Construct of self-circularization RNA

Abstract

The self-circulating RNA structure of the present invention can be expressed in a DNA vector and simultaneously circularized through a self-targeting and splicing reaction to form circRNA, and the circRNA can be composed only of a target gene, and the target gene includes an IRES region, a start codon, and a stop codon, which has the advantage of enabling rapid expression of a peptide or protein.

Description

Technology Field

[0001] The present invention relates to RNA structures, etc., with improved self-circulation efficiency. Background Technology

[0002] Circular RNA (circRNA, cRNA) is a single-stranded transcript linked by covalent bonds; through RNA-seq data and newly developed bioinformatics approaches, over tens of thousands of types of circRNA have been identified in various organisms. In eukaryotes, circRNA is generated from mRNA via back-splicing and is known to regulate gene expression by functioning as a microRNA sponge in vivo. It is unknown whether circRNA induces immunogenicity, and due to its structural characteristics, it exists very stably in vivo.

[0003] Meanwhile, the development of therapeutic agents using messenger RNA (mRNA) has been active recently. However, mRNA has limitations in that it is easily degraded in vivo and has a relatively short half-life. To overcome these limitations, research is being conducted to improve stability by attaching a poly(A)tail to mRNA. In the same context, US 10,953,033 introduces circRNA for the purpose of gene expression in vivo based on the structural characteristics of circRNA. Prior art literature

[0005] US 10,953,033

[0006] Tolmachov and Tolmachova, Gene Technology 2015, 4:1 The problem to be solved

[0007] The technical problem that the present invention aims to solve is to provide a circular RNA structure that performs self-targeting and splicing reactions.

[0008] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by a person skilled in the art from the description below. means of solving the problem

[0010] To solve the above problem, the present invention provides a self-circulating RNA structure having the following structure:

[0011] 5' - IGS (internal guide sequence) - Ribozyme - gene of interest - target site - 3'.

[0012] In one embodiment of the present invention, the IGS region forms a guanine (G):uracil (U) wobble base pair with a target site, the guanine forming the wobble base pair is located at the 5' end of the IGS region, and the uracil forming the wobble base pair is located at the 3' end of the target site region, and the IGS region may be composed of adenine (A) or uracil in addition to the bases forming the wobble base pair.

[0013] As another embodiment of the present invention, the IGS region may include or be composed of the nucleotide sequence 5'-GNNNNN-3', and the target site region may include or be composed of the nucleotide sequence 5'-N'N'N'N'N'U-3'. The N of the IGS region and the N' of the target site region may each be independently A or U, and the IGS region may include A and U in a ratio of 2:3 or 3:2.

[0014] As another embodiment of the present invention, the base sequence of the IGS region may be inversely complementary to the base sequence of the target site region, excluding the guanine.

[0015] As another embodiment of the present invention, the ribozyme may be a Group I intron ribozyme, and the ribozyme may include or be composed of the nucleotide sequence of SEQ ID NO. 6.

[0016] As another embodiment of the present invention, the structure may include a nucleotide extended in the 5' direction of an IGS region to form a P1 helix and a P10 helix, wherein the P1 helix is ​​formed in a region where complementary binding between the IGS region and the target site occurs together with a nucleotide extended in the 3' direction of the target site, and the P10 helix is ​​formed in a region where the nucleotide extended in the 5' direction of the IGS region is complementary to a sequence that is inversely complementary to the extended nucleotide located between the ribozyme and the GOI region. The length of the extended nucleotide forming the P1 helix may be 3-nt, and the length of the extended nucleotide forming the P10 helix may be 6-nt.

[0017] As another embodiment of the present invention, the structure may form a P1 helix but not a P10 helix.

[0018] As another embodiment of the present invention, the structure may include a region that can be complementarily coupled to each other at the 5' end and the 3' end, and an ABS (antisense binding sequence) region.

[0019] As another embodiment of the present invention, the ABS region may be composed of a sequence that is reverse complementary to the AS region.

[0020] As another embodiment of the present invention, the length of the AS region may be variable depending on the GOI, but may be 10 to 500-nt, preferably greater than 50-nt and less than 400-nt, more preferably 150-350-nt.

[0021] As another embodiment of the present invention, the GOI region may include an IRES (internal ribosome entry site) region at the 5' end and may include a start codon and a stop codon.

[0022] As another embodiment of the present invention, the structure may further include a spacer region consisting of a random nucleotide sequence, and the spacer region may be located between the IGS region and the target gene region and / or between the target gene region and the target site region.

[0023] As another embodiment of the present invention, the spacer region may include or be composed of poly(A), where poly(A) is a polynucleotide in which adenine (A) is repeatedly connected, and the A may be connected 10 to 50 times, preferably 30 times. Effects of the invention

[0025] The self-circulating RNA structure of the present invention can be expressed in a DNA vector and simultaneously circularized through a self-targeting and splicing reaction without separate GTP treatment to form circRNA. The circRNA can be composed solely of a target gene, and the target gene includes an IRES region, a start codon, and a stop codon, which has the advantage of enabling rapid expression of a peptide or protein. Furthermore, since the circRNA has a circular structure with the 5' and 3' ends not exposed, it is stable and has a high half-life. Therefore, functional RNAs such as miRNA, anti-miRNA, shRNA, aptamer, mRNA vaccine, mRNA therapeutic, antibody, vaccine adjuvant, CAR-T mRNA, genome, or RNA editing-inducing RNA can be prepared as circRNA to ensure high stability within cells. Brief explanation of the drawing

