Lipid nanoparticles for cancer immunotherapy

Abstract

Disclosed are compositions, methods, and kits related to lipid nanoparticles (LNPs) comprising ionizable lipids. The LNPs can comprise mRNAs encoding therapeutic peptides for cancer immunotherapy. In some embodiments, the LNPs comprise mRNAs encoding a GPC3 / CD3 bispecific T-cell engager (BiTE).

Description

LIPID NANOPARTICLES FOR CANCER IMMUNOTHERAPYCROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 510,622, filed June 27, 2023, which application is incorporated herein by reference.BACKGROUND

[0002] Synthetic mRNA provides a template for the synthesis of any given peptide, protein or protein fragment and lends itself to a broad range of pharmaceutical applications, including different modalities of cancer immunotherapy. To function in vivo, mRNA requires safe, effective, and stable delivery systems that protect the nucleic acid from degradation and that allow cellular uptake and mRNA release. Lipid nanoparticle-mRNA formulations have been developed and are under clinical evaluation for the prevention and treatment of viral infections, cancer, and genetic diseases.SUMMARY

[0003] Provided herein are compositions and methods related to delivering nucleic acid molecules (e.g., mRNA) encoding one or more bispecific T-cell engagers (BiTE) targeting glypican-3 (PGC3) for cancer immunotherapy.

[0004] In some aspects, the present disclosure provides a composition comprising a pharmaceutical agent assembled with a lipid composition, wherein the lipid composition comprises an ionizable lipid, wherein the ionizable lipid comprises an amine head group and at least two hydrophobic tail groups RLipid, wherein each RL1Pldindependently comprises a structure selected from the group consisting ofor a pharmaceutically acceptable salt thereof, wherein: Rki and Rk3 are each independently Cl -CIO alkyl; andeach Rk2is independently a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3- C20 heterocycloalkyl, aryl, or heteroaryl; wherein the pharmaceutical agent comprises one or more nucleic acid molecules encoding a bispecific T-cell engager targeting glypican-3 and CD3 (GPC3 / CD3 BiTE). In some embodiments, each RL1Pldis independently selected from the group consistingembodiments, each RL1Pldis independently selected from the group consisting of

[0005] In some aspects, the present disclosure provides a composition comprising a pharmaceutical agent assembled with a lipid composition that comprises an ionizable lipid, wherein the ionizable lipid comprises an amine head group and at least two hydrophobic tail groups RLipid, wherein each RL1Pldindependently comprise a structure of Formula (I / a):or a pharmaceutically acceptable salt thereof; wherein:Rki and Rk3 are each independently Cl -CIO alkyl; and each Rk2is independently a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3- C20 heterocycloalkyl, aryl, or heteroaryl; wherein the pharmaceutical agent comprises one or more nucleic acid molecules encoding a bispecific T-cell engager targeting glypican-3 and CD3 (GPC3 / CD3 BiTEise each Rk2 is independently a C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl. In some embodiments, each Rk2 is independently a C1-C20 alkyl or C2-C20 alkenyl.

[0006] In some embodiments, each Rki is independently C1-C4 alkyl and each Rk3 is independently C1-C4 alkyl. In some embodiments, the ionizable lipid is represented by Formula (II):or a pharmaceutically acceptable salt thereof, wherein:Rbis a substituted or unsubstituted Cl -CIO alkyl; nl and n2 are each independently 1, 2, 3, 4, 5, or 6; andRbl, Rb2, Rb3and Rb4are each independently H or RLipid; wherein at least one of Rbl, Rb2, Rb3and Rb4is not H. In some embodiments, Rbis a C1-C4 alkyl which is optionally substituted with 1 to 4 groups selected from -OH; and nl and n2 are each independently 1, 2, 3, or 4. In some embodiments, each of Rbl, Rb2, Rb3and Rb4is not H.

[0007] In some embodiments, the amine head group is selected from the group consisting of

[0008] In some embodiments, the ionizable lipid comprises L702some embodiments, the ionizable lipidcomprises

[0009] In some embodiments, the lipid composition further comprises a steroid. In some embodiments, the steroid comprises cholesterol or a cholesterol derivative. In some embodiments, the lipid composition further comprises a helper lipid. In some embodiments, the helper lipid comprises phospholipids or zwitterionic lipids comprising l,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE) or l,2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC). In some embodiments, the lipid composition further comprises a polymer conjugated lipid. In some embodiments, the polymer conjugated lipid comprises a polyethylene glycol (PEG) conjugated lipid. In some embodiments, the polymer conjugated lipid comprises l,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[methoxy(poly ethylene glycol)-2000 (DSPE-PEG2k) or 1,2- dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2k). In some embodiments, the lipid composition further comprises a steroid, a helper lipid, and a polymer conjugated lipid. In some embodiments, the ionizable lipid is present in the lipid composition at a weight percentage from about 30% to about 90%. In some embodiments, the steroid is present in the lipid composition at a weight percentage from about 10% to about 40%. In some embodiments, the helper lipid is present in the lipid composition at a weight percentage from about 1% to about 20%. In some embodiments, the polymer conjugated lipid is present in the lipid composition at a weight percentage from about 1% to about 20%. In some embodiments, the weight ratio of the ionizable lipid / steroid / helper lipid / polymer conjugated lipid is about 4 / 1 / I / 1. In some embodiments, the weight ratio of the pharmaceutical agent / lipid composition is from about 1 :200 to about 1 :5. In some embodiments, the lipid composition further comprises a steroid and a helper lipid. In some embodiments, the ionizable lipid is present in the lipid composition at a weight percentage from about 30% to about 90%. In some embodiments, the helper lipid is present in the lipid composition at a weight percentage from about 5% to about 40%. In some embodiments, the steroid is present in the lipid composition at a weight percentage from about 5% to about 40%. In some embodiments, the weight ratio of the ionizable lipid / steroid / helper lipid is about 2 / 1 / 1.

[0010] In some embodiments, the lipid composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier comprises a sugar, and wherein the sugar comprises mannitol, sucrose, maltose, or trehalose. In someembodiments, the carrier is present in the composition at a weight percentage from about 5% to about 60%. In some embodiments, the ionizable lipid comprises at least two hydrophobic tails, wherein not all hydrophobic tails are identical. In some embodiments, the ionizable lipid comprises at least two hydrophobic tails, wherein two or more hydrophobic tails are identical. In some embodiments, the pharmaceutical agent comprises one or more mRNA molecules encoding a bispecific T-cell engager targeting glypican-3 and CD3 (GPC3 / CD3 BiTE) or optionally the pharmaceutical agent comprises a nucleic acid sequence having at least 70% sequence identity to SEQ ID NO: 1, or optionally the pharmaceutical agent comprises SEQ ID NO: 1.

[0011] In some embodiments, the pharmaceutical agent further comprises a polynucleotide, an oligonucleotide, a polypeptide, an oligopeptide, a small molecule compound, or any combination thereof. In some embodiments, the small molecule compound comprises a drug for chemotherapy. In some embodiments, the physical properties of the lipid composition are stable for at least 2 months, at least 3 months, at least 4 months, at least 5 months, or at least 6 months or more when stored at 4°C, -20°C, or -80°C In some embodiments, the physical properties of the lipid composition are stable for at least 5 months when stored at 4°C, -20°C, or -80°C. In some embodiments, the physical properties of the lipid composition comprise size, poly dispersity index (PDI), encapsulation efficacy (EE%), or pKa of the lipid composition. In some embodiments, the lipid composition targets a target organ after being administered to a subject. In some embodiments, the target organ comprises a liver, lung or spleen. In some embodiments, the composition targets a target cell after being administered to a subject. In some embodiments, the target cell comprises a hepatocyte, a Kupffer cell, a liver sinusoidal endothelial cell (LSEC), a B cell, a T cell, a dendritic cell, a macrophage, a myeloid cell, a hematopoietic stem cells, or a leukocyte. In some embodiments, after being administered to a subj ect the composition has a faster rate of clearance compared to other compositions. In some embodiments, after being administered to a subject the composition has a longer half-life compared to other compositions. In some embodiments, after being administered to a subject the composition has a half-life of at least 2 hours, at least 3 hours, at least 4 hours, or at least 5 hours. In some embodiments, after the composition is administered to a subject the composition has a larger area under curve (AUC) compared to other compositions. In some embodiments, after the composition is administered to a subject the composition has an AUC of that is at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60% or larger compared to other compositions.

[0012] In some aspects, the present disclosure provides a method for delivering a pharmaceutical agent to a target organ in a subject in need thereof, the method comprising administering an effective amount of the composition provided herein.

[0013] In some aspects, the present disclosure provides a method for delivering a pharmaceutical agent to a target organ in a subject in need thereof, the method comprising: administering to the subject an effective amount of the pharmaceutical agent assembled with a lipid composition provided herein; and thereby providing a greater amount or activity of the pharmaceutical agent in the target organ in the subject as compared to that achieved absent the lipid composition.

[0014] In some aspects, the present disclosure provides a method for delivering a pharmaceutical agent to a target organ in a subject in need thereof, the method comprising administering to the subject an effective amount of the pharmaceutical agent assembled with a lipid composition provided herein; and thereby providing a greater amount or activity of the pharmaceutical agent in the target organ in the subject as compared to a non-target organ.

[0015] In some embodiments, the administering is through systemic administration. In some embodiments, the administering is through intramuscular administration. In some embodiments, the administering is through intravenous administration. In some embodiments, the pharmaceutical agent is delivered at a dosage of no more than 3 mg / kg body weight. In some embodiments, the pharmaceutical agent is delivered at a dosage from about 0.25 mg / kg to about 1 mg / kg body weight. In some embodiments, the pharmaceutical agent is delivered in one or more doses. In some embodiments, the subject is a mammal, and wherein the mammal comprises a rodent or a nonhuman primate. In some embodiments, the activity of the pharmaceutical agent comprises cancer cell killing. In some embodiments, he amount of the pharmaceutical agent is measured by pharmacokinetic parameters, and wherein the pharmacokinetic parameters comprises Cmax, Tmax, half-life, or area under curve (AUC). In some embodiments, the greater amount of the pharmaceutical agent comprises a larger Cmax, a longer half-life, or a larger area under curve (AUC). In some embodiments, the method results in greater cancer cell killing. In some embodiments, the method results in greater the pharmacokinetic parameters of the pharmaceutical agent, and wherein the pharmacokinetic parameters of the pharmaceutical agent comprise Cmax, Tmax, half-life, or area under curve (AUC). In some embodiments, the half-life of the pharmaceutical agent is at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, or at least 6 hours or more. In some embodiments, the target organ comprises a liver, lung or spleen.In some aspects, the present disclosure provides a method for treating a solid-state tumor in a subject in need thereof, comprising administering an effective amount of the composition provided herein. In some embodiments, the solid-state tumor comprises hepatocellular carcinoma. In some embodiments, the solid-state tumor comprises lung cancer. In some embodiments, the lung cancer comprises non-small cell lung cancer. In some embodiments, the administering comprises administering the composition intravenously or intramuscularly to a subject in need thereof. Insome embodiments, the subject comprises a mammal.INCORPORATION BY REFERENCE

[0016] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

[0018] FIG. 1 is a schematic representation of the constructs of glypican-3 (GPC3) / CD3 encoding mRNA.

[0019] FIG. 2 depicts a schematic diagram of dose regiments and blood collection at indicated timepoints for PK profiling of plasma GPC3 / CD3 BiTE protein, BiTE mRNA and ionizable lipid.

[0020] FIGs. 3A-3B depicts protein PK profiling of single dose intravenous (i.v.) administration of LNP-GPC3 / CD3 BiTE mRNA in CD1 mice. FIG. 3A shows GPC3-CD3 BiTE protein concentration in the plasma of CD1 mice after i.v. administration of 0.5 and 0.1 mg / kg LNP- GPC3 / CD3 BiTE mRNA (L88-008), and 0.25 mg / kg of recombinant GPC3 / CD3 BiTE protein (rPR008). 5 mice in each treatment group were blood draw of indicated timepoints for plasma BiTE quantification by CD3 ELISA assay. Concentrations from technical ELISA duplicates are shown. FIG. 3B shows ex vivo concentration- dependent cytotoxicity against GPC3+ HepG2-luc cells induced by BiTE protein produced in vivo, which was collected at 48h post-dose of 0.5 mg / kg L88-008, were measured by luminescence-based assay. hPBMCs were used as effectors at effector target (E:T) cell ratio of 5: 1 and detect luminescence single of target cell following 24h incubation. % of specific lysis were calculated as ([number of live target cells without treatment - number of live target cells with treatment] / [number of live target cells without treatment] x 100%.

[0021] FIG. 4 depicts mRNAPK profiling of single dose intravenous (i.v.) administration of LNP- GPC3 / CD3 BiTE mRNA in CD1 mice. GPC3-CD3 BiTE mRNA concentration in the plasma of CD1 mice after i.v. administration of 0.5 and 0.1 mg / kg L88-008 were quantified by bDNA assay. Data are presented as means ± SD and dotted line depicts the LLOQ of 1 pg / ml.

[0022] FIG. 5 depicts ionizable lipid L88 PK profiling of single dose intravenous (i.v.) administration of LNP-GPC3 / CD3 BiTE mRNA in CD1 mice. L88 lipid concentration in theplasma of CD1 mice after i.v. administration of 0.5 and 0.1 mg / kg L88-008 were quantified by LC-MS. Data are presented as means ± SD and dotted line depicts the LLOQ of 1 ng / ml.

[0023] FIG. 6 is a schematic diagram of an efficacy study design. The study uses hPBMC- reconstituted Hep3B-Luciferase orthotopic hepatocellular carcinomas (HCC) mouse model with tumor cell and hPBMC inoculation and dose regiment of 3 treatment groups (n=4 for each group) including 0.5mg / kg of LNP-mRNA (L88-008), recombinant BiTE protein (rPR008), and vehicle.

[0024] FIGs 7A-7E depicts the results of the efficacy study. Efficacy study of L88-008 was performed in in hPBMC-reconstituted Hep3B-Luciferase orthotopic hepatocellular carcinomas (HCC) mouse model. FIG. 7A shows the total photon flux images of individual mice in each group captured at indicated timepoints by IVIS. FIG. 7B shows the bioluminescence signal quantitated as photons / sec using living Image 4.7 software for each treatment group. Each dot represent mean bioluminescence signal of each group and statistical analysis were compared to G1 PBS control group by 2-way ANOVA test with multiple comparisons analysis at D38 after tumor inoculation. **** p<o 0001. FIGs 7C-7E show total flux (TF) changes of each mouse in individual groups during the treatment were analysis.

[0025] FIG. 8 shows the relative body weight change of each mouse during the treatment were normalized to baseline timepoint (t=0) and each point represent as means ± SD. The statistical analysis was compared to G1_PBS control group by 2-way ANOVA test with multiple comparisons analysis at D38 after tumor inoculation. *** p<0.001.

[0026] FIGs. 9A-9C show the liver and spleen tissue images and weight at end-timepoint (D38 after tumor inoculation). FIG. 9A depicts the terminal liver and spleen tissues from each mouse collected. FIG. 9B and FIG. 9C show liver including tumor tissue and spleen weighted at endtimepoint. Each dots represent 1 mouse data and statistical analysis were compared to G1 PBS control by paired two-tailed t-test. ns, not significant; * P< 0.05, ** P< 0.01.

[0027] FIG. 10 is a bar graph of GPC3-CD3 BiTE protein expression in lung cancer cell lines.DETAILED DESCRIPTION

[0028] Messenger RNA (mRNA) as a platform for efficient protein expression in vivo has many advantages over other therapeutic approaches. A large size and negative charges of mRNA are obstacles to it efficiently reaching the cytosol. Naked mRNA can be spontaneously taken up by different cell types, but this usually results in degradation in acidic endolysosomal compartments. Lipid nanoparticles (LNPs) have been identified as an efficient way to protect mRNA from ubiquitous RNAses, shield it from immune cells and deliver it to cells while enabling escape from the endosome. LNPs generally consist of four major components: an ionizable, a sterol, aphospholipid and a lipid-anchored polyethylene glycol (PEG). The phospholipid and sterol work together to stabilize the LNP, the lipid-anchored PEG provides vial and storage stability and the ionizable lipid is critical for cellular uptake and endosomal escape, allowing for release of the mRNA into the cytosol. By changing the ratio and identities of the lipid components, the efficacy and tolerability of the formulation can be altered. Importantly, mRNA / LNP formulation requires careful process controls to ensure reproducibility of manufacturing and stability.

[0029] Although full-length antibodies have engendered significant success targeting cancers, immune disorders and infectious diseases, they are relatively large and exhibit less tissue penetrance than small molecules. Contrastingly, therapeutic peptides derived from fragments of antibodies, such as bispecific T-cell engagers (e.g., BiTE), can have a small size that enables better tissue penetration. However, the use of these molecules has been hampered by their short halflives of several hours and propensity to aggregate. Both properties could be improved or avoided through mRNA-mediated expression since antibody will be continuously expressed from the mRNA until the mRNA is degraded. This approach would also prevent the aggregation often observed during protein purification. The LNP formulations that encapsulate mRNA for delivery can offer advantages for this technology over recombinant proteins as LNPs can offer greater biodistribution, with more tissue penetration than recombinant antibody proteins. LNPs optimized for mRNA delivery can result in higher expression of therapeutic peptides via more convenient routes of administration, such as subcutaneous or IM.

[0030] The present disclosure relates to compositions and methods comprising LNPs assembled with an mRNA encoding GPC3-CD3 BiTE. Glypican-3 (GPC3) is an oncofetal heparan sulfate (HS) glycoprotein attached to the cell membrane via a glycosylphos-phatidylinositol (GPI) anchors. GPC3 is highly expressed in a wide variety of tissues during embryonic development; however, its expression is hardly detectable in normal adult tissues at both mRNA and protein level. Recent discoveries have shown that GPC3 is highly expressed in a certain tumor tissue. For example, GPC3 has been studied as a molecular marker for the detection and treatment of hepatocellular carcinoma (HCC), a malignant tumor with a fairly poor prognosis (5-year survival of less than 50%). Elevated protein expression of GPC3 has also been reported in lung cancer especially in squamous cell carcinomas by IHC. The overall high protein expression of GPC3 is 45% (21 / 60) in lung cancer, positive expression of GPC3 protein in lung squamous cell carcinoma is higher than in lung adenocarcinoma (70% vs 20%). In 44 patients diagnosed with poorly differentiated carcinoma, expression of GPC-3 was found in 45% (20 / 44) of primary lung cancers, including 79% (15 / 19) of squamous cell carcinomas, 18% (4 / 23) of adenocarcinomas, and 50% (1 / 2) of adenosquamous carcinomas. GPC3 was not expressed in normal lung tissue and wasexpressed in 3.3% (1 out of 30) of lung adenocarcinoma cases and 63.3% (19 out of 30) of lung squamous cell carcinoma cases. Immunohistochemistry (IHC) analysis revealed positive staining of GPC3 protein in 70% (7 / 10) paraffin-embedded lung squamous cell carcinoma (LUSC) tissues. As such, GPC3-CD3 BiTE or mRNA encoding GPC3-CD3 BiTE may be an option for treating HCC or various forms of lung cancer.

[0031] The present disclosure provides compositions and methods related to lipid nanoparticles (LNPs) comprising ionizable lipids and nucleic acid molecules encoding therapeutic peptides for cancer immunotherapy. In some embodiments, the LNPs comprise mRNA that encode an antibody or a fragment thereof. In some embodiments, the LNPs comprise mRNA that encode a bispecific T-cell engager (BiTE). In some embodiments, the composition provided herein comprises LNPs encapsulating an mRNA encoding GPC3-CD3 BiTE. In some embodiments, the mRNA encoding the GPC3-CD3 BiTE is codon-optimized to increase expression in a subject. In some embodiments, the subject comprises a mammal. In some embodiments, the subject comprises a rodent, human or a non-human primate. In some embodiments, the mRNA encoding the GPC3- CD3 BiTE comprises the nucleic acid sequence of SEQ ID NO: 1.

[0032] The LNPs of the composition may deliver the mRNA payload specially to one or more organs (e.g., organ targeting LNPs). In some embodiments, the LNPs are liver-targeting LNPs and the LNPs encapsulating the GPC3-CD3 BiTE mRNA can be delivered preferentially to the liver. In some embodiments, the LNPs are lung-targeting LNPs and the LNPs encapsulating the GPC3- CD3 BiTE mRNA can be delivered preferentially to the lung. In some embodiments, the LNPs are lymphoid tissue-targeting LNPs and the LNPs encapsulating the GPC3-CD3 BiTE mRNA can be delivered preferentially to the lymphoid tissues.

[0033] In some embodiments, the lipid compositions provided herein result in higher expression of therapeutic peptides (e.g., GPC3-CD3 BiTE) than other lipid compositions. In some embodiments, the lipid compositions have a longer half-life than other compositions after administered to a subject in need thereof. In some embodiments, the lipid compositions have a longer half-life than chimeric BiTE proteins. In some embodiments, the methods provided herein relates to enhanced exposure of BiTE in a subject in need thereof due to administration of the lipid composition comprising mRNA encoding the BiTE. In some embodiments, the methods comprise administering the lipid compositions via convenient routes of administration, such as subcutaneous or IM.Definitions

[0034] Before the embodiments of the disclosure are described, it is to be understood that such embodiments are provided by way of example only, and that various alternatives to theembodiments of the disclosure described herein may be employed in practicing the disclosure. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure.

[0036] In the context of the present application, the following terms have the meanings ascribed to them unless specified otherwise:

[0037] As used throughout the specification and claims, the terms “a”, “an” and “the” are generally used in the sense that they mean “at least one”, “at least a first”, “one or more” or “a plurality” of the referenced components or steps, except in instances wherein an upper limit is thereafter specifically stated. For example, a “cleavage sequence”, as used herein, means “at least a first cleavage sequence” but includes a plurality of cleavage sequences. The operable limits and parameters of combinations, as with the amounts of any single agent, will be known to those of ordinary skill in the art in light of the present application.

[0038] The terms “polypeptide”, “peptide”, and “protein” are used interchangeably herein to generally refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.

[0039] As used herein, the term “antibody” refers to an immunoglobulin (Ig) whether natural or partly or wholly synthetically produced. The term also covers any polypeptide or protein having a binding domain which is, or is homologous to, an antigen-binding domain. The term further includes “antigen-binding fragments” or “functional fragment thereof, or “fragment of an antibody”, “antibody fragment”, “functional fragment of an antibody” and other interchangeable terms for similar binding fragments such as described below. An antibody includes, for example, monoclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies, recombinant antibodies, chemically engineered antibodies, deimmunized antibodies, affinity-matured antibodies, multispecific antibodies (for example, bispecific antibodies and polyreactive antibodies), heteroconjugate antibodies, antibody fragments, and combinations thereof (e.g., a monoclonal antibody that is also deimmunized, a humanized antibody that is also deimmunized, etc.). An antibody can be, for example, murine, chimeric, humanized, heteroconjugate, bispecific, diabody, triabody, or tetrabody. The antigen binding fragment can include, for example, Fab’, F(ab’)2, Fab, Fv, rlgG, scFv, hcAbs (heavy chain antibodies), a single domain antibody, VHH, VNAR, sdAbs, or nanobody.

[0040] The term “antigen” refers to a molecule bound by an antibody or a fragment thereof. In some cases, the antigen can be referred to as a “ligand” of the antibody. An antigen can be derived from a surface protein of a cell, such as an immune cell or a cancer cell. In some cases, an antigen can be derived from a surface protein of a tumor cell. An antigen can be targeted by the antibody for killing of a cell.

[0041] As used herein, the terms “treatment” or “treating,” or “palliating” or “ameliorating” are used interchangeably herein. These terms generally refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and / or a prophylactic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms or improvement in one or more clinical parameters associated with the underlying disorder such that an improvement is observed in the subject, notwithstanding that the subject may still be afflicted with the underlying disorder. For prophylactic benefit, the compositions may be administered to a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made.

[0042] A “therapeutic effect” or “therapeutic benefit,” as used herein, generally refers to a physiologic effect, including but not limited to the mitigation, amelioration, or prevention of disease or an improvement in one or more clinical parameters associated with the underlying disorder in humans or other animals, or to otherwise enhance physical or mental wellbeing of humans or animals, resulting from administration of a polypeptide of the disclosure other than the ability to induce the production of an antibody against an antigenic epitope possessed by the biologically active protein. For prophylactic benefit, the compositions may be administered to a subject at risk of developing a particular disease, a recurrence of a former disease, condition or symptom of the disease, or to a subject reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made.

[0043] The terms “therapeutically effective amount” and “therapeutically effective dose”, as usedherein, generally refer to an amount of a drug or a biologically active protein, either alone or as a part of a polypeptide composition, that is capable of having any detectable, beneficial effect on any symptom, aspect, measured parameter or characteristics of a disease state or condition when administered in one or repeated doses to a subject. Such effect need not be absolute to be beneficial. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0044] For the chemical groups and compound classes, the number of carbon atoms in the group or class is as indicated as follows: “Cn” defines the exact number (n) of carbon atoms in the group / class. “C<n” defines the maximum number (n) of carbon atoms that can be in the group / class, with the minimum number as small as possible for the group / class in question, e.g., it is understood that the minimum number of carbon atoms in the group “alkenyl(C<8)” or the class “alkene(C<8)” is two. Compare with “alkoxy(C<10)”, which designates alkoxy groups having from 1 to 10 carbon atoms. “Cm-n” or “Cm-Cn” defines both the minimum (m) and maximum number (n) of carbon atoms in the group. Thus, “Cl -CIO alkyl” designates those alkyl groups having from 2 to 10 carbon atoms. These carbon number indicators may precede or follow the chemical groups or class it modifies and it may or may not be enclosed in parenthesis, without signifying any change in meaning. Thus, the terms “C5 olefin”, “C5-olefin”, “olefines)”, and “olefines” are all synonymous.

[0045] The term “saturated” when used to modify a compound or chemical group means the compound or chemical group has no carbon-carbon double and no carbon-carbon triple bonds, except as noted below. When the term is used to modify an atom, it means that the atom is not part of any double or triple bond. In the case of substituted versions of saturated groups, one or more carbon oxygen double bond or a carbon nitrogen double bond may be present. And when such a bond is present, then carbon-carbon double bonds that may occur as part of keto-enol tautomerism or imine / enamine tautomerism are not precluded. When the term “saturated” is used to modify a solution of a substance, it means that no more of that substance can dissolve in that solution.

[0046] The term “aliphatic” generally signifies that the compound or chemical group so modified is an acyclic or cyclic, but non-aromatic hydrocarbon compound or group. In aliphatic compounds / groups, the carbon atoms can be joined together in straight chains, branched chains, or non-aromatic rings (alicyclic). Aliphatic compounds / groups can be saturated, that is joined by single carbon-carbon bonds (alkanes / alkyl), or unsaturated, with one or more carbon-carbon double bonds (alkenes / alkenyl) or with one or more carbon-carbon triple bonds (alkynes / alkynyl).

[0047] The term “aromatic” when used to modify a compound or a chemical group atom meansthe compound or chemical group contains a planar unsaturated ring of atoms that is stabilized by an interaction of the bonds forming the ring.

[0048] The term “alkyl” when used without the “substituted” modifier refers to a monovalent saturated aliphatic group with a carbon atom as the point of attachment, a linear or branched acyclic structure, and no atoms other than carbon and hydrogen. The groups -CH3 (Me), -CH2CH3 (Et), -CH2CH2CH3 (zz-Pr or propyl), -CH(CH3)2 (z-Pr, 'Pr or isopropyl), -CH2CH2CH2CH3 (zz-Bu), -CH(CH3)CH2CH3 ( ec-butyl), -CH2CH(CH3)2 (isobutyl), -C(CH3)3 (tert-butyl, / -butyl, Z-Bu or 'Bu), and -CH2C(CH3)3 (zzeo-pentyl) are non-limiting examples of alkyl groups. The term “alkanediyl” when used without the “substituted” modifier refers to a divalent saturated aliphatic group, with one or two saturated carbon atom(s) as the point(s) of attachment, a linear or branched acyclic structure, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. The groups -CEfe- (methylene), -CH2CH2-, -CEEC CEE^CEE-, and -CH2CH2CH2- are non-limiting examples of alkanediyl groups. An “alkane” refers to the class of compounds having the formula H-R, wherein R is alkyl as this term is defined above. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2. The following groups are non-limiting examples of substituted alkyl groups: -CH2OH, -CH2CI, -CF3, -CH2CN, -CH2C(O)OH, -CH2C(O)OCH3, -CH2C(O)NH2, -CH2C(O)CH3, -CH2OCH3, -CH2OC(O)CH3, -CH2NH2, -CH2N(CH3)2, and -CH2CH2CI. The term “haloalkyl” is a subset of substituted alkyl, in which the hydrogen atom replacement is limited to halo (i.e. -F, -Cl, -Br, or -I) such that no other atoms aside from carbon, hydrogen and halogen are present. The group, -CH2CI is a nonlimiting example of a haloalkyl. The term “fluoroalkyl” is a subset of substituted alkyl, in which the hydrogen atom replacement is limited to fluoro such that no other atoms aside from carbon, hydrogen and fluorine are present. The groups -CH2F, -CF3, and -CH2CF3 are non-limiting examples of fluoroalkyl groups.

[0049] The term “cycloalkyl” when used without the “substituted” modifier refers to a monovalent saturated aliphatic group with a carbon atom as the point of attachment, the carbon atom forming part of one or more non-aromatic ring structures, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. Non-limiting examples include: -CH(CH2)2 (cyclopropyl), cyclobutyl, cyclopentyl, or cyclohexyl (Cy). The term “cycloalkanediyl” when used without the “substituted” modifier refers to a divalent saturated aliphatic group with two carbon atoms as points of attachment, no carbon-carbon double or triple bonds, and no atoms otherthan carbon and hydrogen. The groupis a non-limiting example of cycloalkanediyl group. A “cycloalkane” refers to the class of compounds having the formula H-R, wherein R is cycloalkyl as this term is defined above. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2.

[0050] The term “alkenyl” when used without the “substituted” modifier refers to an monovalent unsaturated aliphatic group with a carbon atom as the point of attachment, a linear or branched, acyclic structure, at least one nonaromatic carbon-carbon double bond, no carbon-carbon triple bonds, and no atoms other than carbon and hydrogen. Non-limiting examples include: -CH=CH2 (vinyl), -CH=CHCH3, -CH=CHCH2CH3, -CH2CH=CH2(allyl), -CH2CH=CHCH3, and -CH=CHCH=CH2. The term “alkenediyl” when used without the “substituted” modifier refers to a divalent unsaturated aliphatic group, with two carbon atoms as points of attachment, a linear or branched, a linear or branched acyclic structure, at least one nonaromatic carbon-carbon double bond, no carbon-carbon triple bonds, and no atoms other than carbon and hydrogen. The groups -CH=CH-, -CH=C(CH3)CH2- -CH=CHCH2- and -CH2CH=CHCH2- are non-limiting examples of alkenediyl groups. It is noted that while the alkenediyl group is aliphatic, once connected at both ends, this group is not precluded from forming part of an aromatic structure. The terms “alkene” and “olefin” are synonymous and refer to the class of compounds having the formula H-R, wherein R is alkenyl as this term is defined above. Similarly, the terms “terminal alkene” and “a-olefin” are synonymous and refer to an alkene having just one carbon-carbon double bond, wherein that bond is part of a vinyl group at an end of the molecule. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2. The groups -CH=CHF, -CH=CHC1 and -CH=CHBr are non-limiting examples of substituted alkenyl groups.

[0051] The term “alkynyl” when used without the “substituted” modifier refers to a monovalent unsaturated aliphatic group with a carbon atom as the point of attachment, a linear or branched acyclic structure, at least one carbon-carbon triple bond, and no atoms other than carbon and hydrogen. As used herein, the term alkynyl does not preclude the presence of one or more nonaromatic carbon-carbon double bonds. The groups -C=CH, -C=CCH3, and -CH2C=CCH3 are non-limiting examples of alkynyl groups. An “alkyne” refers to the class of compounds havingthe formula H-R, wherein R is alkynyl. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2.

[0052] The term “aryl” when used without the “substituted” modifier refers to a monovalent unsaturated aromatic group with an aromatic carbon atom as the point of attachment, the carbon atom forming part of a one or more six-membered aromatic ring structure, wherein the ring atoms are all carbon, and wherein the group consists of no atoms other than carbon and hydrogen. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. Non-limiting examples of aryl groups include phenyl (Ph), methylphenyl, (dimethyl)phenyl, -C6H4CH2CH3 (ethylphenyl), naphthyl, and a monovalent group derived from biphenyl. The term “arenediyl” when used without the “substituted” modifier refers to a divalent aromatic group with two aromatic carbon atoms as points of attachment, the carbon atoms forming part of one or more six-membered aromatic ring structure(s) wherein the ring atoms are all carbon, and wherein the monovalent group consists of no atoms other than carbon and hydrogen. As used herein, the term does not preclude the presence of one or more alkyl, aryl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). Non-limiting examples of arenediyl groups include:

[0053] The term “aralkyl” when used without the “substituted” modifier refers to the monovalent group -alkanediyl-aryl, in which the terms alkanediyl and aryl are each used in a manner consistent with the definitions provided above. Non-limiting examples are: phenylmethyl (benzyl, Bn) and 2-phenyl-ethyl. When the term aralkyl is used with the “substituted” modifier one or more hydrogen atom from the alkanediyl and / or the aryl group has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3,-C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -0C(0)CH3, -NHC(0)CH3, -S(O)2OH or -S(O)2NH2. Non-limiting examples of substituted aralkyls are: (3-chlorophenyl)-methyl, and 2-chloro-2-phenyl-eth-l-yl.

[0054] The term “hetero” when used to modify a compound or chemical group means the compound or chemical group has at least an atom that is not carbon, for example, N, O, S, Se, P, Si, B, or any other heteroatom. For example, a heteroaliphatic can be any aliphatic moiety containing at least one heteroatom selected from N, O, P, B, S, