Simultaneous quantification of BK virus and cytomegalovirus in sample

Abstract

The present invention relates to a multiplexing assay method for the quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample. According to the present invention, BKV and CMV in a sample can be simultaneously quantified by one reaction, thereby reducing inspection costs such as a reduction in the amount of the sample, a reduction in inspection time, and a reduction in inspection equipment and administration manpower. In addition, the oligonucleotide set used in the method of the present invention enables more accurate diagnosis of BKV and CMV with high sensitivity and specificity. Furthermore, the method of the present invention can increase the diagnosis rate of opportunistic infection in kidney transplanted patients and contribute to the improvement of the survival rate of transplanted organs and patients in the long term.

Description

Simultaneous quantification method for BK virus and cytomegalovirus in samples

[0001] The present invention relates to a method for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample.

[0002]

[0003] Human polyomavirus type BK virus is a non-enveloped virus with a circular, double-stranded DNA genome of approximately 5,300 bp. The genome encodes three capsid structural proteins, namely viral capsid protein 1 (VP1), VP2, and VP3, as well as the large T and small T antigens.

[0004] The BK virus was first isolated in 1971 from urine from a patient with ureteral stenosis (BK) after a kidney transplant. Although BK virus infection is widespread, infected individuals are typically asymptomatic or present with only mild symptoms (e.g., respiratory infection or fever). After initial infection, BK virus typically remains latent in urothelium and renal tubular epithelial cells. It is estimated that more than 80% of the population harbors this latent form of the virus.

[0005] However, the symptoms of BK virus infection in immunosuppressed and / or immunocompromised individuals can be quite severe, for example, in the setting of organ transplantation. In organ transplantation, clinical manifestations may include renal dysfunction and the presence of renal tubular cells and inflammatory cells in the urine. Specifically, in the setting of immunosuppression and / or immunocompromise, BK virus reactivates and replicates, triggering a cascade of events beginning with tubular cell lysis and viruria. BK virus then amplifies in the interstitium and crosses the peritubular capillaries, causing viremia and ultimately invading the allograft, resulting in various tubulointerstitial lesions and BK virus nephrophathy (BKVN). BK virus significantly increases the risk of graft loss. BK virus is an opportunistic viral infection after transplantation, affecting approximately 15% of kidney transplant recipients in the first year. If left untreated, BKVN will progress to allograft failure.

[0006] Although immunosuppression and / or immunocompromise are major risk factors for BK virus infection, other risk factors include male sex, older age, previous rejection episodes, human leukocyte antigen mismatch, prolonged cold ischemia, BK serostatus, and ureteral stent placement. Treatment options for patients with symptomatic BK virus infection are limited, and effective prophylaxis is not available. The cornerstone of treatment is reducing immunosuppression, which increases the risk of allograft rejection. Antiviral medications are used, but the results are inconsistent. BK virus is currently recognized as a major cause of interstitial nephritis and allograft failure in kidney transplant recipients.

[0007] BK virus infection is diagnosed by a blood test for BK virus or a urine test for decoy cells. The presence of decoy cells, although a sensitive indicator, has a low positive predictive value for the diagnosis of BKVN (see Mbianda et al. Journal of Clinical Virology 71:59-62 (2015)). Quantifying viral load in plasma and urine using DNA or mRNA has been used to diagnose BKVN. However, transplant kidney biopsy remains the gold standard for diagnosing BKVN. However, transplant kidney biopsy is a time-consuming, invasive, and cumbersome procedure.

[0008]

[0009] Cytomegalovirus (CMV) is a ubiquitous herpes-like virus with a linear, double-stranded DNA genome of approximately 236,000 kb. CMV infects 40-80% of humans before puberty. CMV remains latent after primary infection and is often asymptomatic. Even reinfection is often asymptomatic or causes only mild disease in immunocompetent hosts. However, in immunocompromised individuals, such as congenitally infected infants, allogeneic transplant recipients, or those with autoimmune deficiency syndrome (AIDS), CMV can cause serious and sometimes life-threatening diseases, such as retinitis, gastrointestinal disorders, and encephalitis. Half of allogeneic stem cell recipients develop CMV infection within 100 days of transplantation. CMV end-organ disease is a serious and frequent complication of allogeneic stem cell transplantation.

[0010] Early and sensitive diagnosis is very important, as early administration of antiviral drugs (e.g., ganciclovir and foscarnet) can have a significant beneficial effect on the patient's prognosis.

[0011] Various methods are used to analyze CMV. Anti-CMV antibodies, particularly IgM antibodies, can be used as markers for CMV infection. However, the detection of anti-CMV antibodies is limited in distinguishing between latent and active infection.

[0012] Most current viral detection methods cannot definitively predict whether an infection will result in symptoms. Serological methods are indirect and often lack sensitivity. Viral culture, such as viral culture from blood cells, is a more direct diagnostic parameter for CMV viremia, but these methods are technically difficult and time-consuming. Furthermore, viral culture does not necessarily correspond to CMV disease. Isolation of the virus from peripheral leukocytes may not predict clinical symptoms in some immunosuppressed patients.

[0013]

[0014] As previously mentioned, while most healthy adults have low levels of BK virus and CMV, these viruses can be activated or opportunistically infected, resulting in elevated levels in kidney transplant recipients, especially during immunosuppressive therapy. Therefore, there is a need in the art for a rapid, reliable, and sensitive method for simultaneously quantifying BK virus and CMV in biological samples.

[0015]

[0016] Numerous references and patents are cited and cited throughout the specification. The disclosures of these references and patents are incorporated herein by reference in their entirety to further clarify the state of the art and the scope of the invention.

[0017]

[0018] The present inventors sought to develop a novel method capable of simultaneously quantifying BKV and CMV in a sample with improved sensitivity and specificity. As a result, the present inventors confirmed that a method utilizing a first set of oligonucleotides hybridizing to the VP2 gene of BKV and a second set of oligonucleotides hybridizing to the UL55 gene of CMV can effectively simultaneously quantify BKV and CMV in a sample in a single reaction.

[0019] Accordingly, an object of the present invention is to provide a method for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample.

[0020] Another object of the present invention is to provide a composition for a method for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample.

[0021] Other objects and advantages of the present invention will become more apparent from the detailed description below taken together with the appended claims.

[0022]

[0023] In one aspect of the present invention, a method for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample is provided, comprising the following steps:

[0024] (a) performing a nucleic acid amplification reaction comprising contacting a sample in a single reaction vessel with a first set of oligonucleotides hybridizable to the VP2 gene of BKV and a second set of oligonucleotides hybridizable to the UL55 gene of CMV, wherein the nucleic acid amplification reaction generates a first amplification curve representing amplification of the VP2 gene of BKV in the sample and a second amplification curve representing amplification of the UL55 gene of CMV in the sample; and

[0025] (b) determining the amount of BKV in the sample by comparing the first amplification curve generated above with a standard curve generated from a reference sample containing a known amount of the VP2 gene, and determining the amount of CMV in the sample by comparing the second amplification curve generated above with a standard curve generated from another reference sample containing a known amount of the UL55 gene.

[0026] In certain embodiments, the first oligonucleotide set comprises a plurality of oligonucleotides hybridizable to the nucleotide sequence of SEQ ID NO: 1 or a complement thereof.

[0027] In certain embodiments, at least one of the plurality of oligonucleotides has 1-3 deoxyinosines; one or two of the deoxyinosines are located in a core region ranging from the 3rd nucleotide at the 3'-end to the 6th nucleotide at the 3'-end of the oligonucleotide, and the remainder are located in a region ranging from the 4th nucleotide at the 5'-end to the 7th nucleotide at the 3'-end of the oligonucleotide.

[0028] In certain embodiments, the first oligonucleotide set does not comprise an oligonucleotide hybridizable to the genomic sequence of JC virus or simian virus 40.

[0029] In certain embodiments, the first oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 2 and a primer having the nucleotide sequence of SEQ ID NO: 3.

[0030] In certain embodiments, the first oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 4.

[0031] In certain embodiments, the probe comprises a detectable fluorescent label and a quenching moiety capable of quenching a signal from the fluorescent label.

[0032] In certain embodiments, the second oligonucleotide set comprises a plurality of oligonucleotides hybridizable to the nucleotide sequence of SEQ ID NO: 5 or a complement thereof.

[0033] In certain embodiments, at least one of the plurality of oligonucleotides has 1-3 deoxyinosines; one or two of the deoxyinosines are located in a core region ranging from the 3rd nucleotide at the 3'-end to the 6th nucleotide at the 3'-end of the oligonucleotide, and the remainder are located in a region ranging from the 4th nucleotide at the 5'-end to the 7th nucleotide at the 3'-end of the oligonucleotide.

[0034] In certain embodiments, the second oligonucleotide set does not comprise an oligonucleotide hybridizable to the genomic sequence of herpes simplex virus 1, human herpesvirus 2, human herpesvirus 4, human herpesvirus 6B, human herpesvirus 6, or human herpesvirus 7 virus.

[0035] In certain embodiments, the second oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 6 and a primer having the nucleotide sequence of SEQ ID NO: 7.

[0036] In certain embodiments, the second oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 8.

[0037] In certain embodiments, the probe comprises a detectable fluorescent label and a quenching moiety capable of quenching a signal from the fluorescent label.

[0038] In certain embodiments, the nucleic acid amplification reaction is a real-time PCR or an isothermal amplification reaction.

[0039] In a specific embodiment, the reference samples containing the VP2 gene of the base are each 10 1copies / uL to 10 10 3 or more containing the selected amount from copies / uL.

[0040] In a specific embodiment, another reference sample containing the UL55 gene of the base is 10 1 copies / uL to 10 10 3 or more containing the selected amount from copies / uL.

[0041] In certain embodiments, the sample is whole blood, plasma or serum collected from a subject who has received a kidney transplant.

[0042] In certain embodiments, the subject is less than one year post-renal transplant.

[0043] In certain embodiments, the sample has a volume of 5 to 15 ul, and the total volume of the nucleic acid amplification reaction is 20 to 30 ul.

[0044] In another aspect, the present invention provides a composition for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample, comprising:

[0045] (a) a first set of oligonucleotides hybridizable to the VP2 gene of BKV;

[0046] (b) a second set of oligonucleotides hybridizable to the UL55 gene of CMV; and

[0047] (c) A reagent for nucleic acid amplification comprising a polymerase, dNTPs, and a buffer.

[0048] In certain embodiments, the composition further comprises a reference sample containing a known amount of the VP2 gene and another reference sample containing a known amount of the UL55 gene.

[0049] In certain embodiments, the first oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 2 and a primer having the nucleotide sequence of SEQ ID NO: 3.

[0050] In certain embodiments, the first oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 4.

[0051] In certain embodiments, the second oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 6 and a primer having the nucleotide sequence of SEQ ID NO: 7.

[0052] In certain embodiments, the second oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 8.

[0053]

[0054] The method of the present invention can simultaneously quantify BKV and CMV in a sample in a single reaction, thereby reducing testing costs through reduced sample volume, shortened testing time, and reduced testing equipment and administration personnel. Furthermore, the oligonucleotide set used in the method of the present invention enables more accurate diagnosis of BKV and CMV with high sensitivity and specificity. Furthermore, the method of the present invention can increase the diagnosis rate of opportunistic infections in kidney transplant patients and contribute to improved long-term survival rates of both transplant recipients and patients.

[0055]

[0056] I. Simultaneous quantitative method

[0057] In one aspect, the present invention provides a method for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample, comprising the following steps:

[0058] (a) performing a nucleic acid amplification reaction comprising contacting a sample in a single reaction vessel with a first set of oligonucleotides hybridizable to the VP2 gene of BKV and a second set of oligonucleotides hybridizable to the UL55 gene of CMV, wherein the nucleic acid amplification reaction generates a first amplification curve representing amplification of the VP2 gene of BKV in the sample and a second amplification curve representing amplification of the UL55 gene of CMV in the sample; and

[0059] (b) determining the amount of BKV in the sample by comparing the first amplification curve generated above with a standard curve generated from a reference sample containing a known amount of the VP2 gene, and determining the amount of CMV in the sample by comparing the second amplification curve generated above with a standard curve generated from another reference sample containing a known amount of the UL55 gene.

[0060]

[0061] Hereinafter, the contents of the present disclosure are described in more detail for each step:

[0062]

[0063] Step (a): Performing the nucleic acid amplification reaction

[0064] In step (a) of the present disclosure, a nucleic acid amplification reaction is performed for target nucleic acids of BKV and CMV.

[0065] Specifically, a nucleic acid amplification reaction is performed comprising contacting a sample in a single reaction vessel with a first set of oligonucleotides hybridizable to the VP2 gene of BKV and a second set of oligonucleotides hybridizable to the UL55 gene of CMV.

[0066] According to the method of the present invention, the process for amplifying the target nucleic acid of BKV and the process for amplifying the target nucleic acid of CMV occur simultaneously in a single reaction vessel, and the results of both are provided simultaneously. Therefore, the method of the present invention is also referred to by terms such as "multiplex analysis," "multiplex reaction," and "multiplex amplification."

[0067] The term "vessel" (container, carrier) or "reaction vessel" as used herein refers to a physical compartment or space that houses the components used in the nucleic acid amplification reaction for BKV and CMV.

[0068] Non-limiting examples of the above containers include tubes, plates, etc. The containers may be sealed, for example, by a cap or by a film through a suitable sealing machine.

[0069] In certain embodiments, a “single reaction vessel” is one well in a well plate, such as a 48-well plate, a 96-well plate, a 192-well plate, or a 384-well plate.

[0070] The term "sample" as used herein may mean any analyte that contains or is suspected of containing a nucleic acid to be detected. For example, the sample includes biological samples (e.g., cells, tissues, and body fluids) and non-biological samples (e.g., food, water, and soil), and the biological sample may be, but is not limited to, viruses, bacteria, tissues, cells, blood (including whole blood, plasma, and serum), lymph, bone marrow fluid, saliva, sputum, swabs, aspirations, milk, urine, feces, eye fluid, semen, brain extracts, spinal fluid, joint fluid, thymus fluid, bronchial washings, ascites, or amniotic fluid.

[0071] According to one embodiment, the sample may be obtained from a subject, particularly a mammal, more particularly a human, and may be, for example, but not limited to, a swab, saliva, sputum, aspiration, bronchoalveolar lavage (BAL), gargle, or blood.

[0072] In certain embodiments, the sample is whole blood, plasma or serum.

[0073] The sample may be derived from a subject. As used herein, the term "subject" refers to a subject suspected of being infected with BKV and / or CMV, the pathogen from which the target nucleic acid to be analyzed using the method of the present disclosure is derived, or a subject requiring testing or diagnosis of the pathogen. Examples of the subject include, but are not limited to, mammals such as dogs, cats, rodents, primates, and humans, and particularly humans.

[0074] In certain embodiments, the subject is a subject who has received a kidney transplant. In more specific embodiments, the subject is a subject who has received a kidney transplant less than one year ago.

[0075] In the context of the above subject, the sample may be whole blood, plasma or serum collected from a subject who has received a kidney transplant, or whole blood, plasma or serum collected from a subject who has received a kidney transplant less than one year ago.

[0076] According to one embodiment, the sample may undergo a nucleic acid extraction and / or purification process known in the art for efficient amplification reaction (see Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)). The nucleic acid extraction and / or purification process may vary depending on the type of sample.

[0077]

[0078] The terms "nucleic acid", "nucleic acid sequence" or "nucleic acid molecule" as used herein mean a deoxyribonucleotide or ribonucleotide polymer in single-stranded or double-stranded form, which nucleotides may include derivatives of natural nucleotides, non-natural nucleotides or modified nucleotides that can function in the same manner as naturally occurring nucleotides.

[0079] As used herein, the terms "target nucleic acid," "target nucleic acid sequence," or "target sequence" refer to a nucleic acid sequence to be detected. The target nucleic acid includes both newly generated nucleic acids in the reaction and those initially present in the sample.

[0080] The target nucleic acid herein includes a target nucleic acid from BKV and a target nucleic acid from CMV, both of which are double-stranded DNA. These double-stranded target nucleic acids can be separated into single-stranded or partially single-stranded forms for use in the methods of the present invention. Known methods for separating the strands include, but are not limited to, heating, alkali, formamide, urea, and glycoxal treatment, enzymatic methods (e.g., helicase action), and binding proteins. For example, strand separation can be achieved by heating at a temperature in the range of 80°C to 105°C. A general method for achieving such treatment is provided by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001).

[0081] In one embodiment, there are two target nucleic acids, one of which is a nucleic acid from BK virus (BKV) and the other is a nucleic acid from cytomegalovirus (CMV).

[0082] In certain embodiments, there are two target nucleic acids, one of which is the VP2 gene of BKV or a portion thereof, and the other is the UL55 gene of CMV or a portion thereof.

[0083] In certain embodiments, the target nucleic acids are two, one of which has a sequence from nucleotide 624 to nucleotide 1679 of the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence from nucleotide 624 to nucleotide 1679 of the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more. A sequence having at least 90% identity, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, to the sequence from nucleotide 82066 to nucleotide 84789 in the CMV whole genome under NC_006273.

[0084] In certain embodiments, the target nucleic acids are two, one of which has a sequence from nucleotide 948 to nucleotide 1108 of the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence from nucleotide 948 to nucleotide 1108 of the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more. A sequence having at least 90% identity, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, to the sequence from nucleotide 82871 to nucleotide 83019 in the CMV whole genome under NC_006273.

[0085] In other words, there are two target nucleic acids, one of which has a sequence from the 325th nucleotide to the 485th nucleotide in the VP2 gene of the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other has a sequence from the 325th nucleotide to the 485th nucleotide in the VP2 gene of the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more. A sequence having at least 90% identity, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, to the sequence from nucleotide 806 to nucleotide 954 in the UL55 gene of the CMV whole genome under NC_006273.

[0086] In certain embodiments, the target nucleic acids are two, one of which has a sequence from nucleotide 948 to nucleotide 1108 of the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence from nucleotide 948 to nucleotide 1108 of the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more. A sequence having at least 90% identity, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, to the sequence from nucleotide 82871 to nucleotide 83019 in the CMV whole genome under NC_006273.

[0087] In certain embodiments, the target nucleic acids are two, one of which has a sequence comprising any one nucleotide selected from the group consisting of the 748th nucleotide to the 948th nucleotide in the BKV whole genome under Genbank Accession No. NC_001538 to any one nucleotide selected from the group consisting of the 1108th nucleotide to the 1308th nucleotide, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence comprising any one nucleotide selected from the group consisting of the 748th nucleotide to the 948th nucleotide in the BKV whole genome under Genbank Accession No. NC_001538 to the 1108th nucleotide to the 1308th nucleotide, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more. A sequence comprising any one nucleotide selected from the group consisting of the 82671st nucleotide to the 82871st nucleotide in the CMV whole genome under NC_006273 to any one nucleotide selected from the group consisting of the 83019th nucleotide to the 83219th nucleotide, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.

[0088] In certain embodiments, the target nucleic acids are two, one of which has a sequence comprising any one nucleotide selected from the group consisting of nucleotide 848 to nucleotide 948 in the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence comprising any one nucleotide selected from the group consisting of nucleotide 848 to nucleotide 948 in the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more. A sequence comprising any one nucleotide selected from the group consisting of the 82771st nucleotide to the 82871st nucleotide in the CMV whole genome under NC_006273 to any one nucleotide selected from the group consisting of the 83019th nucleotide to the 83119th nucleotide, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.

[0089] In certain embodiments, the target nucleic acids are two, one of which has a sequence comprising any one nucleotide selected from the group consisting of nucleotide 898 to nucleotide 948 in the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence comprising any one nucleotide selected from the group consisting of nucleotide 898 to nucleotide 948 in the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more. A sequence comprising any one nucleotide selected from the group consisting of nucleotides 82821 to 82871 to any one nucleotide selected from the group consisting of nucleotides 83019 to 83069 in the CMV whole genome under NC_006273, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.

[0090] In certain embodiments, the target nucleic acids are two, one of which has the nucleotide sequence of SEQ ID NO: 1, or a sequence having at least 90%, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity thereto, and the other of which has the nucleotide sequence of SEQ ID NO: 5, or a sequence having at least 90%, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity thereto.

[0091] In certain embodiments, there are two target nucleic acids, one of which has the nucleotide sequence of SEQ ID NO: 1 and the other of which has the nucleotide sequence of SEQ ID NO: 5.

