Pharmaceutical composition for preventing or treating targeted cancer comprising BRCA-specific sirna as active ingredient

Abstract

The present invention provides a BRCA-specific siRNA for the purpose of improving the sensitivity of cancer cells to a PARP inhibitor. The siRNA of the present invention can induce cancer cell death together with a PARP inhibitor in patients having a wild-type BRCA gene with low therapeutic efficacy of the PARP inhibitor. A fusion protein-siRNA complex for siRNA delivery, of the present invention, is introduced into cells via CD47, and thus can be delivered more specifically to cancer cells while being introduced with high efficiency, thereby maximizing a desired cell death effect.

Description

Pharmaceutical composition for preventing or treating targeted cancer comprising BRCA-specific SIRNA as an active ingredient

[0001] The present invention provides a wild-type BRCA-specific siRNA for the purpose of improving the sensitivity of cancer cells to a PARP inhibitor, and more specifically, provides a pharmaceutical composition for the prevention or treatment of cancer, including the siRNA as an active ingredient, for use in combination with a PARP inhibitor.

[0002] The BRCA1 and BRCA2 genes play a crucial role in DNA repair, and mutations in these genes are known to increase the risk of developing breast and ovarian cancer. Approximately 10% of all ovarian cancer cases are hereditary, and approximately 7% of breast cancer cases are known to be due to a genetic predisposition. Most hereditary breast and ovarian cancers are caused by mutations in the BRCA1 and BRCA2 genes.

[0003] Cancer cells with BRCA1 / 2 mutations are known to repair DNA through the base excision repair (BER) mechanism, and PARP protein is essential for BER pathway activation. Accordingly, olaparib, veliparib, niraparib, and rucaparib have been approved as PARP inhibitors for the treatment of breast and ovarian cancers harboring BRCA mutations. In addition, it was recently discovered that RARP inhibitors induce a potent antitumor immune response mediated by STING in BRCA-deficient ovarian cancer cells. However, BRCA1 / 2 mutations are identified in only about 10% of all ovarian and breast cancer patients, and the anticancer effect of PARP inhibitors is low in the approximately 90% of ovarian and breast cancer patients with wild-type BRCA genes without mutations, and effective treatments for these cancers are still lacking.

[0004] Meanwhile, siRNA (small interfering RNA) is a small RNA fragment of 18-27 nt in size created by the cleavage of double-stranded RNA by Dicer. It can be used to specifically bind to mRNA with a complementary sequence and suppress the expression of said mRNA. Various RNAi-based drugs have been approved by the FDA to knock down target genes that cause diseases, but siRNA-based drugs for cancer treatment must solve the problems of effective delivery into cells and target cell-specific delivery. In other words, siRNA-based anticancer agents require a delivery system that can effectively deliver the siRNA only into target cells, along with the siRNA sequence that induces effective knockdown of the target gene.

[0005] CD47 is a cell membrane protein that interacts with SIRPα to protect cells from macrophages. Cancer cells overexpress CD47 to evade the innate immune system, and CD47 overexpression, particularly in ovarian cancer, is strongly correlated with poor prognosis. Recently, the present inventors have demonstrated that SIRPα can be used to specifically deliver siRNA to cancer cells.

[0006] The present inventors have conducted extensive research to develop an effective therapeutic approach for ovarian cancer and breast cancer with wild-type BRCA genes and have completed the present invention.

[0007] [Prior Art Literature]

[0008] [Patent Document]

[0009] KR 10-2228271

[0010] [Non-patent literature]

[0011] Engineered SIRP Variants as Immunotherapeutic Adjuvants to Anticancer Antibodies. Science, 341(6141), 88-91.

[0012] The technical task to be achieved by the present invention is to enhance the cancer cell killing effect of a PARP inhibitor for cancers having wild-type BRCA1 and / or BRCA2 genes in cancers in which a high correlation between BRCA gene mutations and cancer occurrence has been revealed.

[0013] Accordingly, the present invention aims to provide a pharmaceutical composition for treating cancer, which comprises the siRNA as an active ingredient, and is intended for use in combination with a PARP inhibitor.

[0014] In addition, the present invention aims to provide a pharmaceutical composition for enhancing the efficacy of a PARP inhibitor, which comprises the siRNA as an active ingredient.

[0015] In addition, the present invention aims to provide a fusion protein-siRNA complex in which a SIRPα protein and a linker peptide cleaved by a lysosomal enzyme are covalently linked to siRNA in order to specifically deliver the siRNA to cancer cells with high efficiency.

[0016] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.

[0017] To solve the above problem, the present invention provides a pharmaceutical composition for preventing or treating cancer, which comprises BRCA (Breast Cancer Susceptibility Gene)1 specific siRNA (small interfering RNA) and / or BRCA2 specific siRNA as an active ingredient.

[0018] As one embodiment of the present invention, the pharmaceutical composition may be used in combination with a PPAR (poly ADP-ribose polymerase) inhibitor.

[0019] As another embodiment of the present invention, the BRCA1-specific siRNA may be an oligonucleotide having a length of 15 to 31 nt capable of complementary binding to BRCA1 mRNA, and may specifically include or consist of a base sequence represented by SEQ ID NO: 3.

[0020] As another embodiment of the present invention, the BRCA2-specific siRNA may be an oligonucleotide having a length of 15 to 31 nt capable of complementary binding to BRCA2 mRNA, and may specifically include or consist of a base sequence represented by SEQ ID NO: 5.

