MICROORGANISM WITH IMPROVED BRANCHED-CHAIN ​​L-AMINO ACIDS PRODUCTION CAPACITY AND PROCEDURE FOR PRODUCING BRANCHED-CHAIN ​​AMINO ACIDS USING THE SAME

Abstract

A branched-chain L-amino acid producing microorganism that has enhanced acetate metabolism regulator A activity and a procedure for producing branched-chain L-amino acids using the same are revealed.

Description

MICROORGANISM WITH IMPROVED BRANCHED-CHAIN ​​L-AMINO ACIDS PRODUCTION CAPACITY AND PROCEDURE FOR PRODUCING BRANCHED-CHAIN ​​AMINO ACIDS USING THE SAME [Technical field] This disclosure relates to a branched-chain L-amino acid producing microorganism that has enhanced acetate metabolism regulator activity and to a process for producing a branched-chain L-amino acid using the same. [Background of the art] L-amino acids, as the basic building blocks of proteins, are used as key ingredients in pharmaceuticals, food additives, animal feed, nutritional supplements, pesticides, disinfectants, and similar products. In particular, branched-chain amino acids (BCAAs), a generic term for the essential L-amino acids L-valine, L-leucine, and L-isoleucine, are known for their antioxidant effects and their direct stimulation of protein synthesis in muscle cells. On the other hand, the production of branched-chain amino acids using microorganisms is primarily carried out by microorganisms of the genus Escherichia or microorganisms of the genus Corynebacterium. Branched-chain amino acids are known to be produced biosynthetically using 2-ketoisocaproate as a precursor to pyruvic acid through several steps (US patents 10316297 B2, 10526586 B2, and 10072278 B2). However, the production of L-branched-chain amino acids using microorganisms faces the challenge that mass production is not easily achieved industrially. [Divulgation] [Technical problem] Against this background, as a result of intense efforts to improve the ability to produce branched-chain L-amino acids using microorganisms, the present inventors have discovered that the ability to produce branched-chain L-amino acids increases significantly by increasing the expression of the acetate metabolism regulator A (hereafter referred to as RamA) of the microorganisms, thus completing the present disclosure. [Technical solution] One objective of this disclosure is to provide a microorganism that produces nczAnn / zznz / E / YiAi branched-chain L-amino acids that have enhanced acetate metabolism regulator activity. Another object of the present disclosure is to provide a branched-chain L-amino acid producing microorganism that includes a polynucleotide having promoter activity and that includes the substitution of a nucleotide with a different nucleotide at one or more corresponding positions selected from the 34s, 36s, 37s, 413s and 43s nucleotide positions of a nucleotide sequence as set out in SEQ ID NO: 1. Another objective of this disclosure is to provide a procedure for producing a branched-chain L-amino acid, including the procedure for cultivating the microorganism in a culture medium. Another object of the present disclosure is to provide a polynucleotide having promoter activity and including the substitution of a nucleotide with a different nucleotide at one or more corresponding positions selected from positions 34, 36, 37, 41 and 43 of a nucleotide sequence as set forth in SEQ ID NO: 1. [Advantageous effects] Branched-chain L-amino acids can be produced in high yields by cultivating the branched-chain L-amino acid producing microorganism that includes the polynucleotide of this disclosure. Furthermore, the amino acids produced by this disclosure can be applied to various products, such as human food, feed additives, or pharmaceuticals, as well as animal feed or animal feed additives. [Best way] This disclosure will be described in detail. Furthermore, each description and embodiment disclosed herein may be applied to different descriptions and embodiments. In addition, all combinations of various components disclosed herein are included within the scope of this disclosure. Furthermore, the scope of this disclosure should not be limited by the descriptions provided below. Those skilled in the art will recognize, or be able to determine through routine experimentation alone, many equivalents to the specific embodiments of this disclosure. It is intended that such equivalents will fall within the scope of the following claims. One aspect of this disclosure provides a branched-chain amino acid-producing microorganism that has enhanced acetate metabolism regulator A activity. As used herein, the expression acetate metabolism regulator A refers to a regulatory protein related to acetic acid metabolism as the target protein of this disclosure and may be encoded by the ramA gene. In this disclosure, the expression of acetate metabolism regulator A can be enhanced and the enhanced expression can result in an increased ability to produce a branched-chain L-amino acid. As used herein, the term enhancement of acetate metabolism regulator A activity means that the activity of acetate metabolism regulator A is increased compared to its intrinsic activity. Enhancement can be used interchangeably with activation, upregulation, overexpression, augmentation, and similar terms. In this sense, activation, enhancement, upregulation, overexpression, and augmentation can all include anything that exhibits activity not originally possessed or that exhibits enhanced activity compared to intrinsic activity or activity before modification. Intrinsic activity refers to the activity of a particular polypeptide originally possessed by an original strain or an unmodified microorganism before transformation when the microorganism is transformed by genetic modification caused by a natural or artificial factor.This term can be used interchangeably with pre-modification activity. Enhancement, upregulation, overexpression, or increased activity of a polypeptide compared to intrinsic activity means that the activity and / or concentration (expression level) of a particular polypeptide is enhanced compared to that of an original strain or unmodified microorganism before transformation. The improvement can be achieved by introducing a foreign polypeptide or by enhancing the activity and / or increasing the concentration (expression level) of an endogenous polypeptide. Whether the activity of acetate metabolism regulator A is enhanced can be determined based on the improvement / increase in the activity or expression level of the polypeptide or the amount of a product released from the polypeptide. The enhancement of acetate metabolism regulator A activity can be achieved by applying several well-known procedures in the art, and these procedures are not limited as long as the activity of a target polypeptide is improved compared to that of the nczpnn / zznz / E / YiAi microorganism before modification. Specifically, any genetic engineering and / or protein engineering procedure well-known in the art as routine molecular biology procedures can be used without limitation (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16; Sambrook et al. Molecular Cloning 2012). Specifically, improved activity of acetate metabolism regulator A can be achieved by: 1) increase in the number of copies of a polynucleotide that codes for the polypeptide in cells; 2) replacement of a gene expression regulatory sequence on the chromosome encoding the polypeptide with a sequence that enhances the expression of the polypeptide or introduces a modification to it; 3) modification of a nucleotide sequence that encodes an initiation codon or a 5'-UTR region of a gene transcript that encodes the polypeptide; 4) modification of an amino acid sequence of the polypeptide to improve the activity of the polypeptide; 5) modification of a polynucleotide sequence that codes for the polypeptide to improve the activity of the polypeptide (e.g., modification of a nucleotide sequence of a polypeptide gene to code for a modified polypeptide to have improved activity); 6) introduction of a foreign polypeptide having the activity of the polypeptide and a foreign polynucleotide encoding it; 7) optimization of a codon of a polynucleotide that codes for the polypeptide; 8) modification or chemical modification of a selected exposed region by analyzing a three-dimensional structure of the polypeptide; or 9) any combination of two or more selected from 1) to 8) above, without being limited to them. More specifically, increasing the number of copies of a polynucleotide encoding the polypeptide described in 1) above can be achieved by introducing a vector, which replicates and functions independently of a host cell and is operatively linked to the polynucleotide encoding the polypeptide, into the host cell. Alternatively, increasing the number of copies can be achieved by introducing one or more copies of the polynucleotide encoding the polypeptide into the chromosome of the host cell. Chromosomal insertion can be accomplished by introducing, but is not limited to, a vector capable of inserting the polynucleotide into the host cell's chromosome. The vector is as described below. A gene expression regulatory sequence (or expression regulatory region) on the chromosome encoding the polypeptide can be replaced with a sequence that enhances polypeptide expression or introduces a modification to the polypeptide described in 2) above, for example, by inducing a mutation in the sequence through deletion, insertion, non-conservative or conservative substitution, or any combination thereof, or by replacing the gene expression regulatory sequence with a sequence capable of enhancing polypeptide expression, in order to further improve the activity of the expression regulatory region. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding the ribosome binding site, a sequence for regulating transcription or translation termination, an enhancer, and the like.The substitution can be carried out, specifically, by a procedure of substituting an endogenous promoter for a strong heterologous promoter, but is not limited to them. Examples of strong promoters known in the art may include, but are not limited to, promoters CJ1 to CJ7 (U.S. patent no. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, the SPL13(sm3) promoter (U.S. patent no. 10584338 B2), the O2 promoter (U.S. patent no. 10273491 B2), the tkt promoter, and the yccA promoter. The modification of a nucleotide sequence encoding an initiation codon or a 5'-UTR region of a gene transcript encoding the polypeptide described in 3) above can be achieved, for example, by substituting the nucleotide sequence with a nucleotide sequence encoding another initiation codon that has a higher polypeptide expression level than, but is not limited to, the endogenous initiation codon. The modification of an amino acid sequence or a nucleotide sequence described in 4) and 5) above can be achieved by inducing a mutation in the amino acid sequence of the polypeptide or the nucleotide sequence encoding the polypeptide by deletion, insertion, non-conservative or conservative substitution, or any combination thereof, or by replacing the amino acid sequence or nucleotide sequence with a modified amino acid sequence or nucleotide sequence nczpnn / zznz / E / YiAi to have stronger activity, or by replacing an amino acid sequence from a modified nucleotide sequence to increase activity, in order to further enhance the activity of the polypeptide, without limitation. The substitution can be carried out, specifically, by inserting a polynucleotide into the chromosome by homologous recombination, without limitation.In this regard, a vector used for this purpose may also include a selection marker to confirm its insertion into the chromosome. The selection marker will be described below. The introduction of a foreign polypeptide having the activity of the polypeptide described in 6) above can be achieved by introducing a foreign polynucleotide encoding a polypeptide that exhibits identical or similar activity to the polypeptide in a host cell. The origin or sequence of the foreign polynucleotide is not particularly restricted, provided that the foreign polynucleotide exhibits identical or similar activity to the polypeptide. A procedure used for the introduction can be appropriately selected by those skilled in the art. As the introduced polynucleotide is expressed in the host cell, the polypeptide is produced, and its activity can be enhanced. The optimization of a codon of a polynucleotide encoding the polypeptide described in 7) above can be achieved by optimizing a codon to increase transcription or translation of an endogenous polynucleotide in a host cell, or by optimizing a codon to allow optimized transcription or translation of a foreign polynucleotide in a host cell. The modification or chemical alteration of an exposed region selected by analyzing a three-dimensional structure of the polypeptide described in 8) above can be achieved, for example, by determining a candidate template protein according to similar sequences based on comparing information about a sequence of the polypeptide to be analyzed with a database that stores information about existing protein sequences, identifying the structure based on it, selecting an exposed region to modify or chemically alter, and modifying or chemically altering the exposed region. The improvement in the activity of acetate metabolism regulator A as described above may be an increase in the activity or concentration (expression level) of the polypeptide compared to the activity or concentration of acetate metabolism regulator A expressed in wild-type or non-nczpnn / zznz / E / YiAi modified microorganism strains, or an increase in the amount of a product obtained from the polypeptide, but is not limited to them. More specifically, as used herein, the term gene expression regulatory sequence, used interchangeably with gene expression regulatory region, refers to a sequence operatively linked to a target gene to express the target gene and may include the modified polynucleotide of this disclosure. As described above, the gene expression regulatory sequence of this disclosure may refer to a promoter, enhancer, or the like for effecting transcription of a gene and may be a concept that further includes an operator sequence for controlling transcription, a sequence encoding a suitable mRNA ribosome binding site, and DNA that regulates transcription termination and translation. In one realization of the present disclosure, the gene expression regulatory sequence may be a promoter, although not exclusively. In one embodiment of the present disclosure, the expression of acetate metabolism regulator A can be enhanced by introducing a modification to the promoter or by replacing the promoter with a promoter that has stronger activity, although not exclusively. As used herein, the term promoter refers to an untranslated nucleotide sequence that includes a polymerase binding site, located upstream of a coding region, and which has the activity of initiating the transcription of a target gene into mRNA; that is, a region of DNA that leads to the initiation of gene transcription when a polymerase binds to it. The promoter may be located in the 5' region of an mRNA transcription initiation site. As used herein, the term "operatively linked" means functionally linked to the sequence of a target gene such that a polynucleotide having the promoter activity described herein initiates and participates in the transcription of the target gene. The operational linkage can be achieved using a genetic recombination technique known in the art, and site-specific DNA cleavage and ligation can be performed using, but are not limited to, a restriction enzyme, ligase, or similar agent. In this disclosure, the target gene refers to a gene that encodes the target protein whose expression is to be controlled in a microorganism; specifically, the gene may be a gene that encodes the acetate metabolism regulator A, although this is not the only possible interpretation. More specifically, the gene may be the ramA gene, although this is not the only possible interpretation. nczpnn / zznz / E / YiAi Furthermore, the ramA gene can be an endogenous or foreign gene and may contain a mutation that adjusts its activity. A ramA gene sequence can be easily obtained from a database known as GenBank, maintained by the National Institutes of Health (USA), by experts in the technique. Another aspect of the present disclosure provides a branched-chain L-amino acid producing microorganism that includes a polynucleotide having promoter activity and that includes the substitution of a nucleotide with a different nucleotide at one or more corresponding positions selected from positions 34, 36, 37, 41 and 43 of a nucleotide sequence as set out in SEQ ID NO: 1. As used herein, the term polynucleotide refers to a DNA chain that has a certain minimum length as a polymer of nucleotides in which the nucleotide monomers are linked together in the form of a long chain by covalent bonds. In consideration of the promoter descriptions, the expression polynucleotide having promoter activity may be used interchangeably with modified polynucleotide, modified promoter, or modified ramA promoter in this disclosure, and all terms and expressions described above may be used herein. In this sense, the term modification refers to a genetically or non-genetically stable phenotypic change and may be used interchangeably with mutation in this document. Specifically, the modified polynucleotide described in this disclosure may have altered (increased) promoter activity compared to an unmodified polynucleotide. Therefore, the expression of the ramA gene, which is a target gene operatively linked to the modified polynucleotide described in this disclosure, and the activity of the protein encoded by the ramA gene may be adjusted (increased), and the expression of other genes, as well as the target gene, may also be adjusted. For the purposes of this disclosure, the polynucleotide having promoter activity refers to a polynucleotide capable of expressing a protein involved in an increase in the production of amino acids, specifically branched-chain amino acids, more specifically, amino acids including, but not limited to, leucine, valine, and isoleucine. As used herein, the polynucleotide sequence expression as set forth in SEQ ID NO: 1 may refer to a promoter sequence of a gene nczpnn / zznz / E / YiAi that encodes the acetate metabolism regulator A (RamA). The polynucleotide having promoter activity of the present disclosure is a modified polynucleotide that does not have a naturally derived sequence but has promoter activity and the expression of the target protein operatively bound to it can be increased compared to the polynucleotide sequence as set out in SEQ ID NO: 1. Specifically, the modified polynucleotide of the present disclosure may be a polynucleotide in which the nucleotide sequence set out in SEQ ID NO: 1, i.e., the promoter sequence of the ramA gene, is modified and at least one nucleotide from the nucleotides 34°, 36s, 37a, 41a and 43a of the sequence may be substituted with a different nucleotide. More specifically, the modified polynucleotide of this disclosure may include, but is not limited to, the substitution with T at nucleotide 34a; the substitution with T at nucleotide 36a; the substitution with G at nucleotide 37a; the substitution with T at nucleotide 41a; the substitution with A at nucleotide 43a; or any combination thereof in the nucleotide sequence as set forth in SEQ ID NO: 1. By modification, the polynucleotide of this disclosure may consist of a nucleotide sequence selected from SEQ ID NO: 3 through 5. In one embodiment, the modified polynucleotide of the present disclosure may include the substitution with T at nucleotide 34a; substitution with T at nucleotide 36a; and substitution with G at nucleotide 37a in the nucleotide sequence as set forth in SEQ ID NO: 1. In this instance, the modified polynucleotide of the present disclosure may consist of SEQ ID NO: 5. In another embodiment, the modified polynucleotide of the present disclosure may include the substitution with T at nucleotide 41a; and the substitution with A at nucleotide 43a in the nucleotide sequence as set forth in SEQ ID NO: 1. In this case, the modified polynucleotide of the present disclosure may consist of SEQ ID NO: 4. In another embodiment, the modified polynucleotide of the present disclosure may include the substitution with T at nucleotide 34a; substitution with T at nucleotide 36a; substitution with G at nucleotide 37a; substitution with T at nucleotide 41a; and substitution with A at nucleotide 43a in the nucleotide sequence as set forth in SEQ ID NO: 1. In this case, the modified polynucleotide of the present disclosure may consist of SEQ ID NO: 3. nczpnn / zznz / E / YiAi The branched-chain L-amino acid producing microorganism of the present disclosure may be a microorganism that includes a polynucleotide having promoter activity and includes T substitution at nucleotide 34s; T substitution at nucleotide 362; G substitution at nucleotide 37s; T substitution at nucleotide 41s; A substitution at nucleotide 43°; or any combination thereof in the nucleotide sequence as set forth in SEQ ID NO: 1. Specifically, the branched-chain L-amino acid producing microorganism of this disclosure may be a microorganism that includes a polynucleotide having promoter activity and consisting of a nucleotide sequence selected from SEQ ID NOS: 3 to 5 or a nucleotide sequence having at least 80% and less than 100% sequence homology with the same. The modified polynucleotide of this disclosure will be described in more detail below. As used herein, the term branched-chain amino acid refers to an amino acid that has a branched alkyl group on a side chain and includes valine, leucine, and isoleucine. Specifically, in this disclosure, the branched-chain amino acid may be an L-branched-chain amino acid, and the L-branched-chain amino acid may be, but is not limited to, L-valine, L-leucine, and L-isoleucine. As used herein, the term "branched-chain amino acid producing microorganism" includes all wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. It may also refer to a microorganism that includes the genetic modification to produce a target branched-chain amino acid or that has enhanced activity whereby a particular mechanism is weakened or enhanced by the introduction of a foreign gene or by the enhancement or inactivation of the activity of an endogenous gene. In this disclosure, "microorganism capable of producing a branched-chain L-amino acid" may be used interchangeably with "branched-chain amino acid producing microorganism" and "microorganism that has the ability to produce branched-chain amino acids." For the purposes of this disclosure, the microorganism may be any microorganism capable of producing a branched-chain amino acid and including the modified polynucleotide of this disclosure. Specifically, the branched-chain amino acid producing microorganism may be a microorganism characterized in that the ability to produce a target branched-chain amino acid is enhanced by including the modified polynucleotide.Specifically, in this disclosure, the branched-chain amino acid producing microorganism or the microorganism that has the ability to produce a branched-chain amino acid may be, but not be limited to, a microorganism in which some of the genes in a branched-chain amino acid biosynthesis pathway are enhanced or weakened, or a microorganism in which some of the genes in the branched-chain amino acid breakdown pathway are enhanced or weakened. In one embodiment, in this disclosure, the microorganism of the genus Corynebacterium having the ability to produce branched-chain amino acids may refer to a microorganism of the genus Corynebacterium including the modified polynucleotide of this disclosure or transformed with a vector that includes a gene encoding the polynucleotide of this disclosure to have an enhanced ability to produce branched-chain amino acids. The microorganism of the genus Corynebacterium having an enhanced ability to produce branched-chain amino acids refers to a microorganism that has an enhanced ability to produce branched-chain amino acids compared to the amino acid capacity of an original strain prior to transformation or an unmodified microorganism.The term "unmodified microorganism" does not exclude strains that have a mutation that can occur naturally in microorganisms and refers to a microorganism that does not include the polynucleotide of this disclosure or a microorganism that is not transferred with a vector that includes the polynucleotide of this disclosure. The microorganism of the genus Corynebacterium may specifically include Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, Corynebacterium stationis and the like, without being limited thereto. As used herein, the term vector refers to an artificial DNA molecule that includes genetic material for expressing a target polypeptide in a suitable host cell; specifically, a DNA construct that includes a nucleotide sequence of a polynucleotide encoding the target polypeptide and is operatively linked to a suitable expression regulatory region capable of expressing a target gene. After the suitable host cell is transformed with the vector, the vector can replicate or function independently of the host genome or it can integrate into the genome. The vector used in this disclosure is not particularly limited, and any vector known in the field may be used. Examples of conventional vectors may include a natural or recombinant plasmid, cosmid, virus, and bacteriophage. For example, as phage vectors or cosmid vectors, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, and similar vectors may be used. As plasmid vectors, pDZ-based, pBR-based, pUC-based, pBluescriptlI-based, pGEM-based, pTZ-based, pCL-based, pET-based, and similar vectors may be used. Specifically, the vectors pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118 and pCC1 BAC can be used. For example, a target polynucleotide can be inserted into a chromosome using a chromosomal insertion vector. The polynucleotide can be inserted into the chromosome using any known technique, such as homologous recombination, but this is not the only method. The polynucleotide may also include a selection marker to confirm chromosomal insertion. The selection marker is used to select cells transformed with the vector, that is, to identify whether a target nucleic acid molecule is inserted or not. Markers that provide selective phenotypes, such as drug tolerance, nutrient requirements, resistance to cytotoxic agents, or surface polypeptide expression, can be used.Since only cells expressing the selection marker can survive or show different phenotypes in the environment treated with a selective agent, transformed cells can be selected. As used herein, the term transformation refers to a procedure for introducing a vector containing a target polynucleotide into a host cell or microorganism in such a way that the polynucleotide is expressed in the host cell. The transformed polynucleotide may be in a form inserted into the host cell's chromosome or in a form located outside the chromosome, provided that the polypeptide is expressed in the host cell. Furthermore, the polynucleotide may include DNA and RNA encoding the target polypeptide. The polynucleotide may be introduced into the host cell in any form, as long as it is introduced into the host cell and expressed therein. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all the essential elements necessary for self-replication.The expression cassette typically includes a promoter operatively linked to the polynucleotide, nczpnn / zznz / E / YiAi, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of a self-replicating expression vector. Alternatively, the polynucleotide may be introduced into the host cell in its original form and operatively linked to a sequence required for expression within the host cell, but this is not the only option. Another aspect of this disclosure provides a procedure for producing a branched-chain L-amino acid that includes culturing the microorganism in a culture medium. In addition, the procedure for producing the branched-chain L-amino acid may also include recovering or separating a target substance from the culture medium or microorganism. The polynucleotide, microorganism of the genus Corynebacterium, vector and branched-chain amino acid are as described above. As used herein, the term culture refers to the cultivation of the microorganism of this disclosure in an appropriately adjusted environment. A culture procedure of this disclosure may be carried out using appropriate culture media and culture conditions well known in the art. Persons skilled in the art may appropriately adjust the culture procedure according to a selected strain. Specifically, culture may be carried out by, but is not limited to, a batch culture procedure, a continuous culture procedure, and a batch-feed culture procedure. As used herein, the term culture medium refers to a material in which the nutrients necessary for cultivating the microorganism of this disclosure are mixed as major components and which supplies nutrients and growth factors, as well as water, that are essential for survival and growth. Specifically, although the culture media and other culture conditions for the microorganism of the genus Corynebacterium of this disclosure are not particularly limited as long as the media are commonly used in the cultivation of microorganisms, the microorganism of this disclosure can be cultivated in an ordinary medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins under aerobic conditions while adjusting the temperature, pH, and the like. Specifically, the culture medium for the microorganism of the genus nczpnn / zznz / E / YiAi Corynebacterium is disclosed in a document (Manual of Methods for General Bacteriology of the American Society for Bacteriology (Washington DC, USA, 1981)). In this disclosure, the following may be used as carbon sources: carbohydrates such as glucose, sucrose, lactose, fructose, and maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, and citric acid; and amino acids such as glutamic acid, methionine, and lysine. In addition, natural organic nutrients such as starch hydrolysates, molasses, treacle, rice bran, cassava, sugarcane bagasse, and corn mash liquor may be used, and specifically, carbohydrates such as glucose and sterile pretreated molasses (i.e., molasses converted to reduced sugars) may be used. Appropriate amounts of any other carbon source may also be used without limitation. These carbon sources may be used alone or in combination with at least two of them, although this is not a limiting factor. Nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; and organic nitrogen sources such as amino acids, for example, glutamic acid, methionine, and glutamine, peptone, NZ-amine, meat extract, yeast extract, malt extract, fermented corn liquor, casein hydrolysate, fish or its degradation products, and defatted soybean meal or its degradation products. These nitrogen sources may be used alone or in combination with at least two of them, but are not limited to them. As phosphorus sources, monopotassium phosphate, dipotassium phosphate, or corresponding sodium salts can be used. Inorganic compounds such as sodium chloride, calcium chloride, ferrous chloride, magnesium sulfate, ferrous sulfate, manganese sulfate, calcium carbonate, and similar compounds can be used. Amino acids, vitamins, and / or appropriate precursors can also be included. These components or precursors can be added to the culture medium in a continuous or batch procedure, without limitation. Furthermore, during the cultivation procedure for the microorganism described in this disclosure, the pH of the culture medium may be adjusted by adding a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, or sulfuric acid in an appropriate procedure. Additionally, during the cultivation procedure, foaming may be prevented by using an antifoaming agent, such as a fatty acid polyglycol ester. Oxygen or an oxygen-containing gas may also be injected into the culture medium to maintain aerobic conditions, or nitrogen, hydrogen, or carbon dioxide gases may be injected into the culture medium to maintain anaerobic and microaerobic conditions without injecting any other gas. In this disclosure, the culture temperature can be maintained at 20°C to 45°C, specifically from 25°C to 40°C, and the culture can be carried out for approximately 10 hours to 160 hours, without limitation. The branched-chain L-amino acid produced by the culture described in this disclosure may be released into the culture medium or remain in the cells. The procedure for producing a branched-chain L-amino acid according to this disclosure may further include preparing the microorganism of this disclosure, preparing a culture medium to grow the strain, or any combination thereof (regardless of order, in any order), for example, prior to culturing. The procedure for producing a branched-chain L-amino acid according to this disclosure may further include recovering the branched-chain L-amino acid from the culture medium (in which the cultivation was performed) or the microorganism of this disclosure. The recovery step may be performed additionally after the cultivation procedure. The recovery step can be performed by collecting the target L-branched-chain amino acid using an appropriate procedure known in the art, in accordance with the microorganism culture procedures described in this disclosure, such as a continuous or batch feeding procedure. Examples of methods include centrifugation, filtration, treatment with a protein precipitating agent (desalination), extraction, ultrasonic disintegration, ultrafiltration, dialysis, various chromatographic procedures such as molecular sieve chromatography (gel permeation), adsorption chromatography, ion-exchange chromatography, and affinity chromatography, HPLC, SMB, and any combination thereof. The target L-branched-chain amino acid can be recovered from the culture medium or the microorganism using any appropriate procedure known in the art. Furthermore, the process for producing a branched-chain L-amino acid according to this disclosure may also include a purification step. The purification may be carried out using an appropriate process known in the art. For example, when the process for producing a branched-chain L-amino acid according to nczpnn / zznz / E / YiAi in this disclosure includes both a recovery step and a purification step, the recovery and purification steps may be carried out continuously or discontinuously, regardless of the order, or they may be carried out simultaneously or as an integrated step, without limitation. Another aspect of the present disclosure provides a polynucleotide having promoter activity and includes the substitution of at least one nucleotide selected from the 34s, 36s, 37s, 4Γ and 43s nucleotides of the nucleotide sequence as set forth in SEQ ID NO: 1 with a different nucleotide. The polynucleotide and the promoter are as described above. Furthermore, the modified polynucleotide sequence of this disclosure may be modified by mutagenesis well known in the art, e.g., direct evolution and site-directed mutagenesis. Therefore, the modified polynucleotide of the present disclosure may include a polynucleotide having a nucleotide sequence in which the 34s base is fixed as T; the 36s base is fixed as T; the 37s base is fixed as G; the 413s base is fixed as T; and the 43s base is fixed as A and the other part of the nucleotide sequence has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology or identity with the nucleotide sequence of SEQ ID NO: 3. Furthermore, the modified polynucleotide of this disclosure may include a polynucleotide having a nucleotide sequence in which base 413 is fixed as T; and base 433 is fixed as A and the other part of the nucleotide sequence has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology or identity with the nucleotide sequence of SEQ ID NO: 4. Furthermore, the modified polynucleotide of this disclosure may include a polynucleotide having a nucleotide sequence in which base 343 is fixed as T; base 363 is fixed as T; and base 37 is fixed as G and the other part of the sequence has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology or identity with the nucleotide sequence of SEQ ID NO: 5. In this case, the nucleotide sequence that has homology or identity can exclude a sequence that has 100% identity or can be a sequence that has less than 100% identity. It is obvious that any polynucleotide having a nucleotide sequence that includes deletion, modification, substitution or addition of one or more nucleotides other than nczpnn / zznz / E / YiAi at positions 34Q, 36°, 37°, 41ao 43a is within the scope of this disclosure provided that the nucleotide sequence retains homology and biological activity identical or equivalent to that of at least one nucleotide sequence selected from SEQ ID NOS: 3 to 5. As used herein, the term homology or identity refers to a degree of relatedness between two given amino acid or nucleotide sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably. The homology or sequence identity of conserved polynucleotides or polypeptides can be determined using a conventional alignment algorithm and can be applied in conjunction with predetermined gap penalties set by a program. Essentially, homologous or identical sequences can generally hybridize with each other, either partially or completely, under moderate or very stringent conditions. Hybridization obviously includes the hybridization of one polynucleotide with another polynucleotide that includes a general codon or a codon, taking into account codon degeneracy. Homology, similarity, or identity between two polynucleotide or polypeptide sequences can be determined using any computer algorithm known in the technique, e.g., FASTA program, using predetermined parameters introduced by Pearson et al. (1988) Proc. Nati. Acad. Sci. USA 85:2444. Alternatively, homology, similarity, or identity can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (version 5.0.0 or later) (including the GCG program package (Devereux, J. et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, SF et al., J MOLEC BIOL 215:403 (1990); Guide to Muge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and CARILLO et al. (1988) SIAM J Applied Math 48:1073).For example, homology, similarity, or identity can be determined using BLAST, from the National Center for Biotechnology Information database, or ClustalW. Homology, similarity, or identity between polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program as introduced by Needleman et al. (1970), J Mol Biol. 48: 443, as disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In summary, the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids) that are similar, divided by the total number of symbols in the shorter of the two sequences. Default parameters of the GAP program may include: (1) a binary comparison matrix (containing a value of 1 for identities and 0 for non-identifications) and the weighted comparison matrix of Gribskov et al. (1986), Nuci. Acids Res. 14:6745 as described in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence and Structure, National Biomedical Research Foundation, pp.353-358 (1979) (or EDNAFULL (EMBOSS NCBI NUC4.4 version) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a penalty of 10 for opening a gap and a penalty of 0.5 for extending a gap); and (3) no penalty for closing gaps. Furthermore, the modified polynucleotide of this disclosure may include various modifications made to a coding region, provided that the nucleotide sequence is not changed by codon degeneracy or in consideration of the codons preferred by a living organism in which the polynucleotide is expressed. Likewise, the polynucleotide may include any nucleotide sequence that has promoter activity and hybridizes with a probe constructed using a known gene sequence, for example, a nucleotide sequence wholly or partially complementary to the nucleotide sequence under strict conditions, to include at least one substituted nucleotide in the nucleotide sequence of SEQ ID NO: 1, without limitation. The expression "strict conditions" refers to conditions that allow for specific hybridization between polynucleotides. Such conditions are disclosed in detail in known documents (e.g., J. Sambrook et al.).For example, the conditions may include hybridizing between genes that have high homology, e.g., 40% or higher homology, specifically 70% or higher, 80% or higher, 85% or higher, 90% or higher, more specifically 95% or higher, even more specifically 97% or higher, and more specifically 99% or higher, without hybridizing between genes that have lower homology or identity than described above, or hybridizing once, specifically two or three times, under conventional washing conditions for Southern-type hybridization at a salt concentration and temperature of 60°C, 1x SSC and 0.1% SDS, specifically 60°C, 0.1x SSC, 0.1% SDS, and more specifically 68°C, 0.1x SSC and 0.1% SDS. Hybridization requires that two nucleic acids have complementary sequences, although the bases do not necessarily match depending on the degree of hybridization. The term complementary is used to describe the relationship between nucleotide bases capable of hybridizing with each other. For example, with respect to DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Therefore, this disclosure may include not only a substantially similar nucleic acid sequence but also an isolated nucleic acid fragment complementary to the full sequence. Specifically, polynucleotides that have homology or identity can be detected using the hybridization conditions described above, which include a hybridization procedure at a Tm value of 55 °C. The Tm value can also be, but is not limited to, 60 °C, 63 °C, or 65 °C, and those skilled in the art can adjust it appropriately according to the intended purpose. An appropriate degree of rigor for polynucleotide hybridization may depend on the lengths of the polynucleotides and a degree of complementarity and parameters thereof are well known in the technique (Sambrook et al., cited above, 9.50-9.51, 11.7-11.8). In particular, the expression the modified polynucleotide consists of a nucleotide sequence selected from SEQ ID NO: 3 to 5 or a nucleotide sequence having at least 80% or more and less than 100% sequence homology does not exclude the addition and / or deletion and / or mutation of a nucleotide that may occur during a binding procedure to a target gene, for example, using a restriction enzyme, in the case that the polynucleotide is used in a state bound to the target gene, as a promoter. For example, the polynucleotide consisting of a nucleotide sequence selected from SEQ ID NO: 3 to 5 and having promoter activity may also include a polynucleotide hybridized with a nucleotide sequence wholly or partially complementary to a nucleotide sequence selected from SEQ ID NO: 3 to 5 under strict conditions to have the promoter activity of this disclosure. The microorganism incorporating the modified polynucleotide of this disclosure is characterized by an increased production of branched-chain amino acids, including valine, leucine, and isoleucine. While wild-type strains of the genus Corynebacterium are unable to produce, or produce only trace amounts of, branched-chain amino acids, the polynucleotide with the promoting activity described herein is significant because it increases the production of branched-chain amino acids. [Mode of the invention] The following disclosure will be described in this document as nczpnn / zznz / E / YiAi Table 1 nczAnn / zznz / E / YiAi Strain name L-Valine (g / l) Control KCCM11201P 2.8 Experimental group A1 2.9 A2 2.5 A3 3.5 A4 3.0 A5 1.5 A6 1.2 A7 4.2 A8 3.9 A9 2.8 A10 2.4 A11 3.1 A12 3.3 A13 3.8 A14 2.7 A15 2.9 In comparison with the KCCM11201P strain used as a control, the A7 strain was selected, whose valine production increased the most (see Table 1). Example 2· Confirmation of mutation by gene sequencing The main genes of strain A7 that had an enhanced capacity to produce valine were sequenced and compared with those of strain KCCM11201P and strain Corynebacterium glutamicumATCC14067. As a result, it was confirmed that strain A7 contained the mutation at the promoter position of acetate metabolism regulator A. Specifically, it was confirmed that strain A7 had a nucleotide sequence SEQ ID NO: 2, which included a mutation in the promoter region (SEQ ID NO: 1) of the ramA gene. In the following examples, the effects of the modification inserted at a specific position in the promoter region of the ramA gene and the effects of the enhanced expression of RamA by enhancement or replacement of the ramA gene promoter on the production of valine, isoleucine and leucine, which are branched-chain amino acids of a microorganism of the genus Corynebacterium, were investigated. Example 3· Construction of the introduced strain with modification and confirmation of the valine production capacity Example 3-1. Introduction of promoter modification in the KCCM11201P strain of Corynebacterium glutamicum and evaluation of L-valine production capacity To insert a polynucleotide modified with the ramA gene promoter, represented by SEQ ID NO: 2, into Corynebacterium glutamicum KCCM11201P, a vector containing a target modification was prepared. Specifically, genomic DNA from strain A7 was extracted using a G-spin total DNA extraction minikit (Intron, no. 2 cat. 17045) according to the kit protocols, and PCR was performed using the genomic DNA as a template. PCR was performed under the following conditions: denaturation at 94 °C for 5 minutes; 25 cycles of denaturation at 94 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 150 seconds. and then polymerization at 72 °C for 7 minutes and a PCR product (hereafter referred to as modification introduced fragment 1) of 1114 bp was obtained using SEQ ID NO: 9 and 10. After treating the modified fragment 1 with the restriction enzyme Xbal (New England Biolabs, Beverly, MA), the modified fragment 1 was ligated into a pDZ vector (Korean patent no. 10-0924065 and international patent application publication no. 2008-033001) treated with the same restriction enzyme using a T4 ligase (New England Biolabs, Beverly, MA). After transforming E. coli DH5a with the constructed gene, the transformed strains were selected on LB medium containing kanamycin, and DNA was obtained from them using a DNA rotation plasmid DNA purification kit (NtRON) to prepare a pDZ-Pm-ramA vector containing the modified fragment 1. nczpnn / zznz / E / YiAi Table 2 Primer Base sequence SEQ ID NO: Pm(TATAAT)- F1 gctctagaTAGGCCGGTTCGGACTCGCCCTGCC SEQ ID NO: 9 Pm(TATAAT)- R1 g ctctag aaacgtg cg cg cag tcatg gtg actt SEQ ID NO: 10 Corynebacterium glutamicum KCCM11201P was transformed with the pDZ-Pm-ramA vector via homologous chromosomal recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Strains in which the chromosome was inserted with the vector via homologous sequence recombination were selected in a culture medium containing kanamycin (25 mg / L). PCR was then performed on Corynebacterium glutamicum transformants in which secondary recombination was completed using SEQ IDs 9 and 10, and strains in which the promoter modification was inserted in a region upstream of ramA (SEQ ID 1) on the chromosome were confirmed. The recombinant strain was named Corynebacterium glutamicum KCCM11201P-Pm-ramA. To compare the valine production capacity between the valine-producing strains Corynebacterium glutamicum KCCM11201P and KCCM11201P-Pm-ramA, the flask evaluation was performed. After subculturing each strain on a nutrient medium, each strain was inoculated into a 250 mL corner baffle flask containing 25 mL of production medium and cultured while shaking at 30 °C for 72 hours at 200 rpm. L-valine concentrations were then analyzed using HPLC, and the analyzed L-valine concentrations are shown in Table 3 below. Nutrient medium (pH 7.2) g of glucose, 5 g of meat sauce, 10 g of polypeptone, 2.5 g of sodium chloride, 5 g of yeast extract, 20 g of agar, 2 g of urea (based on 1 L of distilled water) Production medium (pH 7.0) 100 g of glucose, 40 g of ammonium sulfate, 2.5 g of soy protein, 5 g of maize solids, 3 g of urea, 1 g of potassium phosphate dibasic, 0.5 g of magnesium sulfate heptahydrate, 100 pg of biotin, 1 mg of thiamine-HCl, 2 mg of calcium pantothenate, 3 mg of nicotinamide, 30 g of calcium carbonate (based on 1 L of distilled water) Table 3 nczpnn / zznz / E / YiAi L-valine production capacity of KCCM11201P and KCCM11201PPm-ramA Strain L-Valine (g / l) Lot 1 Lot 2 Lot 3 Average KCCM11201P 2.6 2.5 2.7 2.6 KCCM11201 P-PmramA 3.2 3.3 3.1 3.2 As a result, it was confirmed that the L-valine production capacity of the KCCM11201 P-Pm-ramA strain increased by approximately 23% compared to that of KCCM11201P. Example 3-2. Construction of a mutant strain of Corynebacterium glutamicum KCCM11201P in which the promoter is improved and replaced and evaluation of the L-valine production capacity of the constructed strain As shown in the results of Example 3-1 above, it was confirmed that the valine production capacity had been improved by modifying the ramA gene promoter, and vectors were therefore constructed to enhance or replace the ramA promoter according to the modified promoter of SEQ ID NO: 2 to further increase ramA expression. To construct vectors including the modification, primer 3 (SEQ ID NO: 11) to primer 10 (SEQ ID NO: 18) of Table 4 were synthesized to have an xbal restriction enzyme region at the 5' end and the 3' end. The enhanced ramA promoters were designated Pm1, Pm2, and Pm3-ramA, and a pair of primers from SEQ ID NO: 11 and 13; and a pair of primers from SEQ ID NO: 12 and 14 were used to construct Pm1-ramA and a pair of primers from SEQ ID NO: 11 and 15 and a pair of primers from SEQ ID NO: 12 and 14 were used to construct Pm2-ramA. Likewise, a pair of primers from SEQ ID NO: 11 and 17; and a pair of primers from SEQ ID NO: 12 and 18 were used to construct Pm3-ramA. PCR was performed using each of the primers and wild-type Corynebacterium glutamicum chromosomal DNA as a template [Sambrook et al., Molecular Cloning, a Laboratory Manual (1989), Coid Spring Harbor Laboratories]. In this case, the PCR was performed under the following conditions: denaturation at 95 °C for 5 minutes; 30 cycles of denaturation at 94 °C for 30 seconds, hybridization at 56 °C for 30 seconds and polymerization at 72 °C for 1 minute; and then polymerization at 72 °C for 7 minutes. Next, a PCR product obtained from the procedure described above and the previously prepared pDZ-Pm-ramA vector were treated with the restriction enzyme xbal, followed by fusion cloning. Fusion cloning was performed using an In-Fusion® HD cloning kit (Clontech). E. coli DH5o was transformed with this kit and swabbed onto LB solid medium containing kanamycin (25 mg / L). Colonies transformed with plasmids into which a target gene was inserted were selected by PCR, and the plasmids were obtained by extraction and named pDZ-Pm1-ramA, pDZ-Pm2-ramA, and pDZnczpnn / zznz / E / YiAi. Pm3-branchA, respectively. Tabla 4 nczpnn / zznz / E / YiAi Cebador Secuencia de bases SEQ ID NO: Cebador 3 gctcggtacccggggatcctctctagataggccggttcggactcgccctgcc SEQ ID NO: 11 Cebador 4 ttacgccaagcttgcatgctctagaaacgtgcgcgcagtcatggtgactt SEQ ID NO: 12 Cebador 5 CGA CAA GGG TCC ATT ATA CCA CAC CTT TGG GGG T SEQ ID NO: 13 Cebador 6 acccccaaggT gT Gg taT a AtgG acccttgtcg SEQ ID NO: 14 Cebador 7 TCG ACA AGG GTA CAT TAT ACT TCC CCT TT SEQ ID NO: 15 Cebador 8 aaaggggaagtaT aAtgtacccttgtcga SEQ ID NO: 16 Cebador 9 AAG GGT ACA GTG TAC CAC ACC TTT GGG GGT SEQ ID NO: 17 Cebador 10 accccaaaggT gTGgtacactgtaccctt SEQ ID NO: 18 Cebador 11 attcgagctcggtacccggtctagatcaagaaactgcaggtgtgtaccga SEQ ID NO: 19 Cebador 12 CAT CGG ETIQUETA GCT ATG CCG GCG GTA CCT TCA GAT TTC CTC CTG CTT TAC CA SEQ ID NO: 20 Cebador 13 gtaccgccggcatagcctaccgatg SEQ ID NO: 21 Cebador 14 AGT GTT TCC TTT CGT TGG GTA CGT A SEQ ID NO: 22 Cebador 15 tacgtacccaacgaaag g aaacactgtgg atacccag cg g attaaag atg SEQ ID NO: 23 Cebador 16 TGG ATG CCT GCA GGT CGA CTC TAG AAT CGC GGC GCA GAT CCT CAT CGGTC SEQ ID NO: 24 Also, separately, to replace the ramA promoter with Pcj7 which is a stronger promoter, primers 11 (SEQ ID NO: 19) to primer 16 (SEQ ID NO: 24) in Table 4 were synthesized to have an xbal restriction enzyme region at the 5' and 3' ends. A vector pDZ-Pcj7-ramA was constructed in the same way as the vector construction procedure in Example 3-1 described above using a pair of primers from SEQ ID NO: 19 and 20; a pair of primers from SEQ ID NO: 21 and 22; and a pair of primers from SEQ ID NO: 23 and 24. Corynebacterium glutamicum KCCM11201P was transformed with the vectors pDZ-Pm1 ramA, pDZ-Pm2 ramA, pDZ-Pm3 ramA, and pDZ-Pc17 ramA by homologous chromosomal recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Strains in which the chromosome was inserted with the vector by homologous sequence recombination were selected in a culture medium containing kanamycin (25 mg / l). PCR was then performed using the Corynebacterium glutamicum transformants in which secondary recombination was completed using SEQ ID NO: 9 and 10, and strains in which the ramA promoter was enhanced and replaced with the Pc17 promoter were confirmed. Among the recombinant strains, Corynebacterium glutamicum KCCM11201 P-Pm1ramA, KCCM11201 P-Pm2-ramA and KCCM11201 P-Pm3-ramA were designated CA08-1518, CA08-1519 and CA08-1520, respectively, and were deposited at the Korean Culture Center for Microorganisms (KCCM), recognized as an international depositary authority under the Budapest Treaty, on April 27, 2020, with reference numbers KCCM12704P, KCCM12705P and KCCM12706P, respectively. Likewise, the strain replaced with the Pcj7 promoter was named KCCM11201P-Pcj7ramA. Subsequently, valine production capacity was evaluated in the same manner as in Example 3-1 above, and the results are shown in Table 5 below. Table 5 nczpnn / zznz / E / YiAi Strain L-Valine (g / l) Lot 1 Lot 2 Lot 3 Average KCCM11201P 2.6 2.5 2.7 2.6 KCCM11201 P-Pm1-ramA(CA081518) 3.2 3.4 3.3 3.3 KCCM11201 P-Pm2-ramA(CA081519) 3.1 3.2 3.3 3.2 KCCM11201 P-Pm3-ramA(CA081520) 3.2 3.0 3.1 3.1 KCCM11201 P-Pcj7-ramA 2.9 3.1 3.0 3.0 According to the results in Table 5, it was confirmed that the strains KCCM11201 P-Pm1ramA (CA08-1518), KCCM11201 P-Pm2-ramA (CA08-1519) and KCCM11201 P-Pm3-ramA (CA08-1520), including the improved promoter, compared to the strain KCCM11201P, increased L-valine production by approximately 27%, 23% and 19%, respectively, which are similar to or greater than the L-valine production capacity of the KCCM11201 P-Pcj7-ramA strain substituted with the stronger promoter. Example 3-3: Construction of a mutant strain of the CJ7V strain of Corynebacterium glutamicum in which the ramA gene promoter is enhanced and replaced and evaluation of the L-valine production capacity of the constructed strain In order to identify whether the effect of improving L-valine production capacity is obtained in other L-valine-producing strains belonging to Corynebacterium glutamicum, wild-type Corynebacterium glutamicum ATCC14067 was introduced with a type of modification [ilvN(A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Number 3, pp. 456-467] to prepare a strain having an improved L-valine production capacity. Specifically, genomic DNA from the Corynebacterium glutamicum strain ATCC14067 was extracted using a G-spin total DNA extraction mini kit (Intron, n.scat. 17045) according to the kit protocols. PCR was performed using the genomic DNA as a template. To construct a vector by introducing the A42V modification into the ivN gene, gene fragments A and B were obtained using a primer pair from SEQ IDs 25 and 26, and a primer pair from SEQ IDs 27 and 28, respectively. PCR was performed under the following conditions: denaturation at 94 °C for 5 minutes; 25 cycles of denaturation at 94 °C for 30 seconds, hybridization at 55 °C for 30 seconds, and polymerization at 72 °C for 60 seconds, and then polymerization at 72 °C for 7 minutes. As a result, polynucleotide fragments A and B, both of 537 bp, were obtained. A PCR product of 1044 bp (hereafter referred to as fragment 2 introduced by modification) was obtained by performing an overlapping PCR using the two fragments as templates with SEQ ID NO: 25 and 26. After treating the modified fragment 2 with the restriction enzyme Xbal (New England Biolabs, Beverly, MA), the modified fragment 2 was ligated into a pDZ vector treated with the same restriction enzyme using a T4 ligase (New England Biolabs, Beverly, MA). After transforming E. coli DH5a with the constructed gene, the transformed strains were selected on kanamycin-containing LB medium, and DNA was extracted from them using a DNA spin purification kit (NtRON). The vector used to introduce the A42V modification of the ivN gene was named pDZ-ilvN(A42V). nczpnn / zznz / E / YiAi nczpnn / zznz / E / YiAi Table 6 Primer Base Sequence SEQ ID NO: Primer 17 aatttct ag ag g cag accctattct atg aag g SEQ ID NO: 25 Primer 18 agtgtttcggtctttacagacacgagggac SEQ ID NO: 26 Primer 19 gtccctcgtgtctgtaaagaccgaaacact SEQ ID NO: 27 Primer 20 aatttctagacgtgggagtgtcactcgcttgg SEQ ID NO: Subsequently, wild-type Corynebacterium glutamicum ATCC14067 was transformed with the pDZ-ilvN(A42V) vector via homologous chromosomal recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Strains in which the chromosome was inserted with the vector via homologous sequence recombination were selected in a culture medium containing kanamycin (25 mg / L). Gene fragments were then amplified by PCR in Corynebacterium glutamicum transformants in which secondary recombination was completed using SEQ IDs NO: 25 and 26, and the strains in which the modification was inserted were confirmed by gene sequencing. The