[0027] FIGS. 1a and 1b are schematic diagrams of the process in which a self-circulating RNA structure of the present invention, comprising only IGS, ribozyme, target gene, and target site region, is formed into circRNA by a self-targeting and splicing (STS) reaction. FIG. 2a is a schematic diagram of the process in which the self-circulating RNA structure of the present invention, comprising AS, IGS, ribozyme, target gene, target site, and ABS region, is formed into circRNA by an STS reaction. FIG. 2b is a schematic diagram of the self-circulating RNA structure of the present invention, which includes an IRES and a stop codon in the target gene region to enable translation of the transgene, and additionally includes a nucleotide extended in the 5' direction to form a P1 helix and a P10 helix, and the process of the structure being formed into circRNA by an STS reaction. FIG. 2c is one form of the self-circulating RNA structure of the present invention. FIG. 2d is a DNA template sequence for preparing the self-circulating RNA structure expression vector of the present invention. Figure 3 shows the results of electrophoresis on a polyacrylamide gel to confirm whether circRNA is generated immediately after in vitro transcription of the self-circulating RNA structure expression vector of the present invention, without additional GTP treatment. Samples obtained immediately after transcription (direct STS) and samples after the first and second STS reaction steps, in which additional GTP is treated to induce first and second circulating reactions, were used, and a portion of each sample was treated with RNase R to remove linear RNA, thereby concentrating the circRNA in the sample and performing electrophoresis. Figure 4 verifies that Candidate 1, presumed to be circRNA in the results of Figure 3, is circRNA, Figure 4a is the result of extracting RNA from the candidate 1 band and performing RT-PCR, and Figure 4b is the result of sequencing analysis of the RNA extracted from the candidate 1 band. Figure 5 verifies that the RNA in the candidate 1 band from the results of Figure 4 is a monomer; RNA was extracted from candidate 1 and 2 bands, which are presumed to be circRNA from the results of Figure 3, and Mg 2+ This is the result of electrophoresis after inducing nick by treatment. Figure 6 shows the results of confirming whether the self-circulating RNA structure expression vector of the present invention generates circRNA within a cell and whether the transgene contained in the circRNA is expressed. Specifically, Figure 6a shows the structure of the self-circulating RNA structure expression vector, Figure 6b shows the results of confirming the expression of the transgene through a luciferase activity assay, and Figures 6c and 6d show the results of RP-PCR and base sequence analysis verifying that the transgene is expressed in the circRNA. Figures 7 and 8 show the circRNA purification conditions and purification results via HPLC. Specifically, Fig. 7a shows the HPLC analysis conditions using an Ultra HPLC system, Fig. 7b shows the results of column purification of a sample obtained immediately after in vitro transfer, and Fig. 7c shows the results of column purification after treating the sample with RNase R. In addition, Fig. 8a shows the results of confirming peaks in the fractions obtained through column purification, and Fig. 8b shows the electrophoresis results of fractions 7, 10, 11, 12, and 13, in which peaks were prominent in Fig. 8a. Figures 9 and 10 confirm the effect of the AS region on the STS reaction and cyclicization in the self-cyclic RNA structure of the present invention, Figure 9 is the structure of a self-cyclic RNA containing AS regions of different lengths, and Figure 10 is the electrophoresis result of a sample obtained after in vitro transcription of a vector expressing the RNA. Figures 11 and 12 confirm the effect of the Spacer region on STS reaction and cyclicization in the self-cyclic RNA structure of the present invention. Figure 11 shows the structure of self-cyclic RNA containing a control spacer (control spacer) and poly(A) spacers of various lengths, and Figure 12 shows the electrophoresis results of a sample obtained after in vitro transcription of a vector expressing the RNA. Figure 13 shows the nucleotide sequences near the regions cleavaged by ribozymes of self-circulating RNA containing only the P1 region; self-circulating RNA containing only the P1 and P10 regions; and self-circulating RNA containing the P1 region, P10 region, and AS region, and each region. Figure 14 is the nucleotide sequence of a DNA template for the production of a self-circulating RNA expression vector that has no P10 and AS regions and contains only the P1 region. Figure 15 is the result of electrophoresis of samples obtained after in vitro transcription of each autocyclic RNA expression vector of Figure 13. Figures 16a and 16b are the results of confirming, through electrophoresis, that an autocircular RNA structure is formed as circRNA after in vitro transcription in an autocircular RNA expression vector that contains only the P1 region and lacks the P10 and AS regions. FIGS. 17 to 19 confirm the effect of the base sequence of the P1 region on the STS reaction and cyclicization in the self-cyclic RNA structure of the present invention. Specifically, FIG. 17 shows the design of P1 regions with different base sequences, FIG. 18 shows the electrophoresis results of a sample obtained after in vitro transcription of a self-cyclic RNA expression vector having the P1 region of FIG. 17, FIG. 19 shows the electrophoresis results of a sample obtained after in vitro transcription of a self-cyclic RNA expression vector having an AU-rich P1 region and a self-cyclic RNA expression vector having a 2-site P1 region, and is an RT-PCR electrophoresis result confirming circular RNA. FIG. 20 is a schematic diagram showing only the essential components of a self-circulating RNA structure. FIG. 20a shows that circRNA can be produced using only an RNA structure containing only IGS, ribozyme, and a GOI region and a uracil base at the 3' end. FIG. 20b shows that if a uracil base is included at the 3' end of the GOI, circRNA can be produced using only an RNA structure containing only IGS, ribozyme, and a GOI region, and in this case, the resulting circRNA consists only of GOI. In other words, FIG. 20b is a schematic diagram showing that if uracil is included after five unique base sequences at any part of the GOI, that part is made the 3' end and the remaining part of the 3' side of the GOI is sent immediately after the ribozyme to form a circular RNA consisting only of GOI without additional uracil. Figure 21 shows the design of various combinations of AU-rich target sites. FIGS. 22a and 22b are denature PAGE results confirming circular RNA, obtained as electrophoresis results of a sample obtained after in vitro transcription of an autocyclic RNA expression vector having the AU-rich target site and the corresponding IGS region of FIG. 21. Figure 23a is a simple schematic diagram illustrating that circRNA consisting only of GOI can be produced by selecting a target site inside a target gene and reconstructing the GOI based on it. Figure 23b is a schematic diagram of the structure of a reconstructed GOI in which a target site is selected inside the target gene and the GOI is reconstructed based on this. Figure 23c shows the region of the target site in the nucleotide sequence of the target gene (CVB3 IRES-sGFP). Figure 23d shows each region of the DNA template for expressing a self-circulating RNA structure containing the reconstructed target gene (CVB3 IRES-sGFP). Figure 23e shows the PAGE results after performing IVT using an expression vector of an auto-circular RNA construct containing a reconstructed target gene (CVB3 IRES-sGFP). Figure 24 shows the results of HPLC after performing IVT using an expression vector of an auto-circular RNA construct containing a reconstructed target gene (CVB3 IRES-sGFP). Specifically, FIGS. 24a and 24b show the results of HPLC after IVT of an expression vector of an autocircular RNA construct using a reconstituted target gene rearranged based on the AU11 target site in the target gene (CVB3 IRES-sGFP). FIGS. 24c and 24d show the results of HPLC after IVT of an expression vector of an autocircular RNA construct using a reconstituted target gene rearranged based on the AU19 target site in the target gene (CVB3 IRES-sGFP). FIG. 24e shows the conditions for HPLC execution. Figure 25 shows the results of performing 4% denatured PAGE on the HPLC peak of the IVT product using an expression vector of an auto-circular RNA construct containing the reconstructed target gene (CVB3 IRES-sGFP). Figure 26a shows the region of the target site in the nucleotide sequence of the target gene (CVB3 IRES- R. Luciferase mutant). Figure 26b shows each region of a DNA template for expressing a self-circulating RNA structure containing a reconstructed target gene (CVB3 IRES- R.Luciferase mutant). Figure 26c is the PAGE result after performing IVT using an expression vector of an autocyclic RNA construct containing a reconstructed target gene (CVB3 IRES- R.Luciferase mutant). Figure 26d shows the results of performing 4% denatured PAGE on the HPLC peak of the IVT product using an expression vector of an autocyclic RNA construct containing the reconstructed target gene (CVB3 IRES- R.Luciferase mutant). Figure 27a shows the region of the target site in the nucleotide sequence of the target gene (CVB3 IRES- F. Luciferase). Figure 27b shows each region of a DNA template for the expression of a self-circulating RNA structure containing a reconstruction target gene (CVB3 IRES- F. Luciferase). Figure 27c is the PAGE result after performing IVT using an expression vector of an autocyclic RNA construct containing a reconstructed target gene (CVB3 IRES- F.Luciferase). Specific details for implementing the invention

[0028] The inventors devised a system (hereinafter referred to as 'Circularization system by self-targeting & splicing reaction') in which RNA loaded with a target gene is circulated by performing self-targeting and splicing reactions using a trans-splicing ribozyme (T / S ribozyme) for the production of circRNA (Figs. 1a and 1b).

[0029] Group I intron ribozymes can induce trans-splicing by cleaving target RNA through two consecutive trans-esterification reactions and then connecting transcripts that exist separately at the cleaved 3' ends.

[0030] Accordingly, the system of the present invention can produce circRNA by configuring an internal guide sequence (IGS) in the 5' direction of a gene of interest (GOI) and a target site in the 3' direction so that the IGS binds complementarily to the target site, while forming a guanine (G) : uracil (U) wobble base pair to induce cleavage and splicing by a ribozyme located between the GOI and the IGS (Figs. 2a and 2b).

[0031] Meanwhile, the inventors, drawing on previous research on improving the trans-splicing efficiency of Group I intron ribozymes (Mol Ther.2005 Nov;12(5):824-34.), designed a self-circulating RNA structure such that an AS (antisense sequence) region capable of mutually complementary binding and an ABS (antisense binding sequence) exist at the 5' and 3' ends of the self-circulating RNA structure as schematically illustrated in FIG. 2c, and P1 and P10 helices are formed before and after the secondary structure of the ribozyme, and constructed a DNA template capable of expressing said RNA structure under a T7 promoter (Example 1).

[0032] Subsequently, a vector inserted with the above DNA template was prepared and transcribed in vitro (IVT), after which the formation of circRNA was confirmed. As a result, it was found that the vector expressed a self-circulating RNA structure, and that the RNA structure formed monomeric circRNA immediately after transcription through a self-targeting and splicing (STS) reaction without the addition of GTP (Example 2).

[0033] Furthermore, the inventors sought to verify whether the self-circulating RNA structure expression vector could express the RNA structure of the present invention within a cell, and whether the expressed RNA could express the target gene loaded in the form of circRNA. Specifically, to enable the translation of the gene (transgene) within the cell, an IRES and a stop codon were included within the target gene, and a plasmid vector was prepared using Gaussian luciferase as a transgene within the target gene. The plasmid vector was then transformed into a cell to confirm the generation of circRNA and luciferase activity. As a result, it was confirmed at the molecular level that the prepared plasmid vector expressed the self-circulating RNA structure within the cell, that the structure was circulated into circRNA by a ribozyme, and that the target gene was expressed from the circRNA (Example 3).

