Uses of zmst1 protein and coding gene thereof in regulation and control of stay-green, disease resistance and yield of plant

Abstract

Disclosed are uses of a ZmST1 protein and a coding gene thereof in regulation and control of the stay-green, disease resistance and yield of a plant. A ZmST1 overexpression strain is constructed by overexpressing a ZmST1 protein in corn, and by analyzing the phenotypes of the leaf stay-green property and the disease resistance and the yield of the ZmST1 overexpression strain in the mature period, it is found that: compared with the wild type, the ZmST1 overexpression strain shows that the visible functional stay-green is prolonged, the field disease resistance is enhanced, the stem diameter of the cluster is increased, the grain is increased, and the yield is increased. It is indicated that the ZmST1 protein or the coding gene thereof can regulate and control the stay-green and disease resistance of the leaves in the mature period of the corn by participating in transferring of products of photosynthesis in chloroplasts of the corn, delay the aging process of the leaves, prolong the stay-green functional period of the leaves of the plant, and increase the yield of the corn. The present invention has important significance for cultivating high-yield corn.

Description

Application of ZmST1 protein and its encoding gene in regulating plant stay-green, disease resistance and yield

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to the Chinese patent application (application number 202310784939.0) filed on June 29, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present invention belongs to the field of biotechnology, and in particular relates to the application of ZmST1 protein and its encoding gene in regulating plant stay-greenness, disease resistance and yield. Background Art

[0004] As one of the three major staple food crops, corn is currently the most widely cultivated and highest-yielding crop. Furthermore, corn is also an important feed crop and industrial raw material. Therefore, increasing corn yield is crucial for ensuring food security and meeting market demand. Currently, the key to increasing crop yield lies in three key areas: 1. Improving the photosynthetic capacity of "source" tissues; 2. Improving the sugar unloading capacity of the phloem; and 3. Improving the sugar unloading and storage capacity of "sink" tissues. As autotrophic organisms, plants primarily photosynthesize light energy through chloroplasts, converting it into chemical energy, primarily in the form of sugars, which provide energy for plant growth and development. The transport of sugars from "source" to "sink" tissues influences all stages of plant vegetative and reproductive growth. In particular, the redistribution of photosynthetic products and their transport capacity to "sink" tissues directly influence the size of these organs and crop yield. Sugar transporters play a key role in the transport of sugars from "source" to "sink" tissues within plants.

[0005] ATP-binding cassette transporters (ATP-BCTs), one of the largest protein subfamilies in plants, transport substrates including sugars, metal ions, and auxins, participating in numerous physiological and biochemical processes. Maize contains 133 ATP-binding cassette transporter members, but their functions are poorly understood. Further research is needed to understand their roles in the transport of photosynthetic products and the distribution of sugars.

[0006] SUMMARY OF THE INVENTION

[0007] The technical problem to be solved by the present invention is how to regulate plant stay-greenness, disease resistance, and yield. The technical problem to be solved is not limited to the technical subject matter described herein, and those skilled in the art will clearly understand other technical subjects not mentioned herein through the following description.

[0008] In a first aspect, the present invention claims novel uses of ZmST1 protein or biomaterials related to ZmST1 protein.

[0009] The present invention claims the use of ZmST1 protein or a biomaterial related to ZmST1 protein in any one of the following 1)-5):

[0010] 1) Regulate plant stay-greenness;

[0011] 2) regulating plant yield;

[0012] 3) Regulate plant disease resistance;

[0013] 4) Cultivating transgenic plants with improved stay-green properties and / or increased yield and / or increased disease resistance;

[0014] 5) Plant breeding;

[0015] The ZmST1 protein is any one of a1), a2), a3), or a4):

[0016] a1) a protein having an amino acid sequence of SEQ ID No. 3;

[0017] a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in a1);

[0018] a3) a protein related to plant green retention, disease resistance or yield obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence described in a1);

[0019] a4) A protein having 90% identity with the amino acid sequence of a1), derived from maize and associated with plant stay-green, disease resistance or yield.

[0020] Among them, SEQ ID No. 3 consists of 220 amino acid residues.

[0021] In the protein described in a2) above, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and / or a SUMO tag, among others.

[0022] In the protein described in a3) above, the substitution and / or deletion and / or addition of amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0023] In the protein described in a4) above, the identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, a search can be performed using blastp as the program, setting the Expect value to 10, all filters to OFF, BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity value (%) can then be obtained. The identity includes amino acid sequences having 90% or greater, or 91% or greater, or 92% or greater, or 93% or greater, or 94% or greater, or 95% or greater, or 96% or greater, or 97% or greater, or 98% or greater, or 99% or greater homology to the amino acid sequence of SEQ ID No. 3 of the present invention.