[0021] In addition, the present invention provides a composition for enhancing the sensitivity of cancer cells to a PPAR inhibitor, comprising the BRCA1-specific siRNA and / or BRCA2-specific siRNA as an active ingredient.

[0022] As one embodiment of the present invention, the PPAR inhibitor may be at least one selected from the group consisting of Olaparib, Veliparib, Niraparib, Rucaparib, and Talazoparib.

[0023] As another embodiment of the present invention, the cancer may be a cancer known to have a high correlation between BRCA gene mutation and the onset, metastasis, or recurrence of cancer, and non-limiting examples thereof may include ovarian cancer, breast cancer, prostate cancer, etc.

[0024] As another embodiment of the present invention, the cancer may be a cancer in which a BRCA gene mutation has a high correlation with the onset, metastasis, or recurrence of cancer, and in which the cancer cell killing effect of a PARP inhibitor is known to be low in patients without a BRCA gene mutation or with a wild-type BRCA gene.

[0025] As another embodiment of the present invention, the cancer may be a cancer that has no mutation in the BRCA1 gene or has a wild-type BRCA1 gene in a cancer type that has a high correlation between BRCA gene mutation and the onset, metastasis, or recurrence of cancer.

[0026] In another embodiment of the present invention, the cancer may be a cancer that has no mutation in the BRCA2 gene or has a wild-type BRCA2 gene in a cancer type that has a high correlation between BRCA gene mutation and the onset, metastasis, or recurrence of cancer.

[0027] As another embodiment of the present invention, the cancer may be a cancer that has no mutations in both the BRCA1 and BRCA2 genes or has wild-type BRCA1 and BRCA2 genes in a cancer type that has a high correlation between BRCA gene mutations and the onset, metastasis, or recurrence of cancer.

[0028] Meanwhile, the siRNA of the present invention can be provided by conjugating the siRNA to a fusion protein in which a SIRPα protein and a linker peptide are covalently linked to each other for siRNA delivery specifically to cancer cells. The siRNA conjugated to the fusion protein is introduced into cells through the interaction between SIRPα and CD47 protein, and thus can act more effectively on cancer cells that overexpress CD47.

[0029] The present invention provides the above-described fusion protein-siRNA complex for effective siRNA delivery to CD47-overexpressing cancer cells.

[0030] As an embodiment of the present invention, the linker peptide constituting the fusion protein is not limited as long as the linker peptide can be cleaved within a cell to release siRNA from the complex, and in specific experiments of the present invention, a linker peptide having a sequence that is cleaved by a lysosomal degrading enzyme was used.

[0031] As another embodiment of the present invention, the SIRPα protein may be modified to have improved affinity with CD47.

[0032] In addition, the present invention provides a method for preventing or treating cancer, comprising (1) administering the BRCA1-specific siRNA and / or BRCA2-specific siRNA to a subject, and (2) administering a PARP inhibitor to the subject.

[0033] As one embodiment of the present invention, the subject in the method may be an ovarian cancer, breast cancer, or prostate cancer patient who has no mutation in the BRCA1 gene, no mutation in the BRCA2 gene, or no mutation in both the BRCA1 and BRCA2 genes.

[0034] In addition, the present invention provides the use of the BRCA1-specific siRNA and / or BRCA2-specific siRNA for the preparation of a pharmaceutical composition for the purpose of enhancing the cancer cell killing effect of a PARP inhibitor.

[0035] The BRCA-specific siRNA of the present invention can enhance the sensitivity to PARP inhibitors in cancers that have a wild-type BRCA gene of about 80% or more and thus have a low cancer treatment effect with PARP inhibitors. The siRNA of the present invention is provided by being fused with SIRPα protein, and thus has excellent cancer cell targeting ability and intracellular delivery ability while exhibiting almost no cytotoxicity. Therefore, it is expected to be usefully used together with PARP inhibitors in the treatment of cancer patients having a wild-type BRCA gene.

[0036] Figure 1 is a schematic diagram of the mechanism of action of vSIRPα-siBRCA.

[0037] Figure 2 shows the results of confirming the target gene expression suppression effect of three types of siRNA that suppress the expression of BRCA1 or BRCA2. Figure 2A shows the silencing effect result of BRCA1 siRNA #1~3, and Figure 2B shows the silencing effect result of BRCA2 siRNA #1~3.

[0038] Figure 3A confirms the insertion of the vSIRPα-linker gene into the pET28a vector, Figure 3B confirms the expression of vSIRPα-linker in cells transformed with the vector by Coomassie gel staining, and Figure 3C reconfirms this by RP-HPLC.

[0039] Figure 4A is a schematic diagram of the manufacturing process and structure of vSIRPα-siBRCA.

[0040] Figure 4B confirms the production of vSIRPα-siBRCA by Nucleic acid staining.

[0041] Figure 5A shows the results of treating ID8 cells with vSIRPα-siBRCA-Cy5 and observing with a confocal microscope after nuclear staining, and Figure 5B shows the results of treating ID8 cells pre-incubated with anti-CD47 antibody with vSIRPα-siBRCA-Cy5 and observing with a confocal microscope after nuclear staining.

