Materials and methods for incorporating a transgene into the SOCS3 locus of an immune cell

Abstract

The disclosure provides a vector comprising (i) a first polynucleotide sequence encoding a chimeric antigen receptor (CAR), and (ii) a second polynucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA targets the SOCS3 gene in an immune cell. The disclosure also provides a system for introducing a deletion of the SOCS3 gene in an immune cell, the system comprising: (i) one or more site-directed DNA endonucleases; (ii) one or more ribonucleic acids (gRNAs) comprising a spacer sequence corresponding to a target sequence within exon 2 of the SOCS3 gene; and (iii) a nucleotide sequence encoding an exogenous transgene; wherein when the one or more gRNAs is introduced to the cell with the one or more site-directed DNA endonucleases, the one or more gRNAs combine with the site-directed DNA endonuclease to induce double-stranded breaks (DSBs) within exon 2 of the SOCS3 gene, thereby deleting the SOCS3 gene from the immune cell and introducing the exogenous transgene under the control of the SOCS3 locus in the immune cell.

Description

MATERIALS AND METHODS FOR INCORPORATING A TRANSGENE INTO THE SOCS3 LOCUS OF AN IMMUNE CELLSTATEMENT OF GOVERNMENT SUPPORT

[0001] This invention was made with government support under CA232561 , and CA216652 awarded by the National Institutes of Health. The government has certain rights in the invention.INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0002] The sequence listing, which is a part of the present disclosure, is submitted concurrently with the specification as a text file. The name of the text file containing the sequence listing is “57095_Seqlisting.XML", which was created on January 5, 2023 and is 16,384 bytes in size. The subject matter of the sequence listing is incorporated herein in its entirety by reference.BACKGOUND

[0003] The production of pro-inflammatory cytokines and chemokines by cells of the innate immune system play an important role in mediating the initial host defense against invading pathogens. The inability to regulate the nature or duration of the host's inflammatory response can often mediate detrimental host effects as observed in acute and chronic inflammatory diseases. Thus, the ability of the innate immune system to dictate the levels of pro- and antiinflammatory cytokine production is critical in limiting or modulating the nature of the host inflammatory response. This ability is conferred by a family of physiologic intracellular proteins termed suppressors of cytokine signaling (SOCSs). SOCS3 is a key negative regulator for STAT3, which is activated upon engagement of cytokine receptors such as those for IL-2, IL-21, IL-6, and interferons.SUMMARY

[0004] In one aspect, described herein is a vector comprising (i) a first polynucleotide sequence encoding a chimeric antigen receptor (CAR), and (ii) a second polynucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA targets the SOCS3 gene in an immune cell.

[0005] In another aspect, described herein is a vector comprising (i) a first polynucleotide sequence encoding a cytokine, and (ii) a second polynucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA targets a SOCS3 gene in an immune cell.

[0006] In another aspect, described herein is a vector comprising a nucleotide sequence encoding a guide RNA set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.

[0007] In another aspect, described herein is a method of producing an engineered immune cell, comprising: (a) introducing into an immune cell a guide RNA that targets exonl of the SOCS3 gene in the immune cell and a site-directed DNA endonuclease capable of inducing a genetic disruption within exon 2 of gene the immune cell, and (b) introducing an exogenous transgene into the SOCS3 locus of the immune cell, thereby producing an engineered immune cell.

[0008] In another aspect, described herein is a system for introducing a deletion of the SOCS3 gene in an immune cell, the system comprising: (i) one or more site-directed DNA endonucleases; (ii) one or more ribonucleic acids (gRNAs) comprising a spacer sequence corresponding to a target sequence within exon 2 of the SOCS3 gene; and (iii) a nucleotide sequence encoding an exogenous transgene; wherein when the one or more gRNAs is introduced to the cell with the one or more site-directed DNA endonucleases, the one or more gRNAs combine with the site-directed DNA endonuclease to induce double-stranded breaks (DSBs) within exon 2 of the SOCS3 gene, thereby deleting the SOCS3 gene from the immune cell and introducing the exogenous transgene under control of the SOCS3 locus of the immune cell.

[0009] In another aspect, described herein is an immune cell comprising an exogenous transgene operably linked to a SOCS3 promoter.BRIEF DESCRIPTION OF THE FIGURES

[0010] Figure 1 is a bar graph showing the results of sgRNA (SEQ ID NOs:1-5) testing in 293T cells. sgRNA number 5 (SEQ ID NO: 5) provided the highest rate of INDEL and was selected for use in future studies.

[0011] Figure 2 shows that targeting integration of GFP into SOCS3 locus is consistent across different donors. Left plot: Representative scatter plot of GFP expression of different engineering conditions. Right plot: Statistics of the percentage of GFP+ population of different engineering conditions. MOCK: electroporation only, Cas9: NK cells were electroporated with Cas9 mRNA, SOCS3 KO: NK cells were electroporated with Cas9 mRNA + sgRNA, SOCS3- GFP KI: NK cells were electroporated with Cas9 mRNA + sgRNA and transduced with AAV6- SOCS3-GSG-T2A-GFP-BGH. Data is shown as mean ± SD of four donors (n = 4).

[0012] Figure 3 shows that GFP expression increases over IL-2 + IL-21 stimulation. Left plot: Representative histogram of GFP expression over time. Right plot: Percentage of GFP+ population and mean fluorescence intensity (MFI) of GFP expression of different time points. Data is shown as mean ± SD of two donors (n = 2).

[0013] Figure 4 shows that he cytokine combination of IL-2 + IL-21 provides the optimal SOCS3 promoter activity. Left plot: Representative scatter plot of GFP expression of different cytokine stimulation conditions. Right plot: Statistics of the percentage of GFP+ population, MFI of GFP expression, and relative cell count of different cytokine stimulation conditions. Control: no cytokine, IL-2: 10 U / mL IL-2, IL-2 + IL-21: 500 IIJ / mL IL-2 + 10 ng / mL IL-21, IL-12 + IL-18: 10 ng / mL IL-12 + 100 ng / mL IL-18. Data is shown as mean ± SD of four donors (n = 4). Statistical significance is determined by Two-tailed Welch’s unequal variances t test. *, P < 0.05; **, P < 0.01 ; ***, P < 0.001. std, standard for comparison.

[0014] Figure 5 shows the successful targeting integration of a CAR into SOCS3 locus is consistent across different donors. Left plot: Representative scatter plot of RQR8 expression in different engineering conditions. Right plot: Statistics of the percentage of RQR8+ population in different conditions. MOCK: electroporation only, Cas9: NK cells were electroporated with Cas9 mRNA, SOCS3 KO: NK cells were electroporated with Cas9 mRNA + sgRNA, SOCS3-aCD19 CAR KI: NK cells were electroporated with Cas9 mRNA + sgRNA and transduced with AAV6- SOCS3-GSG-T2A-CD19CAR-P2A-RQR8-BGH. Data is shown as mean ± SD of four donors (n = 4).

[0015] Figure 6 shows that CAR expression driven by SOCS3 promoter enhances degranulation and cytokine secretion ability of NK cells. Left plot: Representative histogram of CD107a degranulation and IFNy secretion of different conditions. Right plot: Statistics of the percentage of CD107a+ and IFNy+ of different conditions. MOCK: electroporation only, Cas9: NK cells were electroporated with Cas9 mRNA, SOCS3 KO: NK cells were electroporated with Cas9 mRNA + sgRNA, SOCS3-aCD19 CAR KI: CAR engineered NK cells, CAR neg: RQR8- population of CAR engineered NK cells, CAR pos: RQR8+ population of CAR engineered NK cells. Data is shown as mean ± SD of four donors (n = 4). Statistical significance is determined by Two-tailed Welch’s unequal variances t test. **, P < 0.01 ; ***, P < 0.001. std, standard for comparison, ns., no significance.DETAILED DESCRIPTION

[0016] Hematopoietic cells, particularly lymphoid cells such as T cells and natural killer (NK) cells, employ a variety of regulatory mechanisms to control their function. This includes the suppressor of cytokine signaling (SOCS) family proteins, which serve as negative regulators to various JAK-STAT signaling pathways, which are responsible for signal transduction from membrane receptors including cytokine receptors. In particular, SOCS3 is a key negative regulator for STAT3, which is activated upon engagement of cytokine receptors such as those for IL-2, IL-21, IL-6, and interferons. SOCS3 is encoded by the SOCS3 gene. The human SOCS3 gene is located on chromosome 17, from base pair 78,359,183 to 78,356,778.

[0017] The present disclosure is based, at least in part, on the discovery that integrating transgenes into the SOCS3 genomic locus (utilizing, e.g., CRISPR / Cas9 and adeno-associated virus (AAV) of human NK cells), wherein the transgenes are under control of SOCS3 regulatory elements, resulted in STAT3 engagement via stimulation with IL-2, IL-21 , and / or interferongamma induced expression of the transgene.

[0018] As shown in Figure 3 and Example 4 provided herein, expression of an exogenous transgene under the control of the SOCS3 promoter in a NK cell was controllable by cytokine stimulation of the SOCS3 promoter (e.g., stimulation by IL-2 and / or IL-21). Thus, in one aspect, provided herein are methods of upregulating expression of an exogenous transgene under the control of the SOCS3 promoter in an immune cell (e.g., an exogenous transgene inserted into the SOCS3 locus of an immune cell genome such that the transgene is operably linked to the SOCS3 promoter), wherein the methods comprise contacting the immune cell with a cytokine. In some embodiments, the cytokine is IL-2, IL-15, IL-21 , IL-7, IL-18, and membrane-bound IL-21 (mblL-21).

[0019] In some embodiments, the disclosure provides nucleic acid molecules encoding components of a CRISPR / Cas system (e.g., gRNAs, a nucleic acid encoding a site-directed DNA endonuclease (or recombinant expression vector(s) encoding one or more gRNAs, a site- directed endonuclease, or both)), for use in introducing a gene edit in a subject that results in deletion of the SOCS3 gene in an immune cell and insertion of the transgene under the control of the SOCS3 locus in the immune cell.

[0020] In another aspect, described herein is a system for introducing a deletion of the SOCS3 gene in an immune cell, the system comprising, (i) one or more site-directed DNA endonucleases; (ii) one or more ribonucleic acids (gRNAs) comprising a spacer sequence corresponding to a target sequence within exon 2 of the SOCS3 gene; and (iii) a nucleotide sequence encoding an exogenous transgene; wherein when the one or more gRNAs isintroduced to the cell with the one or more site-directed DNA endonucleases, the one or more gRNAs combine with the site-directed DNA endonuclease to induce double-stranded breaks (DSBs) within exon 2 of the SOCS3 gene, thereby deleting the SOCS3 gene from the immune cell and introducing the exogenous transgene under regulation of the SOCS3 locus of the immune cell.