[0092]

[0093] The present inventors confirmed that among the various genes of BKV, targeting the VP2 gene, particularly the nucleotide sequence of SEQ ID NO: 1, enables the quantification of BKV with the highest specificity and sensitivity. In addition, the present inventors confirmed that among the various genes of CMV, targeting the UL55 gene, particularly the nucleotide sequence of SEQ ID NO: 5, enables the quantification of CMV with the highest specificity and sensitivity (data not shown).

[0094] Although specific sequences of the VP2 gene of BKV and specific sequences of the UL55 gene of CMV are mentioned herein, it should be understood that the sequences are merely exemplified sequences analyzed by the oligonucleotide set according to the present invention, and that various sequences of the VP2 and UL55 genes of subtypes or variants of BKV and CMV are included in the target nucleic acids mentioned herein.

[0095]

[0096] In the method of the present invention, a composition for detecting a target nucleic acid of BKV and a composition for detecting a target nucleic acid of CMV are used for simultaneous quantification of target nucleic acids from BKV and CMV.

[0097] The composition for detecting the target nucleic acid of BKV is specific to the target nucleic acid of BKV, i.e., the VP2 gene, and the composition for detecting the target nucleic acid of CMV is specific to the target nucleic acid of CMV, i.e., UL55.

[0098] The phrase "the composition for detecting a target nucleic acid is specific for a target nucleic acid" herein means that the composition for detecting a target nucleic acid is involved in detecting the target nucleic acid, but is not involved in detecting other nucleic acids. In other words, the phrase means that the composition for detecting a target nucleic acid interacts with the target nucleic acid, but does not interact with other nucleic acids.

[0099] In the present invention, the composition for detecting the target nucleic acid of BKV is specific for the target nucleic acid of BKV but non-specific for the target nucleic acid of CMV, and the composition for detecting the target nucleic acid of CMV is specific for the target nucleic acid of CMV but non-specific for the target nucleic acid of BKV.

[0100] The composition for detecting target nucleic acid of BKV and the composition for detecting target nucleic acid of CMV used in the present invention are used together in one reaction and therefore exist together in one reaction solution or reaction vessel.

[0101] The term "composition for detecting a target nucleic acid" as used herein means a composition containing components used for detecting a target nucleic acid.

[0102] Examples of components included in the composition for detecting the target nucleic acid include, but are not limited to, an oligonucleotide set used to amplify or detect the target nucleic acid, a label, a nucleic acid polymerase, a buffer, a polymerase cofactor, and dNTPs. Optionally, the composition for detecting the target nucleic acid may include various additional components, such as a substance for promoting the reaction, a molecule for inhibiting the nucleic acid polymerase activity, a molecule for preventing contamination, and the like. In addition, the composition for detecting the target nucleic acid may include oligonucleotides or reagents necessary for performing a positive control, negative control, or internal control reaction. In addition, the composition for detecting the target nucleic acid may include a reference sample containing a known amount of a standard target nucleic acid for absolute quantification.

[0103] The optimal amount of each component used in the method of the present invention can be readily determined by one skilled in the art having the benefit of the present disclosure.

[0104] The components of the composition for detecting the target nucleic acid may be stored together in one container before the reaction or may be stored separately in multiple containers.

[0105] According to the method of the present invention, a composition for detecting a target nucleic acid of BKV comprises a first oligonucleotide set capable of hybridizing to the VP2 gene of BKV.

[0106] In certain embodiments, the first oligonucleotide set comprises a plurality of oligonucleotides hybridizable to the nucleotide sequence of SEQ ID NO: 1 or a complement thereof: 5'-GTTTCCACTGTAGGCCTCTATCAGCAATCAGGCATGGCTTTGGAATTGTTTAACCCAGATGAGTACTATGATATTCTGTTTCCTGGTGTAAATACTTTTGTTAATAATATTCAATACCTTGATCCTAGGCATTGGGGTCCTTCTTTGTTTGCTACTATTTC-3' (SEQ ID NO: 1). The nucleotide sequence of SEQ ID NO: 1 is a representative example of a conserved region in the VP2 gene of BKV.

[0107] In a specific embodiment, at least one of the plurality of oligonucleotides included in the first oligonucleotide set has 1-3 deoxyinosines; one or two of the deoxyinosines are located in a core region ranging from the 3rd nucleotide at the 3'-end to the 6th nucleotide at the 3'-end of the oligonucleotide, and the remainder are located in a region ranging from the 4th nucleotide at the 5'-end to the 7th nucleotide at the 3'-end of the oligonucleotide.

[0108] It is known that designing some of the multiple oligonucleotides used in a multiplex amplification reaction to have a specific number of deoxyinosines at specific positions as described above suppresses the formation of non-specific amplification products, particularly primer dimers, in the reaction, reduces nucleic acid amplification efficiency, and facilitates the design of oligonucleotides (see International Patent Publication No. WO2018-124665).

[0109] The method of the present invention enables more effective detection of target nucleic acids by incorporating deoxyinosine into the oligonucleotides so that some or all of the oligonucleotides in the first oligonucleotide set satisfy the above-described requirements.

[0110] According to the method of the present invention, a composition for detecting a target nucleic acid of CMV comprises a second oligonucleotide set capable of hybridizing to the UL55 gene of CMV.

[0111] In certain embodiments, the second oligonucleotide set comprises a plurality of oligonucleotides hybridizable to the nucleotide sequence of SEQ ID NO: 5 or the complement thereof: 5'-CAGTACGGTCAACTGGGCGAGGACAACGAAATCCTGTTGGGCAACCACCGCACTGAGGAATGTCAGCTTCCCAGCCTCAAGATCTTCATCGCCGGGAACTCGGCCTACGAGTACGTGGACTACCTCTTCAAACGCATGATTGACCTCAG-3' (SEQ ID NO: 5). The nucleotide sequence of SEQ ID NO: 5 is a representative example of a conserved region within the UL55 gene of CMV.

[0112] In certain embodiments, at least one of the plurality of oligonucleotides included in the second oligonucleotide set has 1-3 deoxyinosines; one or two of the deoxyinosines are located in a core region ranging from the 3rd nucleotide at the 3'-end to the 6th nucleotide at the 3'-end of the oligonucleotide, and the remainder are located in a region ranging from the 4th nucleotide at the 5'-end to the 7th nucleotide at the 3'-end of the oligonucleotide.

[0113] For details regarding the inclusion of the above deoxyinosine, refer to the aforementioned International Patent Publication No. WO2018-124665.

[0114]

[0115] In one embodiment, each of the first oligonucleotide set and the second oligonucleotide set comprises a primer pair and a probe.

[0116] The term "primer" as used herein refers to an oligonucleotide that can act as an initiator of synthesis under conditions that induce the synthesis of a primer extension product complementary to a target nucleic acid (template), i.e., the presence of nucleotides and a polymerization agent such as DNA polymerase, and at suitable temperature and pH. The primer must be sufficiently long to prime the synthesis of the extension product in the presence of the polymerization agent. The appropriate primer length depends on several factors, such as temperature, application, and the source of the primer.

[0117] As used herein, the term "probe" refers to a single-stranded nucleic acid molecule comprising a portion or portions substantially complementary to a target nucleic acid. According to one embodiment of the present invention, the 3'-end of the probe is "blocked" to prevent its extension. Blocking can be achieved using conventional methods. For example, blocking can be accomplished by adding a chemical moiety, such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane-diol moiety, to the 3'-hydroxyl group of the last nucleotide. Alternatively, blocking can be accomplished by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide lacking a 3'-hydroxyl group, such as a dideoxynucleotide.

[0118] "Complementary" means sufficiently complementary to allow a primer or probe to selectively hybridize to a target nucleic acid sequence under given annealing or hybridization conditions, and includes both "substantially complementary" and "perfectly complementary," preferably perfectly complementary.

[0119] The term "substantially complementary" means that the oligonucleotide is sufficiently complementary to selectively hybridize to a template nucleic acid sequence under designated annealing or hybridization conditions, such that the annealed oligonucleotide can be extended by a polymerase to form a complementary copy of the template. Therefore, this term has a different meaning than "fully complementary" or related terms.

[0120] The term "non-complementary" as used herein means sufficiently non-complementary that a primer or probe does not selectively hybridize to a target nucleic acid sequence under specified annealing or hybridization conditions, and includes both the terms "substantially non-complementary" and "perfectly noncomplementary", preferably perfectly non-complementary.

[0121] The primer or probe may be single-stranded. The primer or probe comprises deoxyribonucleotides, ribonucleotides, or a combination thereof. The primer or probe used in the present invention may comprise naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides.

[0122] The term "annealing" or "priming" refers to the juxtaposition of an oligonucleotide or nucleic acid to a template nucleic acid, which causes a polymerase to polymerize the nucleotides to form a nucleic acid molecule complementary to the template nucleic acid or a portion thereof.

[0123] The term "hybridization" as used herein refers to the formation of a double-stranded polynucleotide through non-covalent bonding between complementary nucleotide sequences of two single-stranded polynucleotides under certain hybridization conditions.

[0124] The terms “annealing” and “hybridization” are not different and will be used interchangeably throughout this specification.

[0125]

[0126] In certain embodiments, the first oligonucleotide set according to the present invention does not comprise an oligonucleotide hybridizable to the genomic sequence of JC virus or simian virus 40.

[0127] The above JC virus and simian virus 40 are known to have high genetic homology with BKV. Therefore, oligonucleotides designed only considering the target sequence of BKV without considering the sequence with high genetic homology with BKV are likely to hybridize to the genome sequence from JC virus or simian virus 40, and may cause false positive results, for example, in samples in which JC virus or simian virus 40 is present but BKV is not present.

[0128] To prevent this, the first oligonucleotide set according to the present invention is designed taking into account the genome sequences of both JC virus and simian virus 40 so that it does not hybridize to the genome sequences of JC virus or simian virus 40.

[0129] In certain embodiments, the first oligonucleotide set comprises a primer having a nucleotide sequence of SEQ ID NO: 2 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto, and a primer having a nucleotide sequence of SEQ ID NO: 3 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto.

[0130] 5'-GTTTCCACTGTAGGCCTITATCAGIAATC-3' (SEQ ID NO: 2)

[0131] 5'-GAAATAGTAGCAAACAAIGAAGGACCICAA-3' (SEQ ID NO: 3).

[0132] As can be seen in the above sequence, the two primers can have deoxyinosine (indicated by 'I') incorporated at specific positions.

[0133] In calculating the homology, the deoxyinosine is considered to match the naturally occurring base opposite it in the alignment.

[0134] In certain embodiments, the first oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 2 and a primer having the nucleotide sequence of SEQ ID NO: 3.

[0135] In certain embodiments, the first oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 4 or a sequence having at least 90% homology thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology thereto:

[0136] 5'-TGGAATTGTTTAACCCAGATGAGTACTATGATAT-3' (SEQ ID NO: 4).

[0137] As can be seen from the above sequence, the probe does not contain deoxyinosine.

[0138] In certain embodiments, the first oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 4.

[0139] The first oligonucleotide set according to the present invention exhibits 100% target coverage for the VP2 gene sequences of 541 different subtypes and variants of BKV. Furthermore, the first oligonucleotide set according to the present invention does not detect the genomic sequences of the 47 strains listed in Table 3 herein. Thus, the first oligonucleotide set according to the present invention detects the target nucleic acid of BKV with high specificity.

[0140]

[0141] In certain embodiments, the second oligonucleotide set according to the present invention does not comprise an oligonucleotide hybridizable to the genomic sequence of a herpes simplex virus 1, human herpesvirus 2, human herpesvirus 4, human herpesvirus 6B, human herpesvirus 6, or human herpesvirus 7 virus.

[0142] The above herpes simplex virus 1, human herpesvirus 2, human herpesvirus 4, human herpesvirus 6B, human herpesvirus 6, and human herpesvirus 7 viruses are known to have high genetic homology with CMV. Therefore, an oligonucleotide designed only considering the target sequence of CMV without considering the sequences having high genetic homology with CMV is likely to hybridize to the genome sequence from the above herpesviruses, and may cause a false positive result, for example, for a sample in which the above herpesviruses are present but CMV is not present.

[0143] To prevent this, the first oligonucleotide set according to the present invention is designed in consideration of the genome sequences of all of the aforementioned herpesviruses so that it does not hybridize to the genome sequences of herpes simplex virus 1, human herpesvirus 2, human herpesvirus 4, human herpesvirus 6B, human herpesvirus 6, or human herpesvirus 7 viruses.

[0144] In certain embodiments, the second oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 6 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto, and a primer having the nucleotide sequence of SEQ ID NO: 7 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto:

[0145] 5'-CAGTACIGTCAACTGGGIGAGG-3' (SEQ ID NO: 6)

[0146] 5'-CTGAGGTIAATCATGCGTTTGAAIAGG-3' (SEQ ID NO: 7).

[0147] As can be seen in the above sequence, the two primers have deoxyinosine (indicated by 'I') incorporated at specific positions.

[0148] In calculating the homology, the deoxyinosine is considered to match the naturally occurring base opposite it in the alignment.

[0149] In certain embodiments, the second oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 6 and a primer having the nucleotide sequence of SEQ ID NO: 7.

[0150] In certain embodiments, the second oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 8 or a sequence having at least 90% homology thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology thereto:

[0151] 5'-CCACCGCACTGAGGAATGTCAG-3' (SEQ ID NO: 8).

[0152] As can be seen from the above sequence, the probe does not contain deoxyinosine.

[0153] In certain embodiments, the second oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 8.

[0154] The second oligonucleotide set according to the present invention exhibits substantially 100% target coverage for the UL55 gene sequences of 523 different subtypes and variants of CMV. Furthermore, the second oligonucleotide set according to the present invention does not detect the genomic sequences of the 47 strains listed in Table 4 herein. Thus, the second oligonucleotide set according to the present invention detects the target nucleic acid of CMV with high specificity.

[0155]

[0156] In certain embodiments, the composition for detecting a target nucleic acid of BKV according to the present invention, particularly the first oligonucleotide set, generates a signal from the fluorescent label in a manner dependent on the cleavage of an oligonucleotide that specifically hybridizes to the VP2 gene of BKV.

[0157] In certain embodiments, the composition for detecting a target nucleic acid of CMV according to the present invention, particularly the second oligonucleotide set, generates a signal from the fluorescent label in a manner dependent on the cleavage of an oligonucleotide that specifically hybridizes to the UL55 gene of CMV.

[0158] In particular, generation of signals by the first oligonucleotide set and the second oligonucleotide set can be achieved by hybridization of an oligonucleotide, e.g., a probe, to a target nucleic acid, followed by cleavage thereof.

[0159] Examples of such signal generation include, but are not limited to, TaqMan probe methods (U.S. Patent No. 5,210,015 and U.S. Patent No. 5,538,848).

[0160] For signal generation by the TaqMan probe method, a composition for detecting a target nucleic acid comprises a set of oligonucleotides including a primer pair and a probe, as well as a nucleic acid polymerase having 5'-nuclease activity. The probe hybridized to the target nucleic acid is cleaved during amplification of the target nucleic acid, thereby generating a signal indicating the presence of the target nucleic acid.

[0161] A specific example of generating a signal by the TaqMan probe method comprises the steps of: (a) hybridizing the target nucleic acid with a probe having a primer pair and an appropriate label (e.g., an interactive dual label); (b) amplifying the target nucleic acid using the product of step (a) and a nucleic acid polymerase having 5' nuclease activity; wherein the probe is cleaved to release the label; and (c) detecting signal generation from the released label.

[0162] Signal generation by the first oligonucleotide set and the second oligonucleotide set can be achieved by various methods known to those skilled in the art in addition to the above-described methods.

[0163]

[0164] In one embodiment, each of the probes included in the first oligonucleotide set and the probes included in the second oligonucleotide set comprises a detectable fluorescent label and a quenching moiety capable of quenching a signal from the fluorescent label.

[0165] The fluorescent label and the quenching moiety herein may be referred to as an interactive dual label, the fluorescent label may be referred to as a fluorescent reporter molecule, and the quenching moiety may be referred to as a quencher molecule.

[0166] Representative examples of interactive label systems including the above-described interactive dual labels include FRET (fluorescence resonance energy transfer) label systems including a fluorescent reporter molecule (donor molecule) and a quencher molecule (acceptor molecule). In FRET, the energy donor is fluorescent, while the energy acceptor can be fluorescent or non-fluorescent. The interactive label system may include a dual label based on "contact-mediated quenching" (Salvatore et al., Nucleic Acids Research, 2002 (30) no. 21 e122 and Johansson et al., J. AM. CHEM. SOC 2002 (124) pp 6950-6956). The interactive label system may include any label system that induces a signal change by the interaction between at least two molecules (e.g., dyes).

[0167] Reporter molecules and quencher molecules useful in the present invention may include any molecules known in the art. Examples include: Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BODIPY TMR (568), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), Rphycocyanin (642), C-Phycocyanin (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705), and Quasar 705 (610). The numbers in parentheses are the maximum emission wavelengths in nanometers. Preferably, the reporter molecule and quencher molecule may include JOE, FAM, TAMRA, ROX, and fluorescein-based labels.

[0168] Suitable fluorescent molecules and suitable reporter-quencher pairs are described in various references, including: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, RP, Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); U.S. Patent Nos. 3,996,345 and 4,351,760.

[0169] It is noteworthy that in the present invention, non-fluorescent quencher molecules (e.g., black quenchers or dark quenchers) capable of quenching fluorescence of a broad wavelength or a specific wavelength can be utilized.

[0170] In a signaling system comprising a reporter and a quencher molecule, the reporter comprises the donor of FRET and the quencher comprises the other partner (acceptor) of FRET. For example, a fluorescein dye may be used as the reporter and a rhodamine dye may be used as the quencher.

[0171] In one embodiment, the interactive dual label is linked to a probe within the first oligonucleotide set.

[0172] In one embodiment, the interactive dual label is linked to a probe within a second oligonucleotide set.

[0173] When the target nucleic acid is not present, each probe in the first oligonucleotide set and the second oligonucleotide set exists in a single-stranded state of a hairpin or random coil structure, in which case the quencher molecule comes into proximity to the reporter molecule and quenches the signal from the reporter molecule, so that no signal is generated.

[0174] On the other hand, when a target nucleic acid is present, each of the probes hybridizes to the target nucleic acid under appropriate hybridization conditions to form a duplex, thereby separating the quencher molecule from the reporter molecule and generating a signal by unquenching the signal from the reporter molecule, and further, as the probe is cleaved by the action of a nuclease, the separation between the quencher molecule and the reporter molecule is enhanced.

[0175] According to the present invention, the fluorescent label linked to the probe included in the first oligonucleotide set is different from the fluorescent label linked to the probe included in the second oligonucleotide set. The difference between the two fluorescent labels means that the signals generated from the fluorescent labels have substantially different signal characteristics (e.g., optical characteristics, emission wavelengths, etc.) and can be easily distinguished using two detection channels.

[0176] In one embodiment, the fluorescent label linked to the probe included in the first oligonucleotide set is FAM or an equivalent thereof.

[0177] In one embodiment, the fluorescent label linked to the probe included in the second oligonucleotide set is Cal Red 610 or an equivalent thereof.

[0178]

[0179] According to the present invention, a nucleic acid amplification reaction is performed for the VP2 gene of BKV and the UL55 gene of CMV.

[0180] The above nucleic acid amplification reaction is a multiplex reaction that simultaneously amplifies two target nucleic acids in one reaction vessel.

[0181] In one embodiment, amplification of the target nucleic acid can be performed via polymerase chain reaction (PCR).

[0182] Polymerase chain reaction is widely used in the art to amplify target nucleic acids, and involves repeated cycles of denaturation of the target nucleic acid sequence, annealing (hybridization) between the target nucleic acid sequence and a primer, and primer extension (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al., (1985) Science 230, 1350-1354).

[0183] If the target nucleic acid is double-stranded, it is desirable to convert the double-stranded nucleic acid into a single-stranded or partially single-stranded form. Methods for separating the double-stranded nucleic acid include, but are not limited to, heat, alkali, formamide, urea, and glycoxal treatment, enzymatic methods (e.g., helicase action), and binding proteins. For example, strand separation can be achieved by heating at a temperature ranging from 80°C to 105°C. A general method for achieving this treatment is provided by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001).

[0184] Annealing of the primer and target nucleic acid can be performed under suitable hybridization conditions, which are generally determined by optimization procedures. Conditions such as temperature, concentration of components, number of hybridization and washing cycles, buffer components, and their pH and ionic strength can vary depending on various factors, including the length and GC content of the primer and target nucleic acid sequences. Detailed hybridization conditions can be found in Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and M. L. M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc., NY (1999).

[0185] The primer annealed to the target nucleic acid is extended by a template-dependent polymerase, which includes the "Klenow" fragment of E. coli DNA polymerase I, a thermostable DNA polymerase, and a bacteriophage T7 DNA polymerase. In one embodiment of the present disclosure, the template-dependent polymerase is a thermostable DNA polymerase obtained from various bacterial species.

[0186] According to one embodiment of the present invention, a nucleic acid polymerase having nuclease activity (e.g., 5'nuclease activity or 3'nuclease activity) can be used.

[0187] Nucleic acid polymerases useful in the present invention include Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Pyrococcus A thermostable DNA polymerase obtained from various bacterial species, including Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifex pyrophilus, and Aquifex aeolieus. In particular, the thermostable DNA polymerase is Taq polymerase.

[0188] When conducting a polymerization reaction, the components required for the reaction may be provided in excess in the reaction vessel. With respect to the components of the extension reaction, excess means an amount of each component such that the ability to achieve the desired extension is not substantially limited by the concentration of said components. In order for the desired reaction to occur, Mg2+ It is desirable to provide sufficient amounts of necessary cofactors such as dATP, dCTP, dGTP and dTTP to the reaction mixture.

[0189] According to the method of the present invention, an increased volume of sample can be used to increase the sensitivity of quantification. The volume of the sample used may be, but is not limited to, 5 to 15 ul, particularly 8 ul, 9 ul, 10 ul, 11 ul, or 12 ul.

[0190] Additionally, to increase the sensitivity of quantification, the method of the present invention may have an increased total reaction volume. The total reaction volume in the nucleic acid amplification reaction according to the present invention may be, but is not limited to, 20 to 30 ul, and in particular, 25 ul, 26 ul, 27 ul, 28 ul, 29 ul, or 30 ul.

[0191] When using mRNA as a starting material, a reverse transcription step is essential prior to the annealing step, and details thereof are disclosed in the literature [Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and Noonan, KF et al., Nucleic Acids Res. 16:10366 (1988)]. For the reverse transcription reaction, an oligonucleotide dT primer, a random primer, or a target-specific primer capable of hybridizing to the poly A tail of the mRNA can be used.

[0192] According to another embodiment, as a method for amplifying the target nucleic acid, ligase chain reaction (LCR, see Wiedmann M, et al., "Ligase chain reaction (LCR) - overview and applications." PCR Methods and Applications 1994 Feb;3(4):S51-64), gap filling LCR (GLCR, see WO 90 / 01069, European Patent No. 439182 and WO 93 / 00447), Q-beta replicase amplification (Q-beta, see Cahill P, et al., Clin Chem., 37(9):1482-5(1991), US Patent No. 5556751), strand displacement amplification (SDA, see GT Walker et al., Nucleic Acids Res. 20(7):16911696(1992), European Patent No. The amplification method may be, but is not limited to, amplification based on nucleic acid sequence (NASBA; see Compton, J. Nature 350(6313):912(1991)), transcription-mediated amplification (TMA; see Hofmann WP et al., J Clin Virol. 32(4):289-93(2005); U.S. Pat. No. 5888779), rolling circle amplification (RCA; see Hutchison CA et al., Proc. Natl Acad. Sci. USA. 102:1733217336(2005)), recombinase polymerase amplification (RPA), or loop-mediated isothermal amplification (LAMP).

[0193] The amplification method described above can amplify target nucleic acids through repetition of a series of reactions with or without temperature changes. The unit of amplification, which includes repetition of the series of reactions, is expressed as a "cycle." Depending on the amplification method, the unit of the cycle can be expressed as the number of repetitions or time.

[0194] For example, detection of a signal can be performed at each cycle of amplification, at a selected subset of cycles, or at the end-point of the reaction.

[0195] According to one embodiment of the present invention, amplification of the target nucleic acid is achieved by asymmetric PCR. The ratio of the primers may be selected taking into account cleavage or hybridization of the downstream oligonucleotide.

[0196]

[0197] In one embodiment, the composition for detecting a target nucleic acid according to the present invention further comprises an oligonucleotide set for an internal control reaction. The internal control reaction may be performed simultaneously with the nucleic acid amplification reaction of the VP2 gene of BKV and the UL55 gene of CMV according to the present invention. As used herein, "internal control" refers to a substance used to confirm the suitability of a reaction, which confirms the presence of a target nucleic acid, loss of target nucleic acid during nucleic acid extraction, and the presence of inhibitory substances in the amplification reaction.

[0198] In one embodiment, the internal control is human hemoglobin subunit beta (HBB).

[0199] In one embodiment, the set of oligonucleotides required for the internal control reaction comprises a primer pair and a probe that are hybridizable with the internal control.

[0200] In one embodiment, the probe used in the internal control reaction comprises a detectable fluorescent label and a quenching moiety capable of quenching a signal from the fluorescent label.

[0201] In one embodiment, the fluorescent label linked to the probe used in the internal control reaction is Quasar 670 or an equivalent thereof.

[0202] In one embodiment, the composition for detecting a target nucleic acid according to the present invention further comprises a positive control for a positive control reaction. The positive control reaction may be performed simultaneously with, before, or after the nucleic acid amplification reaction of the VP2 gene of BKV and the UL55 gene of CMV according to the present invention. The positive control may be the VP2 gene of BKV described above or the UL55 gene of CMV described above. The positive control may be amplified and / or detected by the first oligonucleotide set or the second oligonucleotide set according to the present invention.

[0203] In one embodiment, the composition for detecting a target nucleic acid according to the present invention further comprises a negative control for a negative control reaction. The negative control reaction may be performed simultaneously with, before, or after the nucleic acid amplification reaction of the VP2 gene of BKV and the UL55 gene of CMV according to the present invention. The negative control may be sterile water, particularly ultrapure PCR-grade water, that does not contain a target nucleic acid.

[0204] In one embodiment, the composition for detecting a target nucleic acid according to the present invention further comprises UDG (Uracil DNA Glycosylase). UDG can prevent carry-over contamination, in which the result of a previous reaction (e.g., cDNA or an amplification product) contaminates a newly performed reaction through various routes. Specifically, dUTP is used instead of dTTP among dNTPs to perform a reverse transcription reaction or an amplification reaction. The result (i.e., cDNA or an amplification product) contains dUTP, and by treating with UDG before performing a new reaction, the previous result containing dUTP is hydrolyzed, thereby preventing carry-over contamination.

[0205] As an example of a suitable UDG, heat-labile uracil DNA glycosylase (UDG) can be used. The heat-labile UDG may include, but is not limited to, UDG derived from cold-living organisms, such as psychrophilic bacteria or Atlantic cod. These enzymes are characterized by rapid and irreversible inactivation when exposed to temperatures of 50°C or 55°C, respectively. Therefore, heat-labile UDG is inactivated before the reverse transcription reaction begins, and thus has no effect at all on the cDNA production process by the reverse transcription reaction, and can only remove carry-over contaminants.

[0206]

[0207] The composition for detecting a target nucleic acid according to the present invention generates a signal in the presence of its corresponding target nucleic acid, and enables quantification of the target nucleic acid by detecting the generated signal.

[0208] According to one embodiment of the present invention, a nucleic acid amplification reaction is performed under conditions that allow target amplification along with signal generation by a composition for detecting a target nucleic acid.

[0209] In one embodiment, the generation of the signal includes "signal generation or disappearance" and "signal increase or decrease" from the label. The generation of the signal herein means the generation of a significant signal, i.e., a signal indicating the presence of the target nucleic acid. For example, a significant signal, i.e., a signal indicating the presence of the target nucleic acid, means a signal having an intensity that exceeds the intensity of a background signal or the intensity of a signal that can be generated in the absence of the target nucleic acid, or a significant signal, i.e., a signal indicating the presence of the target nucleic acid, means a signal having an intensity after subtracting the intensity of the background signal or the intensity of a signal that can be generated in the absence of the target nucleic acid from the intensity of the generated signal. If a signal is generated but its intensity is similar to or lower than the intensity of the background signal or the intensity of a signal that can be generated in the absence of the target nucleic acid, the generation of the signal is not considered as a signal or the generation of a signal in the methods of the present invention.

[0210]

[0211] According to the method of the present invention, the nucleic acid amplification reaction generates a first amplification curve representing amplification of the VP2 gene of BKV when BKV is present in the sample, and a second amplification curve representing amplification of the UL55 gene of CMV when CMV is present in the sample.

[0212] In this disclosure, an amplification curve refers to a curve obtained by plotting a data set for a target nucleic acid obtained from an amplification reaction. In one embodiment, the data set comprises a plurality of data points including cycle numbers and signal values.

[0213] In the present invention, the term "cycle" refers to a unit of change in a condition in a plurality of measurements involving a change in said condition. The change in said constant condition may refer to an increase or decrease in, for example, temperature, reaction time, number of reactions, concentration, pH, or the number of replications of a measurement target (e.g., nucleic acid). Accordingly, a cycle may be a time or process cycle, a unit operation cycle, or a reproductive cycle.

[0214] For example, when measuring the substrate degradation capacity of an enzyme according to substrate concentration, the degree of substrate degradation is measured several times by varying the substrate concentration, and the enzyme's substrate degradation capacity is analyzed from these measurements. In this case, a constant change in condition is an increase in substrate concentration, and the unit of substrate concentration increase used is set as one cycle.

[0215] As another example, in the case of isothermal amplification of nucleic acids, one sample can be measured several times with different reaction times. In this case, the reaction time is a change in conditions, and the unit of reaction time is set as one cycle.

[0216] More specifically, the term "cycle" means one unit of repetition, when a reaction is repeated in a certain process or at certain time intervals.

[0217] For example, in the polymerase chain reaction (PCR), one cycle refers to a reaction that includes the steps of nucleic acid denaturation, primer annealing, and primer extension. In this case, a change in certain conditions increases the number of reaction repetitions, and the unit of repetition of the reaction comprising the above series of steps is defined as one cycle.