[0034] Next, the inventors attempted to optimize the RNA structure to efficiently form circRNA immediately through a direct STS reaction on IVT.

[0035] First, the direct STS reaction rate according to the length of the AS region was confirmed through specific experiments. Specifically, self-circulating RNA expression vectors were prepared such that the lengths of the AS and ABS regions were 50, 100, 150, 200, 250, or 300-nt, and the direct STS efficiency was confirmed after inducing IVT with the vectors. As a result, it was confirmed that the self-circulating efficiency decreased significantly at lengths of 200-nt or longer. Meanwhile, although the self-circulating efficiency was similar at lengths of 50, 100, and 150-nt, it was confirmed that the in vitro transcription reaction itself decreased when AS and ABS regions of lengths of 50 or 100-nt were included; thus, it was confirmed that the length of the AS and ABS regions is 150-nt in terms of the efficiency of cricRNA production (Example 5).

[0036] Meanwhile, just as the efficiency of circRNA production was confirmed according to the lengths of the AS and ABS regions, the efficiency of circRNA production was confirmed according to the length and nucleotide sequence of the spacer region in IVT. As a result, it was found that the length and nucleotide sequence did not have a significant effect on the efficiency of circRNA production, but the connection of 30 adenines (A) was sufficient to prevent structural collisions that could occur due to the narrow gap between the ribozyme and the EMCV IRES in the case of the ribozyme and the EMCV IRES (Example 6).

[0037] In the present invention, Group I intron ribozymes capable of continuous trans-esterification reactions were used. Group I intron ribozymes induce trans-splicing by connecting transcripts separately located at the cleaved 3' end after cleavage at the target site. In the case of self-circulating RNA structures, the 5' region of the GOI is connected to the cleaved 3' end rather than the transcripts separately located therein. Therefore, we sought to determine whether the P1 and P10 helix regions, known to increase trans-splicing efficiency, and the AS and ABS regions at both ends of the self-circulating RNA structures also have a positive effect on circularization efficiency.

[0038] Specifically, the inventors prepared self-circulating RNA expression vectors containing only the P1 helix region, only the P1 and P10 helix regions, or both the P1 and P10 helix regions and the AS region, and confirmed the direct STS efficiency after inducing IVT on the vectors. As a result, surprisingly, it was found that the P10 helix region in the self-circulating RNA construct reduced the circRNA production efficiency in the presence of both the P1 helix and the P10 helix regions. Meanwhile, excellent circRNA production efficiency was also exhibited when only the P1 helix region was included without the AS region (Example 7).

[0039] Furthermore, the inventors designed a self-circulating RNA structure such that only the IGS region forms a P1 helix to ensure that only the target gene remains in the final product, circRNA, and verified whether STS reactions occur in various IGS sequences. As a result, surprisingly, it was confirmed that STS reactions were induced in the self-circulating RNA structure expressed on DNA even when only the IGS region formed a P1 helix, and furthermore, circRNA was formed even though the IGS region and the target site region were not complementary to each other. However, when the IGS region and the target site region are not complementary to each other, non-specific reactions may occur in unintended regions, potentially leading to the generation of unintended products. It was found that the efficiency of circRNA production increased as the proportion of base sequences capable of complementary binding increased for the IGS region of 5'-GNNNNN-3' and the target site region of 5'-N'N'N'N'N'U-3' (Example 8-1). Furthermore, inspired by the results showing high circulation efficiency in AU-rich IGS, the inventors sought to determine whether the efficiency of circRNA production could be increased in specific IGS sequences. Accordingly, they designed various combinations of AU-rich IGS excluding bases that form wobble base pairs, constructed DNA templates for expressing self-circulating RNA structures to have target sites complementary to these IGS, and verified the degree of circRNA formation. As a result, the generation of circRNA was confirmed in all combinations of AU-rich IGS, and in particular, it was confirmed that an AU-rich IGS sequence consisting of two A bases and three U bases had relatively high self-circulation efficiency (Example 8-2).From the above, the inventors confirmed that circRNA can be obtained through an STS reaction using only the RNA structure schematically illustrated in FIG. 1a, and that the self-circulating RNA structure schematically illustrated in FIG. 20a can form circRNA composed only of a target gene containing a U base at the 3' end of the GOI from the circRNA precursor, as shown in the schematic diagram of FIG. 20b.

[0040] Meanwhile, when the 3' end of the GOI ends with a U base, the nucleotide sequence of the IGS region can be designed to be inversely complementary to the GOI, thereby allowing the finally generated circRNA to be composed solely of the GOI region (Fig. 20b). However, when the 3' end of the GOI does not end with a U base, there are difficulties in producing circRNA composed solely of the GOI. The inventors confirmed that by selecting a target site within the GOI and reconstructing the GOI based on said target site, circRNA composed solely of the GOI can be obtained even when the 3' end of the GOI does not end with a U base (Example 9).

[0041] When a target site is selected within the target gene, a portion of the GOI located in the 3' direction relative to the uracil base of the target site is named the “3' region GOI,” and the GOI excluding the 3' region GOI is named the “5' region GOI.” In this case, the reconstructed target gene is designed by connecting the 3' region GOI to the 5' direction of the 5' region GOI. That is, the reconstructed target gene has a structure of 5'-[3' region GOI]-[5' region GOI]-3', where [3' region GOI] and [5' region GOI] are directly connected.

[0042] The inventors designed a target gene containing an IRES and a protein-encoding transgene for the production of circRNA for protein expression, selected a target site within the target gene, and then designed a reconstituted target gene such that the circRNA consists only of the IRES and the transgene. They then constructed a vector expressing a self-circulating RNA structure and confirmed the production of circular RNA. Specifically, they selected a target site within a target gene containing CVB3 as the IRES and sGFP (superfolder GFP), RLuc M185V / Q253A, or FLuc as the transgene, designed a reconstituted GOI based on this, constructed a circular RNA precursor expression vector containing the reconstituted GOI, and confirmed the production of circular RNA and its yield through IVT, PAGE, and HPLC (Examples 9-1 to 9-3). As a result, regardless of the type of transgene, the circular RNA precursor containing the reconstituted target gene produced circular RNA, and it was found that the selection of the target site influenced the yield of circular RNA production.

[0043] Meanwhile, the P1 helix refers to a helix structure formed through complementary binding between a base sequence connected to the shear (5' direction) of the ribozyme and a base sequence in the 3' direction of the transcript that is induced to be spliced ​​by the ribozyme during the formation of the secondary structure of a group I intron ribozyme, and the P10 helix refers to a helix structure formed through complementary binding between a shear region of the ribozyme and a base sequence in the 5' direction of the transcript that is cleaved by the ribozyme.

[0044] In the present invention, the P1 helix can be formed through complementary binding between the IGS at the 5' end and the target site at the 3' end in the self-circulating RNA structure of the present invention, and the P10 helix refers to a helix structure formed through complementary binding between the extended base sequence at the 5' end and the base sequence connected to the trailing end (3' direction) of the ribozyme.

[0045] In this specification, a nucleotide sequence forming a P1 helix is ​​referred to as the P1 region or P1 helix region, and likewise, a nucleotide sequence forming a P10 helix is ​​referred to as the P10 region or P10 helix region.

[0046] In the present invention, the nucleotide sequence of the IGS region is 5'-GNNNNN-3' and the nucleotide sequence of the target site region is 5'-N'N'N'N'N'U-3', and the P1 helix can be formed by the IGS region and the target site region being complementarily combined. In this case, to avoid redundant expressions, the description of the P1 helix region can be used in combination with the nucleotide sequence of the IGS region.

[0047] In the present invention, the P1 helix may be formed by including a nucleotide sequence extended in the 5' direction of the IGS region, and naturally, a nucleotide sequence that is inversely complementary to the extended nucleotide sequence extends in the 3' direction of the target site to constitute the P1 helix. In this case, if the extended nucleotide sequence is present, the extended nucleotide sequence region is designated as P1 in this specification to distinguish it from the IGS region. The same applies to the P10 helix.

[0048] Meanwhile, in the present invention, the target site region is intended to represent a nucleotide sequence that binds complementarily to the IGS region. Depending on the nucleotide sequence design of the IGS region, it may overlap with the target gene (GOI) region. Even in this case, to specify the region that binds complementarily to the IGS region, the region within the target gene that binds complementarily to the IGS region is designated and named as the target site. In other words, in the present invention, the target site may overlap with part or all of the target gene region, or may exist separately from the target gene.

