A newly identified circrna and application thereof in preparation of a product related to diagnosis, treatment and prognosis of gastric cancer
By discovering and validating circPDIA4 as a molecular marker for gastric cancer and developing its inhibitors, the problem of lacking effective markers and therapeutic targets in existing technologies has been solved, enabling accurate diagnosis and effective treatment of gastric cancer, and improving patient survival and treatment outcomes.
Patent Information
- Application Number
- CN202211145689.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-20
- Publication Date
- 2026-05-29
- Estimated Expiration
- 2042-09-20
AI Technical Summary
The lack of effective molecular markers and therapeutic targets for gastric cancer in existing technologies leads to poor prognosis and inadequate treatment outcomes for gastric cancer patients.
A novel circular RNA, circPDIA4, was discovered and validated as a molecular marker for gastric cancer. Gastric cancer can be diagnosed and patient prognosis can be predicted by detecting the expression level of circPDIA4. At the same time, circPDIA4 inhibitors were developed for the treatment of gastric cancer, especially by designing specific primers and shRNA to inhibit the expression of circPDIA4 to inhibit the invasion and metastasis of gastric cancer cells.
circPDIA4, as a molecular marker for gastric cancer, can accurately diagnose and predict patient prognosis. circPDIA4 inhibitors can effectively inhibit the invasion and metastasis of gastric cancer cells, improve sensitivity to targeted drugs, and provide new therapeutic targets to improve the survival and treatment outcomes of gastric cancer patients.
Smart Images

Figure CN116286812B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to a newly identified circRNA and its application in the preparation of products related to the diagnosis, treatment, and prognosis of gastric cancer. Background Technology
[0002] Stomach cancer remains a leading cause of cancer death worldwide, with an estimated 769,000 deaths in 2020 (7.7% of all cancer deaths), according to GLOBOCAN estimates. Incidence is generally higher in East Asia and Eastern Europe, and lower in North America and Northern Europe. Identified environmental risk factors for stomach cancer include Helicobacter pylori (H. pylori), alcohol consumption, smoking, salted foods, and low fruit and vegetable intake. Although chronic H. pylori infection is the leading cause of stomach cancer, less than 5% of infected individuals develop the disease, suggesting that other factors, particularly differences in host genes, may play a crucial role in the development of stomach cancer. Surgical or endoscopic resection remains the primary treatment for early and locally advanced stomach cancer. Advanced stomach cancer is typically treated with sequential chemotherapy, with a median survival of less than one year. Therefore, identifying new therapeutic targets to improve the prognosis and clinical outcomes for patients with stomach cancer is crucial.
[0003] Epigenetic alterations, including non-coding RNAs, have been identified as fundamental mechanisms of oncogenesis. Circular RNAs (circRNAs) are a class of non-coding, covalently closed, single-stranded RNAs with distinct tissue- and cell-specific expression patterns. Although initially thought to be products of RNA splicing errors, varying degrees of evidence suggest that circRNAs are associated with cancer development.
[0004] CircRNA biogenesis depends on the backsplicing of precursor mRNAs. In this process, a downstream splice donor is covalently linked to an upstream splice acceptor via one or more exons. Backsplicing requires the ligation of introns flanking the downstream splice donor and upstream splice acceptor sites to bring these splice sites closer together. Dimerization of RNA-binding proteins (RBPs), inverted intron repeat sequences (such as Alu elements), or non-repetitive complementary sequences can promote the formation of circular structures. Dimerization of RBP Quaking (QKI) has been shown to promote circRNA production, particularly during epithelial-mesenchymal transition (EMT). Similarly, other RBPs, such as HNRNPL, FUS, MBNL1, and RBM20, participate in circRNA biogenesis by binding to introns flanking the backsplicing site. Conversely, DHX9 and ADAR1 inhibit Alu-mediated circRNA biogenesis by disrupting the stability of double-stranded RNA structures.