[0218] As used herein, the term “signal value” refers to a value quantified on a certain scale based on the level of a signal (e.g., signal intensity) measured in a cycle of a nucleic acid amplification reaction, or a modified value thereof. The modified value may include a mathematically processed signal value of the measured signal value. Examples of mathematically processed signal values ​​of actually measured signal values ​​(i.e., signal values ​​of a raw data set) may include logarithmic values ​​or derivatives.

[0219] In this specification, the term "data point" refers to a single coordinate value that includes a cycle and a signal value. The term "data" refers to all information that constitutes a data set. For example, each cycle and signal value of an amplification reaction is data.

[0220] The data points obtained by the amplification reaction can be expressed as coordinate values ​​that can be represented in a two-dimensional rectangular coordinate system. In the coordinate values, the X-axis represents the corresponding cycle number, and the Y-axis represents the signal value measured or processed in the corresponding cycle.

[0221] The term "data set" as used herein refers to a collection of data points. For example, the data set may be a collection of data points obtained directly through an amplification reaction performed in the presence of a set of oligonucleotides specific for a target nucleic acid, or may be a modified data set thereof. The data set may be a portion or all of a plurality of data points obtained through the amplification reaction, or a modified data set thereof.

[0222] In one embodiment, the amplification curve according to the present invention is obtained by subtracting the background signal according to a conventionally known method.

[0223]

[0224] Step (b): Determination of the amount of BKV and CMV

[0225] In step (b) of the present disclosure, the amount of BKV in the sample is determined using the first amplification curve generated above, and the amount of CMV in the sample is determined using the second amplification curve generated above.

[0226] Specifically, the amount of BKV in the sample is determined by comparing the first amplification curve generated above with a standard curve generated from a reference sample containing a known amount of the VP2 gene, and the amount of CMV in the sample is determined by comparing the second amplification curve generated above with a standard curve generated from another reference sample containing a known amount of the UL55 gene.

[0227] The standard curve for the VP2 gene and the standard curve for UL55 are prepared prior to or simultaneously with step (b) above.

[0228] In this disclosure, a standard curve generated from a reference sample containing the VP2 gene may be referred to as a “standard curve for the VP2 gene” or a “standard curve for BKV,” and a standard curve generated from a reference sample containing the UL55 gene may be referred to as a “standard curve for the UL55 gene” or a “standard curve for CMV.”

[0229]

[0230] Below, each standard curve is described.

[0231] A standard curve for the VP2 gene is obtained from a nucleic acid amplification reaction using reference samples containing various known amounts of the VP2 gene.

[0232] Similarly, a standard curve for the UL55 gene is obtained from a nucleic acid amplification reaction using another reference sample containing various known amounts of the UL55 gene.

[0233] The nucleic acid amplification reaction for obtaining the above standard curve is performed separately from the nucleic acid amplification reaction in the above-described step (a), and may be called a standard nucleic acid amplification reaction or a reference nucleic acid amplification reaction.

[0234] In one embodiment, the standard curve for the VP gene or the standard curve for the UL55 gene can be obtained by an absolute quantification method known in the art.

[0235] In certain embodiments, the standard curve for the VP gene or the standard curve for the UL55 gene is obtained from the following steps: (i) obtaining an amplification curve by a nucleic acid amplification reaction using a reference sample containing a known amount of the VP gene or the UL55 gene, (ii) determining a threshold cycle (Ct) from the amplification curve, and (iii) plotting the threshold cycle against the log value of the known amount of the VP gene or the UL gene.

[0236] In the above-described embodiments, the known amount of VP2 gene or the known amount of UL55 gene used in step (i) may be a commercially or non-commercially available standard material.

[0237] Additionally, the amount of the base of the gene may be a dilution series of the amount of the gene.

[0238] The dilution series of the above gene refers to a reference sample containing a series of diluted amounts of the gene, which can be prepared taking into account the amount of target nucleic acid known to be commonly present in a sample, particularly a clinical sample.

[0239] In one embodiment, the reference samples containing the VP2 gene of the base are each 10 1 copies / uL to 10 10 3 or more containing the selected amount from copies / uL.

[0240] In a specific embodiment, a reference sample containing the VP2 gene of the base is 10 3 Reference sample containing VP2 gene at 10 copies / uL 5 A reference sample containing VP2 gene at 10 copies / uL and 7 Includes a reference sample containing VP2 gene at 10 copies / uL.

[0241] In one embodiment, another reference sample containing the UL55 gene of the base is 10 1 copies / uL to 10 10 3 or more containing the selected amount from copies / uL.

[0242] In a specific embodiment, another reference sample containing the UL55 gene of the base is 10 3 Reference sample containing UL55 gene at 10 copies / uL 5 A reference sample containing UL55 gene at 10 copies / uL and 7 Includes a reference sample containing UL55 gene at 10 copies / uL.

[0243] In the above-described embodiments, the conditions of the nucleic acid amplification reaction for the reference sample are the same as the conditions of the nucleic acid amplification reaction for the sample according to the present invention. For example, the conditions (e.g., temperature, time, etc.), the container (or the type of container (e.g., plate, etc.)), the device (or the type of device (e.g., thermocycler, etc.)) used, etc. of the nucleic acid amplification reaction using the reference sample are the same as the conditions, the container, the device used, etc. of the nucleic acid amplification reaction using the sample.

[0244] In the above-described implementation, determination of the threshold cycle (Ct) in step (ii) can be performed by various methods known in the art.

[0245] The above threshold cycle exhibits a linear correlation with the amount of target nucleic acid present in the sample. A high threshold cycle indicates a small amount of target nucleic acid present in the sample, whereas a low threshold cycle indicates a large amount of target nucleic acid present in the sample.

[0246] Therefore, 10 3 Reference sample containing VP2 gene at 10 copies / uL 5 A reference sample containing VP2 gene at 10 copies / uL and 7 When determining the threshold cycle from a nucleic acid amplification reaction for a reference sample containing VP2 gene of 10 copies / uL, 3 A reference sample containing VP2 gene at 10 copies / uL will show the highest threshold cycle, 10 7 A reference sample containing VP2 genes at 10 copies / uL will exhibit the lowest threshold cycle. This also applies to a reference sample containing UL55 genes. However, it should be noted that even if the amounts of VP2 and UL55 genes are identical, the threshold cycles obtained from them may differ.

[0247] It will be understood by those skilled in the art that the threshold cycle may be determined by applying a predetermined threshold to the amplification curve and determining the point where the threshold intersects the threshold, or may be determined as the first derivative maximum (FDM), second derivative maximum (SDM), etc. as disclosed in US 6,503,720, US 6,783,934, US 10,176,293, US 8,285,489, US 7,565,250, etc. In addition, those skilled in the art will understand that other parameters, such as Cp (crossing point), Cq (quantification cycle), △Ct, △Cp, or △Cq, may be used instead of the threshold cycle.

[0248] In the above-described implementation, each standard curve is obtained by plotting the threshold cycle against the known positive log value of the VP gene or UL gene.

[0249] In one implementation, the standard curve has the threshold cycle on the y-axis and the amount of each gene (starting amount, log value) on the x-axis.

[0250]

[0251] As described above, each standard curve generated from the reference sample is compared with the corresponding amplification curve among the first amplification curve and the second amplification curve. That is, the first amplification curve is compared with the standard curve for the VP2 gene, and the second amplification curve is compared with the standard curve for the UL55 gene.

[0252] In one embodiment, a threshold cycle is obtained from a first amplification curve for a sample, and an amount of VP2 gene (e.g., a value on the x-axis) corresponding to said threshold cycle (e.g., a value on the y-axis) is obtained from a standard curve for the VP2 gene, and said obtained amount is determined as the amount of BKV in the sample.

[0253] Similarly, in one embodiment, a threshold cycle is obtained from the second amplification curve, and an amount of the UL55 gene (e.g., a value on the x-axis) corresponding to the threshold cycle (e.g., a value on the y-axis) is obtained from a standard curve for the UL55 gene, and the obtained amount is determined as the amount of CMV in the sample.

[0254]

[0255] As described above, the method of the present invention enables simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample using a first oligonucleotide set capable of hybridizing to the VP2 gene of BKV and a second oligonucleotide set capable of hybridizing to the UL55 gene of CMV.

[0256] The quantitative results according to the method of the present invention can be applied to the qualitative analysis of BKV in a sample.

[0257] In one embodiment, if the amount of BKV or CMV determined according to the method of the present invention for a particular sample exceeds a predetermined level, the sample is determined to be positive, whereas if the amount of BKV or CMV is below the predetermined level, the sample is determined to be negative.

[0258] As an example, if the amount of BKV determined according to the method of the present invention for a particular sample exceeds a selected level of 500 copies / ml and 1000 copies / ml, the sample may be determined to be positive, whereas if it is below the level, the sample may be determined to be negative.

[0259] As another example, if the amount of BKV determined according to the method of the present invention for a particular sample exceeds a selected level of 34.5 IU / ml and 137 IU / ml, the sample may be determined to be positive, whereas if it is below the level, the sample may be determined to be negative.

[0260] As mentioned above, the predetermined level can be easily determined by a person skilled in the art.

[0261]

[0262] II. Composition for simultaneous quantification

[0263] According to one aspect, a composition for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample is provided, comprising:

[0264] (a) a first set of oligonucleotides hybridizable to the VP2 gene of BKV;

[0265] (b) a second set of oligonucleotides hybridizable to the UL55 gene of CMV; and

[0266] (c) A reagent for nucleic acid amplification comprising a polymerase, dNTPs, and a buffer.

[0267] Since the components (a), (b) and (c) mentioned above have already been explained in the above section I, their explanation will be omitted in this section.

[0268] In certain embodiments, the composition further comprises a reference sample containing a known amount of the VP2 gene and another reference sample containing a known amount of the UL55 gene.

[0269] In certain embodiments, the first oligonucleotide set comprises a primer having a nucleotide sequence of SEQ ID NO: 2 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto, and a primer having a nucleotide sequence of SEQ ID NO: 3 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto.

[0270] In certain embodiments, the first oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 4 or a sequence having at least 90% homology thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology thereto.

[0271] In certain embodiments, the second oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 6 or a sequence having at least 90% homology thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology thereto, and a primer having the nucleotide sequence of SEQ ID NO: 7.