[0049] In the present invention, the AS (antisense sequence) region is located at the 5' end of the self-circulating RNA structure and is intended to form hydrogen bonds with the base sequence of the ABS (antisense binding sequence) region located at the 3' end of the RNA structure. In the present invention, the AS region essentially coexists with the ABS region, and the absence of the AS region is understood to mean the absence of the ABS region, and likewise, an RNA structure containing the AS region is understood to also contain the ABS region.

[0050] Meanwhile, the inventors confirmed the influence of the presence of three types of components—P1 region, P10 region, and AS region—on the circulation efficiency of a self-circulating RNA structure by the STS reaction, and found that the amount of circRNA produced was highest in the order of including all P1 and P10 regions and AS region, including only the P1 region, and including only the P1 and P10 regions. They also confirmed that a self-circulating RNA structure including only the P1 region is circulated with sufficient efficiency to produce circRNA. Accordingly, the present invention provides a self-circulating RNA structure including only the P1 region.

[0051] Accordingly, in this specification, a self-circulating RNA structure containing only the P1 region means that the P10 region and the AS region are absent, and is not used to mean the exclusion of other configurations. Similarly, a self-circulating RNA structure containing only the P1 region and the AS region means that the P10 region is absent, and is not used to mean the exclusion of other configurations other than the P10 region.

[0053] Hereinafter, embodiments are described in detail with reference to the attached drawings. However, various modifications may be made to the embodiments, and thus the scope of the patent application is not limited or restricted by these embodiments. It should be understood that all modifications, equivalents, and substitutions to the embodiments are included within the scope of the rights.

[0055] The terms used in the embodiments are for illustrative purposes only and should not be interpreted as intended to be limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprising" or "having" are intended to indicate the existence of the features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, and should be understood as not precluding the existence or addition of one or more other features, numbers, steps, actions, components, parts, or combinations thereof.

[0057] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by those skilled in the art to which the embodiments pertain. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and should not be interpreted in an ideal or overly formal sense unless explicitly defined in this application.

[0059] In addition, when describing with reference to the attached drawings, identical components are assigned the same reference numeral regardless of drawing symbols, and redundant descriptions thereof are omitted. In describing the embodiments, if it is determined that a detailed description of related prior art could unnecessarily obscure the essence of the embodiments, such detailed description is omitted.

[0061] [Example]

[0062] Example 1. Design of self-circulating RNA and preparation of the RNA expression vector

[0063] Autocircular RNA was designed as shown in Fig. 2c, and a T7 promoter sequence was additionally included in a DNA template for expression for in vitro transcription (Fig. 2d). The DNA template was amplified by PCR using T7 Circular Forward primer: 5'-GGGATTCGAACATCGATTAATACGACTCACTATAGGGGCATCGATTGAATTGTCGA-3' (Tm = 77.5℃) and T7 Circular Reverse primer: 5'-AGATCTCTCGAGCAGCGCTGCTCGAGGCAAGCTT-3' (Tm = 79.4℃), and the DNA template amplification product was inserted into a pTOP TA V2 cloning vector (Enzynomics) using PstI restriction enzyme to prepare an autocircular RNA expression vector.

[0065] Example 2. Confirmation of in vitro transfer and self-circulation

[0066] 2-1. In vitro transcription (IVT)

[0067] The self-circulating RNA expression vector prepared in Example 1 above was transcribed in vitro using NEB’s HiScribe T7 High Yield RNA Synthesis Kit according to the manufacturer’s protocol. Specifically, a reaction was performed at 37°C for 3 hours using a 20 µL scale (1 µg T7 DNA template, 1 X Reaction buffer, 10 mM each of ATP, UTP, CTP, GTP, and T7 RNA polymerase mix, 2 µl), followed by the addition of 29 µL of nuclease-free water, and then 1 µL of RNase-free DNase I (10 µl / µl) to induce an immediate post-transcribing circularization (direct STS) reaction by reacting at 37°C for 30 minutes.

[0068] Subsequently, an additional circularization reaction was induced to confirm the stage at which the self-circulation reaction is completed. Specifically, the first Self-targeting and splicing (1 st To induce the STS reaction, an additional 28 µL of nuclease-free water, 20 µL of 5X STS buffer (50 mM Hepes (pH 7.0), 150 mM NaCl, 5 mM MgCl2), and 2 µL of 100 mM GTP (final 2 mM) were added to make a volume of 100 µL, and the autocyclic reaction was carried out at 37°C for 1 hour. Then, after heating at 55°C for 15 minutes, column purification was performed using the Monarch RNA cleanup kit (NEB). To the 50 µL of column-purified sample, 20 µL of 5X STS buffer, 100 mM GTP (final 2 mM), and 28 µL of nuclease-free water were added again to make a final volume of 100 µL, and the reaction was carried out at 37°C for 3 hours to induce a second STS (2 ndThe STS reaction was induced. After the reaction, the sample was heated at 55°C for 8 minutes, column purification was performed using the Monarch RNA cleanup kit (NEB), and the concentration was measured using a Nanodrop instrument (Thermo Fisher Scientific product).

[0069] Meanwhile, to remove linear RNA from the reaction product, RNase R was applied to some of the column-purified samples after the first and second STS reactions. Specifically, 10 µL of 10X RNase R reaction buffer (10X: 0.2 M Tris-HCl pH 8.0, 1 M KCl, 1 mM MgCl2) and 20 units of RNase R were added to up to 100 µL of column-purified IVT RNA (volume adjusted to 100 µL with water) and reacted at 37°C for 30 minutes, after which 10 units of RNase R were added and reacted for another 30 minutes, followed by column purification using the Monarch RNA cleanup kit (NEB) and concentration measured with a Nanodrop.

[0070] 250 ng each of RNA obtained from each STS step and the sample of RNA obtained from each step treated with RNase R was mixed with 10 M Urea-BPB (1X TBE) dye in a 1:1 ratio and heated at 75°C for 5 minutes, followed by 4% Polyacrylamide-7 M Urea denature PAGE (electrophoresis for 2 hours at 50 W while maintaining a temperature of 50°C), and the gel was stained with SYBR Gold Nucleic Acid Stain (Thermo Fisher Scientific) and analyzed using ImageQuant 800 (Cytiva product).

[0071] As a result, as can be seen in Figure 3, treatment with RNase R resulted in the appearance of RNA bands that were not effectively cleaved by RNase R and became abundant (Candidate 1), while other bands that were clearly observable despite RNase R treatment were identified (Candidate 2 and a band presumed to be Nicked circular RNA). In addition, an additional 1 st and 2 nd It was confirmed that even without performing the STS reaction, a substance presumed to be circRNA was sufficiently produced through the direct STS reaction, that is, the in vitro transcription reaction alone.

[0073] 2-2. Confirmation of Auto-annularization

[0074] Next, RT-PCR sequencing analysis was performed to verify that Candidate 1 was circRNA among the RNA bands that were not cleaved by RNase R in the PAGE results. Specifically, RT-PCR was performed using primers that enable PCR amplification only when circRNA is produced, using a Circular RNA sample purified by ethanol precipitation after cutting and crushing the band at the Candidate 1 position in the PAGE and eluting it in water at 37°C for 3 to 16 hours, and a linear RNA that cannot be circularized because it lacks ribozyme and antisense regions as a control.

[0075] Reverse transcription (RT) was performed using OneScript Plus RTase (Abm). 125 ng of each RNA (a sample with or without RNase R treatment of the control RNA and RNA presumed to be circular RNA) was heated at 70°C for 5 minutes and placed on ice. Then, 4 µL of 5X RT buffer, 1 µL of 10 mM dNTP mix, 1 µL of 2 µM reverse primer (Circular STS R), and 200 µL of OneScript Plus RTase were added in sequence to a final volume of 20 µL. The mixture was reacted at 50°C for 15 minutes, heated at 95°C for 5 minutes to inactivate the enzyme, and then stored on ice.

[0076] Next, PCR was performed using AccuPower Taq PCR premix (Bionia). 2 µL of RT sample and 1 µL each of 20 µM Circular STS F (5'-CCCTGAGTGGCTGAGCTCAGG-3') and Circular STS R (5'-CAGCAAGCATACTAAATTGCCAG-3') were added, and the volume was adjusted to 20 µL with water. PCR amplification was performed under conditions of 95°C for 1 minute, [95°C for 30 seconds, 65°C for 30 seconds, 72°C for 30 seconds] for 35 cycles, and 72°C for 5 minutes. 5 µL of the PCR product was placed in 1 µL of 6X DNA loading dye and subjected to electrophoresis at 150 V for 35 minutes, after which the image was analyzed using a gel imaging system (Davinch-Gel product from Youngin Science). The expected length of the STS PCR product is 479 bp, and when analyzed with a GeneRuler 50 bp DNA ladder (Thermo Fisher Scientific) on a 1.5% agarose gel (containing IntronBio’s RedSafe Nucleic Acid Staining Solution at a 1X concentration), a specific PCR product of the predicted size was observed only in RNA samples presumed to be circular RNA, regardless of RNase R treatment (Fig. 4a).

[0077] In addition, PCR products were isolated and purified from the obtained band of expected size using a gel extraction kit (Cosmojintech product) according to the manufacturer's protocol, cloned using a TOPcloner TA-Blunt kit (Engenomics product), and transformed into DH5alpha E. coli (Chemically competent E. coli, Engenomics product) to obtain E. coli colonies on an LB-Agar (Kanamycin containing) plate. Plasmid DNA was extracted and purified using a DNA purification kit (Cosmojintech product) according to the manufacturer's protocol and submitted for sequencing analysis (Cosmojintech's Sanger sequencing service, using M13R (-40) or M13F (-20) universal primers provided by the company), and it was confirmed that the 3' of Gaussia Luciferase and the 5' of IRES were accurately connected at the STS junction site (Fig. 4b).

[0078] From the above results, it can be seen that Candidate 1 is a circular RNA.

[0080] 2-3. Re-verification of Self-Circulation

[0081] Although it was confirmed that Candidate 1 is circRNA through RT-PCR, theoretically, the possibility that the above candidate 1 is in the form of a dimer cannot be ruled out. Therefore, a nicking test was performed to re-verify that Candidate 1 is circRNA.

[0082] Purified circular RNA candidates 1 and 2 (100 ng) were mixed with MgCl2 at final concentrations of 0, 2.5, and 5 mM, respectively, and the samples were heated at 65°C for 30 minutes in 10 μL of water, then stored on ice for a short time, and then mixed with 10 μL of 10 M Urea-BPB (1X TEB) loading dye.

[0083] After heating at 75℃ for 5 minutes, 4% Polyacrylamide-7 M Urea denature PAGE (electrophoresis for 2 hours at 50 W while maintaining a temperature of 50℃) was performed, and the gel was stained with SYBR Gold Nucleic Acid Stain (Thermo Fisher Scientific) and analyzed using ImageQuant 800 (Cytiva product). The results are shown in Figure 5.

[0084] In the case of Candidate 1, Mg 2+ Under conditions without [unclear], it contained a band corresponding to the size of a small nicked circular RNA (1092-nt), and 2.5 mM Mg 2+ Under the condition, it was confirmed that the band at position 1, considered to be the location of circular RNA, decreased, and that a band of nicked circular RNA size still existed. 5 mM Mg 2+ Under the conditions, it was confirmed that the nicked circular RNA band completely disappeared due to hydrolysis. Through this, it was observed that Candidate 1, the circular RNA, passed through a 1092-nt size band (2.5 mM Mg2+) expected to be monomer when nicking occurred, and was eventually completely degraded (5 mM Mg2+), thus reconfirming that Candidate 1 is circular RNA and a monomer.

[0085] Meanwhile, Candidate 2 has a size similar to intact RNA (around the 2000-nt mark of the marker) of 1874-nt, and 2.5 mM Mg 2+ Unlike Candidate 1, under mild nicking conditions, the 1092-nt band, which is the size of nicked circular RNA, was not generated and disappeared, indicating that it was not circular RNA.

[0087] Example 3. Confirmation of Intracellular Transcription and Autocyclic Regeneration

[0088] In Example 2, it was confirmed that the self-circulating RNA expression vector prepared in Example 1 was transcribed in vitro to form circRNA. Therefore, we wanted to confirm whether the vector works in the same way in cells, and furthermore, whether the target gene contained in the circRNA is smoothly expressed in cells.

[0089] To express the target gene within the cell, the target gene was designed with the structure of 5'-EMCV IRES-transgene-stop codon-3', and gaussian luciferase (G.luci) was used as the transgene to easily confirm the expressed target gene.

[0090] A self-circular RNA structure containing the aforementioned target gene was designed, and a DNA template capable of expressing it was inserted into a plasmid to be expressed under a pCMV promoter (Fig. 6a). The plasmid vector was transfected into 293A cells, the production of circRNA was confirmed through RT-PCR and sequencing analysis, and the expression of the transgene was confirmed by performing a luciferase activity assay.

[0091] Specifically, 2x10 in a 6-well plate 5 293A cells were seeded into / wells and, after 24 hours, were transformed with the plasmid vector using lipofectamine 2000 transfection reagent. The culture medium was replaced 6 hours after transformation. Then, 100 µL of culture medium was collected at 12, 24, and 48 hours after transformation to measure G.luci activity. G.luci activity was detected in the culture medium, and as it was confirmed that the activity increased over time, it was confirmed that the transgene G.luci was expressed from the vector introduced into the cells (Fig. 6b).

[0092] Whether the expression of the transgene was due to the formation of circRNA was confirmed at the molecular level through RT-PCR and sequencing analysis. 48 hours after transformation, total RNA was extracted using trizol reagent from 293A cells into which the plasmid vector was introduced, and RT-PCR was performed to confirm that circular RNA was produced.

[0093] Reverse transcription (RT) was performed using OneScript Plus RTase (Abm product). 1 µg of total RNA was heated at 70°C for 5 minutes, placed on ice, and then 4 µL of 5X RT buffer, 1 µL of 10 mM dNTP mix, 1 µL of 2 µM reverse primer (Circular STS R), and 200 µL of OneScript Plus RTase were added in sequence to a final volume of 20 µL. The mixture was reacted at 50°C for 15 minutes, heated at 95°C for 5 minutes to inactivate the enzyme, and then stored on ice.

[0094] Next, PCR was performed using AccuPower Taq PCR premix (Bionia product). 2 µL of RT sample and 1 µL each of 20 µM Circular STS primer F (5' - caaggacttggagcccatggagcag - 3') and primer R (5' - tgtgccgcctttgcaggtgtatc - 3') were added, and the volume was adjusted to 20 µL with water. PCR amplification was performed under conditions of 95℃ for 1 minute, [95℃ for 30 seconds, 65℃ for 30 seconds, 72℃ for 30 seconds] for 35 cycles, and 72℃ for 5 minutes. The expected length of the STS PCR product was 479 bp, and when analyzed using a GeneRuler 50 bp DNA ladder (Thermo Fisher Scientific) on a 1.5% agarose gel (containing IntronBio’s RedSafe Nucleic Acid Staining Solution at a 1X concentration), specific PCR products of the predicted size were confirmed only when circular RNA was present. At this time, 5 uL of the PCR product was placed in 1 uL of 6X DNA loading dye and subjected to electrophoresis at 150 V for 35 minutes, after which the images were analyzed using a gel imaging system (Youngin Science’s Davinch-Gel) (Fig. 6c).

[0095] In addition, the obtained band of the expected size was isolated and purified using a gel extraction kit (Cosmojintech product) according to the manufacturer's protocol, cloned using a TOPcloner TA-Blunt kit (Engenomics product), and transformed into DH5alpha E. coli (Chemically competent E. coli, Engenomics product) to obtain E. coli colonies on an LB-Agar (Kanamycin containing) plate. The plasmid DNA was extracted and purified using a DNA purification kit (Cosmojintech product) and manual, and sequencing analysis was requested (Cosmojintech's Sanger sequencing service, using M13R (-40) or M13F (-20) universal primers provided by the company). As a result, it was confirmed that the 3' of Gaussia Luciferase and the 5' of IRES were accurately linked at the STS junction site (Fig. 6d).

[0096] From the above, it was possible to confirm at the molecular level that the prepared plasmid vector expresses a self-circulating RNA structure within a cell, the structure is circulated into circRNA by ribozymes, and the target gene is expressed from the circRNA.