[0042] Figure 6A shows the results of confirming the survival rate of ID8 cells treated with vSIRPα-siBRCA1 or Lipo-siBRCA1. Figure 6B shows the results of confirming the survival rate of ID8 cells treated with vSIRPα-siBRCA1, vSIRPα-siBRCA2, or vSIRPα-siBRCA1 / 2.

[0043] Figure 7A shows the expression level of the BRCA1 gene in ID8 cells treated with various concentrations of vSIRPα-siBRCA1, as confirmed by RT-PCR analysis. Figure 7B shows the expression level of the BRCA2 gene in the same cells treated with various concentrations of vSIRPα-siBRCA2, as confirmed by RT-PCR analysis. Figures 7C and eh 7D show the expression levels of the BRCA1 or BRCA2 gene in ID8 cells treated with 400 nM of vSIRPα-siBRCA1 and vSIRPα-siBRCA2, respectively, as confirmed by RT-PCR analysis.

[0044] Figure 8 shows the results of flow cytometry analysis for γH2AX after treating ID8 cells with vSIRPα-siBRCA1, vSIRPα-siBRCA2, or vSIRPα-siBRCA1 / 2 and adding a PARP inhibitor.

[0045] Figures 9A to 9D show the results of IC50 analysis performed using MTS assay after treating ID8 cells cultured with vSIRPα-siBRCA with a PARP inhibitor (olaparib or talazoparib).

[0046] The present inventors sought to enhance the PARP inhibitor sensitivity of ovarian and breast cancer cells harboring the wild-type BRCA gene using siRNA targeting BRCA mRNA for effective treatment of these cancer cells. To achieve sufficient and specific delivery of the siRNA to these cancer cells, they developed a SIRPα-siBRCA conjugate. (Figure 1)

[0047] The BRCA1 and BRCA2 genes play a crucial role in DNA repair, and cancer cells with BRCA1 / 2 mutations repair DNA through the BER mechanism, which essentially requires the PARP protein. Therefore, PARP inhibitors can have a strong anti-tumor effect in hereditary breast and ovarian cancers caused by mutations in the BRCA1 and BRCA2 genes. However, the anti-cancer effect of PARP inhibitors is low in breast and ovarian cancers with wild-type BRCA genes without mutations.

[0048] The present inventors confirmed that treatment with PARP inhibitors in cells knocked down or knocked out of the BRCA1 and / or BRCA2 genes increased the expression level of γH2AX, a marker of DNA damage. Furthermore, they confirmed that suppressing the expression of BRCA2 or BRCA1 in BRCA1 or BRCA2-deficient cells, respectively, increased the level of cancer cell death induced by PARP inhibitors.

[0049] Accordingly, the present inventors provide siRNA capable of suppressing the expression of the BRCA1 or BRCA2 gene to enhance the anticancer effect of a PARP inhibitor in cancers having wild-type BRCA1 and / or BRCA2 genes.

[0050] In the present invention, 'siRNA (short interfering RNA)' refers to a double-stranded RNA capable of inducing RNAi, which suppresses gene activity. In the present invention, siRNA refers to an siRNA capable of suppressing the expression of a wild-type BRCA1 or wild-type BRCA2 gene. In this specification, an siRNA that suppresses the expression of a wild-type BRCA1 gene is used interchangeably with the term "siBRCA1," and an siRNA that suppresses the expression of a wild-type BRCA2 gene is used interchangeably with the term "siBRCA2."

[0051] Unless otherwise specified herein, the BRCA gene refers to a wild-type BRCA gene without mutation.

[0052] The present inventors searched for siRNAs that more effectively suppress the expression of the wild-type BRCA1 gene or the wild-type BRCA2 gene and selected the siRNAs shown in Table 3 below.

[0053] The BRCA-specific siRNA of the present invention can be synthesized chemically or enzymatically. The method for preparing siRNA is not particularly limited, and methods known in the art can be used. For example, a method of directly chemically synthesizing siRNA, a method of synthesizing siRNA using in vitro transcription, a method of cleaving long double-stranded RNA synthesized by in vitro transcription using an enzyme, an expression method through intracellular delivery of an shRNA expression plasmid or viral vector, and an expression method through intracellular delivery of a PCR (polymerase chain reaction)-induced siRNA expression cassette, but are not limited thereto.

[0054] Meanwhile, the introduction of the above-described siRNA into cells can be carried out using a microinjection method, a calcium phosphate co-precipitation method, an electroporation method, and a liposome method, but the inventors of the present invention developed a “fusion protein-siRNA complex” in which the siRNA is conjugated to a fusion protein in which a SIRPα protein and a linker peptide are covalently linked to improve the cancer cell targeting ability and intracellular delivery ability of the siRNA.

[0055] Therefore, in the present invention, BRCA1 or BRCA2 specific siRNA can be provided in the form of the above-described fusion protein-siRNA complex.

[0056] The fusion protein-siRNA complex of the present invention can be delivered into cells quickly and with high efficiency compared to direct administration of siRNA.

[0057] In the fusion protein of the present invention, the linker peptide is preferably cleavable so that the siRNA can be released from the complex in the cytoplasm, and more preferably, it may be a peptide having a sequence that is cleaved by a lysosomal degrading enzyme so that it can be cleaved when introduced into the cell.