[0021] In another aspect, described herein is a method of producing an engineered immune cell comprising (a) introducing into an immune cell a guide RNA that targets exonl of the SOCS3 gene in the immune cell and a site-directed DNA endonuclease capable of inducing a genetic disruption within exon 2 of gene the immune cell, and (b) introducing an exogenous transgene into the SOCS3 locus of the immune cell, thereby producing an engineered immune cell.

[0022] In some embodiments, the immune cell is a T cell. In some embodiments, the immune cell is a natural killer T cell. In some embodiments, the immune cell is a natural killer (NK) cell.

[0023] In some embodiments, the exogenous transgene is a chimeric antigen receptor (CAR). In some embodiments, described herein is a method of activating a CAR under the control of the SOCS3 promoter in an immune cell (e.g., NK cell), the method comprising contacting a tumor cell with the immune cell, wherein the tumor cell expresses a cytokine and an antigen recognized by the CAR. In some embodiments, the cytokine is IL-2, IL-15, IL-21, IL- 7, IL-18, and membrane-bound IL-21 (mblL-21). In some embodiments, the cytokine is IL-2. In some embodiments, the cytokine is IL-21. Alternatively, the tumor cell may not express the cytokine, and a cytokine is otherwise administered (e.g., via application of the cytokine protein(s) or via administration of a nucleotide that encodes the cytokine and which is expressed).

[0024] As used herein, “chimeric antigen receptor” or “CAR” refers to an artificially constructed hybrid polypeptide comprising an antigen-binding domain (e.g., an antigen-binding portion of an antibody (e.g., a scFV)), a transmembrane domain, and a T-cell signaling and / or T- cell activation domain (e.g., intracellular signaling domain). CARs have the ability to redirect T- cell specificity and reactivity toward a selected target in a non-MHC-restricted manner, exploiting the antigen-binding properties of monoclonal antibodies. Further discussion of CARs can be found, e.g., in Maus et al. Blood 2014 123:2624-35; Reardon et al. Neuro-Oncology 2014 16:1441-1458; Hoyos et al. Haematologica 2012 97:1622; Byrd et al. J Clin Oncol 2014 32:3039-47; Maher et al. Cancer Res 200969:4559-4562; and Tamada et al. Clin Cancer Res 2012 18:6436-6445; each of which is incorporated by reference herein in its entirety.

[0025] In some embodiments, the CAR binds to a tumor antigen on the cell surface of a tumor cell. As used herein, the terms “tumor antigen” refers to an antigen which is differentially expressed by a cancer cell and can thereby be exploited in order to target a cancer cell. Cancer antigens are antigens which can potentially stimulate apparently tumor-specific immune responses. Some of these antigens are encoded, although not necessarily expressed, by normal cells. These antigens can be characterized as those which are normally silent (i.e. , not expressed) in normal cells, those that are expressed only at certain stages of differentiation and those that are temporally expressed such as embryonic and fetal antigens. Other cancer antigens are encoded by mutant cellular genes, such as oncogenes (e.g., activated ras oncogene), suppressor genes (e.g., mutant p53), and fusion proteins resulting from internal deletions or chromosomal translocations. Still other cancer antigens can be encoded by viral genes such as those carried on RNA and DNA tumor viruses. Many tumor antigens have been defined in terms of multiple solid tumors: MAGE 1 , 2, & 3, defined by immunity; MART-1 / Melan- A, gp100, carcinoembryonic antigen (CEA), HER2, mucins (i.e., MLIC-1), prostate-specific antigen (PSA), and prostatic acid phosphatase (PAP). In addition, viral proteins such as some encoded by hepatitis B (HBV), Epstein-Barr (EBV), and human papilloma (HPV) have been shown to be important in the development of hepatocellular carcinoma, lymphoma, and cervical cancer, respectively. In some embodiments, the tumor antigen is CD33, CD19, Meso, Her2, CD133, Muc1 , PSMA, FAP, GD2, BCMA, BAFF, or BAFFR.

[0026] In some embodiments, the CAR targets EGFR (Epidermal growth factor receptor) on non-small cell lung cancer, epithelial carcinoma, glioma; EGFRvlll (Variant III of the epidermal growth factor receptor) on glioblastoma; HER2 (Human epidermal growth factor receptor 2) on ovarian cancer, breast cancer, glioblastoma, colon cancer, osteosarcoma, medulloblastoma; MSLN (Mesothelin) on mesothelioma, ovarian cancer, pancreatic adenocarcinoma; PSMA (Prostate-specific membrane antigen) on prostate cancer; CEA (Carcinoembryonic antigen) on pancreatic adenocarcinoma, breast cancer, colorectal carcinoma; GD2 (Disialoganglioside 2) on neuroblastoma, melanoma; IL13Ra2 (lnterleukin-13Ra2) on glioma; GPC3 (Glypican-3) on hepatocellular carcinoma; CAIX (Carbonic anhydrase IX) on renal cell carcinoma (RCC); LI- CAM (L1 cell adhesion molecule) on neuroblastoma, melanoma, ovarian adenocarcinoma; CA125 (Cancer antigen 125, also known as MLIC16) on epithelial ovarian cancers; CD133 (Cluster of differentiation 133, also known as prominin-1) on glioblastoma, cholangiocarcinoma (CCA); FAP (Fibroblast activation protein) on malignant pleural mesothelioma (MPM); CTAG1B (Cancer / testis antigen 1B, also known as NY-ESO-1) on melanoma and ovarian cancer; MLIC1 (Mucin 1) on seminal vesicle cancer; or FR-a (Folate receptor-a) on ovarian cancer.

[0027] In some embodiments, the CAR comprises an intracellular domain of a costimulatory molecule, wherein the costimulatory molecule is CD27, CD28, 4-1 BB, 0X40, CD30, CD40, PD- 1 , ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, or B7- H3.

[0028] In some embodiments, the exogenous transgene is a cytokine. In some embodiments, the cytokine is IL-2, IL-15, IL-21, IL-7, IL-18, and membrane-bound IL-21 (mblL-21).

[0029] In some embodiments, both a CAR and a cytokine are introduced into the SOCS3 locus of the immune cell. In some embodiments, a polynucleotide encoding a CD33 CAR and a polynucleotide encoding IL-2 are introduced into the SOCS3 locus of the immune cell. In some embodiments, a polynucleotide encoding a CD33 CAR and a polynucleotide encoding IL-15 are introduced into the SOCS3 locus of the immune cell. In some embodiments, a polynucleotide encoding a CD33 CAR and a polynucleotide encoding IL-21 are introduced into the SOCS3 locus of the immune cell.

[0030] Genome Editing

[0031] Genome editing generally refers to the process of modifying the nucleotide sequence of a genome, preferably in a precise or pre-determined manner. Examples of methods of genome editing described herein include methods of using site-directed nucleases to cut deoxyribonucleic acid (DNA) at precise target locations in the genome, thereby creating doublestrand or single-strand DNA breaks at particular locations within the genome. Such breaks can be and regularly are repaired by natural, endogenous cellular processes, such as homology- directed repair (HDR) and non-homologous end-joining (NHEJ), as recently reviewed in Cox et al., Nature Medicine 21(2), 121-31 (2015). NHEJ directly joins the DNA ends resulting from a double-strand break, sometimes with the loss or addition of nucleotide sequence, which may disrupt or enhance gene expression. HDR utilizes a homologous sequence, or donor sequence, as a template for inserting a defined DNA sequence at the break point. The homologous sequence may be in the endogenous genome, such as a sister chromatid.Alternatively, the donor may be an exogenous nucleic acid, such as a plasmid, a single-strand oligonucleotide, a double-stranded oligonucleotide, a duplex oligonucleotide or a virus, that has regions of high homology with the nuclease-cleaved locus, but which may also contain additional sequence or sequence changes including deletions that can be incorporated into the cleaved target locus. A third repair mechanism is microhomology-mediated end joining (MMEJ), also referred to as "Alternative NHEJ”, in which the genetic outcome is similar to NHEJ in that small deletions and insertions can occur at the cleavage site. MMEJ makes use of homologoussequences of a few basepairs flanking the DNA break site to drive a more favored DNA end joining repair outcome, and recent reports have further elucidated the molecular mechanism of this process; see, e.g., Cho and Greenberg, Nature 518, 174-76 (2015); Kent et al., Nature Structural and Molecular Biology, Adv. Online doi:10.1038 / nsmb.2961(2015); Mateos-Gomez et al., Nature 518, 254-57 (2015); Ceccaldi et al., Nature 528, 258-62 (2015). In some instances, it may be possible to predict likely repair outcomes based on analysis of potential microhomologies at the site of the DNA break.

[0032] Each of these genome editing mechanisms can be used to create desired genomic alterations. A step in the genome editing process is to create one or two DNA breaks, the latter as double-strand breaks or as two single-stranded breaks, in the target locus as close as possible to the site of intended mutation. This can be achieved via the use of site-directed polypeptides, as described and illustrated herein.

[0033] Site-directed polypeptides, such as a DNA endonuclease, can introduce double-strand breaks or single-strand breaks in nucleic acids, e.g., genomic DNA. The double-strand break can stimulate a cell's endogenous DNA-repair pathways (e.g., homology-dependent repair or non-homologous end joining or alternative non-homologous end joining (A-NHEJ) or microhomology-mediated end joining). NHEJ can repair cleaved target nucleic acid without the need for a homologous template. This can sometimes result in small deletions or insertions (indels) in the target nucleic acid at the site of cleavage and can lead to disruption or alteration of gene expression.

[0034] The modifications of the target DNA due to NHEJ and / or HDR can lead to, for example, mutations, deletions, alterations, integrations, gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, translocations and / or gene mutation. The processes of deleting genomic DNA and integrating non-native nucleic acid into genomic DNA are examples of genome editing.

[0035] CRISPR Endonuclease System

[0036] In some embodiments, the exogenous transgene (e.g., chimeric antigen receptor) is introduced into the SOCS3 locus of an immune cell (e.g., NK cell) utilizing the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system. A CRISPR genomic locus can be found in the genomes of many prokaryotes (e.g., bacteria and archaea). In prokaryotes, the CRISPR locus encodes products that function as a type of immune system to help defend the prokaryotes against foreign invaders, such as virus and phage. There are three stages ofCRISPR locus function: integration of new sequences into the locus, biogenesis of CRISPR RNA (crRNA), and silencing of foreign invader nucleic acid. Five types of CRISPR systems (e.g., Type I, Type II, Type III, Type II, and Type V) have been identified.

[0037] A CRISPR locus includes a number of short repeating sequences referred to as "repeats." The repeats can form hairpin structures and / or comprise unstructured singlestranded sequences. The repeats usually occur in clusters and frequently diverge between species. The repeats are regularly interspaced with unique intervening sequences referred to as "spacers," resulting in a repeat-spacer-repeat locus architecture. The spacers are identical to or have high homology with known foreign invader sequences. A spacer-repeat unit encodes a crisprRNA (crRNA), which is processed into a mature form of the spacer-repeat unit. A crRNA comprises a "seed" or spacer sequence that is involved in targeting a target nucleic acid (in the naturally occurring form in prokaryotes, the spacer sequence targets the foreign invader nucleic acid). A spacer sequence is located at the 5' or 3' end of the crRNA.