[0005] Multiple studies have shown that circRNAs significantly influence the progression and drug resistance of gastric cancer cells through either tumor-suppressive or tumor-inducing mechanisms. For example, CircURI1 significantly inhibits gastric cancer metastasis both in vitro and in vivo. Mechanistically, CircURI1 directly interacts with hnRNPM, regulating alternative splicing of genes involved in cell migration, thereby demonstrating an inhibitory effect on gastric cancer metastasis. However, different circRNAs play distinctly different roles in gastric cancer cell invasion and metastasis; some circRNAs show inhibitory effects on gastric cancer metastasis, while others promote it. The biological significance of circRNAs in gastric cancer cell invasion and metastasis remains to be explored.
[0006] Chinese patent document CN114836539A (application number: 202210486533.X) discloses a circRNA biomarker for predicting gastric cancer metastasis and its application. This invention clarifies that CircPCSK5 is highly expressed in gastric cancer and can promote the proliferation, invasion, and epithelial-mesenchymal transition of gastric cancer cells. CircPCSK5 can serve as a good prognostic predictor of gastric cancer and a potential molecular therapeutic target.
[0007] Chinese patent document CN114774541A (application number: 202210304289.0) discloses a plasma exosomal circRNA biomarker for the diagnosis and prognostic monitoring of gastric cancer and its application. The circRNA biomarker described in this invention includes hsa_circ_0006853, which is highly expressed in the plasma exosomals of gastric cancer patients, enabling effective diagnosis and prognostic monitoring of gastric cancer, and to some extent, can also differentiate patients with atrophic gastritis. Summary of the Invention
[0008] To address the shortcomings of existing technologies, this invention provides a newly identified circRNA and its application in the preparation of products related to the diagnosis, treatment, and prognosis of gastric cancer.
[0009] This invention has discovered a novel circular RNA (circRNA), namely circPDIA4; and found that circPDIA4 significantly promotes the invasion and metastasis of gastric cancer in vitro and in vivo.
[0010] The technical solution of the present invention is as follows:
[0011] A kind of circular RNA circPDIA4, the nucleotide sequence is as SEQ ID Shown in NO.1 is GTTGTGGACATTGCAAGCAGTTTGCTCCGGAATATGAAAAAAATTGCCAACATATTAAAGGATAAAGATCCTCCCATTCCTGTTGCCAAGATCGATGCAACCTCAGCGTCTGTGCTGGCCAGCAGGTTTGATGTGAGTGGCTACCCCACCATCAAGATCCTTAAGAAGGGGC AGGCTGTAGACTACGAGGGCTCCAGAACCCAGGAAGAAATTGTTGCCAAGGTCAGAGAAGTCTCCCAGCCCGACTGGACGCCTCCACCAGAAGTCACGCTTGTGTTGACCAAAGAGAACTTTGATGAAGTTGTGAATGATGCAGATATCATTCTGGTGGAGTTTTATGCCCCATG.
[0012] An application of circular RNA circPDIA4 as a molecular marker for gastric cancer, the application including the use of a detection product of circular RNA circPDIA4 in the preparation of reagents for gastric cancer diagnosis and prognostic monitoring of gastric cancer patients;
[0013] Alternatively, the use of inhibitors of the circular RNA circPDIA4 in the preparation of drugs for treating gastric cancer;
[0014] Alternatively, the application of circular RNA circPDIA4 in predicting the sensitivity of gastric cancer to targeted drugs;
[0015] The nucleotide sequence of the circular RNA circPDIA4 is shown in SEQ ID NO.1.
[0016] According to a preferred embodiment of the present invention, the product for diagnosing gastric cancer and detecting the prognosis of gastric cancer patients is a reagent, chip, or kit.
[0017] More preferably, the kit is a real-time PCR detection kit.
[0018] According to a preferred embodiment of the present invention, the product for diagnosing gastric cancer and for detecting the prognosis of gastric cancer patients includes a specific primer pair designed based on the circular RNA circPDIA4 with the nucleotide sequence shown in SEQ ID NO.1.
[0019] More preferably, the nucleotide sequences of the specific primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3.