[0058] The fusion protein-siRNA complex of the present invention is readily soluble in physiological solutions, allowing for easy absorption and excellent bioavailability. Specifically, the complex of the present invention facilitates cancer cell-specific intracellular delivery and has excellent potential stability compared to siRNA or SIRPα protein alone. Furthermore, there is no risk of uncontrolled replication, and since it does not require the use of viral or non-viral vectors for siRNA delivery, there is no need for concerns about interference with transfection or potential side effects, making it highly stable. Furthermore, compared to vector-like delivery vehicles, it is much cheaper to synthesize and has excellent delivery efficiency (maximum preventive or therapeutic effects can be achieved by administering low concentrations of siRNA and SIRPα protein), providing significant economic advantages.

[0059] The siRNA used in the production of the fusion protein-siRNA complex of the present invention is not limited to any siRNA capable of silencing a wild-type BRCA gene (BRCA1 or BRCA2 gene) or inhibiting the expression of the gene. However, in terms of the silencing effect, it is preferable to use one containing or consisting of a base sequence represented by SEQ ID NO: 3 or 5, and a maleimide may be bonded to the 3' end of the siRNA for conjugation with the fusion protein.

[0060] In the present invention, the term "complex" refers to a covalent complex formed by chemical bonding of the fusion protein and siRNA. The chemical bond is not particularly limited to one commonly used in the art, but preferably, a derivative containing a maleimide group may be bonded to the end of the siRNA as a linker to bind the cysteine ​​residue of the fusion protein and the siRNA, and the thiol of the cysteine ​​residue present in the fusion protein reacts with the siRNA maleimide group to form a bond.

[0061] The siRNA of the present invention aims to enhance the sensitivity of cancer cells to PARP inhibitors and to enhance the anticancer effect of PARP inhibitors by suppressing the expression of BRCA1 and / or BRCA2 in cancer cells, and the composition comprising the siRNA of the present invention is provided for use in combination with a PARP inhibitor, and the composition comprising the siRNA may be administered simultaneously, sequentially, or alternately with the PARP inhibitor, but preferably, the PARP inhibitor may be administered 24 hours after the administration of the siRNA.

[0062] That is, the pharmaceutical composition for preventing or treating cancer of the present invention aims to increase the sensitivity of cancer cells to a PARP inhibitor, and therefore, it is preferable that the pharmaceutical composition for preventing or treating cancer in the present invention be understood as a pharmaceutical auxiliary composition for preventing or treating cancer.

[0063] The composition of the present invention may be formulated by including one or more pharmaceutically acceptable carriers in addition to the above-described effective ingredients for administration.

[0064] In a composition formulated as a liquid solution, acceptable pharmaceutical carriers include sterile and biocompatible ones, such as saline solution, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and mixtures of one or more of these components. Other conventional additives, such as antioxidants, buffers, and bacteriostatic agents, may be added as needed.

[0065] In addition, the pharmaceutical composition for treating or preventing cancer can be manufactured using, in addition to the effective ingredient, a pharmaceutically suitable and physiologically acceptable adjuvant, and the adjuvant can be a solubilizing agent such as an excipient, a disintegrant, a sweetener, a binder, a coating agent, a swelling agent, a lubricant, a glidant, or a flavoring agent.

[0066] In the present invention, there is no particular limitation on the formulation of the pharmaceutical composition, but it is preferable to provide it as an injectable preparation such as an aqueous solution, suspension, emulsion, etc. by additionally adding a diluent, dispersant, surfactant, binder, and lubricant.

[0067] The pharmaceutical composition for treating or preventing cancer of the present invention targets receptors of cancer cells and already has specificity for cancer cells, so the route of administration is not particularly limited, but is preferably administered in a conventional manner through intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, intrasternal, transdermal, intranasal, nasal, inhalation, topical, rectal, oral, intraocular, or intradermal routes, but is most preferably administered through intravenous injection, but is not particularly limited thereto. Depending on the purpose, it may be administered intraperitoneally, intramuscularly, subcutaneously, orally, intranasally, intrapulmonary, or rectally.

[0068] The composition of the present invention may further include suitable carriers, excipients, and diluents commonly used in the manufacture of pharmaceutical compositions and the like. The "carrier" is a compound that facilitates the addition of the compound into cells or tissues. The "diluent" is a compound that not only stabilizes the biologically active form of the target compound but also dilutes in water to dissolve the compound.

[0069] Carriers, excipients, and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. When formulated, the composition is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

[0070] The term "administration" as used in the present invention means providing a given composition of the present invention to a subject by any suitable method.

[0071] The amount of the composition of the present invention to be used may vary depending on the sex, weight, age, etc. of the subject, and above all, will depend on the condition of the subject to be treated, the specific category or type of the disease to be treated, the route of administration, and the properties of the therapeutic agent used.

[0072] In the present invention, the “subject” is not limited to a mammal, but is preferably a cancer patient without a mutation in the BRCA1 and / or BRCA2 gene, or a cancer patient with a wild-type BRCA1 and / or wild-type BRCA2 gene. The cancer patient with the wild-type BRCA gene may be a patient for whom the cancer treatment effect by a PARP inhibitor is lower than expected, and may be a patient with a wild-type BRCA gene of about 80% or more.

[0073]

[0074] Hereinafter, embodiments are described in detail with reference to the attached drawings. However, the embodiments may be modified in various ways, and the scope of the patent application is not limited or restricted by these embodiments. It should be understood that all modifications, equivalents, or alternatives to the embodiments are included within the scope of the patent application.