[0024] The protein described in a1) or a2) or a3) or a4) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0025] The biological material is any one of the following A1) to A12):

[0026] A1) a nucleic acid molecule encoding a ZmST1 protein;

[0027] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0028] A3) a recombinant vector containing the nucleic acid molecule described in A1);

[0029] A4) a recombinant vector containing the expression cassette described in A2);

[0030] A5) a recombinant microorganism containing the nucleic acid molecule described in A1);

[0031] A6) a recombinant microorganism containing the expression cassette described in A2);

[0032] A7) a recombinant microorganism containing the recombinant vector described in A3);

[0033] A8) a recombinant microorganism containing the recombinant vector described in A4);

[0034] A9) a recombinant host cell containing the nucleic acid molecule described in A1);

[0035] A10) a recombinant host cell containing the expression cassette described in A2);

[0036] A11) a recombinant host cell containing the recombinant vector described in A3);

[0037] A12) A recombinant host cell containing the recombinant vector described in A4).

[0038] Furthermore, the nucleic acid molecule described in A1) is the gene shown in B1) or B2) or B3) below:

[0039] B1) DNA molecule shown in SEQ ID No. 1;

[0040] B2) DNA molecule shown in SEQ ID No. 2;

[0041] B3) A DNA molecule having 75% or more identity with the nucleotide sequence defined in B1) or B2) and encoding the above-mentioned ZmST1 protein.

[0042] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0043] Those skilled in the art can readily mutate the nucleotide sequence encoding the ZmST1 protein of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that share 75% or greater identity with the nucleotide sequence encoding the ZmST1 protein are derived from and equivalent to the nucleotide sequence of the present invention, as long as they encode the ZmST1 protein and have the same function.

[0044] As used herein, the term "identity" refers to sequence similarity to a naturally occurring nucleic acid sequence. "Identity" includes nucleotide sequences that are 75% or greater identical to the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence set forth in SEQ ID No. 3. Identity can be assessed visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess identity between related sequences.

[0045] The 75% or greater identity may be 75%, 80%, 85%, 90% or 95% greater. The 75% or greater identity may be at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The 85% or greater identity may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or greater identity may be at least 95%, 96%, 97%, 98%, or 99% identity.

[0046] In the above applications, the expression cassette refers to a DNA capable of expressing the ZmST1 protein in a host cell. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule containing all regulatory sequences necessary for expressing the ZmST1 protein nucleic acid molecule. The regulatory sequences are capable of directing the coding sequence to express the ZmST1 protein in a suitable host cell under compatible conditions. The regulatory sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, the regulatory sequence must include a promoter and termination signals for transcription and translation. The regulatory sequence may be provided with a linker to introduce specific restriction enzyme sites into the vector for ligating the regulatory sequence to the coding region of the protein-encoding nucleic acid sequence. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence recognized by the host cell in which the nucleic acid sequence is expressed. The promoter sequence contains transcriptional regulatory sequences that mediate protein expression. The promoter may be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutant, truncated, and hybrid promoters, and may be derived from a gene encoding an extracellular or intracellular protein that is homologous or heterologous to the host cell. The regulatory sequence may also be a suitable transcriptional terminator sequence, i.e., a sequence that is recognized by the host cell and thereby terminates transcription. The terminator sequence may be operably linked to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that is functional in the selected host cell may be used in the present invention. The regulatory sequence may also be a suitable leader sequence, i.e., an untranslated region of an mRNA that is important for translation in the host cell. The leader sequence may be operably linked to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that is functional in the selected host cell may be used in the present invention. The regulatory sequence may also be a signal peptide coding region, which encodes an amino acid sequence attached to the amino terminus of the protein that directs the encoded protein into the cell's secretory pathway. Any signal peptide coding region that directs the expressed protein into the secretory pathway of the host cell may be used in the present invention. It may also be desirable to add regulatory sequences that can regulate protein expression based on the growth of the host cell.

[0047] In the above application, the vector refers to a vector capable of carrying the ZmST1 gene into the host cell for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e., cosmid), Ti plasmid, viral vector (such as retrovirus (including lentivirus), adenovirus, adeno-associated virus, etc.).