[0020] The nucleotide sequences of the primer pair are as follows:
[0021] F:TCATTCTGGTGGAGTTTTATGCC SEQ ID NO.2;
[0022] R:GCTGAGGTTGCATCGATCTT SEQ ID NO.3.
[0023] According to a preferred embodiment of the present invention, the drug for treating gastric cancer includes nucleic acid molecules, lipids, small molecule chemicals, antibody drugs, peptides, or interfering lentiviruses, all of which are inhibitors of circular RNA circPDIA4.
[0024] More preferably, the nucleic acid molecule includes: small interfering RNA (siRNA), double-stranded RNA (dsRNA), short hairpin RNA (shRNA), or antisense oligonucleotide.
[0025] More preferably, the nucleotide sequence of the short hairpin RNA is shown in SEQ ID NO.6;
[0026] Alternatively, the nucleotide sequence of the short hairpin RNA is shown in SEQ ID NO.7.
[0027] shcircPD-1: 5'-ACCGGTCGGCAATGTCCACACCATGGGGCTCGAGCCCCATGGTGTGGACATTGTTTTTGAATTC-3'SEQ ID NO.6;
[0028] shcircPD-2: 5'-ACCGGTCGGAATGTCCACACCATGGGGCCTCGAGGCCCCATGGTGTGGACATTTTTTTGAATTC-3' SEQ ID NO.7.
[0029] According to a preferred embodiment of the present invention, the cancer cell types of the gastric cancer are MKN-45 and HGC-27.
[0030] A kit for diagnosing gastric cancer and for prognostic testing of gastric cancer patients, comprising a specific primer pair designed based on the circular RNA circPDIA4 with the nucleotide sequence shown in SEQ ID NO.1.
[0031] According to a preferred embodiment of the present invention, the nucleotide sequences of the specific primer pairs in the kit are as shown in SEQ ID NO.2 and SEQ ID NO.3.
[0032] According to a preferred embodiment of the present invention, the kit is a real-time quantitative PCR detection kit.
[0033] A drug for treating gastric cancer, comprising a short hairpin RNA nucleotide sequence as shown in SEQ ID NO. 6; and / or a short hairpin RNA nucleotide sequence as shown in SEQ ID NO. 7.
[0034] Beneficial effects
[0035] 1. This invention discovers a novel circular RNA (circRNA), namely circPDIA4; and finds that the expression of the circPDIA4 gene in gastric cancer tissue is significantly higher than that in normal tissue. Its high expression level is associated with poor survival in gastric cancer patients. In vitro, circPDIA4 can promote cell migration and invasion, and in vivo, it can promote the metastasis of gastric cancer. At the same time, patients with low expression of circPDIA4 show sensitivity to ERK1 / 2 inhibitors, a novel targeted drug, indicating that circPDIA4 can become a new target for precision treatment of gastric cancer, a potential indicator for predicting the efficacy of targeted therapy for gastric cancer, and a new molecular biomarker for gastric cancer.
[0036] 2. The application of the circPDIA4 detection reagent in the preparation of reagents for diagnosing the prognosis of gastric cancer patients in this invention mainly involves using circPDIA4 as a detection biomarker to prepare a corresponding real-time PCR detection kit for detecting the prognosis of gastric cancer patients. This kit is simple to operate, has good stability, and high sensitivity. Furthermore, the shRNA provided in this invention can inhibit the expression of circPDIA4, thereby inhibiting the invasive and metastatic ability of gastric cancer cells, which is of great significance in the preparation of drugs for treating gastric cancer. Attached Figure Description
[0037] Figure 1 This is a schematic diagram of the structure of the circPDIA4 molecule.
[0038] Figure 2 Figure showing the expression of circPDIA4 in cancerous tissue and adjacent normal tissue of gastric cancer patients;
[0039] In the diagram: GC represents cancerous tissue, and Normal represents adjacent normal tissue.
[0040] Figure 3 A graph showing the relationship between circPDIA4 and the prognosis of gastric cancer patients;
[0041] In the figure: PFS is the progression-free survival time; OS is the total survival time.
