Knockdown efficiency is presented in Fig. 4C. Cell proliferation was found to be significantly inhibited (Fig. 1, B).

[0076] sgLETN-1 sense 5'-3' TCAAATTTCAGTCGGAACTC (Sequence identification number: 70)

[0077] sgLETN-2 sense 5'-3' GAGACGATATGCTACGGGTG (Sequence identification number: 71)

[0078] sgEV-1 sense 5'-3' GAACGTTGGCACTACTTCAC (Sequence identification number: 72)

[0079] sgEV-2 sense 5'-3' GCGCCTTAAGAGTACTCATC (Sequence ID: 73)

[0080] Meanwhile, LETN overexpression was performed. Cells were seeded into 35 mm dishes for transfection after cell attachment. 2 μl of liposomal Lipofectamine 2000 (Thermo Fisher, 11668019) and 2 μg of the LETN overexpression plasmid plv-LETN (constructed by Wuxi Qinglan Biotechnology Co., Ltd., expression plasmid: plv-mCherry, catalog number 36084) were each diluted in 250 ml of medium. After thorough mixing, the mixture was incubated for 20 minutes with standing water, then slowly added dropwise into the dishes containing the cells, and the overexpression efficiency was detected by RT-qPCR after 48 hours (see Fig. 4, D). It was found that cell proliferation and colony formation could be promoted (Fig. 1, F, G).

[0081] Subsequently, lung cancer cell line HCC827 (ATCC CRL-2868) as well as prostate cancer cell lines DU145 (ATCC HTB-81) and PC3 (ATCC CRL-1435) were selected, and similar effects were observed. When LETN was knocked down by siRNA (the method was the same as previously performed on the hepatocellular carcinoma cell line HUH7, and knockdown efficiency is presented in Fig. 4A), the cell proliferation rate was significantly reduced, and colony-forming ability was also destroyed (Fig. 1, C).

[0082] Example 3 Study of lncRNA RP11-196G18.22 (LETN) at animal levels

[0083] The effects of LETN on the oncogenic ability of tumor cells were further investigated. First, a stable screening cell line with LETN knocked down was constructed using viral packaging shRNA (shRNA sequences are presented in Table 3). First, for viral packaging, 293T cells (Shanghai Cell Bank, Chinese Academy of Sciences) were seeded in 100 mm plates and transfected the following day. 12 μl of liposomal lipofectamine 2000 (Thermo Fisher, 11668019) was diluted in 1 ml of medium, and 7.1 μl of the packaging vector Δ8.9 (Tsinghua University Library Platform), 3.55 μg of VSVG (Tsinghua University Library Platform), and 3 μg of the expression vector plv-LETN were diluted in 1 ml of medium. After thorough mixing, the mixture was incubated for 20 minutes while left to stand, then slowly added dropwise into a dish containing cells, and the medium was replenished to 10 ml. After 48 hours, the supernatant was collected and centrifuged at 3000 rpm for 10 minutes. This supernatant was aliquoted as the virus solution and stored at -80°C until use. To construct a stable screening cell line with LETN knockdown, cells were first seeded into a 35 mm dish, 500 μl of virus solution was added the following day, and the medium was replenished to 2 ml. After 48 hours, a stable screening cell line as desired was obtained by adding puromycin once every 3 days to remove cells without virus expression. LETN-knockdown HUH7 cell lines (knockdown efficiency was detected by RT-qPCR and is presented in Fig. 4B) were injected subcutaneously into athymic nude mice (BALB / c nude mice, male, from the Animal Center of Tsinghua University). After 5 weeks of inoculation, the size of the tumor mass was measured weekly using a vernier caliper. The tumor was removed to measure its weight and volume.Tumor masses formed by LETN-knockdowned cells were found to be significantly smaller than those of the control group, and their tumor volume and weight were much smaller than those of the control group (Fig. 1, H). Therefore, HUH7 was selected to construct a stably screened cell line overexpressing LETN, which was injected subcutaneously into athymic nude mice. After 5 weeks of inoculation, the same procedure was performed. Tumor masses formed by LETN-knockdowned cells were found to be significantly larger than those of the control group, and their tumor volume and weight were much larger than those of the control group (Fig. 1, I). In summary, through detailed experimental confirmation based on tumor markers such as cell proliferation, colony formation, and subcutaneous tumorigenesis, lncRNA LETN was considered to have a significant function in inhibiting the carcinogenesis and progression of hepatocellular carcinoma and to be a potential therapeutic target.