[0048] In the above-mentioned application, the recombinant vector refers to the recombinant DNA molecule formed by connecting the ZmST1 gene to the vector in vitro. Available existing plant expression vectors can be used to construct a recombinant vector containing the ZmST1 gene or the ZmST1 gene expression cassette. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company) etc. The plant expression vector can also include the 3' end non-translated region of the foreign gene, i.e., include a polyadenylic acid signal and any other DNA fragments that participate in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylation to the 3' end of the mRNA precursor, such as the non-translated region transcribed at the 3' end of Agrobacterium crown gall induction (Ti) plasmid genes (such as the nopaline synthase gene Nos) and plant genes (such as soybean storage protein genes) all have similar functions. When using the gene construction plant expression vector of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signals and start codons are wide, and can be natural or synthetic. The translation initiation region can come from a transcription initiation region or a structural gene. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be modified to include genes encoding enzymes or luminescent compounds that can be expressed in plants (such as the GUS gene, luciferase gene), antibiotic marker genes (such as the nptII gene, which confers resistance to kanamycin and related antibiotics; the bar gene, which confers resistance to the herbicide phosphinothricin; the hph gene, which confers resistance to the antibiotic hygromycin; the dhfr gene, which confers resistance to methotrexate; and the EPSPS gene, which confers resistance to glyphosate), chemical resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes, which provide the ability to metabolize mannose. For the safety of transgenic plants, it is possible to omit any selectable marker genes and directly screen transformed plants using stress.

[0049] In the above applications, the microorganisms may be bacteria, fungi, actinomycetes, protozoa, algae or viruses. The bacteria may be from the genus Escherichia sp., Erwinia sp., Agrobacterium sp., Flavobacterium sp., Alcaligenes sp., Pseudomonas sp., Bacillus sp., etc., but are not limited thereto. For example, the bacteria may be Escherichia coli, Bacillus subtilis or Bacillus pumilus. The fungus may be a yeast, which may be from the genus Saccharomyces (such as Saccharomyces cerevisiae), the genus Kluyveromyces (such as Kluyveromyces lactis), the genus Pichia (such as Pichia pastoris), the genus Schizosaccharomyces (such as Schizosaccharomyces pombe), the genus Hansenula (such as Hansenula polymorpha), etc., but is not limited thereto. The fungus may also be from the genus Fusarium (Fusarium sp.), the genus Rhizoctonia (Rhizoctonia sp.), the genus Verticillium (Verticillium sp.), the genus Penicillium (Penicillium sp.), the genus Aspergillus (Aspergillus sp.), the genus Cephalosporium (Cephalosporium sp.), etc., but is not limited thereto. The actinomycetes may be from, but are not limited to, Streptomyces sp., Nocardia sp., Micromonospora sp., Streptosporangium sp., Actinoplanes sp., Thermoactinomyces sp., etc. The algae may be from, but are not limited to, Fucus sp., Achnanthes sp., Amphiprora sp., Amphora sp., Ankistrodesmus sp., Asteromonas sp., Boekelovia sp., etc. The virus may be, but are not limited to, rotavirus, herpes virus, influenza virus, adenovirus, etc.

[0050] In the above applications, the host cell (also referred to as the recipient cell) can be a plant cell or an animal cell. The host cell can be understood to refer not only to the specific recipient cell but also to the progeny of such a cell. Due to natural, accidental or intentional mutations and / or changes, the progeny may not necessarily be completely identical to the original parent cell, but are still included in the scope of host cells. Suitable host cells are known in the art, wherein: the plant cells may be, but are not limited to, plant cells such as Arabidopsis thaliana, tobacco (Nicotiana tabacum), corn (Zea mays), rice (Oryza sativa), and wheat (Triticum aestivum); the animal cells may be, but are not limited to, mammalian cells (e.g., Chinese hamster ovary cells (CHO cells), African green monkey kidney cells (Vero cells), baby hamster kidney cells (BHK cells), mouse breast cancer cells (C127 cells), human embryonic kidney cells (HEK293 cells), human HeLa cells, fibroblasts, bone marrow cell lines, T cells, or NK cells), avian cells (e.g., chicken or duck cells), amphibian cells (e.g., African clawed frog (Xenopus laevis) cells or giant salamander (Andrias davidianus) cells), fish cells (e.g., grass carp, carp, rainbow trout, or catfish cells), insect cells (e.g., Sf21 cells or Sf-9 cells), etc.

[0051] In the above applications, the recombinant microorganism (or recombinant host cell) refers to the manipulation and modification of the genes of the target microorganism (or target host cell) to obtain a recombinant microorganism (or recombinant host cell) with a changed function. For example, the recombinant microorganism (or recombinant host cell) obtained after the ZmST1 gene or recombinant vector is introduced into the target microorganism (or target host cell) can be understood as referring not only to a specific recombinant microorganism (or recombinant host cell), but also to the offspring of such a cell, and due to natural, accidental or intentional mutations and / or changes, the progeny may not necessarily be completely identical to the original parental cell, but is still included in the scope of the recombinant microorganism (or recombinant host cell).

[0052] In the above application, the regulating the staying green property of plants is regulating the staying green property of plant leaves.

[0053] Furthermore, the regulating the staying green property of plant leaves is to improve the staying green property of plant leaves (such as mature leaves).

[0054] In a specific embodiment of the present invention, when the content and / or activity of ZmST1 protein in a plant is increased, the leaves of the plant do not show obvious chlorosis during the mature stage and have a high stay-green property.

[0055] In the above application, the regulation of plant disease resistance is regulation of plant resistance to ear and grain rot.

[0056] Furthermore, the regulating the plant's resistance to ear and kernel rot is to improve the plant's resistance to ear and kernel rot.

[0057] In a specific embodiment of the present invention, when the content and / or activity of the ZmST1 protein in a plant is increased, the disease index of the plant to ear and kernel rot is reduced.

[0058] In the above application, the regulation of plant yield is embodied in any one of the following C1) to C4):

[0059] C1) regulating the stem thickness of plant ears;

[0060] C2) regulating plant grain length;

[0061] C3) regulating plant seed width;

[0062] C4) Regulating plant grain weight (e.g., 100-grain weight, standard plot grain weight).

[0063] Furthermore, the regulation of the plant's ear stem thickness, grain length, grain width and grain weight is to increase the plant's ear stem thickness, grain length, grain width and grain weight.

[0064] In a specific embodiment of the present invention, when the ZmST1 protein content and / or activity in a plant is increased, the ear stem diameter, grain length, grain width, 100-grain weight, and standard plot grain weight of the plant are increased.

[0065] In a second aspect, the present invention claims a method for producing transgenic plants with improved stay-green property and / or improved yield and / or improved disease resistance.

[0066] The method for cultivating transgenic plants with improved stay-green property and / or increased yield and / or improved disease resistance claimed in the present invention comprises the following steps: increasing the content and / or activity of ZmST1 protein in a recipient plant to obtain a transgenic plant; the stay-green property, yield and / or disease resistance of the transgenic plant are higher than those of the recipient plant.

[0067] In the above method, the transgenic plant has a higher staying green property than the recipient plant, which is reflected in that the leaves of the transgenic plant have a higher staying green property than the recipient plant, and is further reflected in that the leaves of the transgenic plant in the mature stage have a higher staying green property than the recipient plant.

[0068] In the above method, the disease resistance of the transgenic plant is higher than that of the recipient plant, which is reflected in that the transgenic plant has higher resistance to ear rot than that of the recipient plant, and is further reflected in that the disease index of the transgenic plant to ear rot is lower than that of the recipient plant.

[0069] In the above method, the yield of the transgenic plant is higher than that of the recipient plant, which is embodied in any one of the following E1) to E4):

[0070] E1) the transgenic plant has a greater ear stem than the recipient plant;

[0071] E2) the transgenic plant has a grain length greater than that of the recipient plant;

[0072] E3) the width of the grains of the transgenic plant is greater than that of the recipient plant;

[0073] E4) The grain weight of the transgenic plant is greater than that of the recipient plant.

[0074] The grain weight of the transgenic plant is greater than that of the recipient plant, which is further reflected in that the 100-grain weight and / or the standard plot grain weight of the transgenic plant are greater than those of the recipient plant.

[0075] In the above method, the method for increasing the content and / or activity of the ZmST1 protein in the recipient plant is to overexpress the ZmST1 protein in the recipient plant.

[0076] Furthermore, the overexpression method comprises introducing the gene encoding the ZmST1 protein into a recipient plant. The introduction includes, but is not limited to, transfection of plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transfection, and then cultivating the transfected plant cells or tissues into plants.

[0077] Furthermore, the nucleotide sequence of the gene encoding the ZmST1 protein is shown in SEQ ID No. 2.

[0078] In a specific embodiment of the present invention, the gene encoding the ZmST1 protein is introduced into a recipient plant via the overexpression vector pCAMBAIA3300-myc-ZmST1. The overexpression vector pCAMBAIA3300-myc-ZmST1 is obtained by replacing the DNA fragment between the two XcmI restriction sites in the pCAMBAIA3300-myc vector with the DNA molecule represented by SEQ ID No. 2, while maintaining the remaining sequences of the pCAMBAIA3300-myc vector unchanged.

[0079] In any of the above-described uses or methods, the transgenic plants are understood to include not only first-generation transgenic plants obtained by transforming the ZmST1 gene into a recipient plant, but also progeny thereof. Transgenic plants can be propagated within the species in which they are grown, or they can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. Transgenic plants include seeds, callus, whole plants, and cells.

[0080] In any of the above uses or methods, the ear rot is caused by Fusarium verticillioides.