[0075]

[0076] The terms used in the examples are for illustrative purposes only and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, terms such as "comprise" or "have" are intended to indicate the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but should be understood to not preclude the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.

[0077]

[0078] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiments pertain. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0079]

[0080] In addition, when describing with reference to the attached drawings, identical components will be assigned the same reference numerals regardless of the drawing numbers, and redundant descriptions thereof will be omitted. When describing embodiments, if a detailed description of a related known technology is judged to unnecessarily obscure the gist of the embodiment, the detailed description will be omitted.

[0081] [Experimental Methods and Materials]

[0082] 1. Materials

[0083] The DNA plasmid encoding enhanced vSIRPα was purchased from Cosmo Genetech (Seoul, Republic of Korea). BRCA1 siRNA, BRCA2 siRNA, and Cy5-conjugated BRCA1 siRNA were purchased from Integrated DNA Technologies (IDT; Coralville, IA, USA). Kanamycin, isopropyl β-D-1-thiogalactopyranoside (IPTG), maleimide-PEG2-NHS ester, and cathepsin B were purchased from Sigma-Aldrich (St. Louis, MO, USA). pET28a vector and Lipofectame3000 were purchased from Invitrogen (Carlsbad, CA, USA), and T4 DNA ligase and Nde1 and HindIII restriction enzymes were purchased from New England Biolabs (Ipswich, MA, USA). LB broth, phenol chloroform isoamylalchol, and bromophenol blue were purchased from Sigma-Aldrich. RNeasy Mini Kit and Ni-NTA agarose were provided by Qiagen (Hilden, Germany). For some cell experiments, RPMI medium, fetal bovine serum (FBS), and penicillin-streptomycin mixture (Pen-Strep) were provided by Gibco (Carlsbad, CA, USA). Anti-mouse CD47 antibody (MIAP301) and PE anti-H2A.Phospho X (Ser139) was provided by BioLegend (San Diego, CA, USA), iScriptTM Reverse Transcription Super mix was provided by Bio-Rad Laboratories (Hercules, CA, USA), SYBR Green PCR Master Mix was purchased from Life Technologies (Carlsbad, CA, USA), CellTiter 96 Aqueous One Solution Cell Proliferation Assay was provided by (Madison, WI, USA). Olaparib was purchased from Santa Cruz Biotechnology (Dallas, TX, USA), and talazoparib (BMN673) was purchased from Selleck chemical (Houston, TX, USA).

[0084]

[0085] 2. Preparation of vSIRPα-linker

[0086] To produce a fusion protein comprising the vSIRPα protein, a lysosomal cleavable linker (GFLG) peptide, and a region to which siRNA is conjugated, the following sequence was inserted into the C-terminal gene of vSIRPα to produce a vSIRPα-linker DNA fragment: CATATGGAAGAGGAGCTGCAGATCATCCAGCCTGACAAGTCCGTGCTGGTCGCTGCTGGTGAAACTGCCACTCTGCGTTGTACGATTACCAGCCTGTTCCCGGTGGGTCCAATCCAGTGGTTCCGTGGTGCTGGTCCGGGTCGTGTTCTGATCTACAACCAGCGTCAAGGTCCGTTCCCGCGTGTAACTACCGTTAGCGATACCA CGAAGCGTAACAACATGGACTTTTCCATCCGCATTGGCAATATTACCCCGGCCGACGCGGGCACCTACTATTGCATCAAATTTCGCAAAGGCTCCCCGGATGATGTAGAATTTAAATCTGGCGCAGGCACCGAACTGTCTGTTCGCGCAAAACCGGTCGACGGTGGGTTTCTGGGTGGGGGAGGATGCGGTTGAAAGCTT (SEQ ID NO: 1). The underlined region is the GFLG coding sequence.

[0087] To obtain recombinant vSIRPα from E. coli BL21, the vSIRPα-linker DNA fragment was inserted into the pET28a vector to construct the pET28a-vSIRPα-linker vector, which was then transformed into E. coli BL21. Colonies were selected and cultured in LB broth, and after isolation of the plasmid DNA by a standard method, the DNA composition of the vSIRPα-linker plasmid was confirmed by electrophoresis on a 0.8% agarose gel. The transformed E. coli BL21 was cultured at 20°C for 14-16 hours under 0.5 mM IPTG conditions to induce protein expression. The following day, the cell culture was centrifuged at 5,000 rpm for 15 minutes to obtain E. coli BL21, and the cells were lysed by sonication for 2 hours. The lysed samples were centrifuged at 13,000 rpm for 10 min at 4°C and purified using a Ni-NTA column. After purification, vSIRPα expression was confirmed by SDS-PAGE and HPLC.

[0088]

[0089] 3. siBRCA preparation

[0090] First, three siRNAs capable of inhibiting the expression of BRCA1 or BRCA2 were designed and produced. Table 1 below shows the specific sequence information of the three BRCA1 siRNAs, and Table 2 below shows the specific sequence information of the three BRCA2 siRNAs. The results of measuring the level of BRCA1 or BRCA2 expression inhibition by each siRNA using the TriFECTa kit (IDT) are shown in Figures 2A and 2B. The finally optimized BRCA1 siRNA and BRCA2 siRNA are shown in Table 3 below. In Tables 1 to 3 below, * indicates deoxyribonucleotide (DNA).