[0042] Figure 4 A graph showing the RNA expression levels of HGC27 and MKN45 cells after lentivirus infection with overexpression plasmids or shRNA.
[0043] In the figure: the vertical axis represents the expression level of RNA; A is a bar chart of expression efficiency in HGC27 cells; B is a bar chart of expression efficiency in MKN45 cells; PDIA4 represents the mRNA of PDIA4; Vector represents the empty vector control group; circPDIA4 represents the overexpression vector plasmid group.
[0044] Figure 5 This is a cell invasion assay diagram of HGC27 and MKN45 cells after stable overexpression or knockdown of circPDIA4;
[0045] In the figure: A is a cell invasion assay showing stable knockdown of circPDIA4 in HGC27 and MKN45 cells, and B is a cell invasion assay showing stable overexpression of circPDIA4 in HGC27 and MKN45 cells.
[0046] Figure 6 This is a bar chart showing the number of cells that crossed the basement membrane after HGC27 and MKN45 cells stably overexpressed or knocked down circPDIA4.
[0047] In the figure: the vertical axis represents the number of cells, A is a bar chart of the number of HGC27 cells that crossed the basement membrane, and B is a bar chart of the number of MKN45 cells that crossed the basement membrane.
[0048] Figure 7 The effect of stable knockdown or overexpression of circPDIA4 in HGC27 cells on the ability of nude mice to metastasize to lung tumors;
[0049] In the figure: the vertical axis represents the average fluorescence intensity; A is the average fluorescence quantification of the ability of HGC27 cells to metastasize to the lungs of nude mice after stable knockdown of circPDIA4; B is the average fluorescence quantification of the ability of HGC27 cells to metastasize to the lungs of nude mice after stable overexpression of circPDIA4.
[0050] Figure 8 This is a quantitative graph showing the changes in EMT-related markers after stable overexpression or knockdown of circPDIA4 in HGC27 and MKN45 cells, as detected by Western blotting.
[0051] In the figure: the vertical axis represents the relative protein level. A is a quantitative graph showing the effect of overexpression of circPDIA4 on the protein level of EMT-related markers in HGC27 and MKN45 cells; B is a quantitative graph showing the effect of stable knockdown of circPDIA4 on the protein level of EMT-related markers in HGC27 and MKN45 cells.
[0052] Figure 9 This is a graph showing the effect of stable knockdown or overexpression of circPDIA4 on ERK1 / 2 inhibitors in HGC27 and MKN45 cells.
[0053] In the figure: the vertical axis represents relative cell viability. A shows the change in cell viability of HGC27 cells after stable knockdown of circPDIA4 and application of ERK1 / 2 inhibitors; B shows the change in cell viability of MKN45 cells after stable knockdown of circPDIA4 and application of ERK1 / 2 inhibitors; C shows the change in cell viability of HGC27 cells after overexpression of circPDIA4 and application of ERK1 / 2 inhibitors; D shows the change in cell viability of MKN45 cells after stable overexpression of circPDIA4 and application of ERK1 / 2 inhibitors. Detailed Implementation
[0054] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.
[0055] Unless otherwise specified, the drugs and reagents used in the examples are common market products. Any content not described in detail in the examples is based on the prior art.
[0056] Source of materials
[0057] MKN-45, HGC-27, and HEK293T cells were obtained from commercially available sources.
[0058] The culture media used for gastric cancer cells in the examples were DMEM or 1640 medium, available from Gibco; trypsin and Opti-MEM, available from Gibco; RIPA lysis buffer, available from Beyotime Biotech; PMSF protease inhibitor, available from Kingtech Pharmaceuticals; Trizol, available from Invitrogen; SYBR Premix Ex Taq, available from Takara; siRNA transfection reagent (INTERFERin), plasmid transfection reagent (JetPRIME), and JetPRIME Buffer, available from Polyplus; and Transwell chambers, available from Corning.
[0059] Example 1
[0060] A circular RNA circPDIA4
[0061] The inventors analyzed circRNA sequencing results from gastric cancer cell lines and identified 11 novel circRNAs (not included in the circBase database). Through a series of experimental screenings and verifications, they identified circPDIA4 as a novel circRNA molecule. circPDIA4 is formed by circularization of exons 3 and 4 of the PDIA4 gene. Sanger sequencing verified the circularization sequence at the circPDIA4 linker, such as... Figure 1 As shown.
[0062] Example 2
[0063] Cancerous tissue and adjacent normal tissue from gastric cancer patients at Shandong Cancer Hospital were collected. The expression level of circPDIA4 was detected by RT-qPCR. The results showed that circPDIA4 expression was significantly elevated in gastric cancer tissue (p < 0.005). Figure 2 As shown.
[0064] The primer sequences are as follows, see Table 1:
[0065] Table 1
[0066]
[0067]
[0068] The RT-qPCR reaction system consisted of: 5 μL of 2×SYBR Premix Ex Taq (TliRNaseH Plus), 1 μL of forward and reverse primers (10 μM), 0.2 μL of cDNA, and 3.8 μL of ultrapure water, for a total of 10 μL. The expression of relevant RNA was calculated using the 2-ΔΔCt method.
[0069] Example 3
[0070] A follow-up study of 126 gastric cancer patients revealed Kaplan-Meier survival curves showing that patients with high expression of circPDIA4 in gastric cancer tissue had shorter overall survival and disease-free survival. Figure 3 As shown, all differences were statistically significant (P < 0.005).
[0071] Example 4
[0072] Stable knockdown or overexpression of circPDIA4 gastric cancer cell lines were obtained in HGC27 and MKN45 cells via lentivirally packaged shRNA plasmids (NC, shcircPD-1, and shcircPD-2) or via lentivirally packaged overexpression plasmids (vector and circPDIA4). Recombinant lentiviral particles were generated by transient co-transfection of shcircPD-1, shcircPD-2, or circPDIA4 and packaging plasmids into HEK293T cells.
[0073] After 48 and 72 hours of transfection into HEK293T cells, viral supernatant containing recombinant lentiviral particles was collected. Gastric cancer cell lines HGC-27 and MKN-45 were infected with viral supernatant containing 8 μg / mL polybrene, respectively. Stable PDIA4 overexpression (OE) cells were selected using 2 μg / mL puromycin. Stable PDIA4 gene knockout (KD) gastric cancer cells were selected using 10 μg / mL cyprodinil. The expression level of circPDIA4 was detected by RT-qPCR in these lentivirally transduced cells. RT-qPCR results showed that, as... Figure 4 As shown.
[0074] Depend on Figure 4 It can be seen that shRNAs (shcircPD-1 and shcircPD-2) had no significant effect on PDIA4 mRNA levels, but significantly reduced circPDIA4 levels; the circPDIA4 overexpression vector plasmid group had no significant effect on PDIA4 mRNA levels, but significantly increased circPDIA4 levels. The stable screening cell lines only knocked down or overexpressed circPDIA4, without significantly affecting PDIA4 mRNA levels.
[0075] The shRNA sequences are shown in Table 2:
[0076] Table 2
[0077]
[0078]
[0079] Example 5
[0080] The effect of circPDIA4 on the invasive ability of gastric cancer cells (Transwell assay)
[0081] (1) Take out the chamber and place it in a 24-well plate. Add 1 mL of pure DMEM or 1640 medium (without antibiotics and serum) and soak for 30 min. Place it in an incubator for 30 min to pre-treat the chamber.
[0082] (2) After digesting and centrifuging the stably overexpressed or knocked-down circPDIA4 cells (HGC27 / MKN45), resuspend the cells in a low-nutrient medium (1% FBS), mix by pipetting, count the cells and then dilute to 300 cells / μL.