[0081] In any of the above uses or methods, the plant is any one of the following D1) to D4):

[0082] D1) dicots or monocots;

[0083] D2) Grasses;

[0084] D3) Zea mays;

[0085] D4) Corn.

[0086] In a specific embodiment of the present invention, the corn variety is the corn inbred line ND101.

[0087] The transgenic plants produced according to the above method also fall within the protection scope of the present invention.

[0088] The present invention overexpresses the ZmST1 protein in corn to construct a ZmST1 overexpression strain. Phenotypic analysis of the ZmST1 overexpression strain's leaf stay-green and disease resistance at maturity, as well as yield, revealed that compared with the wild type, the ZmST1 overexpression strain exhibited visibly extended functional stay-green, enhanced field disease resistance, increased cob stem thickness, larger grains, and increased yield. This suggests that the ZmST1 protein or its encoding gene can regulate the stay-greenness and disease resistance of corn leaves at maturity by participating in the transport of photosynthetic products within corn chloroplasts, thereby delaying leaf senescence, extending the functional stay-green period of plant leaves, and increasing corn yield. The present invention is of great significance for cultivating high-yield and disease-resistant corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] FIG1 shows the identification of ZmST1 overexpression lines.

[0090] Figure 2 shows the leaf stay-green and disease resistance phenotypes of wild-type maize ND101 and ZmST1 overexpressing lines at maturity.

[0091] FIG3 shows the disease index of wild-type maize ND101 and ZmST1 overexpression lines.

[0092] FIG4 shows the grain weight of standard plots of wild-type maize ND101 and ZmST1 overexpressing lines.

[0093] FIG5 shows the ear phenotypes of wild-type maize ND101 and ZmST1 overexpression lines.

[0094] FIG6 shows the grain phenotype and 100-grain weight of wild-type maize ND101 and ZmST1 overexpression lines. Modes for Carrying Out the Invention

[0095] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0096] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques and conditions described in literature in the field or according to product specifications. Materials and reagents used in the following examples were commercially available unless otherwise noted. In the following examples, quantitative experiments were performed in triplicate or more, unless otherwise noted.

[0097] The maize inbred line ND101 in the following examples was provided by the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University and is recorded in the document “Liu F, Cheng J, Liu X, Wang X (2021) High-throughput and accurate determination of transgene copy number and zygosity in transgenic maize: from DNA extraction to data analysis. Int J Mol Sci 22: 12487”.

[0098] The Agrobacterium tumefaciens strain EHA105 in the following examples was provided by the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University and is described in the document “Chen, S.; Songkumarn, P.; Liu, J.; Wang, G.-LA Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics. Plant Physiol. 2009, 150, 1111-1121.”

[0099] The pCAMBAIA3300-myc vector in the following examples was provided by the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University, and is recorded in the document “Boxin Liu and others, Manipulating ZmEXPA4 expression ameliorates the drought-induced prolonged anthesis and silking interval in maize, The Plant Cell, Volume 33, Issue 6, June 2021, Pages 2058-2071, https: / / doi.org / 10.1093 / plcell / koab083.”

[0100] Example 1: Application of ZmST1 protein in improving plant stay-greenness, disease resistance and yield

[0101] 1. Acquisition and identification of ZmST1 overexpression lines

[0102] 1. Obtaining ZmST1 overexpression lines

[0103] 1) Construction of pCAMBAIA3300-myc-ZmST1 overexpression vector

[0104] The DNA fragment between the two XcmI restriction sites in the pCAMBAIA3300-myc vector was replaced with the DNA molecule shown in SEQ ID No. 2, while keeping the other sequences of the overexpression vector pCAMBAIA3300-myc unchanged to obtain the pCAMBAIA3300-myc-ZmST1 overexpression vector.

[0105] 2) Preparation of recombinant bacteria

[0106] The pCAMBAIA3300-myc-ZmST1 overexpression vector was introduced into EHA105 Agrobacterium, and after identification, EHA105 Agrobacterium containing the pCAMBAIA3300-myc-ZmST1 overexpression vector was obtained.

[0107] 3) Obtaining transgenic plants

[0108] Agrobacterium-mediated genetic transformation was used to transform immature embryos of wild-type maize inbred line ND101 with Agrobacterium EHA105 containing the pCAMBAIA3300-myc-ZmST1 overexpression vector to obtain T0 generation transgenic maize plants.

[0109] 4) PCR identification of ZmST1 overexpression lines

[0110] Extract genomic DNA from T0 transgenic corn plants and perform PCR identification using Bar-F and Bar-R primers. T0 transgenic corn plants that amplify a 552 bp fragment are considered positive plants. After 2-3 generations of breeding, homozygous lines are obtained. The primer sequences are as follows:

[0111] Bar-F: ATGAGCCCAGAACGACGC (SEQ ID No. 4);

[0112] Bar-R: TCAAATCTCGGTGACGGG (SEQ ID No. 5).