[0091]

[0092]

[0093]

[0094] SEQ ID NO: BRCA2siRNA #1SenseAUGCUAUUGAGAAUAUCGAUACA*T*T4AntisenseAAUGUAUCGAUAUUCUCAAUAGCAUGC5BRCA2siRNA #2SenseGUCAAACCUUUCUGGUCUAAAUG*A*A10AntisenseUUCAUUUAGACCAGAAAGGUUUGACUG11BRCA2siRNA #3SenseGCAUGAUUGGUUCUGCUAGAGCU*C*C12AntisenseGGAGCUCUAGCAGAACCAAUCAUGCAG13

[0095]

[0096] SEQ ID NO: BRCA1siRNASense5'-Amine-CUUGAACCAA UCAGUAGAAAUCC*A*A-3' (*; DNA)2Antisense5'-UUGGAUUCUACUGUGGUUCAAGUG-3'3BRCA2siRNASense5'-Amine-AUGCUAUUGAGAAUAUCAUCA*T*T-3'4Antisense5'-AAUGUAUCGAUUCAUUCAAUAGCAUGC-3'5

[0097]

[0098] 4. Synthesis and Characterization of vSIRPα-siBRCA

[0099] Amine-modified siBRCA (10 nmol) was conjugated to maleimide-NHS (300 nmol) in 50 mM HEPES (pH 7.4) at 4°C for 4 h. The maleimide-conjugated siBRCA was purified using a NAP-10 column and lyophilized. Subsequently, recombinant vSIRPα (10 nmol) containing the linker was conjugated to the maleimide-conjugated siBRCA (10 nmol) via a thiol-maleimide coupling reaction in 50 mM HEPES (pH 7.0–7.4) for 4 h. After performing 12% SDS-PAGE, the gel was stained with GelRed Nucleic Acid dye (10,000X) and scanned with GelDotTMXR+ (Bio-Rad) to confirm vSIRPα-siBRCA synthesis.

[0100]

[0101] 5. Cellular uptake and cytotoxicity

[0102] ID8, a mouse ovarian cancer cell line, was cultured in RPMI 1640 containing 10% FBS, 1% Pen-Strep, 1% L-glutamine, 0.5% sodium pyruvate, and 1.7 μl β-mercaptoethanol in an incubator at 37ºC and 5% CO2. 2 × 10 cells were seeded in 35 mm cover glass dishes. 5 Cells were seeded on the cells / dish.

[0103] For the cellular uptake assay, Cy5-conjugated siBRCA1 was used as the siBRCA in vSIRPα-siBRCA. To determine whether the cellular uptake of vSIRPα-siBRCA was CD47-dependent, ID8 cells were pre-incubated with anti-CD47 antibody for 30 min. After incubation, cells were fixed with 4% formaldehyde, incubated with DAPI for 10 min at room temperature to stain the nuclei, and observed using a confocal microscope.

[0104] To determine the cytotoxicity of vSIRPα-siBRCA, ID8 cells were seeded at 3 x 10 per well in a 96-well microplate. 3 Cells were seeded and treated with various concentrations of vSIRPα-siBRCA1 or siBRCA1-mixed lipofectamine (Lipo-siBRCA1), and cell viability was determined 48 hours later using a cell proliferation assay kit. The absorbance of the solution was measured at 490 nm using a plate reader.

[0105]

[0106] 6. In vitro gene silencing

[0107] ID8 cells were seeded at 2 × 10 in 6-well plates. 5Cells were seeded per dish and cultured for 48 h with PBS, siBRCA1, siBRCA1 and lipofectamine, or vSIRPα-siBRCA1. The final concentration of each sample was set to 600 nM. RNA was isolated using the RNeasy Mini Kit according to the manufacturer's instructions, and cRNA was synthesized using iScriptTM Reverse Transcription Super mix. Similarly, ID8 cells were treated with PBS, siBRCA1, siBRCA2 and lipofectamine (Lipo-siBRCA2), or vSIRPα-siBRCA2, cultured for 48 h, and RNA was obtained as described above and analyzed by RT-PCR.

[0108]

[0109] 7. DNA damage analysis using flow cytometry

[0110] We aimed to determine the reduction in DNA repair mechanism activation and DNA damage levels by PARP inhibitors (PARPi).

[0111] ID8 cells were seeded at 2 × 10 in 6-well plates. 5 Cells were seeded per dish and cultured with PBS, vSIRPα-siBRCA1, vSIRPα-siBRCA2, and vSIRPα-siBRCA1 / 2 for 48 h. The cells were then trypsinized and seeded at 2 × 10 5 Cells were seeded per dish and treated with olaparib or talazoparib at the indicated concentrations for 24–48 hours.

[0112] Afterwards, cells were detached with Trypsin-EDTA, blocked with PBS containing 1% FBS for 30 minutes, and stained with phospho-H2AX antibody for 2 hours. After washing with PBS, flow cytometry analysis was performed using a FACS device.

[0113]

[0114] [Experimental Results]

[0115] 1. Synthesis and in vitro characterization of vSIRPα-siBRCA1 / 2 conjugates.

[0116] The C-terminus of vSIRPα contains a linker sequence that can bind to maleimide-modified siBRCA and be cleaved in the cytoplasm following CD47-mediated endocytosis. The DNA sequence encoding the vSIRPα-linker was cloned into the pET28a vector encoding vSIRPα, and the PCR product from the resulting plasmid was analyzed by agarose gel electrophoresis, confirming that the 400-bp vSIRPα-linker gene was inserted as expected into the plasmid vector (Fig. 3A).