[0272] In certain embodiments, the second oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 8 or a sequence having at least 90% homology thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology thereto.

[0273] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0274]

[0275] Hereinafter, the present invention will be described in more detail through examples. These examples are intended to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention, as set forth in the appended claims, is not limited by these examples.

[0276]

[0277] Example

[0278] Example 1: Confirming target coverage of oligonucleotide sets

[0279] The VP2 gene of BKV was determined as a target nucleic acid for detecting BKV. A conserved region with little sequence variation within the VP2 gene of BKV was selected, and a forward primer having the nucleotide sequence of SEQ ID NO: 2 capable of hybridizing to the conserved region, a reverse primer having the nucleotide sequence of SEQ ID NO: 3, and a probe having the nucleotide sequence of SEQ ID NO: 4 were designed. In the case of the probe, a FAM fluorescent label was linked to one end and BHQ-2 was linked to the other end. The designed primers and probe were collectively referred to as the first oligonucleotide set.

[0280] The target coverage of the first oligonucleotide set was analyzed as follows.

[0281] First, the genome sequence of BKV (taxonomy ID: 1891762) was collected from the NCBI database. As a result of the collection, a total of 541 target nucleic acid sequences were collected. Thereafter, the sequences of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 within the first oligonucleotide set were compared with each of the collected target nucleic acid sequences to determine the number of mismatches.

[0282] The above results are shown in Table 1 below.

[0283] Number of mismatches Sequence number 01234567>=8 Coverage (%) 2541 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 541100 3541 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 541100 4541 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 5410 / 541100

[0284] The above table shows the number of target nucleic acids having 0, 1, 2, 3, 4, 5, 6, 7 and 8 mismatched nucleotides for the sequences of SEQ ID NOs: 2, 3 and 4, respectively. As shown in Table 1, each of the sequences of SEQ ID NOs: 2, 3 and 4 was found to have 0 mismatches with all 541 target nucleic acids, which demonstrates that the primers and probes of SEQ ID NOs: 2, 3 and 4 according to the present invention have 100% match with the collected 541 genome sequences of BKV, thus exhibiting 100% target coverage.

[0285]

[0286] Meanwhile, the UL55 gene of CMV was determined as a target nucleic acid for detecting CMV. A conserved region with little sequence variation within the UL55 gene of CMV was selected, and a forward primer having a nucleotide sequence of SEQ ID NO: 6 that can hybridize to the conserved region, a reverse primer having a nucleotide sequence of SEQ ID NO: 7, and a probe having a nucleotide sequence of SEQ ID NO: 8 were designed. In the case of the probe, a Cal Red 610 fluorescent label was linked to one end and BHQ-2 was linked to the other end. The designed primers and probe were collectively referred to as the second oligonucleotide set.

[0287] The target coverage of the second oligonucleotide set was analyzed as follows.

[0288] First, the genome sequence of CMV (taxonomy ID: 10359) was collected from the NCBI database. As a result of the collection, a total of 523 target nucleic acid sequences were collected. Thereafter, the sequences of SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8 within the second oligonucleotide set were compared with each of the collected target nucleic acid sequences to determine the number of mismatches.

[0289] The above results are shown in Table 2 below.

[0290] Number of mismatches Sequence number 01234567>=8 Coverage (%) 6523 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 5231007521 / 5232 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 52399.68521 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 5230 / 52399.6

[0291] The above table shows the number of target nucleic acids having 0, 1, 2, 3, 4, 5, 6, 7 and 8 mismatched nucleotides for the sequences SEQ ID NO: 6, 7 and 8, respectively.

[0292] As shown in Table 2 above, the sequence of SEQ ID NO: 6 was found to have 0 mismatches for all 523 target nucleic acids, and thus, the sequence exhibited 100% target coverage. In addition, the sequences of SEQ ID NOs: 7 and 8 were found to have 0 mismatches for 521 of the 523 target nucleic acids, and 1 mismatch for 2 target nucleic acids. Since the sequences of SEQ ID NOs: 7 and 8 are expected to be capable of hybridizing even to a target nucleic acid having 1 mismatch, it was confirmed that the primers and probes of SEQ ID NOs: 6, 7, and 8 according to the present invention exhibited substantially 100% target coverage.

[0293]

[0294] Example 2: Confirming the specificity of the oligonucleotide set

[0295] The specificity of the first and second oligonucleotide sets designed in Example 1 was confirmed.

[0296] First, for the specificity test of the BK virus, a total of 47 specificity strains were selected, including JC virus and simian virus 40, which belong to the polyomavirus family and have high genetic homology with the BK virus, and other strains known to exist in humans but which should not be detected by the first oligonucleotide set according to the present invention.

[0297] A reaction mixture for real-time PCR was prepared by mixing 10 μl of genomic DNA of each of the 47 strains, 6.25 μl of the first oligonucleotide set designed in Example 1, 6.25 μl of 4X Master mix (final, 200 uM dNTPs, 2 mM MgCl2, 2 U of Taq DNA polymerase, 0.1 U of UDG), and 2.5 μl of distilled water.

[0298] Each of the above-prepared reaction mixtures was placed in different tubes and denatured at 95°C for 15 minutes in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad), followed by 45 cycles of 95°C for 10 seconds, 60°C for 15 seconds, and 72°C for 10 seconds. The signal was measured at 72°C during each cycle to obtain an amplification curve.

[0299] The presence or absence of each target nucleic acid was determined by applying a predetermined threshold to the above amplification curve.

[0300] The above results are shown in Table 3 below.

[0301] No.AnalyteResult1Acinetobacter baumanniiN.D.2Citrobacter freundiiN.D.3Corynebacterium diphtheriaeN.D.4Corynebacterium striatumN.D.5Corynebacterium urealyticusN.D.6Escherichia coli (O138:K81(B):H14)ND7Enterobacter cloacae subsp. cloacaeN.D.8Enterococcus faeciumN.D.9Escherichia coliN.D.10Escherichia fergusoniiN.D.11Escherichia hermanniiN.D.12Escherichia vulnerisN.D.13Haemophilus aegyptiusN.D.14Haemophilus aphrophilusN.D.15Listeria seeligeriN.D.16Listeria innocua SeeligerN.D.17Neisseria lactamica Hollis et al.ND18Neisseria mucosaN.D.19Pantoea agglomeransN.D.20Serratia marcescensN.D.21Staphylococcus capitis subsp. capitisN.D.22Staphylococcus hominis subsp. hominisN.D.23Staphylococcus epidermidisN.D.24Staphylococcus saprophyticus subsp. saprophyticusN.D.25Streptococcus pseudopneumoniaeN.D.26Streptococcus australisN.D.27Streptococcus bovisN.D.28Streptococcus intermediusN.D.29Bacillus cereusN.D.30Bacillus subtilisN.D.31Salmonella bongoriN.D.32Herpes simplex virus 1 (Strain: Maclntyre)ND33Herpes herpesvirus 2N.D.34Human herpesvirus 4, Epstein Barr virus (EBV)ND35Human herpesvirus 6BN.D.36Human herpesvirus 6N.D.37Human Herpes 7 virus (SB strain)ND38Dengue virus Type 2N.D.39La Crosse VirusN.D.40Measles VirusN.D.41St. Louis Encephalitis VirusN.D.42International Standard for Hepatitis B virusN.D.43International Standard for Hepatitis C virusN.D.44Coxsackievirus B1_titeringN.D.45Varicella zoster virusN.D.46JC virusN.D.47Simian virus 40N.D.

[0302] (ND: Not Detected)

[0303] As shown in Table 3 above, the first oligonucleotide set according to the present invention was found not to detect other clinically important strains, including JC virus and simian virus 40, which have high genetic homology with BKV, demonstrating the high target specificity of the first oligonucleotide set according to the present invention.

[0304]

[0305] Next, for the specificity test of the CMV virus, a total of 47 specificity strains were selected, including herpes simplex virus 1 (strain: Maclntyre), which belongs to the herpesvirus family and has high genetic homology with the CMV virus, human herpesvirus 2, human herpesvirus 4 Epstein-Barr virus (EBV), human herpesvirus 6B, human herpesvirus 6, and human herpesvirus 7 virus (SB strain), and other strains known to exist in humans but which should not be detected by the second oligonucleotide set according to the present invention.

[0306] A reaction mixture for real-time PCR was prepared by mixing 10 μl of genomic DNA of each of the 47 strains, 6.25 μl of the second oligonucleotide set designed in Example 1, 6.25 μl of 4X Master mix (final, 200 uM dNTPs, 2 mM MgCl2, 2 U of Taq DNA polymerase, 0.1 U of UDG), and 2.5 μl of distilled water.

[0307] Each of the above-prepared reaction mixtures was placed in different tubes and denatured at 95°C for 15 minutes in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad), followed by 45 cycles of 95°C for 10 seconds, 60°C for 15 seconds, and 72°C for 10 seconds. The signal was measured at 72°C during each cycle to obtain an amplification curve.

[0308] The presence or absence of each target nucleic acid was determined by applying a predetermined threshold to the above amplification curve.

[0309] The above results are shown in Table 4 below.

[0310] No.AnalyteResult1Acinetobacter baumanniiN.D.2Citrobacter freundiiN.D.3Corynebacterium diphtheriaeN.D.4Corynebacterium striatumN.D.5Corynebacterium urealyticusN.D.6Escherichia coli (O138:K81(B):H14)ND7Enterobacter cloacae subsp. cloacaeN.D.8Enterococcus faeciumN.D.9Escherichia coliN.D.10Escherichia fergusoniiN.D.11Escherichia hermanniiN.D.12Escherichia vulnerisN.D.13Haemophilus aegyptiusN.D.14Haemophilus aphrophilusN.D.15Listeria seeligeriN.D.16Listeria innocua SeeligerN.D.17Neisseria lactamica Hollis et al.ND18Neisseria mucosaN.D.19Pantoea agglomeransN.D.20Serratia marcescensN.D.21Staphylococcus capitis subsp. capitisN.D.22Staphylococcus hominis subsp. hominisN.D.23Staphylococcus epidermidisN.D.24Staphylococcus saprophyticus subsp. saprophyticusN.D.25Streptococcus pseudopneumoniaeN.D.26Streptococcus australisN.D.27Streptococcus bovisN.D.28Streptococcus intermediusN.D.29Bacillus cereusN.D.30Bacillus subtilisN.D.31Salmonella bongoriN.D.32Herpes simplex virus 1 (Strain: Maclntyre)ND33human herpesvirus 2N.D.34Human herpesvirus 4, Epstein Barr virus (EBV)ND35Human herpesvirus 6BN.D.36Human herpesvirus 6N.D.37Human Herpes 7 virus (SB strain)ND38Dengue virus Type 2N.D.39La Crosse VirusN.D.40Measles VirusN.D.41St. Louis Encephalitis VirusN.D.42International Standard for Hepatitis B virusN.D.43International Standard for Hepatitis C virusN.D.44Coxsackievirus B1_titeringN.D.45Varicella zoster virusN.D.46JC virusN.D.47Simian virus 40N.D.

[0311] (ND: Not Detected)

[0312] As shown in Table 4 above, the second oligonucleotide set according to the present invention was found not to detect other clinically important strains, including herpes simplex virus 1 (strain: MacIntyre), human herpesvirus 2, human herpesvirus 4 Epstein-Barr virus (EBV), human herpesvirus 6B, human herpesvirus 6, and human herpesvirus 7 virus (SB strain), which have high genetic homology with CMV, demonstrating the high target specificity of the second oligonucleotide set according to the present invention.

[0313]

[0314] Example 3: Quantification of target nucleic acid

[0315] It was confirmed whether the first and second oligonucleotide sets designed in Example 1 were effective in quantifying target nucleic acids.

[0316] First, real-time PCR using the first oligonucleotide set according to the present invention was performed on each of a total of 130 plasma samples, including 32 plasma samples clinically confirmed positive for BKV and 98 plasma samples confirmed negative for BKV.

[0317] Genomic DNA was extracted from the plasma sample using the QIAsymphony DSP Virus / pathogen Midi Kit (Qiagen, Cat. No. 937055). The extracted genomic DNA was then subjected to real-time PCR as described in Example 1 to obtain a first amplification curve.

[0318] Next, the Ct value was calculated by applying RFU 300 as a threshold to the first amplification curve.

[0319] Afterwards, the amount of BKV was calculated by substituting the Ct value from the first amplification curve into the standard curve for the VP2 gene of BKV prepared in advance.

[0320] If the amount of BKV calculated above exceeded 500 copies / ml, the sample was determined to be positive, and if it was below the level, the sample was determined to be negative.

[0321] The above results are shown in Table 5 below.

[0322] Positive Decision Negative Decision Positive Samples = 32 32 0 Negative Samples = 98 0 98

[0323] As shown in Table 5 above, real-time PCR using the first oligonucleotide set according to the present invention determined all 32 positive samples for BKV to be positive, and all 98 negative samples to be negative. Therefore, it was confirmed that the first oligonucleotide set according to the present invention can accurately quantify / qualify positive and negative BKV samples.

[0324]

[0325] Next, real-time PCR using the second oligonucleotide according to the present invention was performed on a total of 130 plasma samples, including 33 plasma samples clinically confirmed to be positive for CMV and 97 plasma samples confirmed to be negative for CMV.

[0326] Genomic DNA was extracted from the plasma sample using the QIAsymphony DSP Virus / pathogen Midi Kit (Qiagen, Cat. No. 937055). The extracted genomic DNA was then subjected to real-time PCR as described in Example 1 to obtain a second amplification curve.

[0327] Next, the Ct value was calculated by applying RFU 300 as a threshold to the second amplification curve.

[0328] Afterwards, the amount of CMV was calculated by substituting the Ct value from the second amplification curve into the standard curve for the UL55 gene of CMV prepared in advance.

[0329] If the amount of CMV calculated above exceeded 34.5 IU / ml, the sample was determined to be positive, and if it was below the level, the sample was determined to be negative.

[0330] The above results are shown in Table 6 below.

[0331] Positive Decision Negative Decision Positive Samples = 33 33 0 Negative Samples = 98 5 92

[0332] As shown in Table 6 above, real-time PCR using the second oligonucleotide set according to the present invention determined all 33 positive samples for CMV as positive, and 92 out of 97 negative samples for CMV were determined as negative, but 5 were determined as positive.

[0333] Five negative samples determined to be positive by real-time PCR according to the present invention were confirmed to contain CMV by sequencing. The sequencing results showed that all five negative samples contained CMV. However, whereas the collected negative samples are determined to be negative when the amount of CMV is 137 IU / ml or less, the method of the present invention determines them to be negative when the amount of CMV is greater than 34.5 IU / ml. The five samples were found to contain amounts of CMV between 34.5 IU / ml and 137 IU / ml. This difference is due to the difference in the criteria for determining a negative result, and it was confirmed that the second oligonucleotide set according to the present invention can accurately quantify / qualify positive and negative CMV samples.

[0334]

[0335] As can be seen from the above results, the method according to the present invention enables more accurate simultaneous diagnosis of BKV and CMV with high sensitivity and specificity.

Claims

1. A method for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample, comprising the following steps: (a) performing a nucleic acid amplification reaction comprising contacting a sample in a single reaction vessel with a first set of oligonucleotides hybridizable to the VP2 gene of BKV and a second set of oligonucleotides hybridizable to the UL55 gene of CMV, wherein the nucleic acid amplification reaction generates a first amplification curve representing amplification of the VP2 gene of BKV in the sample and a second amplification curve representing amplification of the UL55 gene of CMV in the sample; and (b) determining the amount of BKV in the sample by comparing the first amplification curve generated above with a standard curve generated from a reference sample containing a known amount of the VP2 gene, and determining the amount of CMV in the sample by comparing the second amplification curve generated above with a standard curve generated from another reference sample containing a known amount of the UL55 gene.

2. A method according to claim 1, wherein the first oligonucleotide set comprises a plurality of oligonucleotides capable of hybridizing to the nucleotide sequence of SEQ ID NO: 1 or a complement thereof.

3. A method according to claim 2, wherein at least one of the plurality of oligonucleotides has 1 to 3 deoxyinosines; one or two of the deoxyinosines are located in a core region ranging from the 3rd nucleotide to the 6th nucleotide at the 3'-end of the oligonucleotide, and the remainder are located in a region ranging from the 4th nucleotide at the 5'-end to the 7th nucleotide at the 3'-end of the oligonucleotide.

4. A method according to claim 1, characterized in that the first oligonucleotide set does not contain an oligonucleotide capable of hybridizing to the genome sequence of JC virus or simian virus 40.

5. A method according to claim 2, characterized in that the first oligonucleotide set comprises a primer having a nucleotide sequence of SEQ ID NO: 2 and a primer having a nucleotide sequence of SEQ ID NO:

3.

6. A method according to claim 2, wherein the first oligonucleotide set comprises a probe having a nucleotide sequence of SEQ ID NO:

4.

7. A method according to claim 6, wherein the probe comprises a detectable fluorescent label and a quenching moiety capable of quenching a signal from the fluorescent label.

8. A method according to claim 1, wherein the second oligonucleotide set comprises a plurality of oligonucleotides capable of hybridizing to the nucleotide sequence of SEQ ID NO: 5 or a complement thereof.

9. A method according to claim 8, wherein at least one of the plurality of oligonucleotides has 1 to 3 deoxyinosines; one or two of the deoxyinosines are located in a core region ranging from the 3rd nucleotide at the 3'-end to the 6th nucleotide at the 3'-end of the oligonucleotide, and the remainder are located in a region ranging from the 4th nucleotide at the 5'-end to the 7th nucleotide at the 3'-end of the oligonucleotide.

10. A method according to claim 1, wherein the second oligonucleotide set does not include an oligonucleotide capable of hybridizing to the genome sequence of herpes simplex virus 1, human herpesvirus 2, human herpesvirus 4, human herpesvirus 6B, human herpesvirus 6, or human herpesvirus 7 virus.

11. A method according to claim 8, characterized in that the second oligonucleotide set comprises a primer having a nucleotide sequence of SEQ ID NO: 6 and a primer having a nucleotide sequence of SEQ ID NO:

7.

12. A method according to claim 8, wherein the second oligonucleotide set comprises a probe having a nucleotide sequence of SEQ ID NO:

8.

13. A method according to claim 12, wherein the probe comprises a detectable fluorescent label and a quenching moiety capable of quenching a signal from the fluorescent label.

14. A method according to claim 1, characterized in that the nucleic acid amplification reaction is a real-time PCR or isothermal amplification reaction.

15. In the first paragraph, each of the reference samples containing the VP2 gene of the base is 10 1 copies / uL to 10 10 A method characterized in that three or more of the selected amount are included in copies / uL.

16. In the first paragraph, another reference sample containing the UL55 gene of the base is 10 each. 1 copies / uL to 10 10 A method characterized in that three or more of the selected amount are included in copies / uL.

17. A method according to claim 1, characterized in that the sample is whole blood, plasma or serum collected from a subject who has received a kidney transplant.

18. A method according to claim 17, characterized in that the subject has received a kidney transplant for less than one year.

19. A method according to claim 1, wherein the sample has a volume of 5 to 15 ul, and the total volume of the nucleic acid amplification reaction is 20 to 30 ul.

20. A composition for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample, comprising: (a) a first set of oligonucleotides hybridizable to the VP2 gene of BKV; (b) a second set of oligonucleotides hybridizable to the UL55 gene of CMV; and (c) A reagent for nucleic acid amplification comprising a polymerase, dNTPs, and a buffer.

21. A composition according to claim 20, characterized in that the composition further comprises a reference sample containing a known amount of VP2 gene and another reference sample containing a known amount of UL55 gene.

22. A composition according to claim 20, wherein the first oligonucleotide set comprises a primer having a nucleotide sequence of SEQ ID NO: 2 and a primer having a nucleotide sequence of SEQ ID NO:

3.

23. A composition according to claim 20, wherein the first oligonucleotide set comprises a probe having a nucleotide sequence of SEQ ID NO:

4.

24. A composition according to claim 1, characterized in that the second oligonucleotide set comprises a primer having a nucleotide sequence of SEQ ID NO: 6 and a primer having a nucleotide sequence of SEQ ID NO:

7.

25. A composition according to claim 1, wherein the second oligonucleotide set comprises a probe having a nucleotide sequence of SEQ ID NO: 8.