[0113] 2. RT-PCR identification of ZmST1 overexpression lines

[0114] RNA was extracted from the wild-type maize inbred line ND101 and the T3 generation homozygous ZmST1 overexpression line. cDNA was obtained using the TaRaRa reverse transcription kit. RT-PCR was performed using cDNA as a template and specific primers. The Ubiquitin gene was used as an internal reference. The primer sequences are as follows:

[0115] UbiP-seq:TTTTAGCCCTGCCTTCATACGC (SEQ ID No. 6);

[0116] NosR-seq: AGACCGGCAACAGGATTCAATC (SEQ ID No. 7);

[0117] Ubiquitin-F: TGGTTGTGGCTTCGTTGGTT (SEQ ID No. 8);

[0118] Ubiquitin-R: GCTGCAGAAGAGTTTTGGGTACA (SEQ ID No. 9).

[0119] The results are shown in Figure 1. The results showed that the wild-type maize inbred line ND101 and the lines without overexpression of ZmST1 had no bands, while the seven ZmST1 overexpression homozygous lines with different ZmST1 overexpression levels all had bands, which were recorded as ZmST1 overexpression homozygous lines. OE -1 to ZmST1 overexpression homozygous lines OE -7. Select ZmST1 overexpression homozygous strains OE -1 and ZmST1 overexpression homozygous lines OE -2 was used for the following analytical experiments.

[0120] 2. Application of ZmST1 protein in improving plant stay-greenness

[0121] Test material: T3 generation ZmST1 overexpression homozygous strain OE -1, T3 generation ZmST1 overexpression homozygous strain OE -2 and the wild-type maize inbred line ND101.

[0122] The T3 generation ZmST1 overexpression homozygous lines were OE -1, T3 generation ZmST1 overexpression homozygous strain OE -2 and wild-type maize inbred line ND101 (control) seeds were planted at the China Agricultural University Hainan Nanbin South Breeding Base in a double-row area with a row length of 2.5 meters, a row spacing of 60 centimeters, and a plant spacing of 25 centimeters. The plant phenotypes were observed after maturity.

[0123] The results are shown in Figure 2. It can be seen from the figure that compared with the wild-type maize inbred line ND101, the homozygous lines overexpressing ZmST1 at maturity OE -1 and ZmST1 overexpression homozygous lines OE -2 leaves have no obvious chlorosis and have a high degree of staying green.

[0124] 3. Application of ZmST1 protein in improving plant disease resistance

[0125] The T3 generation ZmST1 overexpression homozygous lines were OE -1, T3 generation ZmST1 overexpression homozygous strain OE -2 and wild-type maize inbred line ND101 (control) were planted in the Hainan Nanbin South Breeding Base of China Agricultural University in a double-row plot with a row length of 2.5 meters, a row spacing of 60 cm, and a plant spacing of 25 cm. 15 days after silking, individual maize plants were inoculated with a pathogen solution of Fusarium verticillioides. The specific inoculation steps were based on the method described in the literature "Yao, Lishan, et al. "Combined genome-wide association study and transcriptome analysis reveal candidate genes for resistance to Fusarium ear rot in maize." Journal of integrative plant biology 62.10(2020):1535-1551." The specific steps were as follows: an inoculator was used to inject 2 ml of pathogen solution (spore concentration of 5×10 6The inoculation site was sealed with waterproof tape after injection. Field phenotypic observations were conducted 45 days after inoculation. The bracts of the inoculated ears were removed and the disease severity was graded from 1 to 5 based on the comparison of the diseased area to the total area of ​​the ear: Grade 1, 0-1% of the diseased area; Grade 2, 2-10% of the diseased area; Grade 3, 11-25% of the diseased area; Grade 4, 26-50% of the diseased area; and Grade 5, 50% or more of the diseased area. The disease severity grade of each inbred line was converted into a disease severity index (DSI). The disease severity index (DSI) was statistically analyzed on a plot-by-plot basis: DSI (%) = Σ(specified disease severity value × number of plants with that value) × 100 / (1 × total number of plants).

[0126] The results are shown in Figure 3. The results show that: wild-type maize inbred line ND101, T3 generation ZmST1 overexpression homozygous line OE -1, T3 generation ZmST1 overexpression homozygous strain OE The disease indexes of ZmST1 overexpressing homozygous lines were 0.56, 0.30, and 0.39, respectively. Compared with the wild-type maize inbred line ND101, the disease index of the ZmST1 overexpressing homozygous lines was significantly reduced, indicating that the ZmST1 protein can regulate plant resistance to ear and kernel rot.