[0117] The above recombinant plasmid vector was transformed into E. coli BL21, and the transformed BL21 cells were cultured and vSIRPα expression was induced, which was confirmed by SDS-PAGE and RP-HPLC (Figures 3B and 3C).

[0118] To synthesize vSIRPα-siBRCA, cysteine ​​residues of the modified vSIRPα protein were conjugated to maleimide-conjugated siBRCA via thiol-maleimide coupling ( Fig. 4A ). The production of vSIRPα-siBRCA conjugates was confirmed by PAGE gel analysis with nuclear staining, as evidenced by a slight band shift upon siBRCA conjugation compared to vSIRPα+linker ( Fig. 4B ).

[0119]

[0120] 2. CD47-mediated endocytosis of vSIRPα-siBRCA conjugates in vitro

[0121] Because siRNA has a high negative charge, it has difficulty penetrating cell membranes. To efficiently deliver siRNA into cancer cells, we designed vSIRPα-siBRCA, and confirmed the uptake efficiency of the vSIRPα-siBRCA conjugate using Cy5-conjugated siBRCA. The degree of cellular uptake of the conjugate was confirmed by comparison with Cy5-conjugated siBRCA.

[0122] ID8 cells are cells with relatively high CD47 expression levels. ID8 cells were treated with the vSIRPα-siBRCA or siBRCA, stained, and observed using a confocal microscope (Figs. 5A and 5B). As a result, the vSIRPα-siBRCA conjugate was highly efficiently taken up into cancer cells within 3 to 6 hours, whereas naked siBRCA showed very low uptake even after 6 hours (Fig. 5A). From the above, it can be seen that the vSIRPα-siBRCA conjugate can be taken up into cells more efficiently than siRNA and can be selectively taken up by CD47-overexpressing cells (Fig. 5B).

[0123]

[0124] 3. Cytotoxicity and gene silencing of vSIRPα-siBRCA conjugates in vitro

[0125] The cytotoxicity of the vSIRPα-siBRCA conjugate was evaluated by measuring cell viability 48 hours after treatment with the vSIRPα-siBRCA conjugate in ID8 cells. The cytotoxicity of the vSIRPα-siBRCA conjugate was compared with that of Lipo-siBRCA.

[0126] As a result, we confirmed that the viability of cells administered Lipo-siBRCA1 decreased at 100 nM and significantly decreased at a concentration of 2 μM, whereas vSIRPα-siBRCA1 did not show significant toxicity up to 2 μM (Fig. 6A). In addition, vSIRPα-siBRCA2 did not show significant toxicity up to 1 μM, whereas cell viability was slightly reduced when 1 μM of vSIRPα-siBRCA1 and vSIRPα-siBRCA2 were simultaneously treated (Fig. 6B). Unlike Lipofectamine™, Lipo-siBRCA did not show significant toxicity up to 2 μM.

[0127] Next, the expression level of the BRCA gene was determined by treating ID8 cells with the vSIRPα-siBRCA conjugate. The vSIRPα-siBRCA conjugate was treated to cells at a concentration of 200 nM or 400 nM, and for comparison, the same experiment was performed using the same amount of Lipo-siBRCA.

[0128] As a result, 200 nM vSIRPα-siBRCA1 downregulated the BRCA1 gene similarly to the same amount of Lipo-siBRCA1, and 200 nM vSIRPα-siBRCA2 also exhibited the same gene silencing effect (Fig. 7). Specifically, 200 nM vSIRPα-siBRCA2 reduced the expression level of the BRCA2 gene by approximately 75%, 400 nM vSIRPα-siBRCA2 reduced the expression level of the BRCA2 gene by approximately 90%, and 400 nM vSIRPα-siBRCA1 reduced the expression level of the BRCA1 gene by approximately 85% (Fig. 7A and B). In addition, when 400 nM of vSIRPα-siBRCA1 and vSIRPa-BRCA2 were treated simultaneously, it was confirmed that the expression levels of the BRCA1 and BRCA2 genes were reduced by 85-90%, respectively (Fig. 7C and eh 7D).

[0129]

[0130] 4. DNA damage following PARP inhibitor treatment in BRCA silenced cells

[0131] To evaluate the level of PARP inhibitor-mediated DNA damage in BRCA gene-silenced cells, the expression level of γH2AX (phospho-H2AX), a DNA damage marker, was measured by flow cytometry.

[0132] The BRCA silenced ID8 cells were treated with vSIRPα-siBRCA1 and vSIRPα-siBRCA2, either alone or in combination, and 48 hours later, the PARP inhibitor talazoparib was treated to each cell and cultured for 48 hours. As a result, a significantly increased expression level of γH2AX was confirmed in ID8-sgBRCA1 / 2 cells.

[0133] Flow cytometric analysis of the experimental group treated with 0.01 μM talazoparib in BRCA silenced cells showed that γH2AX increased approximately 1.32-fold in BRCA1 silenced cells, 2.16-fold in BRCA2 silenced cells, and 3.06-fold in BRCA1 / 2 silenced cells compared to the control group (Fig. 8).

[0134] From the above results, it was found that silencing the BRCA2 gene enhances the sensitivity of cells to PARP inhibitors more than BRCA1, and in particular, when BRCA1 / 2 were co-silenced, the sensitivity to PARP inhibitors was most greatly enhanced.