recombinant strain was named Corynebacterium glutamicum CJ7V. Finally, Corynebacterium glutamicum CJ7V was transformed with the vectors in the same manner as in Examples 3-1 and 3-2, and the strains were named Corynebacterium glutamicum CJ7V-Pm1-ramA, CJ7V-Pm2-ramA, CJ7V-Pm3-ramA, and CJ7V-Pcj7-ramA, respectively. To compare the L-valine production capacity among the constructed strains, the strains were cultured in the same manner as in Example 3-1 above, and the L-valine concentrations were analyzed. The analyzed L-valine concentrations are shown in Table 7 below. Table 7 Comparison of L-valine production capacity L-Valine strain (g / l) Lot 1 Lot 2 Lot 3 Average CJ7V 2.2 2.2 2.3 2.2 CJ7V-Pm1-ramA 2.8 2.7 2.7 2.7 CJ7V-Pm2-ramA 2.6 2.6 2.7 2.6 CJ7V-Pm3-ramA 2.6 2.4 2.5 2.5 CJ7V-Pcj7-ramA 2.4 2.5 2.6 2.5 As shown in Table 7, it was confirmed that the CJ7V-Pm1-ramA, CJ7VPm2-ramA, and CJ7V-Pm3-ramA strains, including the improved promoter, increased L-valine production by approximately 23%, 18%, and 14%, respectively, which are similar to or greater than the L-valine production capacity of the CJ7V-Pcj7-ramA strain substituted with the strongest promoter. Example 3-4: Construction of a mutant strain of Corynebacterium glutamicum CJ8V in which the ramA gene promoter is enhanced and replaced and evaluation of the L-valine production capacity of the constructed strain In order to identify whether the effect of improving L-valine production capacity is obtained in other L-valine-producing strains belonging to Corynebacterium glutamicum, the wild-type strain Corynebacterium glutamicum ATCC13869 was introduced with a [ilvN(A42V)] type modification in the same way as in the procedure of Example 3-3 to prepare a strain that had the ability to produce L-valine, and the recombinant strain was named Corynebacterium glutamicum CJ8V. Finally, the Corynebacterium glutamicum CJ8V strain was transformed using the vectors in the same manner as in the procedure of Examples 3-1 and 3-2, and the strains were named Corynebacterium glutamicum CJ8V-Pm1-ramA, CJ8V-Pm2-ramA, CJ8V-Pm3-ramA, and CJ8V-Pcj7-ramA, respectively. To compare the L-valine production capacity among the constructed strains, the strains were cultured in the same manner as in Example 3-1 above, and the L-valine concentrations were analyzed. The analyzed L-valine concentrations are shown in Table 8 below. Table 8 nczpnn / zznz / E / YiAi L-valine production capacity L-Valine strain (g / l) Batch 1 Batch 2 Batch 3 Average CJ8V 1.9 2.0 1.9 1.9 CJ8V-Pm1-ramA 2.3 2.3 2.3 2.3 CJ8V-Pm2-ramA 2.3 2.1 2.2 2.2 CJ8V-Pm3-ramA 2.0 2.1 2.2 2.1 CJ8V-Pcj7-ramA 2.1 2.0 1.9 2.0 As shown in Table 8, it was confirmed that the CJ8V-Pm1-ramA, CJ8VPm2-ramA, and CJ8V-Pm3-ramA strains, including the improved promoter, compared to the CJ8V strain, increased L-valine production by approximately 21%, 16%, and 10%, respectively, which are similar to or greater than the L-valine production capacity of the CJ8V-Pcj7-ramA strain substituted with the stronger promoter. Example 4. Construction of L-leucine producing mutant strain Corynebacterium glutamicum KCCM11661P and KCCM11662P in which the promoter modification is introduced and evaluation of the L-leucine production capacity The Corynebacterium glutamicum strains KCCM11661P and KCCM11662P were transformed using the pDZ-Pm1-ramA, pDZ-Pm2-ramA, pDZ-Pm3-ramA, and pDZ-Pcj7-ramA vectors via homologous chromosomal recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Strains in which the chromosome was inserted using the vector via homologous sequence recombination were selected in a culture medium containing kanamycin (25 mg / L). PCR was then performed on the Corynebacterium glutamicum transformants in which secondary recombination was completed using SEQ ID NO: 9 and 10, and strains in which the ramA promoter was enhanced and replaced by Pcj7 were confirmed. The recombinant strains were named Corynebacterium glutamicum KCCM11661 P-Pm1 -ramA, KCCM11661P Pm2-ramA, K KCCM11661 P-Pm3-ramA, KCCM11661 P-Pcj7-ramA and KCCM11662P-Pm1-ramA, KCCM11662P Pm2-ramA, K KCCM11662P-Pm3-ramA and KCCM11662P-Pcj7-ramA, respectively. The constructed strains were grown according to the following procedure and the leucine production capacity was compared. After subculturing each strain in a nutrient medium, each strain was inoculated into a 250 ml corner baffle flask containing 25 ml of production medium and cultured while shaking at 30 °C for 72 hours at 200 rpm. L-leucine concentrations were then analyzed using HPLC, and the analyzed L-leucine concentrations are shown in Table 9 below. < Nutrient medium (pH 7.2)> g of glucose, 5 g of meat sauce, 10 g of polypeptone, 2.5 g of sodium chloride, 5 g of yeast extract, 20 g of agar, 2 g of urea (based on 1 L of distilled water)<Medio de producción (pH 7,0)> g of glucose, 20 g of ammonium sulphate, 20 g of solid corn macerates, 1 g of dibasic potassium phosphate, 0.5 g of heptahydrated magnesium sulphate, 100 pg of biotin, nczpnn / zznz / E / YiAi mg of thiamine-HCI and 15 g of calcium carbonate (based en 1 I de water destilada) Tabla 9 nczAnn / zznz / E / YiAi Capacity to produce L-leucine Cepa L-Leucine (g / l) Lote 1 Lote 2 Lote 3 Promedio KCCM11661P 2.8 2.6 2.7 2.7 KCCM11661 P-Pm1-ramA 3.2 2.9 2.8 3.0 KCCM11661P Pm2-ramA 3.0 2.8 2.9 2.9 KCCM11661 P-Pm3-ramA 3.1 3.1 3.0 3.0 KCCM11661 P-Pcj7-ramA 3.2 3.1 3.1 3.1 KCCM11662P 3.0 3.1 2.9 3.0 KCCM11662P-Pm1 -ramA 3.3 3.3 3.5 3.3 KCCM11662P Pm2-ramA 3.3 3.2 3.2 3.2 KCCM11662P-Pm3-ramA 3.2 3.5 3.3 3.3 KCCM11662P-Pcj7-ramA 3.4 3.4 3.3 3.3 As a result, it was confirmed that the strains KCCM11661 P-Pm1-ramA, KCCM11661P Pm2-ramA and KCCM11661 P-Pm3-ramA, including the improved promoter, improved L-leucine production by 11%, 7% and 11% respectively, compared to the KCCM11661P strain, which are similar to or better than the L-leucine production capacity of the KCCM11661 P-Pcj7-ramA strain replaced with the stronger promoter. Furthermore, it was confirmed that the strains KCCM11662P-Pm1-ramA, KCCM11662P Pm2ramA and KCCM11662P-Pm3-ramA, including the improved strain, improved L-leucine production by 10%, 6% and 10% respectively, compared to the KCCM11662P strain, which are similar to or better than the L-leucine production capacity of the KCCM11662P-Pcj7-ramA strain substituted with the strongest promoter. Example 5. Construction of an L-isoleucine-producing mutant strain Corynebacterium glutamicum KCCM11248P in which the ramAse gene promoter is enhanced and replaced, and evaluation of the L-isoleucine production capacity To identify whether the effect of improving L-isoleucine production capacity is obtained in other L-isoleucine-producing strains belonging to Corynebacterium glutamicum, the Lysoleucine-producing Corynebacterium glutamicum strain KCCM11248P was transformed with the vectors in the same way as in Examples 3-1 and 3-2 above, and the transformed strains were named Corynebacterium glutamicum KCCM11248P-Pm-ramA, KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, KCCM11248P-Pm3-ramA and KCCM11248P-Pcj7-ramA, respectively. Strains KCCM11248P-Pm-ramA, KCCM11248P-Pm1 -ramA, KCCM11248P-Pm2-ramA, KCCM11248P-Pm3-ramA and KCCM11248P-Pcj7-ramA were cultured according to the following procedure and the isoleucine production capacity was evaluated. Each strain was inoculated into a 250 ml corner baffle flask containing 25 ml of seed medium and cultured while shaking at 30 °C for 20 hours at 200 rpm. Then, 1 ml of the seed medium was inoculated into a 250 ml corner baffle flask containing 24 ml of production medium and cultured while shaking at 30 °C for 48 hours at 200 rpm. The compositions of the seed medium and production medium are as follows. <Medio de siembra (pH 7,0)> g of glucose, 10 g of peptone, 5 g of yeast extract, 1.5 g of urea, 4 g of KH2PO4, 8 g of K2HPO4, 0.5 g of MgSO4-7H2O, 100 pg of biotin, 1000 pg of thiamine HCl, 2000 pg of calcium pantothenate and 2000 pg of nicotinamide (based on 1 L of distilled water)<Medio de producción (pH 7,0)> g glucose, 12.5 g (NHDzSCU, 2.5 g soy protein, 5 g macerated corn solids, 3 g urea, 1 g KH2PO4, 0.5 g MgSO4-7H2O, 100 pg biotin, 1000 pg HCI, 200 pg HCI calcium pantothenate, 3000 pg nicotinamide, 30 g CaCO3 (based on 1 I distilled water) After completion of cultivation, the concentrations of L-isoleucine were measured by HPLC, the measured concentrations of L-isoleucine are shown in Table 10 below. nczpnn / zznz / E / YiAi Table 10 L-lsoleucine strain (g / l) Batch 1 Batch 2 Batch 3 Average KCCM11248P 1.6 1.3 1.4 1.43 KCCM11248P-Pm1-ramA 2.0 1.8 2.2 2.00 KCCM11248P-Pm1-ramA 2.0 1.8 2.00 1.90 KCCM11248P-Pm3-ramA 1.7 1.8 1.6 1.70 KCCM11248P-Pcj7-ramA 1.8 1.8 1.7 1.76 As a result, it was confirmed that the strains KCCM11248P-Pm1-ramA, KCCM11248PPm2-ramA and KCCM11248P-Pm3-ramA, including the improved promoter, increased L-isoleucine production by 39%, 32% and 18%, respectively, compared to the KCCM11248P strain, which are similar to or better than the Lysoleucine production capacity of the KCCM11248P-Pcj7-ramA strain substituted with the stronger promoter. The foregoing description in this disclosure is provided for illustrative purposes, and those skilled in the art will understand that various changes and modifications may be made without altering the technical concept and essential characteristics of this disclosure. It is therefore evident that the embodiments described above are illustrative in all respects and do not limit this disclosure. The scope of this disclosure is therefore defined not by the detailed description but by the claims and their equivalents, and all variations within the scope of the claims and their equivalents are to be construed as included in the disclosure.