[0038] A CRISPR locus also comprises polynucleotide sequences encoding CRISPR Associated (Cas) genes. Cas genes encode endonucleases involved in the biogenesis and the interference stages of crRNA function in prokaryotes. Some Cas genes comprise homologous secondary and / or tertiary structures.

[0039] Site-Directed DNA Endonuclease

[0040] A site-directed DNA endonuclease is a nuclease used in genome editing to cleave DNA. The site-directed DNA endonuclease may be administered to a cell or a subject as either: one or more polypeptides, or one or more mRNAs encoding the polypeptide. In the context of a CRISPR / Cas system, the site-directed DNA endonuclease can bind to a guide RNA that, in turn, specifies the site in the target DNA to which the polypeptide is directed.

[0041] In some embodiments, a site-directed DNA endonuclease comprises a plurality of nucleic acid-cleaving (i.e. , nuclease) domains. Two or more nucleic acid-cleaving domains can be linked together via a linker. In some embodiments, the linker comprises a flexible linker. Linkers may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40 or more amino acids in length.

[0042] In some embodiments, the one or more site-directed DNA endonucleases is a Cas1, Cas1 B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1 , Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16,CsaX, Csx3, Csx1 , Csx15, Csf1, Csf2, Csf3, Csf4, or Cpf1 (also known as Cas12a) endonuclease; or a homolog thereof, recombination of the naturally occurring molecule, codon- optimized, or modified version thereof, and combinations thereof. In some embodiments, the site-directed DNA endonuclease is Cas9. Naturally-occurring wild-type Cas9 enzymes comprise two nuclease domains, a HNH nuclease domain and a RuvC domain. Herein, the “Cas9” refers to both naturally-occurring and recombinant Cas9s. Cas9 enzymes contemplated herein comprises a HNH or HNH-like nuclease domain, and / or a RuvC or RuvC-like nuclease domain.

[0043] Exemplary CRISPR / Cas polypeptides include the Cas9 polypeptides in Fig. 1 of Fonfara et al., Nucleic Acids Research, 42: 2577-2590 (2014) (incorporated herein by reference). The CRISPR / Cas gene naming system has undergone extensive rewriting since the Cas genes were discovered. Fig. 5 of Fonfara, supra, provides PAM sequences for the Cas9 polypeptides from various species.

[0044] Cas9 polypeptides can introduce double-strand breaks or single-strand breaks in nucleic acids, e.g., genomic DNA. The double-strand break can stimulate a cell's endogenous DNA-repair pathways (e.g., homology-dependent repair (HDR) or non-homologous end joining (NHEJ) or alternative non-homologous end joining (A-NHEJ) or microhomology-mediated end joining (MMEJ)).

[0045] Guide RNAs

[0046] A guide RNA (or ‘gRNA”) comprises at least a spacer sequence that hybridizes to a target nucleic acid sequence of interest, and a CRISPR repeat sequence. In Type II systems, the gRNA also comprises a tracrRNA sequence. In the Type II guide RNA, the CRISPR repeat sequence and tracrRNA sequence hybridize to each other to form a duplex. In the Type V guide RNA, the crRNA forms a duplex. In both systems, the duplex binds a site-directed polypeptide, such that the guide RNA and site-direct polypeptide form a complex. The guide RNA provides target specificity to the complex by virtue of its association with the site-directed polypeptide. The guide RNA thus directs the activity of the site-directed polypeptide.

[0047] In some embodiments, the guide RNA is double-stranded. The first strand comprises in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence and a minimum CRISPR repeat sequence. The second strand comprises a minimum tracrRNA sequence (complementary to the minimum CRISPR repeat sequence), a 3’ tracrRNA sequence and an optional tracrRNA extension sequence.

[0048] In some embodiments, the guide RNA is single-stranded guide. A single-molecule guide RNA in a Type II system comprises, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat sequence, a single-stranded guide linker, a minimum tracrRNA sequence, a 3’ tracrRNA sequence and an optional tracrRNA extension sequence. The optional tracrRNA extension may comprise elements that contribute additional functionality (e.g., stability) to the guide RNA. The single-stranded guide linker links the minimum CRISPR repeat and the minimum tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension comprises one or more hairpins.

[0049] A single-stranded guide RNA in a Type V system comprises, in the 5' to 3' direction, a minimum CRISPR repeat sequence and a spacer sequence.

[0050] By way of illustration, guide RNAs used in the CRISPR / Cas system, or other smaller RNAs can be readily synthesized by chemical means, as illustrated below and described in the art. While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high-performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides. One approach used for generating RNAs of greater length is to produce two or more molecules that are ligated together. Much longer RNAs, such as those encoding a Cas9 endonuclease, are more readily generated enzymatically. Various types of RNA modifications can be introduced during or after chemical synthesis and / or enzymatic generation of RNAs, e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and / or enhance other attributes, as described in the art.

[0051] Exemplary gRNA for use in the methods described herein include, but are not limited to, the sgRNAs provided in SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.

[0052] Nucleic acid modifications

[0053] In certain embodiments, modified polynucleotides are used in the CRISPR / Cas9 system, in which case the guide RNAs (either single-molecule guides or double-molecule guides) and / or a DNA or an RNA encoding a Cas endonuclease introduced into a cell can be modified. Such modified polynucleotides can be used in the CRISPR / Cas9 system to edit any one or more genomic loci.

[0054] Modified guide RNAs can be used to enhance the formation or stability of the CRISPR / Cas9 genome editing complex comprising guide RNAs, which may be single-molecule guides or double-molecule, and a Cas endonuclease. Modifications of guide RNAs can also or alternatively be used to enhance the initiation, stability or kinetics of interactions between the genome editing complex with the target sequence in the genome, which can be used, for example, to enhance on-target activity. Modifications of guide RNAs can also or alternatively be used to enhance specificity, e.g., the relative rates of genome editing at the on-target site as compared to effects at other (off-target) sites.

[0055] Modifications can also or alternatively be used to increase the stability of a guide RNA, e.g., by increasing its resistance to degradation by ribonucleases (RNases) present in a cell, thereby causing its half-life in the cell to be increased. Modifications enhancing guide RNA halflife can be particularly useful in embodiments in which a Cas endonuclease is introduced into the cell to be edited via an RNA that needs to be translated in order to generate endonuclease, because increasing the half-life of guide RNAs introduced at the same time as the RNA encoding the endonuclease can be used to increase the time that the guide RNAs and the encoded Cas endonuclease co-exist in the cell.

[0056] Modifications can also or alternatively be used to decrease the likelihood or degree to which RNAs introduced into cells elicit innate immune responses. Such responses, which have been well characterized in the context of RNA interference (RNAi), including small-interfering RNAs (siRNAs), as described below and in the art, tend to be associated with reduced half-life of the RNA and / or the elicitation of cytokines or other factors associated with immune responses.

[0057] One or more types of modifications can also be made to RNAs encoding an endonuclease that are introduced into a cell, including, without limitation, modifications that enhance the stability of the RNA (such as by increasing its degradation by RNAses present in the cell), modifications that enhance translation of the resulting product (i.e. the endonuclease), and / or modifications that decrease the likelihood or degree to which the RNAs introduced into cells elicit innate immune responses.

[0058] Combinations of modifications can likewise be used. In the case of CRISPR / Cas9, for example, one or more types of modifications can be made to guide RNAs, and / or one or more types of modifications can be made to RNAs encoding Cas endonuclease.

[0059] By way of illustration of various types of modifications, especially those used frequently with smaller chemically synthesized RNAs, modifications can comprise one or more nucleotides modified at the 2' position of the sugar, in some embodiments a 2'-O-alkyl, 2'-O- alkyl-O-alkyl, or 2'-fluoro-modified nucleotide. In some embodiments, RNA modifications include 2'-fluoro, 2'-amino or 2' O-methyl modifications on the ribose of pyrimidines, abasic residues, or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than 2'-deoxyoligonucleotides against a given target.

[0060] A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligonucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Some oligonucleotides are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH2 -NH-O-CH2, CH,~N(CH3)~O~CH2 (known as a methylene(methylimino) or MMI backbone), CH2 --O--N (CH3)-CH2, CH2-N (CH3)-N (CH3)-CH2and O-N (CH3)- CH2-CH2backbones, wherein the native phosphodiester backbone is represented as O- P-- O- CH,); amide backbones [see De Mesmaeker et al., Ace. Chem. Res., 28:366-374 (1995)]; morpholino backbone structures (see Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al., Science 1991 , 254, 1497). Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see US patent nos. 3,687,808; 4,469,863; 4,476,301 ; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321 ,131 ; 5,399,676; 5,405,939; 5,453,496;5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821 ; 5,541 ,306; 5,550,111 ; 5,563,253; 5,571 ,799; 5,587,361 ; and 5,625,050.

[0061] Morpholino-based oligomeric compounds are described in Braasch and David Corey, Biochemistry, 41(14): 4503-4510 (2002); Genesis, Volume 30, Issue 3, (2001); Heasman, Dev. Biol., 243: 209-214 (2002); Nasevicius et al., Nat. Genet., 26:216-220 (2000); Lacerra et al., Proc. Natl. Acad. Sci., 97: 9591-9596 (2000); and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991.

[0062] Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc., 122: 8595-8602 (2000).

[0063] Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH2 component parts; see US patent nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141 ; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541 ,307; 5,561 ,225;5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.

[0064] One or more substituted sugar moieties can also be included, e.g., one of the following at the 2' position: OH, SH, SCH3, F, OCN, OCH3OCH3, OCH3O(CH2)n CH3, O(CH2)n NH2, or O(CH2)n CH3, where n is from 1 to about 10; C1 to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3; OCF3; O-, S-, or N-alkyl; O-, S-, or N- alkenyl; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. In some embodiments, a modification includes 2'- methoxyethoxy (2'-0-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl)) (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Other modifications include 2'-methoxy (2'-0-CH3), 2'-propoxy (2 -OCH2 CH2CH3) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics, such as cyclobutyls in place of the pentofuranosyl group.

[0065] In some embodiments, both a sugar and an internucleoside linkage, i.e. , the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar- backbone of an oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds comprise, but are not limited to, US patent nos. 5,539,082; 5,714,331 ; and 5,719,262. Further teaching of PNA compounds can be found in Nielsen et al, Science, 254: 1497-1500 (1991).

[0066] Guide RNAs can also include, additionally or alternatively, nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5- methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-(methylamino)adenine, 2- (imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7- deazaguanine, N6 (6-aminohexyl)adenine, and 2,6-diaminopurine. Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, pp75-77 (1980); Gebeyehu et al., Nucl. Acids Res. 15:4513 (1997). A "universal" base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1.2 °C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are embodiments of base substitutions.

[0067] Modified nucleobases comprise other synthetic and natural nucleobases, such as 5- methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-th iocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine,7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine.

[0068] Thus, the term “modified” refers to a non-natural sugar, phosphate, or base that is incorporated into a guide RNA, an endonuclease, or both a guide RNA and an endonuclease. It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligonucleotide, or even in a single nucleoside within an oligonucleotide.

[0069] Target Nucleic Acid Sequence

[0070] The guide RNA hybridizes to a target nucleic acid sequence within exon 2 of the SOCS3 gene. In some embodiments, the target nucleic acid sequence comprises 20 nucleotides in length. In some embodiments, the target nucleic acid comprises more than 20 nucleotides in length. In some embodiments, the target nucleic acid comprises less than 20 nucleotides in length. In some embodiments, the target nucleic acid comprises at least: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides in length. In some embodiments, the target nucleic acid comprises at most: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides in length.

[0071] In some embodiments, the target nucleic acid sequence is within the SOCS3 gene located at Chromosome 17: 78,359,183-78,356,778. In some embodiments, target sequence is within the coding region of SOCS3 located on the reverse strand of Chromosome 17:78,359,183-78,356,778,

[0072] The ends from a DNA break or ends from different breaks can be joined using the several nonhomologous repair pathways in which the DNA ends are joined with little or no basepairing at the junction. In addition to canonical NHEJ, there are similar repair mechanisms, such as alt-NHEJ. If there are two breaks, the intervening segment can be deleted or inverted. NHEJ repair pathways can lead to insertions, deletions or mutations at the joints.

[0073] For any of the genome editing strategies, gene editing can be confirmed by sequencing or PCR analysis.

[0074] Nucleic Acids Encoding System Components

[0075] In another aspect, the present disclosure provides a nucleic acid comprising a nucleotide sequence encoding one or more guide RNAs, and a DNA endonuclease.

[0076] In some embodiments, the nucleic acid encoding one or more guide RNAs and a DNA endonuclease comprises a vector (e.g., a recombinant expression vector). In another aspect, described herein is a vector comprising (i) a first polynucleotide sequence encoding a chimeric antigen receptor (CAR), and (ii) a second polynucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA targets the SOCS3 gene in an immune cell. In another aspect, described herein is a vector comprising (i) a first polynucleotide sequence encoding a cytokine, and (ii) a second polynucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA targets a SOCS3 gene in an immune cell. In yet another aspect, described herein is vector comprising a nucleotide sequence encoding a guide RNA set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.

[0077] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional nucleic acid segments can be ligated. Another type of vector is a viral vector, wherein additional nucleic acid segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.

[0078] In some embodiments, vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors", or more simply "expression vectors", which serve equivalent functions.

[0079] The term "operably linked" means that the nucleotide sequence of interest is linked to regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence. The term "regulatory sequence" is intended to include, for example, promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in Goeddel; Gene Expression Technology:Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells, and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the target cell, the level of expression desired, and the like.

[0080] Expression vectors contemplated include, but are not limited to, viral vectors based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retrovirus (e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus) and other recombinant vectors. Other vectors contemplated for eukaryotic target cells include, but are not limited to, the vectors pXT1, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40 (Pharmacia). Other vectors may be used so long as they are compatible with the host cell.

[0081] In some embodiments, a vector comprises one or more transcription and / or translation control elements. Depending on the host / vector system utilized, any of a number of suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. may be used in the expression vector. In some embodiments, the vector is a self-inactivating vector that either inactivates the viral sequences or the components of the CRISPR machinery or other elements.

[0082] Non-limiting examples of suitable eukaryotic promoters ( / .e., promoters functional in a eukaryotic cell) include those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTRs) from retrovirus, human elongation factor-1 promoter (EF1), a hybrid construct comprising the cytomegalovirus (CMV) enhancer fused to the chicken beta-actin promoter (CAG), murine stem cell virus promoter (MSCV), phosphoglycerate kinase-1 locus promoter (PGK), and mouse metallothionein-l.

[0083] For expressing small RNAs, including guide RNAs used in connection with Cas endonuclease, various promoters such as RNA polymerase III promoters, including for example U6 and H1, can be advantageous. Descriptions of and parameters for enhancing the use of such promoters are known in art, and additional information and approaches are regularly beingdescribed; see, e.g., Ma, H. et al., Molecular Therapy - Nucleic Acids 3, e161 (2014) doi:10.1038 / mtna.2014.12.

[0084] In some embodiments, a promoter is an inducible promoter (e.g., a heat shock promoter, tetracycline-regulated promoter, steroid- regulated promoter, metal-regulated promoter, estrogen receptor-regulated promoter, etc.). In some embodiments, a promoter is a constitutive promoter (e.g., CMV promoter, UBC promoter). In some embodiments, the promoter is a spatially restricted and / or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.).

[0085] In some embodiments, the nucleic acid encoding one or more guide RNAs and / or site- directed DNA endonuclease are packaged into or on the surface of delivery vehicles for delivery to cells. Delivery vehicles contemplated include, but are not limited to, nanospheres, liposomes, quantum dots, nanoparticles, polyethylene glycol particles, hydrogels, and micelles. A variety of targeting moieties can be used to enhance the preferential interaction of such vehicles with desired cell types or locations.

[0086] Introduction of the complexes, polypeptides, and nucleic acids of the disclosure into cells can occur by viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro-injection, nanoparticle-mediated nucleic acid delivery, and the like.

[0087] Delivery Methods

[0088] The nucleotide sequences (or vectors) disclosed herein can be delivered to a host cell or subject, in vivo or ex vivo, using various known and suitable methods available in the art. The nucleic acid constructs can be delivered together with components of a suitable gene editing system (e.g., RNA-guided DNA-binding agent such as a Cas nuclease with its corresponding guide RNA) as described herein.

[0089] Viral and non-viral based gene delivery methods can be used to introduce the nucleotide sequences disclosed herein and components of the gene editing system in cells (e.g., mammalian cells) and target tissues. Non-viral vector delivery systems include nucleic acids such as non-viral vectors, plasmid vectors, and, e.g., nucleic acid complexed with a delivery vehicle such as a liposome, lipid nanoparticle (LNP), or poloxamer. Viral vector delivery systems include DNA and RNA viruses.

[0090] In some embodiments, the viral vector is an adeno-associated virus (AAV) vector. AAV vectors are well known and have been used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). Construction of recombinant AAV vectors is described in a number of publications, including U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989). In some embodiments, the viral vector may be an AAV vector. In some embodiments, the AAV vector is, e.g., AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1 , AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrhIO, or AAVLK03. In some embodiments, the AAV vector is AAV6.

[0091] Methods and compositions for non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, LNPs, polycation or lipidmucleic acid conjugates, naked nucleic acid (e.g., naked DNA / RNA), artificial virions, and agent-enhanced uptake of DNA. Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids.

[0092] Additional exemplary nucleic acid delivery systems include those provided by AmaxaBiosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.) and Copernicus Therapeutics Inc. (see for example U.S. Pat. No. 6,008,336). Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386; 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam.TM. and Lipofectin.TM.). The preparation of lipidmucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known in the art, and as described herein.

[0093] Various delivery systems (e.g., vectors, liposomes, LNPs) containing the bidirectional constructs and / or gene editing components (e.g., guide RNA and Cas) can also be administered to an organism for delivery to cells in vivo or administered to a cell or cell culture ex vivo. Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood, fluid, or cells including, but not limited to, injection, infusion, topical application and electroporation. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art.

[0094] Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application, as described below. Alternatively, vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, usually after selection for cells which have incorporated the vector.

[0095] Lipid nanoparticles (LNPs) are a well-known means for delivery of nucleotide and protein cargo and may be used for delivery of the bidirectional nucleic acid constructs disclosed herein. In some embodiments, LNPs may be used to deliver components of a gene editing system. In some embodiments, the LNPs deliver nucleic acid (e.g., DNA or RNA), protein (e.g., RNA-guided DNA binding agent), or nucleic acid together with protein.

[0096] Engineered immune cells

[0097] In another aspect, described herein is a method of producing an engineered immune cell, comprising (a) introducing into an immune cell a guide RNA that targets exon 2 of the SOCS3 gene in the immune cell and a site-directed DNA endonuclease capable of inducing a genetic disruption within exon 2 of gene the immune cell, and (b) introducing an exogenous transgene into the SOCS3 locus of the immune cell, thereby producing an engineered immune cell.

[0098] In some embodiments, the site-directed DNA endonuclease is Cas9.

[0099] In some embodiments, the genetic disruption comprises a double-stranded break(DSB) within exon 2 of the SOCS3 gene in the immune cell, which results in deletion of the SOCS3 gene. In some embodiments, the guide RNA comprises a nucleotide sequence set forth in SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.

[0100] In another aspect, described herein is an immune cell comprising an exogenous transgene operably linked to a SOCS3 promoter. In some embodiments, the immune cell is a T cell. In some embodiment, the immune cell is a natural killer cell. In some embodiments, the immune cell is a NK T cell. Optionally, the exogenous transgene is inserted into the SOCS3 locus of the immune cell genome such that the exogenous transgene is operably linked to the SOCS3 promoter; for instance, the exogenous transgene may be inserted into exon 2 of SOCS3 locus.

[0101] The exogenous transgene can be a CAR. In some embodiments, the CAR comprises an antigen binding domain that binds to a tumor antigen. Exemplary tumor antigens include, but are not limited to, CD33, CD19, Meso, Her2, CD133, Muc1 , PSMA, FAP, GD2, BCMA, BAFF, or BAFFR.

[0102] Therapeutic Methods

[0103] In some embodiments, the vector or system described herein is administered to a subject in need of treatment. In some embodiments, the subject has cancer.

[0104] As used herein, the term “cancer” refers to a hyperproliferation of cells that have lost normal cellular control, resulting in unregulated growth, lack of differentiation, local tissue invasion, and metastasis. Cancers are classified based on the histological type (e.g., the tissue in which they originate) and their primary site (e.g., the location of the body the cancer first develops), and can be carcinoma, a melanoma, a sarcoma, a myeloma, a leukemia, or a lymphoma. “Cancer” can also refer to a solid tumor. As used herein, the term “tumor” refers to an abnormal growth of cells or tissues, e.g., of malignant type or benign type. “Cancer” can be metastatic, meaning the cancer cells have disseminated from its primary site of origin and migrated to a secondary site.

[0105] As used herein, the terms "treat,” "treatment," "treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder, e.g., melanoma, colon cancer, or other cancer, including cancer resistant to particular therapies, e.g., checkpoint inhibitor therapy. The term “treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder. Treatment is generally “effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective" if the progression of a disease is reduced or halted. That is, “treatment" includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of, progress or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e. , not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and / or decreased mortality.

[0106] In some embodiments, the cancer is a carcinoma, a melanoma, a sarcoma, a myeloma, a leukemia, or a lymphoma.

[0107] A carcinoma is a cancer that originates in an epithelial tissue. Carcinomas account for approximately 80-90% of all cancers. Carcinomas can affect organs or glands capable of secretion (e.g., breasts, lung, prostate, colon, or bladder). There are two subtypes of carcinomas: adenocarcinoma, which develops in an organ or gland, and squamous cell carcinoma, which originates in the squamous epithelium. Adenocarcinomas generally occur in mucus membranes and are observed as a thickened plaque-like white mucosa. They often spread easily through the soft tissue where they occur. Squamous cell carcinomas can originate from any region of the body. Examples of carcinomas include, but are not limited to, prostate cancer, colorectal cancer, microsatellite stable colon cancer, microsatellite instable colon cancer, hepatocellular carcinoma, breast cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, melanoma, basal cell carcinoma, squamous cell carcinoma, renal cell carcinoma, ductal carcinoma in situ, invasive ductal carcinoma.

[0108] Sarcomas are cancers that originate in supportive and connective tissues, for example bones, tendons, cartilage, muscle, and fat. Sarcoma tumors usually resemble the tissue in which they grow. Non-limiting examples of sarcomas include, Osteosarcoma or osteogenic sarcoma (originating from bone), Chondrosarcoma (originating from cartilage), Leiomyosarcoma (originating from smooth muscle), Rhabdomyosarcoma (originating from skeletal muscle), Mesothelial sarcoma or mesothelioma (originate from membranous lining of body cavities), Fibrosarcoma (originating from fibrous tissue), Angiosarcoma or hemangioendothelioma (originating from blood vessels), Liposarcoma (originating from adipose tissue), Glioma or astrocytoma (originating from neurogenic connective tissue found in the brain), Myxosarcoma (originating from primitive embryonic connective tissue), or Mesenchymous or mixed mesodermal tumor (originating from mixed connective tissue types).

[0109] Melanoma is a type of cancer forming from pigment-containing melanocytes. Melanoma typically develops in the skin, but can occur in the mouth, intestine, or eye.

[0110] Myelomas are cancers that originate in plasma cells of bone marrow. Non-limiting examples of myelomas include multiple myeloma, plasmacytoma and amyloidosis.

[0111] Leukemias (also known as “blood cancers”) are cancers of the bone marrow, which is the site of blood cell production. Leukemia is often associated with the overproduction of immature white blood cells. Immature white blood cells do not function properly, rendering the patient prone to infection. Leukemia additionally affects red blood cells and can cause poor blood clotting and fatigue due to anemia. Leukemia can be classified as being acute myeloid leukemia (AML), Chronic myeloid leukemia (CML), Acute lymphocytic leukemia (ALL), andChronic lymphocytic leukemia (CLL). Examples of leukemia include, but are not limited to, Myelogenous or granulocytic leukemia (malignancy of the myeloid and granulocytic white blood cell series), Lymphatic, lymphocytic, or lymphoblastic leukemia (malignancy of the lymphoid and lymphocytic blood cell series), and Polycythemia vera or erythremia (malignancy of various blood cell products, but with red cells predominating).

[0112] Lymphomas develop in the glands or nodes of the lymphatic system (e.g., the spleen, tonsils, and thymus), which purifies bodily fluids and produces white blood cells, or lymphocytes. Unlike leukemia, lymphomas form solid tumors. Lymphoma can also occur in specific organs, for example the stomach, breast, or brain; this is referred to as extranodal lymphomas).Lymphomas are sub-classified into two categories: Hodgkin lymphoma and Non-Hodgkin’s lymphoma. The presence of Reed-Sternberg cells in Hodgkin lymphoma diagnostically distinguishes Hodgkin lymphoma from Non-Hodgkin’s lymphoma. Non-limiting examples of lymphoma include Diffuse large B-cell lymphoma (DLBCL), Follicular lymphoma, Chronic lymphocytic leukemia (CLL), Small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, Burkitt lymphoma, hairy cell leukemia (HCL). In one embodiment, the cancer is DLBCL or Follicular lymphoma.

[0113] In some embodiments, the cancer is a solid tumor. Non-limiting examples of solid tumors include Adrenocortical Tumor, Alveolar Soft Part Sarcoma, Chondrosarcoma, Colorectal Carcinoma, Desmoid Tumors, Desmoplastic Small Round Cell Tumor, Endocrine Tumors, Endodermal Sinus Tumor, Epithelioid Hemangioendothelioma, Ewing Sarcoma, Germ Cell Tumors (Solid Tumor), Giant Cell Tumor of Bone and Soft Tissue, Hepatoblastoma, Hepatocellular Carcinoma, Melanoma, Nephroma, Neuroblastoma, Non-Rhabdomyosarcoma Soft Tissue Sarcoma (NRSTS), Osteosarcoma, Paraspinal Sarcoma, Renal Cell Carcinoma, Retinoblastoma, Rhabdomyosarcoma, Synovial Sarcoma, and Wilms Tumor. Solid tumors can be found in bones, muscles, or organs, and can be sarcomas or carinomas.

[0114] In various embodiments, the cancer is metastatic.

[0115] In various cases, the subject being treated using a method as disclosed herein suffers from a solid tumor or a soluble cancer with a microtumor environment. In various cases, the cancer is melanoma, head and neck cancer, lung cancer (e.g., non-small cell lung cancer), bladder cancer, kidney cancer, prostate cancer, a central nervous system (CNS) cancer, breast cancer, stomach cancer, thyroid cancer, ovarian cancer, or Non-Hodgkin’s lymphoma. In some cases, the cancer is melanoma. In various cases, the cancer is bladder cancer. In variouscases, the cancer is kidney cancer. In various cases, the cancer is non-small cell lung cancer. In various cases, the cancer is head and neck cancer.

[0116] The efficacy of the treatment methods described herein can be determined by the skilled clinician. However, a treatment is considered “effective treatment" if one or more of the signs or symptoms of a condition described herein is altered in a beneficial manner, other clinically accepted symptoms are improved, or even ameliorated, or a desired response is induced e.g., by at least 10% following treatment according to the methods described herein. Efficacy can be assessed, for example, by measuring a marker, indicator, symptom, and / or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate. Treatment according to the methods described herein can reduce levels of a marker or symptom of a condition, e.g., by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80 % or at least 90% or more.

[0117] Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (i.e., progression of the disease is halted). Methods of measuring these indicators are known to those of skill in the art and / or are described herein.

[0118] Combination Therapy

[0119] In various embodiments, the vector or system disclosed herein can be combined with therapy utilizing a second therapeutic agent, e.g., an additional anti-cancer therapy. An anticancer therapy can be, e.g., chemotherapy, radiation therapy, chemo-radiation therapy, immunotherapy, hormone therapy, surgery or stem cell therapy.

[0120] In accordance with some embodiments, the subject is administered a chemotherapeutic agent in combination with the vector, system, or methods described herein. Exemplary chemotherapeutic agents include, but are not limited to, a platinum chemotherapeutic agent, an anthracyclin therapeutic agent, or an alkylating chemotherapeutic agent. Non-limiting examples of chemotherapeutic agents include an anthracycline (e.g., doxorubicin (e.g., liposomal doxorubicin)), a vinca alkaloid (e.g., vinblastine, vincristine, vindesine, vinorelbine), an alkylating agent (e.g., cyclophosphamide, decarbazine, melphalan, ifosfamide, temozolomide), an immune cell antibody (e.g., alemtuzamab, gemtuzumab, rituximab, tositumomab), an antimetabolite (including, e.g., folic acid antagonists, pyrimidine analogs, purine analogs and adenosine deaminase inhibitors (e.g., fludarabine)), an mTORinhibitor, a TNFR glucocorticoid induced TNFR related protein (GITR) agonist, a proteasome inhibitor (e.g., aclacinomycin A, gliotoxin or bortezomib), an immunomodulator such as thalidomide or a thalidomide derivative (e.g., lenalidomide). General chemotherapeutic agents considered for use in combination therapies include anastrozole (Arimidex®), bicalutamide (Casodex®), bleomycin sulfate (Blenoxane®), busulfan (Myleran®), busulfan injection (Busulfex®), capecitabine (Xeloda®), N4-pentoxycarbonyl-5- deoxy- 5-fluorocytidine, carboplatin (Paraplatin®), carmustine (BiCNll®), chlorambucil (Leukeran®), cisplatin (Platinol®), cladribine (Leustatin®), cyclophosphamide (Cytoxan® or Neosar®), cytarabine, cytosine arabinoside (Cytosar-U®), cytarabine liposome injection (DepoCyt®), dacarbazine (DTIC-Dome®), dactinomycin (Actinomycin D, Cosmegan), daunorubicin hydrochloride (Cerubidine®), daunorubicin citrate liposome injection (DaunoXome®), dexamethasone, docetaxel (Taxotere®), doxorubicin hydrochloride (Adriamycin®, Rubex®), etoposide (Vepesid®), fludarabine phosphate (Fludara®), 5- fluorouracil (Adrucil®, Efudex®), flutamide (Eulexin®), tezacitibine, Gemcitabine (difluorodeoxycitidine), hydroxyurea (Hydrea®), Idarubicin (Idamycin®), ifosfamide (I FEX®), irinotecan (Camptosar®), L-asparaginase (ELSPAR®), leucovorin calcium, melphalan (Alkeran®), 6-mercaptopurine (Purinethol®), methotrexate (Folex®), mitoxantrone (Novantrone®), mylotarg, paclitaxel (Taxol®), phoenix (Yttrium90 / MX- DTPA), pentostatin, polifeprosan 20 with carmustine implant (Gliadel®), tamoxifen citrate (Nolvadex®), teniposide (Vumon®), 6-thioguanine, thiotepa, tirapazamine (Tirazone®), topotecan hydrochloride for injection (Hycamptin®), vinblastine (Velban®), vincristine (Oncovin®), and vinorelbine (Navelbine®). Exemplary alkylating agents include, without limitation, nitrogen mustards, ethylenimine derivatives, alkyl sulfonates, nitrosoureas and triazenes): uracil mustard (Aminouracil Mustard®, Chlorethaminacil®, Demethyldopan®, Desmethyldopan®, Haemanthamine®, Nordopan®, Uracil nitrogen mustard®, Uracillost®, Uracilmostaza®, Uramustin®, Uramustine®), chlormethine (Mustargen®), cyclophosphamide (Cytoxan®, Neosar®, Clafen®, Endoxan®, Procytox®, Revimmune™), ifosfamide (Mitoxana®), melphalan (Alkeran®), Chlorambucil (Leukeran®), pipobroman (Amedel®, Vercyte®), triethylenemelamine (Hemel®, Hexalen®, Hexastat®), triethylenethiophosphoramine, Temozolomide (Temodar®), thiotepa (Thioplex®), busulfan (Busilvex®, Myleran®), carmustine (BiCNU®), lomustine (CeeNU®), streptozocin (Zanosar®), and Dacarbazine (DTIC-Dome®). Additional exemplary alkylating agents include, without limitation, Oxaliplatin (Eloxatin®); Temozolomide (Temodar® and Temodal®); Dactinomycin (also known as actinomycin-D, Cosmegen®); Melphalan (also known as L-PAM, L-sarcolysin, and phenylalanine mustard, Alkeran®); Altretamine (also known as hexamethylmelamine (HMM), Hexalen®); Carmustine(BiCNll®); Bendamustine (Treanda®); Busulfan (Busulfex® and Myleran®); Carboplatin (Paraplatin®); Lomustine (also known as CCNll, CeeNll®); Cisplatin (also known as CDDP, Platinol® and Platinol®-AQ); Chlorambucil (Leukeran®); Cyclophosphamide (Cytoxan® and Neosar®); Dacarbazine (also known as DTIC, DIC and imidazole carboxamide, DTIC-Dome®); Altretamine (also known as hexamethylmelamine (HMM), Hexalen®); Ifosfamide (Ifex®);Prednumustine; Procarbazine (Matulane®); Mechlorethamine (also known as nitrogen mustard, mustine and mechloroethamine hydrochloride, Mustargen®); Streptozocin (Zanosar®); Thiotepa (also known as thiophosphoamide, TESPA and TSPA, Thioplex®); Cyclophosphamide (Endoxan®, Cytoxan®, Neosar®, Procytox®, Revimmune®); and Bendamustine HC1 (Treanda®). Exemplary mTOR inhibitors include, e.g., temsirolimus; ridaforolimus (formally known as deferolimus, (IR,2R,45)-4-[(2R)-2[(1R,95,125,15R,16E,18R,19R,21R,235,24E,26E,28Z,305,325,35R)-l,18-dihydroxy-19,30- dimethoxy-15,17,21 ,23, 29,35- hexamethyl-2,3,10,14,20-pentaoxo-l l,36-dioxa-4- azatri cyclo [30.3.1.04'9] hexatriaconta- 16,24,26,28-tetraen-12-yl]propyl]-2-methoxycyclohexyl dimethylphosphinate, also known as AP23573 and MK8669, and described in PCT Publication No. WO 03 / 064383); everolimus (Afinitor® or RADOOI); rapamycin (AY22989, Sirolimus®); simapimod (CAS 164301-51-3); emsirolimus, (5-{2,4-Bis[(35,)-3-methylmorpholin-4- yl]pyrido[2,3-(i]pyrimidin-7-yl}-2- methoxyphenyl)methanol (AZD8055); 2-Amino-8-[iraw5,-4-(2- hydroxyethoxy)cyclohexyl]-6- (6-methoxy-3-pyridinyl)-4-methyl-pyrido[2,3-JJpyrimidin-7(8H)-one (PF04691502, CAS 1013101-36-4); and N2-[l,4-dioxo-4-[[4-(4-oxo-8-phenyl-4H-l-benzopyran-2- yl)morpholinium-4-yl]methoxy]butyl]-L-arginylglycyl-L-a-aspartylL-serine-, inner salt (SF1126, CAS 936487-67-1), and XL765. Exemplary immunomodulators include, e.g., afutuzumab (available from Roche®); pegfilgrastim (Neulasta®); lenalidomide (CC-5013, Revlimid®); thalidomide (Thalomid®), actimid (CC4047); and IRX-2 (mixture of human cytokines including interleukin 1, interleukin 2, and interferon y, CAS 951209-71-5, available from IRX Therapeutics). Exemplary anthracyclines include, e.g., doxorubicin (Adriamycin® and Rubex®); bleomycin (lenoxane®); daunorubicin (dauorubicin hydrochloride, daunomycin, and rubidomycin hydrochloride, Cerubidine®); daunorubicin liposomal (daunorubicin citrate liposome, DaunoXome®); mitoxantrone (DHAD, Novantrone®); epirubicin (Ellence™); idarubicin (Idamycin®, Idamycin PFS®); mitomycin C (Mutamycin®); geldanamycin; herbimycin; ravidomycin; and desacetylravidomycin. Exemplary vinca alkaloids include, e.g., vinorelbine tartrate (Navelbine®), Vincristine (Oncovin®), and Vindesine (Eldisine®)); vinblastine (also known as vinblastine sulfate, vincaleukoblastine and VLB, Alkaban-AQ® and Velban®); and vinorelbine (Navelbine®). Exemplary proteosome inhibitors include bortezomib (Velcade®);carfilzomib (PX- 171-007, (5)-4-Methyl-N-((5)-l-(((5)-4-methyl-l-((R)-2-methyloxiran-2-yl)-l- oxopentan-2- yl)amino)-l-oxo-3-phenylpropan-2-yl)-2-((5,)-2-(2-morpholinoacetamido)-4- phenylbutanamido)-pentanamide); marizomib (NPT0052); ixazomib citrate (MLN-9708); delanzomib (CEP-18770); and O-Methyl-N-[(2-methyl-5-thiazolyl)carbonyl]-L-seryl-O- methyl-N- [(IIS')-2-[(2R)-2-methyl-2-oxiranyl]-2-oxo-l-(phenylmethyl)ethyl]- L-serinamide (ONX-0912).

[0121] One of skill in the art can readily identify a chemotherapeutic agent of use with methods and compositions describe herein {e.g., see Physicians' Cancer Chemotherapy Drug Manual 2014, Edward Chu, Vincent T. DeVita Jr., Jones & Bartlett Learning; Principles of Cancer Therapy, Chapter 85 in Harrison's Principles of Internal Medicine, 18th edition; Therapeutic Targeting of Cancer Cells: Era of Molecularly Targeted Agents and Cancer Pharmacology, Chs. 28-29 in Abeloff’s Clinical Oncology, 2013 Elsevier; and Fischer D S (ed): The Cancer Chemotherapy Handbook, 4th ed. St. Louis, Mosby-Year Book, 2003).

[0122] In accordance with some embodiments, the subject is administered a radiation therapy in combination with the methods described herein. Radiation therapy, according to the invention disclosed herein, encompasses both non-invasive (external) and invasive (internal) radiation therapies. In an external radiation therapy, treatment is affected by radiation sources outside the body, whereas in an invasive radiation therapy treatment is affected by radiation sources planted inside the body. The representative diseases treated by non-invasive or invasive radiation therapy include, for example, cancer, rheumatoid arthritis, angioplasty, or restenosis.

[0123] In accordance with some embodiments, the subject is administered a chemo-radiation therapy, e.g., a combination of a chemotherapy and radiation therapy, in combination with the methods described herein.

[0124] In accordance with some embodiments, the subject is administered a hormone therapy in combination with the methods described herein. Hormone therapy is designed to add, block, or remove hormones from the body to, e.g., halt or slow the growth of cancer cells. Hormone therapy can include administration of, e.g., progesterone, oophorectomy, tamoxifen, gonadotropin-releasing hormone (GnRH) agonists or analogues and androgen therapy. Hormone therapy can also refer to removing glands, e.g., thyroid, pancreas, and ovary, to reduce the levels of hormones in the body. Hormone therapies are known in the art and can be administered by a skilled person.

[0125] In accordance with some embodiments, the subject is administered a stem cell therapy in combination with the methods described herein. Stem cell therapy can comprise removing stem cells from a subject prior to receiving treatment to destroy all stem cells (e.g., chemotherapy, radiotherapy, or a combination thereof). Stems cells can be re-administered to the patient following such treatment (e.g., a stem cell transplant). A stem cell transplant can be autologous, or allogenic. A stem cell transplant can be a tandem transplant (e.g., two or more transplants in a row), a mini-transplant (e.g., a subject’s immune system is suppressed less than a typical transplant), or a syngeneic stem cell transplant (e.g., allogenic stem cells received from an identical twin). Cancers that can be treated with stem cell therapy include but are not limited to leukemias, lymphomas, multiple myeloma, testicular cancer, neuroblastoma, and certain childhood cancers.

[0126] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein.

[0127] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.EXAMPLESExample 1 - Identification of sgRNAs

[0128] Chemically modified sgRNAs were obtained from Integrated DNA Technologies and CleanCap Cas9 mRNA was purchased from TriLink Biotechnologies. HEK293T cells were obtained from ATCC and cultured according to the manufacturer’s recommendation. The sgRNAs obtained were as follows:

[0100] SgRNA #1 - AAACUUGCUGUGGGUGACCA (SEQ ID NO: 1);

[0101] sgRNA #2 - CGGCGGCGGGAAACUUGCUG (SEQ ID NO: 2);

[0102] sgRNA #3 - CACAGCAAGUUUCCCGCCGC (SEQ ID NO: 3);

[0103] sgRNA #4 - GGGCGGCUCAUCCCGGCGGC (SEQ ID NO: 4); and

[0104] sgRNA #5 - CAGGGGGCGGCUCAUCCCGG (SEQ ID NO: 5)

[0129] HEK293 T cells were plated 24 hours prior to transfection and grown to a confluency of 70%. At this time the cells were transfected with 1.5 ug of Cas9 mRNA and 1 ug of sgRNA using the Mirus TransIT-mRNA Kit (Mirus Bio). 3 days after transfection, cells were collected and genomic DNA was harvested for PCR amplification of the SOCS3 locus. PCR products were run on a 1% agarose gel to assess accurate size and then sent for sanger sequencing (Eurofins Genomics). Synthego ICE was then used to assess INDEL rates on all samples (https: / / ice.synthego.eom / # / ).

[0130] As shown in Figure 1, sgRNA number 5 (CAGGGGGCGGCUCAUCCCGG, SEQ ID NO: 5) provided the highest rate of INDEL and was selected for use in future studies.Example 2 - Targeted Integration of a transgene in the SOCS3 locus us a NK cell

[0131] AAV6-SOCS3-GSG-T2A construct was cloned into a pAAV backbone and the desired cargo was synthesized after the T2A site. Following plasmid generation AAV6 viral particles were produced commercially using 293T cells.

[0132] Peripheral blood mononuclear cells (PBMCs) from healthy human donors were obtained by automated leukapheresis (Memorial Blood Centers, Minneapolis, MN). CD3+ T cells or CD56+CD3-NK cells were isolated from the PBMC population using the EasySep Human T Cell Isolation Kit or EasySep Human NK Cell Isolation Kit (STEMCELL Technologies, Cambridge, MA). T cells were frozen at 1-2 x 107cells / mL and NK cells were frozen at 5 x 106cells / mL in CryoStor CS10 (STEMCELL Technologies, Cambridge, MA) and thawed into culture as needed.

[0133] Natural killer cell culture and expansion: NK cells were cultured in CTS AIM V SFM containing 5% CTS Immune cell SR (ThermoFisher, Waltham, MA), Penicillin / Streptomycin, and IL-2 (100 IIJ / mL). NK cells were activated by co-culture with X-irradiated (100 Gray) feeder cells (K562 expressing membrane-bound IL21 and 41BB-L) at indicated feederNK ratios (2:1 prior to electroporation, 5:1 48 hours after electroporation, or 1:1 for all subsequent expansions).

[0134] pAAV-SOCS3-GSG-T2A-GFP-BGH was generated using a standard pAAV backbone with ITRs and the SOCS3 homology arms was generated and GSG-T2A-GFP was chemically synthesized into the region between the homology arms.

[0135] Natural killer cell engineering

[0136] Neon: Feeder cell-activated NK cells were washed once with PBS and resuspended at 3 x l07cells / mL in electroporation buffer. Protector RNase inhibitor (Sigma Aldrich, St. Louis,MO) was added to the mixture at a concentration of 0.8 U / pL and incubated for 5 minutes at room temperature. The cell mixture was added to 1.5 pg of Cas9 mRNA and 1 pg chemically modified sgRNA (e.g., modified with a 2’-O-Methyl at the 3 first and last bases as well as 3’ phosphorothioate bonds between the first 3 and last 2 bases) on ice. This mixture was electroporated in a 10 pL tip using the Neon Transfection System (ThermoFisher, Waltham, MA) under the following conditions: 1850 volts, pulse width of 10 ms, two pulses. NK cells were allowed to recover at a density of 1.5 x 106cells / mL in antibiotic-free medium containing 1 pg / mL DNase I solution (STEMCELL Technologies, Cambridge, MA), and were then transduced with rAAV at a MOI of 500,000 viral particles per cell. Cells were cultured in complete NK cell medium at a density of 6 x 105cells / mL. 48 hours after electroporation, NK cells were expanded with feeder cells at a 5:1 feeder: NK ratio.

[0137] Amaxa: Feeder cell-activated NK cells were washed once with PBS and resuspended at 3 x 107cells / mL in electroporation buffer. Protector RNase inhibitor (Sigma Aldrich, St. Louis, MO) was added to the mixture at a concentration of 0.8 U / pL and incubated for 5 minutes at room temperature. The cell mixture was added to 1.5 pg of Cas9 mRNA and 1 pg chemically modified sgRNA on ice. This mixture was electroporated in a 20 pL cuvette using the Amaxa 4D Nucleofector (Lonza, Germany) under the following condition: EO-115. NK cells were allowed to recover at a density of 1.5 x 106cells / mL in antibiotic-free medium containing 1 pg / mL DNase I solution (STEMCELL Technologies, Cambridge, MA), and were then transduced with rAAV at a MOI of 500,000 viral particles per cell. Cells were cultured in complete NK cell medium at a density of 6 x 105cells / mL. 48 hours after electroporation, NK cells were expanded with feeder cells at a 5:1 feeder: NK ratio.

[0138] MaxCyte: Day 7 feeder cell-activated NK cells were washed once with DPBS and resuspended in MaxCyte electroporation buffer to the cell density of 8.4 x 104 cells / pL. An electroporation reaction was consisted of 43 pL of cell suspension, 1 pL of Protector RNase inhibitor (Sigma Aldrich, St. Louis, MO), 3.75 pL of Cas9 mRNA (1 pg / pL), and 2.5 pL of chemically modified sgRNA 5 (1 pg / pL). The mixture was then incubated in room temperature for 5 mins before electroporation and transferred into R-50x3 assembly. The electroporation was conducted in MaxCyte ATx using Expanded T cell condition 4. Immediately after electroporation, the R-50x3 assembly was incubated in 37°C to allow cell recovery for 20 mins. Afterwards, the cells of each reaction were transferred to 6-well plate and rested in 3.6 mL recovery medium (CTS AIM V SFM containing 5% CTS Immune cell SR, and 100 IIJ / mL IL-2) for 40 mins. The rAAV transduction mixture is prepared by diluting 3 x 1011 viral particles (5 x105 viral particles per cell) in 400 pL recovery medium. Six hundred pL of cell suspension in 6- well plate (6 x 105 cells) was transferred to 24-well plate after resting and gently mixed with the rAAV transduction mixture. After 72 hours culture, NK cells were expanded with feeder cells at the feederNK ratio of 5:1 in complete medium (CTS AIM V SFM containing 5% CTS Immune cell SR, and Penicillin / Streptomycin) containing 100 lll / mL IL-2.Example 3 - Targeting integration of GFP into SOCS3 locus of a NK cell

[0139] NK cells were engineered using the MaxCyte method described above in Example 2 and then transduced with AAV6-SOCS3-GSG-T2A-GFP-BGH. After 7 days expansion, the edited NK cells were centrifuged and resuspended in complete medium containing 10 lll / mL IL- 2 to allow cytokine cool-off for 48 hours. Forty-eight hours later, the NK cells were stimulated in complete medium containing 500 lll / mL IL-2 + 10 ng / mL IL-21 for 72 hours. The stimulated NK cells were processed using protocol described in [Page 1 Material and method]. Flow cytometry was performed to access the GFP expression and viability. All data was analyzed by FlowJo using the following gating strategy: FSC / SSC > Singlets (FSC-width / SSC) > Viable (R780dim) > CD56+.

[0140] As shown in Figure 2, the SOCS3-GFP knock-in efficiency is 81.8 ± 4.67% across four independent donors. An ultra-low level of auto-fluorescence occurs in other control groups. Integration of GFP into SOCS3 locus is robust.Example 4 - SOCS3 Cytokine Stimulation after GFP integration

[0141] NK cells were engineered using the MaxCyte method described above in Example 2 and then transduced with AAV6-SOCS3-GSG-T2A-GFP-BGH. After 7 days expansion, the edited NK cells were centrifuged and resuspended in complete medium containing 10 IIJ / mL IL- 2 to allow cytokine cool-off for 48 hours. Forty-eight hours later, the NK cells were stimulated in complete medium containing 500 IIJ / mL IL-2 + 10 ng / mL IL-21 for 2, 24, 48, and 72 hours. The stimulated NK cells were stained in staining solution containing Fixable Viability Dye eFluor 780 (ThermoFisher, Waltham, MA) and anti-CD56, clone 5.1 H11 (BioLegend, San Diego, CA) according to the manufacturer’s protocol. Flow cytometry was performed in CytoFlex (Beckman Coulter, Brea, CA) to access the GFP expression and viability. All data was analyzed by FlowJo (BD Biosciences, San Jose, CA) using the following gating strategy: FSC / SSC > Singlets (FSC- width / SSC) > Viable (R780dim) > CD56+.

[0142] As shown in Figure 3, GFP expression driven by the SOCS3 promoter was controllable by cytokine stimulation. The percentage of the GFP+ population graduallyincreased over time and became stable 48 hours after IL-2 + IL-21 stimulation. The MFI of GFP expression also gradually increased over time after IL-2 + IL-21 stimulation. Based on the data, the IL-2 + IL-21 stimulation of 72 hours is necessary to induce the optimal SOCS3 promoter activity.

[0143] Also as shown in Figure 4, severe cell death was observed in control (no cytokine) and 10 U / mL IL-2 groups. Stimulation of IL-2 + IL-21 outperforms IL-12 + IL-18 in the percentage of GFP+, MFI, and relative cell count. Compared to other cytokine combinations, the IL-2 + IL-21 stimulation was optimal to induce SOCS3 promoter activity and maintain cell viability.Example 5 -Targeted Integration of a CAR in the SOCS3 locus of a NK cell

[0144] The experiments described above in Example 2 were repeated to integrate CARs into the SOCS3 locus of a NK cell.

[0145] NK cells were engineered using the MaxCyte method described above in Example 2 and then transduced with AAV6-SOCS3-GSG-T2A-CD19CAR-P2A-RQR8-BGH. After 7 days expansion, the edited NK cells were centrifuged and resuspended in complete medium containing 10 IIJ / mL IL-2 to allow cytokine cool-off for 48 hours. Forty-eight hours later, the NK cells were stimulated in complete medium containing 500 IIJ / mL IL-2 + 10 ng / mL IL-21 for 72 hours. The stimulated NK cells were stained in staining solution containing Fixable Viability Dye eFluor 780, anti-CD56, clone 5.1 H11 , and anti-CD34 antibody, clone: QBEND / 10 (ThermoFisher, Waltham, MA) according to the manufacturer’s protocol. Flow cytometry was performed in CytoFlex (Beckman Coulter, Brea, CA) to access the RQR8 expression and viability. All data was analyzed by FlowJo (BD Biosciences, San Jose, CA) using the following gating strategy: FSC / SSC > Singlets (FSC-width / SSC) > Viable (R780dim) > CD56+.

[0146] As shown in Figure 5, the SOCS3-aCD19 CAR knock-in efficiency was 34.6 ± 12.0% across four independent donors. A low level of integration efficiency was observed in one of four donors. Integration of aCD19 CAR into SOCS3 locus was robust.

[0147] The methods provided in Example 4 will be repeated using other CAR and / or CAR / cytokine constructs (e.g., pAAV-SOCS3-GSG-T2A-CD33CARgen2-BGH; pAAV-SOCS3- GSG-T2A-CD33CARgen2-P2A-slL2-BGH; pAAV-SOCS3-GSG-T2A-CD33CARgen2-P2A- SIL15-BGH; pAAV-SOCS3-GSG-T2A-CD33CARgen2-P2A-slL21).Example 6 - Functional analysis of SOCS3-CAR NK cells

[0148] Raji cells were maintained in complete medium. NK cells were engineered using the MaxCyte method described above in Example 2 and then transduced with AAV6-SOCS3-GSG- T2A-CD19CAR-P2A-RQR8-BGH. After 7 days expansion, the edited NK cells were centrifuged and resuspended in complete medium containing 10 lll / mL IL-2 to allow cool-off for 48 hours. Forty-eight hours later, the NK cells were stimulated in complete medium containing 500 lll / mL IL-2 + 10 ng / mL IL-21 for 72 hours. The stimulated NK cells and Raji cells were pelleted and resuspended in freshly prepared complete medium containing 500 IIJ / mL IL-2 + 10 ng / mL IL-21 to cell density of 1 x 106 cells / mL. To initiate the intracellular cytokine staining (ICS) assay, 1 x 105 NK cells (100 pL) were co-cultured with 1 x 105 Raji cells (100 pL) in a 96-well plate at 37°C for 10 mins. After 10 mins, 2 pL of anti-CD107a antibody, clone H4A3 (BD Bioscience, San Jose, CA) was added into each well. The plate was then incubated at 37°C for 1 hour. Protein transport blocking solution was prepared by diluting 1 pL of Brefeldin A and 1 pL of Monensin in 1 mL of complete medium containing 500 IIJ / mL IL-2 + 10 ng / mL IL-21. Twenty pL of protein transport blocking solution was then added into each well. The plate was incubated at 37°C for another 3 hours and then 4°C refrigerator overnight. After overnight incubation, the cells were centrifuged, stained in staining solution containing Fixable Viability Dye eFluor 780 and anti-CD34 antibody, clone: QBEND / 10 and then fix-permeabilized by Cytofix / Cytoperm Fixation / Permeablization solution kit (BD Bioscience, San Jose, CA) per the manufacturer’s protocols. The fixed / permeablized cells were stained in anti-IFNy antibody (ThermoFisher, Waltham, MA) solution according to the manufacture’s protocol and proceeded to flow cytometry analysis. Flow cytometry was performed in CytoFlex (Beckman Coulter, Brea, CA) to access the RQR8 expression, CD107a degranulation, IFNy secretion, and viability. All data was analyzed by FlowJo (BD Biosciences, San Jose, CA) using the following gating strategy: FSC / SSC > Singlets (FSC-width / SSC) > Viable (R780dim) > CD56+.

[0149] As shown in Figure 6, there is no significant difference in degranulation and IFNy secretion ability between the MOCK, Cas9, and SOCS3 KO groups. In the SOCS3-aCD19 CAR KI group, the CAR neg (RQR8-) group shows similar results as the three control groups, and the CAR pos (RQR8+) group shows significant enhancement of degranulation and IFNy secretion compared to other groups. The expression of synthetic aCD19 CAR construct driven by SOCS3 promoter significantly improves the degranulation and IFNy secretion ability of NK cells.

Claims

What is claimed is:

1. A vector comprising (i) a first polynucleotide sequence encoding a chimeric antigen receptor (CAR), and (ii) a second polynucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA targets the SOCS3 gene in an immune cell.

2. The vector of claim 2, wherein the guide RNA targets a region within exon 2 of the SOCS3 gene in an immune cell.

3. The vector of claim 1 or claim 2, wherein the chimeric antigen receptor comprises an antigen binding domain that binds to a tumor antigen.

4. The vector of claim 3, wherein the tumor antigen is CD33, CD19, Meso, Her2, CD133, Muc1 , PSMA, FAP, GD2, BCMA, BAFF, or BAFFR.

5. The vector of any one of claims 1-4, wherein the chimeric antigen receptor comprises an intracellular domain of a costimulatory molecule, wherein the costimulatory molecule is CD27, CD28, 4-1 BB, 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function- associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, or B7-H3.

6. The vector of any one of claims 1-5, further comprising a nucleotide encoding a cytokine.

7. The vector of claim 6, wherein the cytokine is IL-2, IL-15, IL-21, IL-7, IL-18 and membrane-bound IL-21 (mblL-21).

8. A vector comprising (i) a first polynucleotide sequence encoding a cytokine, and (ii) a second polynucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA targets a SOCS3 gene in an immune cell.

9. The vector of claim 8, wherein the guide RNA targets a region within exon 2 of the SOCS3 gene in an immune cell.

10. The vector of claim 9, wherein the cytokine is IL-2, IL-15, IL-21, IL-7, IL-18 and membrane-bound IL-21 (mblL-21),11. The vector of any one of claims 8-10, further comprising a nucleotide encoding a chimeric antigen receptor (CAR).

12. The vector of claim 11, wherein the chimeric antigen receptor comprises an antigen binding domain that binds to a tumor antigen.3513. The vector of claim 12, wherein the tumor antigen is CD33, CD19, Meso, Her2, CD133, Muc1 , PSMA, FAP, GD2, BCMA, BAFF, or BAFFR.

14. The vector of any one of claims 11-13 wherein the chimeric antigen receptor comprises an intracellular domain of a costimulatory molecule, wherein the costimulatory molecule is CD27, CD28, 4-1 BB, 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function- associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, or B7-H3.

15. The vector of any one of claims 1-14, wherein the guide RNA comprises a nucleotide sequence set forth in SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.

16. The vector of any one of claims 1-15, wherein the guide RNA comprises a nucleotide sequence set forth in SEQ ID NO: 5.

17. A vector comprising a nucleotide sequence encoding a guide RNA set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.

18. The vector of claim 1 further comprising a nucleotide sequence encoding a Cas9 DNA endonuclease.

19. The vector of any one of claims 1-18, that is a viral vector.

20. The vector of any one of claims 1-19, that is an AAV vector.

21. The vector of claim 20, wherein the vector is AAV6.

22. The vector of any one of claims 1-21, that is formulated in a lipid nanoparticle.

23. A pharmaceutical composition comprising the vector of any one of claims 1-20 and a pharmaceutically acceptable carrier.

24. One or more guide ribonucleic acids (gRNAs) comprising a spacer sequence set forth in one or more of SEQ ID NOs: 1 , 2, 3, 4 or 5.

25. The one or more gRNAs of claim 24, wherein the one or more gRNAs are one or more single-molecule guide RNAs (sgRNAs).

26. The one or more gRNAs or sgRNAs of claim 22, wherein the one or more gRNAs or one or more sgRNAs is one or more modified gRNAs or one or more modified sgRNAs.

27. A pharmaceutical composition comprising the one or more gRNAs of claims 24- 26 and a pharmaceutically acceptable carrier.3628. A method of producing an engineered immune cell, comprising:(a) introducing into an immune cell a guide RNA that targets exon 2 of the SOCS3 gene in the immune cell and a site-directed DNA endonuclease capable of inducing a genetic disruption within exon 2 of gene the immune cell, and(b) introducing an exogenous transgene into the SOCS3 locus of the immune cell, thereby producing an engineered immune cell.

29. The method of claim 28, wherein the site-directed DNA endonuclease is Cas9.

30. The method of claim 28 or claim 29, wherein the genetic disruption comprises a double-stranded break (DSB) within exon 2 of the SOCS3 gene in the immune cell, which results in deletion of the SOCS3 gene.

31. The method of any one of claims 28-30, wherein the guide RNA comprises a nucleotide sequence set forth in SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.

32. The method of any one of claims 28-31 , wherein the guide RNA comprises a nucleotide sequence set forth in SEQ ID NO: 5.

33. The method of any one of claims 28-32, wherein the exogenous transgene is a chimeric antigen receptor (CAR).

34. The method of claim 33, wherein the chimeric antigen receptor comprises an antigen binding domain that binds to a tumor antigen.

35. The method of claim 34, wherein the tumor antigen is CD33, CD19, Meso, Her2, CD133, Muc1 , PSMA, FAP, GD2, BCMA, BAFF, or BAFFR.

36. The method of any one of claims 33-35, wherein the chimeric antigen receptor comprises an intracellular domain of a costimulatory molecule, wherein the costimulatory molecule is CD27, CD28, 4-1 BB, 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function- associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, or B7-H3.

37. The method of any one of claim 28-36, wherein the immune cell is a T cell.

38. The method of any one of claims 28-36, wherein the immune cell is a natural killer T cell.

39. The method of any one of claims 38-36, wherein the immune cell is a natural killer cell.

40. A system for introducing a deletion of the SOCS3 gene in an immune cell, the system comprising:(i) one or more site-directed DNA endonucleases;(ii) one or more ribonucleic acids (gRNAs) comprising a spacer sequence corresponding to a target sequence within exon 2 of the SOCS3 gene; and(iii) a nucleotide sequence encoding an exogenous transgene; wherein when the one or more gRNAs is introduced to the cell with the one or more site- directed DNA endonucleases, the one or more gRNAs combine with the site-directed DNA endonuclease to induce double-stranded breaks (DSBs) within exon 2 of the SOCS3 gene, thereby deleting the SOCS3 gene from the immune cell and introducing the exogenous transgene into the SOCS3 locus of the immune cell.

41. The system of claim 40, wherein the one or more site-directed DNA endonucleases is a Cas9 endonuclease.

42. The system of claim 40 or claim 41, wherein the guide RNA comprises a nucleotide sequence set forth in SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.

43. The system of any one of claims 40-42, wherein the guide RNA comprises a nucleotide sequence set forth in SEQ ID NO: 5.

44. The system of any one of claims 40-43, wherein the exogenous transgene is a chimeric antigen receptor (CAR).

45. The system of claim 44, wherein the chimeric antigen receptor comprises an antigen binding domain that binds to a tumor antigen.

46. The system of claim 45, wherein the tumor antigen is CD33, CD19, Meso, Her2, CD133, Muc1 , PSMA, FAP, GD2, BCMA, BAFF, or BAFFR.

47. The system of any one of claims 44-46, wherein the chimeric antigen receptor comprises an intracellular domain of a costimulatory molecule, wherein the costimulatory molecule is CD27, CD28, 4-1 BB, 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function- associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, or B7-H3.

48. The system of any one of claims 40-47, wherein the immune cell is a T cell.

49. The system of any one of claims 40-47, wherein the immune cell is a natural killer T cell.

50. The system of any one of claims 40-47, wherein the immune cell is a natural killer cell.

51. The system of any one of claims 40-50, wherein the system comprises a recombinant expression vector comprising (i) a nucleotide sequence encoding the site-directed DNA endonuclease, (ii) a nucleotide sequence encoding the one or more gRNAs, and (iii) a nucleotide sequence encoding the exogenous transgene.

52. The system of any one of claims 40-51 , wherein the system comprises a first recombinant expression vector comprising a nucleotide sequence encoding the site-directed DNA endonuclease and a second recombinant expression vector comprising (i) a nucleotide sequence encoding the one or more gRNA and (ii) a nucleotide sequence encoding the exogenous transgene.

53. The system of claim 51 or claim 52, wherein the vector is a viral vector.

54. The system of claim 53, wherein the viral vector is an adeno-associated viral (AAV) vector.

55. An immune cell comprising an exogenous transgene operably linked to a SOCS3 promoter.

56. The immune cell of claim 56, that is a T cell.

57. The immune cell of claim 55 or claim 56, that is a natural killer T cell.

58. The immune cell of claim 56, that is a natural killer (NK) cell.

59. The immune cell of any one of claims 55-58, wherein the exogenous transgene encodes a chimeric antigen receptor (CAR).

60. The immune cell of claim 59, wherein the chimeric antigen receptor comprises an antigen binding domain that binds to a tumor antigen.

61. The immune cell of claim 60, wherein the tumor antigen is CD33, CD19, Meso, Her2, CD133, Muc1 , PSMA, FAP, GD2, BCMA, BAFF, or BAFFR.

62. The immune cell of any one of claims 59-61 , wherein the chimeric antigen receptor comprises an intracellular domain of a costimulatory molecule, wherein the39costimulatory molecule is CD27, CD28, 4-1 BB, 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, or B7-H3.40

Images