[0135]

[0136] 5. PARP inhibitor-mediated cell death following BRCA1 or BRCA2 expression silencing

[0137] BRCA gene knockdown and knockout are highly correlated with the synthetic lethal cell death-inducing efficacy of PARP inhibitors. Therefore, we aimed to determine whether PARP inhibitors could induce apoptosis in tumor cells after silencing BRCA1 / 2 expression. Treatment of ID8 cells with vSIRPα-siBRCA conjugates effectively knocked down BRCA1 and / or BRCA2. ID8 cells were treated with vSIRPα-siBRCA conjugates for 48 hours, followed by treatment with various concentrations of talazoparib for 72 hours. Compared with BRCA normal-expressing cells, the IC50 of talazoparib was reduced by 3.23-fold and 4.34-fold in BRCA1-knockdown and BRCA2-knockdown ID8 cells, respectively (Figures 9A and 9D). In particular, in cells co-administered with vSIRPa-siBRCA1 and vSIRPa-BRCA2, the IC50 of talazoparib was reduced by 28.11-fold. These results suggest that the effect of talazoparib may be further enhanced by BRCA2 knockdown in BRCA1 null cancer cells. To confirm this, BRCA2 was knocked down in BRCA1-deficient ID8 cells, and as a result, it was confirmed that the IC50 of talazoparib was reduced by approximately 3.6-fold by BRCA2 knockdown (Figures 9B and 9D).

[0138] The same experiment was performed using the PARP inhibitor olaparib, and the IC50 value of olaparib in ID8-BRCA1 / 2 silenced cells was approximately 13.97 times lower than that in ID8 control cells, approximately 3.76 times lower in ID8-BRCA1 silenced cells, and 2.77 times lower in BRCA2 silenced cells (Figures 9C and 9D).

[0139] From the above, it can be seen that inhibition of the expression of BRCA1 and / or BRCA2 increases the sensitivity to PARP inhibitors in ovarian cancer cells.

[0140]

[0141] Although the embodiments described above have been described with limited drawings, those skilled in the art will appreciate that various technical modifications and variations can be applied based on the above. For example, appropriate results can still be achieved even if the described techniques are performed in a different order than described, and / or components of the described systems, structures, devices, circuits, etc. are combined or combined in a different manner than described, or are replaced or substituted with other components or equivalents.

[0142] Therefore, other implementations, other embodiments, and equivalents to the claims also fall within the scope of the claims described below.

Claims

1. A pharmaceutical composition for preventing or treating cancer, comprising BRCA (Breast Cancer Susceptibility Gene)1 specific siRNA (small interfering RNA) and / or BRCA2 specific siRNA as an active ingredient, A pharmaceutical composition wherein the composition is administered in combination with a PPAR (poly ADP-ribose polymerase) inhibitor.

2. In paragraph 1, The above BRCA1-specific siRNA is an oligonucleotide of 15 to 31 nt in length that can complementarily bind to BRCA1 mRNA, A pharmaceutical composition, wherein the above BRCA2-specific siRNA is an oligonucleotide having a length of 15 to 31 nt that can complementarily bind to BRCA2 mRNA.

3. In paragraph 1, The above BRCA1-specific siRNA contains the base sequence represented by sequence number 3, A pharmaceutical composition, wherein the BRCA2-specific siRNA comprises a base sequence represented by SEQ ID NO:

5.

4. In paragraph 1, A pharmaceutical composition, wherein the cancer is at least one type of cancer selected from the group consisting of ovarian cancer, breast cancer, and prostate cancer.

5. In paragraph 4, A pharmaceutical composition, wherein the cancer is a cancer comprising a wild-type BRCA1 gene and / or a wild-type BRCA2 gene.

6. In paragraph 1, A pharmaceutical composition wherein the above siRNA is conjugated to a fusion protein in which a SIRPα protein and a linker peptide that is cleaved by a lysosomal enzyme are covalently linked.

7. A composition for enhancing the sensitivity of cancer cells to a PPAR (poly ADP-ribose polymerase) inhibitor, comprising BRCA (Breast Cancer Susceptibility Gene)1 specific siRNA (small interfering RNA) and / or BRCA2 specific siRNA as an active ingredient.

8. In paragraph 7, The above BRCA1-specific siRNA contains the base sequence represented by sequence number 3, A composition wherein the above BRCA2-specific siRNA comprises a base sequence represented by SEQ ID NO:

5.

9. In paragraph 7, A composition wherein the cancer is at least one type of cancer selected from the group consisting of ovarian cancer, breast cancer, and prostate cancer.

10. In paragraph 7, A composition wherein the cancer cells are cancer cells comprising a wild-type BRCA1 gene and / or a wild-type BRCA2 gene.

11. In paragraph 7, A composition wherein the above siRNA is conjugated to a fusion protein in which a SIRPα protein and a linker peptide that is cleaved by a lysosomal enzyme are covalently linked.

12. A fusion protein-siRNA complex in which siRNA is conjugated to a fusion protein covalently linked to a SIRPα protein and a linker peptide that is cleaved by a lysosomal enzyme. A fusion protein-siRNA complex, wherein the siRNA comprises a base sequence represented by SEQ ID NO: 3 or SEQ ID NO: 5.

Images