[0083] (3) Take 100 μL of the diluted cell suspension (30,000 cells) into a new EP tube and pipette it several times to mix it well;
[0084] (4) Add 700 μL of high nutrient content culture medium (10% FBS) to the 24-well plate, then put it into the pretreated chamber in step (1), transfer the liquid in step (3) into the upper chamber of the chamber, and after the operation is completed, put it into the incubator to continue the culture. The culture is completed in 24-72 hours.
[0085] (5) Discard the culture medium in the upper and lower chambers, and wash twice with 1 mL of PBS in each well. Add 1 mL of methanol solution and fix at room temperature for 30 min;
[0086] (6) Discard the methanol and rinse twice with 1 mL of PBS in each well;
[0087] (7) Discard the PBS, add 1 mL of 0.5% crystal violet solution, and stain at room temperature for 30 min;
[0088] (8) After staining, recover the crystal violet, rinse several times with PBS, gently wipe away the cells in the upper chamber with a cotton swab, leaving the cells in the lower chamber, let them air dry at room temperature, take pictures under a microscope, and save the images.
[0089] Transwell assays showed that circPDIA4 enhances cell invasion, while knockdown of circPDIA4 significantly reduces cell invasion (e.g., ...). Figure 5 (As shown); count the number of cells in each group and plot a bar chart (e.g.) Figure 6 (As shown).
[0090] Example 6
[0091] To investigate the role of circPDIA4 in hematogenous transfer in vivo, the inventors seeded HGC-27 cells (NC, shcircPD-1, shcircPD-2, vector, or circPDIA4) stably expressing firefly luciferase into the tail veins of 5-week-old female BALB / c nude mice (Beijing River Life Laboratory, China) (n=4 per group). In vivo imaging was performed on mice 4-6 weeks after feeding. Imaging was conducted 10 minutes after intraperitoneal injection of Luci substrate into anesthetized mice. The obtained images were normalized, and the results were statistically analyzed and plotted.
[0092] The results showed that circPDIA4 deficiency significantly inhibited hematogenous metastasis of gastric cancer cells (P<0.001). Stable circPDIA4 overexpression significantly promoted distant gastric cancer metastasis (P<0.001). Figure 7 )
[0093] Example 7
[0094] Western blot experiments were performed on gastric cancer cells (HGC27 / MKN45) stably expressing or knocked down circPDIA4, from which total protein was extracted. The protein concentration of each group was determined using a BCA kit. Equal volumes of protein were subjected to SDS-PAGE gel electrophoresis, and the separated proteins were electroporated onto PVDF membranes. The membranes were blocked with TBST solution containing 5% skim milk powder at room temperature for 2 hours. Proportional diluted E-cadherin, N-cadherin, Vimentin, Zo-1, and GAPDH primary antibodies were added, and the membranes were incubated overnight at 4°C. The next day, the corresponding host horseradish peroxidase enzyme-linked secondary antibody was added, and the membranes were incubated at room temperature for 2 hours. After washing, the membranes were developed and exposed using a high-sensitivity ECL chemiluminescence kit. ImageJ was used to quantify and plot the images. The results are shown below. Figure 8 As shown, circPDIA4 promotes the expression of EMT intermediate markers, namely, upregulation of N-cadherin and Vimentin, and inhibits the expression of epithelial markers, while downregulating the expression of E-cadherin and Zo-1.
[0095] Example 8
[0096] For susceptibility testing of ERK1 / 2 inhibitors (MK-8353, Selleck, S870101), approximately 4000 stable circPDIA4-expressing, stably knocked-down circPDIA4, or control HGC-27 or MKN-45 cells were seeded in each well of a 96-well plate. MK-8353 diluted in dimethyl sulfoxide was added to each well to achieve the desired final concentration (HGC-27: 0 μ / L, 3 μ / L, 6 μ / L, 9 μ / L, 12 μ / L, and 15 μ / L; MKN-45: 0 μ / L, 1 μ / L, 3 μ / L, 6 μ / L, 9 μ / L, and 12 μ / L). After incubating the cells with MK-8353 for 48 h, 20 μL of 5 mg / mL tetramethylazazole salt was added to each well. Cells were incubated with tetramethylazozid salt at 37°C and 5% CO2 for 4 hours, after which 100 μL of dimethyl sulfoxide was added to each well. The absorbance of each well was measured at 492 nm using a microplate reader. Statistical analysis and plotting of the results showed that knockdown of circPDIA4 promoted cell sensitivity to MK-8353, while overexpression of circPDIA4 increased cell resistance to MK-8353. Figure 9 As shown.