Claims

1. A microorganism that produces branched-chain L-amino acids and has enhanced acetate metabolism regulator activity A.

2. The microorganism according to claim 1, wherein the enhanced activity is obtained by: introducing a modification in a gene expression regulatory sequence of the acetate metabolism regulator A; replacing the gene expression regulatory sequence with a sequence that enhances expression; additionally, introducing a modification in the gene to enhance activity; or a combination thereof.

3. The microorganism according to claim 2, wherein the gene expression regulatory sequence is a promoter.

4. The microorganism according to claim 2, wherein the microorganism comprises a polynucleotide having promoter activity and includes the substitution of a nucleotide with a different nucleotide at one or more corresponding positions selected from positions 34, 36, 37, 41 and 43 of a nucleotide sequence as set forth in SEQ ID NO:

1.

5. The microorganism according to claim 4, wherein the polynucleotide comprises substitution with T at nucleotide 342; substitution with T at nucleotide 362; substitution with G at nucleotide 372; substitution with T at nucleotide 41s; substitution with A at nucleotide 43δ; or a combination thereof, in the nucleotide sequence as set forth in SEQ ID NO:

1.

6. The microorganism according to claim 4, wherein the polynucleotide comprises a nucleotide sequence selected from SEQ ID NO: 3 to 5.

7. The microorganism according to claim 1, wherein the microorganism is a microorganism of the genus Corynebacterium. nczpnn / zznz / E / YiAi 8. The microorganism according to claim 7, wherein the microorganism of the genus Corynebacterium comprises Corynebacterium glutamicum.

9. A process for producing a branched-chain L-amino acid, the process comprising cultivating the microorganism according to any one of claims 1 to 8 in a culture medium.

10. The process according to claim 9, further comprising recovering or separating the branched-chain L-amino acid from the culture medium or microorganism.

11. A polynucleotide having promoter activity and comprising the substitution of a nucleotide with a different nucleotide at one or more corresponding positions selected from positions 34, 36, 37, 41 and 43 of a nucleotide sequence as set out in SEQ ID NO:

1.

12. The polynucleotide according to claim 11, wherein the polynucleotide comprises substitution with T at nucleotide 342; substitution with T at nucleotide 36s; substitution with G at nucleotide 37θ; substitution with T at nucleotide 41s; substitution with A at nucleotide 43δ; or a combination thereof, in the nucleotide sequence as set forth in SEQ ID NO:

1.

13. The polynucleotide according to claim 11, wherein the polynucleotide comprises a nucleotide sequence selected from SEQ ID NO: 3 to 5.