[0098] Example 4. circRNA purification

[0099] 4-1. Confirmation of circRNA purification potential via HPLC

[0100] To minimize the occurrence of immunogenicity in the production of circRNA for human injection, analysis and purification using HPLC were performed. Specifically, an Agilent 1290 Infinity II Bio UHPLC system was used, and the analysis conditions are as shown in Figure 7a. For analysis, the gradient condition of [Analytical] was used, and for sample fractionation, the condition of [Fraction collection] was used.

[0101] When analyzing RNA purified only by column (Fig. 7b) and RNA treated with RNase R (Fig. 7c) using the Monarch RNA cleanup kit (NEB) after IVT, there was an increasing peak in the sample treated with RNase R, which showed that circRNA could be separated by HPLC without RNase R treatment.

[0103] 4-2 circRNA purification by HPLC

[0104] Fractions were collected using the gradient specified in the fraction collection conditions via HPLC, and each fraction was obtained as shown in Fig. 8a. Fractions 7 and 10 through 13, which showed distinct peaks, were each run at a rate of 200 ng on 4% denature PAGE, and electrophoresis was performed in the same manner as described above.

[0105] As a result, as can be seen in Fig. 8b, clean circular RNA was isolated and purified from fraction 12.

[0107] Example 5. Optimization of the AS (antisense sequence) region

[0108] We intended to determine the effect of the lengths of the AS (antisense sequence) region and its reverse complementary ABS (antisense binding sequence) region on the immediate cyclic reaction during the in vitro transcription process. Accordingly, DNA templates with varying lengths of the AS and ABS regions of 50, 100, 150, 200, 250, or 300-nt were prepared (Fig. 9), vectors capable of expressing each RNA structure were prepared in the same manner as in Example 1, and in vitro transcription was performed at 37°C for 3 hours in the same manner as in Example 2. The degree of the immediate STS reaction was compared and confirmed by relative band intensity by performing PAGE on a 4% Polyacrylamide-7 M Urea gel (20 x 20 cm, 1 mm).

[0109] The nucleotide sequences of each AS region are shown in Table 1 below.

[0110] division nucleotide sequence (5' --> 3') AS50 AAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC AS100 ACTCGAAGTGGCTGCGTACCACACCCGTCGCATTGGAGAAGGGCACGTAGAAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC AS150 GGCGGCCAGCATGGAGAACTGCCATGGCTCAGCCAGGTAGTACTGTGGGTACTCGAAGTGGCTGCGTACCACACCCGTCGCATTGGAGAAGGGCACGTAGAAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC AS200 AGCGTGAGGAAGTTGATGGGGAAGCCCAGCACGATCAGCAGAAACATGTAGGCGGCCAGCATGGAGAACTGCCATGGCTCAGCCAGGTAGTACTGTGGGTACTCGAAGTGGCTGCGTACCACACCCGTCGCATTGGAGAAGGGCACGTAGAAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC AS250 GGATGTAGTTGAGAGGCGTGCGCAGCTTCTTGTGCTGGACGGTGACGTAGAGCGTGAGGAAGTTGATGGGGAAGCCCAGCACGATCAGCAGAAACATGTAGGCGGCCAGCATGGAGAACTGCCAT GGCTCAGCCAGGTAGTACTGTGGGTACTCGAAGTGGCTGCGTACCACACCCGTCGCATTGGAGAAGGGCACGTAGAAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC AS300 GGTGAAGCCACCTAGGACCATGAAGAGGTCAGCCACGGCTAGGTTGAGCAGGATGTAGTTGAGAGGCGTGCGCAGCTTCTTGTGCTGGACGGTGACGTAGAGCGTGAGGAAGTTGATGGGGAAGCCCAGCACGATCAGCAGAAACATGTA GGCGGCCAGCATGGAGAACTGCCATGGCTCAGCCAGGTAGTACTGTGGGTACTCGAAGTGGCTGCGTACCACACCCGTCGCATTGGAGAAGGGCACGTAGAAGTTAGGGCCTTCTGTGCCATTCATGGCTGTGGCCCTTGTGGCTGACCC

[0111] As a result, as can be seen in Figure 10 and Table 2 below, the self-circulation efficiency of AS50, AS100, and AS150 was relatively superior compared to lengths of AS200 or longer. Meanwhile, AS50 and AS100 produced significantly less total RNA after the in vitro transcription reaction. Therefore, it was found that AS150 is the most optimal length for the expression of self-circulating RNA structures and the production of circular RNA.

[0112] AS series AS50 AS100 AS150 AS200 AS250 AS300 A: Total RNA amount generated (μg) 69.5 ± 1.77 9.15 ± 0.46 176.5 ± 3.89 140 ± 3.54 133 ± 2.83 141 ± 5.66 B: Relative band intensity of circular RNA (%) 6.35 ± 0.25 6.75 ± 0.04 5.95 ± 0.18 4.30 ± 0.07 4.20 ± 0.07 3.60 ± 0.14 Relative factor (A * B) 441 62 1050 602 559 508

[0114] Example 6. Spacer Region Optimization

[0115] Next, to determine the effect of the length or type of spacer region on the immediate cyclic reaction during in vitro transcription, DNA templates containing spacer regions of different lengths and nucleotide sequences were constructed (Fig. 11). Vectors capable of expressing each RNA construct were prepared in the same manner as in Example 1, and in vitro transcription was performed at 37°C for 3 hours in the same manner as in Example 2. The degree of the immediate STS reaction was compared by Relative band intensity using PAGE on a 4% Polyacrylamide-7 M Urea gel (20 x 20 cm, 1 mm). The nucleotide sequences of each spacer region are shown in Table 3 below. In this experiment, the spacers of A10, A30, and A30 were utilized by adding a restriction site to the 3' end immediately following the spacer region for IRES insertion. In this experiment, an AatⅡ site (GACGTC) was added to the 3' end of the spacer.

[0116] division nucleotide sequence (5' --> 3') A10 AAAAAAAAAA A30 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A50 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Control spacer 1 GGTAGTGGTGCTACTAACTTCAGCCTGCTGAAGCA Control spacer 2 GGTAGTAAAACTACTAACTACAACCTGCTGAAGCA

[0117] As a result, as can be seen in Figure 12 and Table 4 below, despite differences in spacer length and sequence, there was no significant difference in immediate circularization efficiency during the in vitro transcription process, but it was found that A30 acted as the most optimal spacer for the expression of self-circulating RNA structures and the production of circular RNA.

[0118] AS150Spacer version A10 Control spacer 1 Control spacer 1 A30 A50 A: Total RNA amount generated (μg) 199.5 ± 9.19 199.5 ± 6.36 187 ± 5.66 190 ± 8.49 192.5 ± 0.71 B: Relative band intensity of circular RNA (%) 5.55 ± 0.35 6.7 ± 0.14 6.15 ± 0.07 6.5 ± 1.27 5.7 ± 0.85 Relative factor (A * B) 1106 ± 19 1311 ± 70 1150 ± 21 1240 ± 297 1097 ± 160

[0119] Example 7. Optimization of Autocyclic RNA Structures

[0120] 7-1. AS region, P1 helix, and P10 helix region

[0121] The self-circulating RNA structure designed in Example 1 includes an AS region, a P1 helix, and a P10 helix region. Below, in order to confirm the effect of each configuration on the immediate circularization reaction during the in vitro transcription process, DNA templates containing only the P1 helix region, only the P1 and P10 helix regions, or both the P1 and P10 helix regions and the AS region were prepared as schematically illustrated in Fig. 13, and vectors capable of expressing each RNA structure were prepared in the same manner as in Example 1. In vitro transcription was performed at 37°C for 3 hours in the same manner as in Example 2, and the degree of the immediate STS reaction was compared and confirmed by relative band intensity by performing PAGE on a 4% Polyacrylamide-7 M Urea gel (20 x 20 cm, 1 mm).

[0122] The nucleotide sequence of the T7 DNA template containing only the P1 helix region is as shown in Fig. 14.

[0123] As a result, as can be seen in Figure 15 and Table 5 below, there was no significant difference in the total RNA transcribed in vitro by each vector, but it was found that the amount of circular RNA produced was higher in the order of containing both the P1 and P10 helixes and the AS region, containing only the P1 helix region, and containing only the P1 and P10 regions.