[0097] This invention discovers a novel circular RNA (circRNA), circPDIA4, and finds that circPDIA4 gene expression is significantly higher in gastric cancer tissues than in normal tissues. High expression levels are associated with poor survival in gastric cancer patients. circPDIA4 promotes cell migration and invasion in vitro and promotes gastric cancer metastasis in vivo. Simultaneously, patients with low circPDIA4 expression exhibit sensitivity to novel targeted drugs such as ERK1 / 2 inhibitors, indicating that circPDIA4 could be a new target for precision treatment of gastric cancer, a potential predictor of the efficacy of targeted therapy for gastric cancer, and a novel molecular biomarker for gastric cancer. The shRNA provided by this invention can inhibit circPDIA4 expression, thereby inhibiting the invasive and metastatic ability of gastric cancer cells, which is of great significance in the preparation of drugs for treating gastric cancer.
Claims
1. A circular RNA circPDIA4, characterized in that, The nucleotide sequence is shown in SEQ ID NO.
1.
2. An application of circular RNA circPDIA4 as a molecular marker for gastric cancer, wherein the application is the use of a detection product of circular RNA circPDIA4 in the preparation of reagents for gastric cancer diagnosis and prognostic monitoring of gastric cancer patients; Alternatively, the use of inhibitors of the circular RNA circPDIA4 in the preparation of drugs for treating gastric cancer; in, The nucleotide sequence of the circular RNA circPDIA4 is shown in SEQ ID NO.1; The inhibitor of the circular RNA circPDIA4 is a short hairpin RNA (shRNA). The nucleotide sequence of the short hairpin RNA is shown in SEQ ID NO.6; or, the nucleotide sequence of the short hairpin RNA is shown in SEQ ID NO.
7.
3. The application as described in claim 2, characterized in that, The products mentioned for diagnosing gastric cancer and detecting the prognosis of gastric cancer patients are reagents, chips, or kits.
4. The application as described in claim 3, characterized in that, The kit is a real-time PCR detection kit.
5. The application as described in claim 3, characterized in that, The product for diagnosing gastric cancer and for prognostic testing of gastric cancer patients includes a specific primer pair designed based on the circular RNA circPDIA4 with the nucleotide sequence shown in SEQ ID NO.
1.
6. The application as described in claim 5, characterized in that, The nucleotide sequences of the specific primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.
3.
7. The application as described in claim 2, characterized in that, The cancer cell types mentioned are MKN-45 and HGC-27.
8. A kit for diagnosing gastric cancer and detecting the prognosis of gastric cancer patients, characterized in that, This includes specific primer pairs designed based on the circular RNA circPDIA4 with the nucleotide sequence shown in SEQ ID NO.
1.
9. The reagent kit as described in claim 8, characterized in that, The nucleotide sequences of the specific primer pairs in the kit are shown in SEQ ID NO.2 and SEQ ID NO.
3.
10. The kit as described in claim 8, characterized in that, The kit is a real-time quantitative PCR detection kit.
11. A drug for treating gastric cancer, characterized in that, It contains a short hairpin RNA nucleotide sequence as shown in SEQ ID NO.6; and / or a short hairpin RNA nucleotide sequence as shown in SEQ ID NO.7.
Citation Information
Patent Citations
Plasma exosome circRNA marker for diagnosis and prognosis monitoring of gastric cancer and application of plasma exosome circRNA marker
CN114774541A
CircRNA (Ribonucleic Acid) marker for gastric cancer metastasis prediction and prognosis judgment and application
CN114836539A
A circRNA biomarker for predicting gastric cancer metastasis and its application
CN114836539B