[0084] Example 4 Exploration of the Mechanism of Action of LETN

[0085] First, RNA in-situ hybridization[6] and nucleoplasmic separation (nucleus / cytosol fractionation kit (Biovision, K266-25)) confirmed that LETN was primarily localized in the nucleus and distributed in clusters. This indicated that LETN could function through binding to proteins. Proteins pulled down via RNA pull-down were analyzed by mass spectrometry to discover proteins interacting with LETN, and it was ultimately revealed that NPM1 was the functional protein that binds to it. Subsequently, the NPM1 antibody anti-NPM1 (AbCAM, ab10530) was used for pull-down via RNA pull-down technology[7], and it was also revealed that NPM1 could indeed pull down lncRNA LETN. Cell fluorescence co-localization experiments further confirmed that LETN was localized in the nucleolus.

[0086] NPM1 is a highly important functional protein in the nucleolus, capable of binding to rDNA promoters to facilitate rDNA transcription; participating in rRNA splicing and maturation; and binding to histones to participate in nucleosome assembly. LETN has indeed been found to be involved in these functions. It has been revealed that knockdown of LETN can significantly reduce the expression of various rRNAs, while overexpression of LETN can promote rRNA expression. Additionally, knockdown of LETN can also affect nucleosome assembly by weakening NPM1's binding ability to histones. The nucleolus consists of three basic structural components: a fibril center, a dense fibril component, and a granular component (from inside to outside). NPM1 is located primarily in the outermost layer and is the most important component of the granular component. Studies have shown that knockdown of NPM1 can disrupt the shape of the nucleolus.

[0087] The inventors' study found that when LETN was knocked down, the nucleoli became irregular and scattered from a regular and dense spherical shape, indicating that LETN also affected the structure of the nucleoli. Through the inventors' algorithm, survival times were analyzed based on clinical data of patients with hepatocellular carcinoma from the TCGA database, where these groups were individually divided as follows: LETN high expression and low expression groups, or NPM1 high expression and low expression groups. It was found that the prognostic survival time of patients in the NPM1 or LETN high expression groups was shorter than that of patients in the low expression groups; and when further subdivided into the following four groups: NPM1-low + LETN-low, NPM1-low + LETN-high, NPM1-high + LETN-low, and NPM1-high + LETN-high, it was found that the survival time of patients with high expression of both NPM1 and LETN was significantly shorter than that of patients with low expression of both NPM1 and LETN.

[0088] A person skilled in the art will understand that although the present invention is described in detail with reference to the above embodiments, the present invention is not limited to these specific embodiments. Based on the methods and technical solutions taught by the present invention, a person skilled in the art may make appropriate modifications or improvements without departing from the spirit of the invention, and all equivalent embodiments obtained thereby are within the scope of the present invention.

[0089] References

[0090] 1. [Schmitt AM, Chang HY: Long Noncoding RNAs in Cancer Pathways. Cancer Cell 2016, 29(4):452-463].

[0091] 2. [Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer Journal for Clinicians 2018, 68(6):394-424].

[0092] 3. [Scudellari M: Drug development: Try and try again. Nature 2014, 516:S4].

[0093] 4. [Box JK, Paquet N, Adams MN, Boucher D, Bolderson E, O'Byrne KJ, Richard DJ: Nucleophosmin: from structure and function to disease development. BMC Mol Biol 2016, 17(1):19].

[0094] 5. [Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F: Genome engineering using the CRISPR-Cas9 system. Nat Protoc 2013, 8(11):2281-2308].