[0124] AS150 P1 (No AS) P1&P10 (No AS) P1&P10 (AS150) A: Total RNA amount generated (μg) 200 196 182 B: Relative band intensity of circular RNA (%) 3.2 0.5 5.1 Relative factor (A * B) 640 98 928

[0126] 7-2. Verification of Circulation of Autocirculating RNA Constructs Not Containing P10 and AS Regions

[0127] From the results of Example 7-1, it can be seen that sufficient circRNA can be produced from a DNA template (P1 structure) that does not contain P10 and AS regions without an additional circularization step during the in vitro transcription process. To verify this, the product after the STS reaction of Example 7-1 was treated with RNase R to remove linear RNA, PAGE was performed in the same manner as in the previous experiment, and RT-PCR and sequencing analysis were performed in the same manner as in Example 2-2.

[0128] As a result, as can be seen in Figures 16a and 16b, even when self-circulation was performed using the P1 structure, an RNA band was observed that was not easily cleaved by RNase R and became abundant when treated with RNase R, and RT-PCR and sequencing analysis were performed on the STS reaction product of the band, confirming that it was circRNA.

[0130] Example 8. Optimization of P1 helix region

[0131] 8-1. P1 helix region and autocirculation

[0132] Through the results of Example 7, it was confirmed that self-circulating structures without P10, AS, and ABS can sufficiently produce circRNA. Accordingly, it was hypothesized that circular RNA would be produced if only the base sequences of the Internal Guide Sequence (IGS) located at the 5' end of the P1 helix and the target site located at the 3' end were made to bind complementarily to each other (U and G are wobble base pairs), and this was intended to be verified.

[0133] Since the IGS region is GNNNNN and the target site base sequence is N'N'N'N'N'U, adding only one nucleotide U to the GOI results in a circRNA composed of only one U base and the GOI region (Figs. 1a and 1b). Additionally, when the 3' end of the GOI ends with a U base, the base sequence of the IGS region can be designed to be inversely complementary to the GOI, thereby allowing the circRNA to be composed only of the GOI region (Figs. 20a and 20b).

[0134] As shown in Fig. 17, the sequences of the IGS and target site were designed in various ways, and after preparing the vector using the method of Example 1, the in vitro transcription (IVT) of Example 2-1 was performed.

[0135] As a result, as can be seen in Figures 18-19 and Table 6 below, an increase in circRNA generated through an immediate STS reaction after in vitro transcription was observed when both ends had complementary sequences, and it was confirmed that the efficiency of circRNA generation was higher, particularly when the IGS and target site were AU-rich sequences. Meanwhile, it was found that vectors containing a no-complement IGS region generated very low levels of circRNA. From the above, it can be seen that if the IGS and the target site are complementary to each other, they can efficiently induce an autocirculation reaction.

[0136] P1 variants (No AS) AS150(P1&P10) RZ004 RZ001 RZ003 GC-rich AU-rich 2 sites No complement Relative band intensity of circular RNA (%) 5.4 3.7 7.9 6.6 5.4 11.6 6.1 1

[0138] 8-2. P1 helix region optimization

[0139] When the sequences of the IGS and the target site are complementary, an immediate STS reaction occurs after transcription in vitro; however, it was found that the STS reaction occurs more actively, particularly in AU-rich IGS and target site sequences. Subsequently, to determine whether specific sequences among the A and U bases constituting the P1 helix affect autocyclic efficiency, a total of 32 combinations of AU-rich IGS were designed, target sites were constructed to have sequences complementary to the said IGS, and the experiment was performed in the same manner as in the preceding Example 8-1 (Fig. 21). To establish identical conditions, the GOI was selected so that none of the 32 AU-rich sequences were present, and the AU-rich sequences complementary to the said IGS were counted in the constructed autocyclic and RNA structures to determine whether the said IGS could bind complementarily to regions other than the target site. One sequence complementary to IGS 17 and 18 was identified within the ribozyme sequence, and no other sequence complementary to IGS was identified within the RNA structure. Meanwhile, since ribozyme cannot target and splice its internal sequence, the circular RNA produced from the self-circulating RNA structure expression vector containing IGS 17 and 18 is generated by targeting and splicing by ribozyme through the complementary binding of the IGS to the target site.

[0140] After reacting for 3 hours at 37°C with a 20 µL scale (1 µg T7 DNA template, 1 X Reaction buffer, 2 µl each of 10 mM ATP, UTP, CTP, GTP, and T7 RNA polymerase mix), 29 µL of nuclease-free water was added, followed by the addition of 1 µL of RNase-free DNase I (10 µg / µl) and incubation at 37°C for 30 minutes. Subsequently, column purification was performed using the Monarch RNA cleanup kit (NEB), and the concentration was measured using a Nanodrop instrument (Thermo Fisher Scientific product). 250 ng of each sample was thoroughly mixed with 10 M Urea-BPB (1X TBE) dye at a minimum sample:Dye ratio of 1:1 or a higher ratio of Dye, heated at 75°C for 5 minutes, and then subjected to electrophoresis for 2 hours on 4% Polyacrylamide-7 M Urea denature PAGE (SYBR Gold Nucleic Acid Stain, Thermo Fisher Scientific) at 50 W while maintaining the temperature at 50°C to confirm the production of circular RNA.

[0141] The results for IGS conditions 1 through 16 are as shown in Fig. 22a, and the relative band intensity was high under IGS conditions 14, 15, and 16, and among them, it was found that the self-circulation efficiency was highest in the IGS sequence of 16.

[0142] The results for the remaining IGS conditions from 17 to 32 are as shown in Figure 22b, and high relative band intensity was observed in IGS sequences 17, 18, 25, and 28-32. Considering the intensity and consistency of the circular RNA bands through repeated experiments, the AU-rich IGS sequences composed of 2 A bases and 3 U bases showed relatively high autocirculation efficiency, with the highest autocirculation efficiency in IGS sequence 16, followed by IGS sequence 28.

[0144] Example 9. GOI Reconstruction

[0145] Additionally, to produce circRNA consisting solely of GOI, the inventors selected a GOI region capable of forming wobble base pairs with IGS as a target site to form circRNA. However, if a target site is selected within a GOI and circRNA is formed as is, the GOI in the downstream region of the target site is cleaved by ribozymes and is not included in the circRNA. Therefore, it is necessary to reconstruct the GOI located upstream and downstream of the target site region (Fig. 23a). Hereinafter, the GOI region located downstream of the target site region is referred to as the 3' region of GOI, and the GOI region excluding the 3' region of GOI is referred to as the 5' region of GOI.

[0146] That is, the inventors selected five bases located upstream of a U base capable of forming wobble base pairs within the GOI as target sites, and designed the circRNA formed by reconstructing the GOI so that the 3' region GOI located downstream of the U base is positioned above the 5' region GOI so that it can be composed of an intact GOI.

[0147] Meanwhile, the GOI may contain two or more U bases capable of forming wobble base pairs. Accordingly, when multiple candidate regions for a target site exist within the GOI, for efficient circRNA production, the target site is selected as one where the five consecutive bases upstream of the U base have high A and U content, as confirmed in Example 8-2. In the figure, the region with high A and U content is labeled “AU rich”.

[0148] Figure 23b illustrates an example of target site selection within a GOI and subsequent GOI reconstruction.

[0149] In the following, the inventors sought to verify whether intended circRNA could be produced through the aforementioned target site selection and GOI reconstruction. Specifically, a target site was selected within a GOI using CVB3 as the IRES and sGFP, RLuc M185V / Q253A, or FLuc genes as transgenes, and the GOI was reconstructed to construct a circular RNA precursor expression vector, followed by IVT. For comparison, a circular RNA precursor with a target site set in the spacer region was constructed, and the target site located in the spacer region is designated as the spacer target. Specific cases of circular RNA precursors are described in the drawings. The production of circular RNA and its yield were confirmed via PAGE and HPLC using the results of the IVT performed on each circular RNA precursor.