[0127] 4. Application of ZmST1 protein in improving corn yield

[0128] Test material: T3 generation ZmST1 overexpression homozygous strain OE -1, T3 generation ZmST1 overexpression homozygous strain OE -2 and the wild-type maize inbred line ND101.

[0129] The T3 generation ZmST1 overexpression homozygous lines were OE -1, T3 generation ZmST1 overexpression homozygous strain OE -2 and wild-type maize inbred line ND101 (control) were planted according to conventional methods at the China Agricultural University Gongzhuling Experimental Base in Jilin Province. The plots were double-rowed, with a row length of 2.5 meters, a row spacing of 60 centimeters, and a plant spacing of 25 centimeters. Three replicates were used. After reaching maturity, the ear and kernel phenotypes were observed, and corn yield was measured. The corn yield measured in this study was based on standard plot kernel weight and 100-kernel weight. Standard plot kernel weight was calculated as follows: Standard plot kernel weight = plot kernel weight × (1 - average kernel moisture content) / (1-14%), where average kernel moisture content is the average moisture content of the seeds obtained from the test material, measured using a Finnish Wile 65 seed moisture meter.

[0130] The results of the standard plot grain weight test are shown in Figure 4. It can be seen from the figure that the standard plot grain weight of the ZmST1 overexpression homozygous line is significantly higher than the standard plot grain weight of the control. Among them, the average standard plot grain weight of the wild-type corn inbred line ND101 is 0.58 kg, and the ZmST1 overexpression homozygous line OE -1 standard plot has an average grain weight of 0.79 kg, and the ZmST1 overexpression homozygous strain OE The average grain weight of the standard plot of -2 is 0.72 kg.

[0131] The results of ear phenotypic observation and ear diameter statistics are shown in Figure 5. It can be seen from the figure that compared with the wild-type corn inbred line ND101, the ear diameter of the ZmST1 overexpression homozygous line is significantly increased. Among them, the average ear diameter of the wild-type corn inbred line ND101 is 35.13 mm, and the average ear diameter of the ZmST1 overexpression homozygous line is 35.13 mm. OE -1 has an average ear diameter of 40.17 mm, and the ZmST1 overexpression homozygous line OE The average ear diameter of -2 is 39.87 mm.

[0132] The results of kernel phenotype observation and kernel length, width and 100-kernel weight are shown in Figure 6. It can be seen from the figure that compared with the wild-type corn inbred line ND101, the kernel width and length of the ZmST1 overexpression homozygous line were significantly increased. Among them, the average kernel width of the wild-type corn inbred line ND101 is 6.24 mm, and the average kernel width of the ZmST1 overexpression homozygous line is 6.24 mm. OE -1 has an average grain width of 6.82 mm, and the ZmST1 overexpression homozygous strain OE -2 has an average kernel width of 7.00 mm; the average kernel length of the wild-type maize inbred line ND101 is 8.12 mm, and the ZmST1 overexpression homozygous line OE -1 has an average grain length of 10.14 mm, and the ZmST1 overexpression homozygous strain OE The average kernel length of -2 is 9.64 mm. In addition, the average 100-kernel weight of the wild-type maize inbred line ND101 is 19.16 g, and the ZmST1 overexpression homozygous line OE -1 has an average 100-grain weight of 30.94 g, and the ZmST1 overexpression homozygous strain OE The average 100-grain weight of -2 is 30.37 grams.

[0133] The above results indicate that ZmST1 protein can regulate the stem thickness of plant ears, grain length, grain width and yield.

[0134] In summary, ZmST1 protein plays a positive regulatory role in plant stay-greenness, disease resistance and yield.

[0135] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions, without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been described herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements of the present invention, including those made using conventional techniques known in the art, outside the scope of the disclosure herein. Applications of the essential features may be made within the scope of the following claims. Industrial Applicability

[0136] The present invention provides the use of the ZmST1 protein in regulating plant stay-green, disease resistance, and yield. Experiments have shown that overexpressing the ZmST1 protein in plants can improve plant stay-green, disease resistance, and yield, which is of great significance for the cultivation of high-yield and disease-resistant plant varieties.

Claims

1. Use of ZmST1 protein in any of the following 1)-5): 1) Regulate plant stay-greenness; 2) Regulate plant yield; 3) Regulate plant disease resistance; 4) Cultivating transgenic plants with improved stay-green properties and / or increased yield and / or improved disease resistance; 5) Plant breeding; The ZmST1 protein is any one of a1), a2), a3), or a4): a1) a protein having an amino acid sequence of SEQ ID No. 3; a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in a1); a3) a protein related to plant green retention, disease resistance or yield obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence described in a1); a4) A protein having 90% identity with the amino acid sequence of a1), derived from corn and associated with plant stay-green, disease resistance or yield.