[0095] 6. [Kawaguchi T, Tanigawa A, Naganuma T, Ohkawa Y, Souquere S, Pierron G, Hirose T: SWI / SNF chromatin-remodeling complexes function in noncoding RNA-dependent assembly of nuclear bodies. Proceedings of the National Academy of Sciences of the United States of America 2015, 112(14):4304-4309].

[0096] 7. [Li X, Wang X, Song W, Xu H, Huang R, Wang Y, Zhao W, Xiao Z, Yang X: Oncogenic Properties of NEAT1 in Prostate Cancer Cells Depend on the CDC5L-AGRN Transcriptional Regulation Circuit. Cancer Res 2018, 78(15):4138-4149].

Claims

Claim 1 A diagnostic agent for cancer comprising an agent for detecting the expression level of lncRNA RP11-196G18.22 (LETN), wherein lncRNA RP11-196G18.22 has the nucleotide sequence presented in sequence identification number: 1, the cancer is selected from the group consisting of hepatocellular carcinoma, lung cancer, and prostate cancer, and the agent for detecting the expression level of lncRNA RP11-196G18.22 (LETN) is a PCR primer for lncRNA RP11-196G18.

22. Claim 2 A diagnostic kit for cancer comprising an agonist for detecting the expression level of lncRNA RP11-196G18.22 (LETN), wherein lncRNA RP11-196G18.22 has the nucleotide sequence presented in sequence identification number: 1, the cancer is selected from the group consisting of hepatocellular carcinoma, lung cancer, and prostate cancer, and the agonist is a PCR primer for lncRNA RP11-196G18.

22. Claim 3 A drug for treating cancer comprising an agent that reduces or inhibits the expression of lncRNA RP11-196G18.22 (LETN), wherein lncRNA RP11-196G18.22 has the nucleotide sequence presented in sequence identification number: 1, the cancer is selected from the group consisting of hepatocellular carcinoma, lung cancer, and prostate cancer, and the agent that reduces or inhibits the expression of lncRNA RP11-196G18.22 (LETN) is selected from the group consisting of antisense RNA, siRNA, shRNA, and CRISPR. Claim 4 A medicine for treating cancer comprising, in paragraph 3, an agent that reduces or inhibits the expression of lncRNA RP11-196G18.22 (LETN), further comprising an additional anticancer agent. Claim 5 A medicine for treating cancer comprising, in paragraph 4, an agent that reduces or inhibits the expression of lncRNA RP11-196G18.22 (LETN), wherein the additional anticancer agent is a chemotherapy agent. Claim 6 A medicine for treating cancer according to claim 4, comprising an additional anticancer agent that reduces or inhibits the expression or mutation of NPM1 or an agent that inhibits the binding of LETN to NPM1, comprising an agent that reduces or inhibits the expression of lncRNA RP11-196G18.22 (LETN). Claim 7 1) a step of determining the expression level of lncRNA RP11-196G18.22 (LETN) in cells overexpressing lncRNA RP11-196G18.22 (LETN); 2) a step of contacting a candidate compound with the cells of step 1); 3) a step of determining the expression level of lncRNA RP11-196G18.22 (LETN) in the cells after step 2); and 4) a step of comparing the expression level of lncRNA RP11-196G18.22 (LETN) determined in step 1) and step 3), wherein a reduced expression level of lncRNA RP11-196G18.22 (LETN) indicates that the candidate compound has anticancer potential, wherein lncRNA RP11-196G18.22 has the nucleotide sequence presented in sequence identification number: 1, the cell is a cancer cell, and the cancer is selected from the group consisting of hepatocellular carcinoma, lung cancer, and prostate cancer. Claim 8 delete Claim 9 delete Claim 10 delete

Citation Information

Patent Citations

  • Compositions comprising lncRNA for diagnosis and prognosis of epithelial-mesenchymal transition in lung cancer

    KR1020190048019A

  • Use of antisense long non-coding rnas for the diagnosis of prostate cancer

    US20180363065A1