[0151] 9-1. GOI : CVB3 IRES-sGFP

[0152] A target gene was designed to enable sGFP expression via CVB3 IRES. Two candidate AU-rich target sites were selected from CVB3 IRES (indicated as AU11 and AU19, respectively). Figure 23c shows the sequence of the target gene and the two AU-rich target site regions within it. A spacer target was used as a control. The initially designed spacer region (AC40 spacer) does not contain any regions that could serve as candidate target sites. Meanwhile, previous studies have confirmed that the length of the spacer region does not affect circularization efficiency. Accordingly, the AC108 spacer was separately designed as a spacer target and constructed to be included in the circular RNA precursor.

[0153] The GOIs upstream and downstream of the target site of AU11 or AU19 of the above-mentioned target gene were reconstructed, and circRNA formation was confirmed by performing IVT. Figure 23d shows each region as a DNA template for circular RNA precursor expression when AU11 was selected as the target site. When AU19 was selected as the target site, the GOIs were reconstructed in the same way as when AU11 was selected as the target site to design a DNA template, and each was prepared as a vector according to the method of Example 1, after which the in vitro transcription (IVT) of Example 2-1 was performed.

[0154] PAGE was performed after IVT to confirm the generation of circRNA (Fig. 23e). As a result, it was confirmed that circular RNA precursors with AU11 and AU19 as target sites formed circRNA through the STS reaction, and that circular RNA precursors with a higher efficiency of circulation were observed in the AU11 target site circular RNA precursor.

[0155] The above PAGE results were reconfirmed by performing IP-RP HPLC (Figs. 24a to 24d). When analyzing samples that had undergone autocyclic conversion using the AU11 target site and were treated with RNase R, a high level of circRNA peaks was observed. On the other hand, for autocyclic constructs using the AU19 target site, which showed relatively lower autocyclic conversion efficiency consistent with the PAGE results, a relatively small circRNA peak was observed when analyzed by HPLC after treatment with RNase R. 4% denatured PAGE was performed on each peak identified from the above IP-RP HPLC results (peaks in Figs. 24b and 24d), and it was confirmed that circRNA was purified (Fig. 25).

[0156] Table 7 below shows the autocyclic efficiency and final yield of circular RNA precursors designed according to the selection of target sites within the GOI. In Table 7, AU16 and AU28 are not shown in Fig. 23c, and the target site (5'-ACGGCU-3') located in the spacer is a control for comparison.

[0157] IRES P1 target site Gene Final Circular Acquisition Efficiency (%) = Amount of Circular RNA purified via IP-RP HPLC / Amount of IVT CVB3 AU16 GFP 6.2 AU28 6.5 AU11 22.9 AU19 1.9 spacer 6.6

[0158] The above results suggest that there are significant differences in self-circulation efficiency and final yield depending on which AU-rich target site is selected for the completely identical GOI sequence or P1 structure.

[0160] 9-2. GOI: CVB3 IRES-R.Luciferase(M185V / Q235A)

[0161] A target gene was designed to enable the expression of the RLuc mutation (M185V / Q235A) by CVB3 IRES. An AU11 target site was selected within the sequence of the target gene, and a DNA template was designed by reconstructing the GOI based on this. After preparing the template as a vector according to the method of Example 1, in vitro transcription (IVT) as in Example 2-1 was performed. A spacer target was used as a control. The circular RNA precursor used as a control, identical to that in Example 9-1, was designed and constructed to include an AC108 spacer.

[0162] Figure 26a shows the sequence of the target gene and the AU-rich target site region within it, and Figure 26b shows the specific sequence and each region of the circular RNA precursor expression DNA template reconstructed from the GOI based on the selected AU11 target site region.

[0163] The results of PAGE after IVT are shown in Fig. 26c, and the circular RNA precursor with AU11 as the target site formed circRNA via STS reaction, which was reconfirmed by IP-RP HPLC. It was confirmed that the circular RNA was purified by performing 4% denatured PAGE on the HPLC peak (Fig. 26d).

[0164] When AU11 is used as the target site, the circular RNA yield is as shown in Table 8 below.

[0165] IRES P1 target site Gene Final Circular Acquisition Efficiency (%) = Amount of Purified Circular RNA / Amount of IVT CVB3 spacer R.Luci 2.1 AU11 13.7

[0167] 9-3. GOI: CVB3 IRES-F.Luciferase

[0168] The same experiment was performed in Example 9-2 by changing the transgene to F. luciferase.

[0169] Figure 27a shows the sequence of the target gene and the AU-rich target site and spacer target site regions within it, and Figure 27b shows the specific sequence and each region of the circular RNA precursor expression DNA template, which was reconstructed using the GOI based on the selected AU11 target site region. The spacer target was used as a control, and in this experiment, all circular RNA precursors were designed and constructed to include AC108 spacers.

[0170] The results of PAGE after IVT are shown in Fig. 27c, and the circular RNA precursor with AU11 as the target site formed circRNA via STS reaction, which was reconfirmed by IP-RP HPLC. It was confirmed that the circular RNA was purified by performing 4% denatured PAGE on the HPLC peak (Fig. 27d).

[0171] IRES P1 target site Gene Final Circular Acquisition Efficiency (%) = Amount of Purified Circular RNA / Amount of IVT CVB3 spacer FLuc NC AU11 (AC 108) 5.7

[0172] From the above results, it can be seen that even when a target site is selected within the target gene regardless of the type of transgene within the target gene and the GOI is reconstructed accordingly, a circular RNA containing only an intact GOI is formed by the circular RNA precursor.

[0174] Although the embodiments have been described above with reference to the limited drawings, those skilled in the art can apply various technical modifications and variations based on the above. For example, suitable results may be achieved even if the described techniques are performed in a different order than described, and / or if the components of the described system, structure, device, circuit, etc. are combined or assembled in a form different from described, or replaced or substituted by other components or equivalents.

[0175] Therefore, other implementations, other embodiments, and equivalents to the claims also fall within the scope of the claims set forth below.

Claims

Claim 1 A self-circulating RNA structure, wherein the structure has a structure of 5' - IGS (internal guide sequence) - Ribozyme - gene of interest - target site - 3', wherein the IGS region forms a guanine (G) : uracil (U) wobble base pair with the target site, the guanine forming the wobble base pair is located at the 5' end of the IGS region, the uracil forming the wobble base pair is located at the 3' end of the target site region, and the IGS region is composed of adenine (A) or uracil in addition to the bases forming the wobble base pair. Claim 2 A self-circulating RNA structure according to claim 1, wherein the target site region overlaps with the target gene region. Claim 3 A self-circulating RNA structure according to claim 1, characterized in that the base sequence of the IGS region is inversely complementary to the base sequence of the target site region, excluding the guanine. Claim 4 In claim 1, the ribozyme is a self-circulating RNA structure that is a Group I intron ribozyme. Claim 5 A self-circulating RNA structure according to claim 1, wherein the ribozyme comprises the nucleotide sequence of SEQ ID NO.

6. Claim 6 A self-circulating RNA structure according to claim 1, wherein the structure comprises a nucleotide extended in the 5' direction of an IGS region to form a P10 helix. Claim 7 A self-circulating RNA structure according to claim 1, wherein the structure comprises nucleotides extended in the 5' direction of the IGS region and the 3' direction of the target site to form a P1 helix. Claim 8 In claim 7, the above structure is a self-circulating RNA structure that does not form a P10 helix. Claim 9 A self-circulating RNA structure according to claim 1 or 6, wherein the structure further comprises an AS (antisense sequence) region in the 5' direction of an IGS region and an ABS (antisense binding sequence) region capable of binding complementarily to the AS region in the 3' direction of a target site. Claim 10 A self-circulating RNA structure according to claim 9, wherein the length of the AS region is 50 to 400 nt. Claim 11 A self-circulating RNA structure according to claim 1, wherein the target gene region includes an IRES (internal ribosome entry site) region at the 5' end. Claim 12 In claim 1, the structure is a self-circulating RNA structure in which a ribozyme region and a target gene region are connected by a spacer region consisting of a random nucleotide sequence. Claim 13 In claim 1, the structure is a self-circulating RNA structure in which a target gene region and a target site region are connected by a spacer region consisting of a random nucleotide sequence. Claim 14 A vector expressing the self-circulating RNA structure of claim 1. Claim 15 In paragraph 14, the vector comprises a promoter operably linked to a gene encoding self-circulating RNA. Claim 16 delete Claim 17 delete Claim 18 delete Claim 19 delete Claim 20 delete Claim 21 delete Claim 22 delete Claim 23 delete Claim 24 delete Claim 25 delete Claim 26 delete

Images