2. Use of biomaterials related to ZmST1 protein in any of the following 1)-5): 1) Regulate plant stay-greenness; 2) Regulate plant yield; 3) Regulate plant disease resistance; 4) Cultivating transgenic plants with improved stay-green properties and / or increased yield and / or improved disease resistance; 5) Plant breeding; The biological material is any one of the following A1) to A12): A1) a nucleic acid molecule encoding a ZmST1 protein; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); A9) a recombinant host cell containing the nucleic acid molecule described in A1); A10) a recombinant host cell containing the expression cassette described in A2); A11) a recombinant host cell containing the recombinant vector described in A3); A12) a recombinant host cell containing the recombinant vector described in A4); The ZmST1 protein is any one of a1), a2), a3), or a4): a1) a protein having an amino acid sequence of SEQ ID No. 3; a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in a1); a3) a protein related to plant green retention, disease resistance or yield obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence described in a1); a4) A protein having 90% identity with the amino acid sequence of a1), derived from corn and associated with plant stay-green, disease resistance or yield.

3. The use according to claim 2, characterized in that: A1) The nucleic acid molecule is any one of the following B1)-B3): B1) a DNA molecule having a nucleotide sequence of SEQ ID No. 1; B2) a DNA molecule having a nucleotide sequence of SEQ ID No. 2; B3) A DNA molecule that has 75% or more identity with the nucleotide sequence described in B1) or B2) and encodes the ZmST1 protein.

4. The use according to any one of claims 1 to 3, characterized in that: The regulating the staying green property of plants is regulating the staying green property of plant leaves.

5. The use according to any one of claims 1 to 4, characterized in that: The regulating plant disease resistance is regulating the plant resistance to ear and grain rot.

6. The use according to any one of claims 1 to 5, characterized in that: The regulating plant yield is embodied in any one of the following C1)-C4): C1) Regulate the stem thickness of plant ears; C2) Regulates plant grain length; C3) Regulates plant grain width; C4) Regulates plant grain weight.

7. The use according to any one of claims 1 to 6, characterized in that: The plant is any one of the following D1)-D4): D1) dicots or monocots; D2) Gramineae; D3) Zea mays; D4) Corn.

8. A method for cultivating transgenic plants with improved stay-green property and / or improved yield and / or improved disease resistance, comprising the following steps: increasing the content and / or activity of ZmST1 protein in a recipient plant to obtain a transgenic plant; the stay-green property, yield and / or disease resistance of the transgenic plant are higher than those of the recipient plant; The ZmST1 protein is any one of a1), a2), a3), or a4): a1) a protein having an amino acid sequence of SEQ ID No. 3; a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in a1); a3) a protein related to plant green retention, disease resistance or yield obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence described in a1); a4) A protein having 90% identity with the amino acid sequence of a1), derived from corn and associated with plant stay-green, disease resistance or yield.

9. The method according to claim 8, characterized in that: The stay-green property of the transgenic plant is higher than that of the recipient plant, which is reflected in that the stay-green property of the leaves of the transgenic plant is higher than that of the recipient plant.

10. The method according to claim 8 or 9, characterized in that: The disease resistance of the transgenic plant is higher than that of the recipient plant, which is reflected in that the resistance of the transgenic plant to ear rot is higher than that of the recipient plant.

11. The method according to any one of claims 8 to 10, characterized in that: The yield of the transgenic plant is higher than that of the recipient plant, which is embodied in any one of the following E1)-E4): E1) the transgenic plant has a greater ear stem thickness than the recipient plant; E2) the grain length of the transgenic plant is greater than that of the recipient plant; E3) the width of the grains of the transgenic plant is greater than that of the recipient plant; E4) The grain weight of the transgenic plant is greater than that of the recipient plant.

12. The method according to any one of claims 8 to 11, characterized in that: The method for increasing the content and / or activity of the ZmST1 protein in the recipient plant is to overexpress the ZmST1 protein in the recipient plant.

13. The method according to claim 12, characterized in that: The overexpression method is to introduce the coding gene of ZmST1 protein into the recipient plant.

14. The method according to any one of claims 8 to 13, characterized in that: The nucleotide sequence of the gene encoding the ZmST1 protein is shown in SEQ ID No.

2.

15. The use according to any one of claims 8 to 14, characterized in that: The plant is any one of the following D1)-D4): D1) dicots or monocots; D2) Gramineae; D3) Zea mays; D4) Corn.

16. A transgenic plant produced according to any one of claims 8 to 15.

Images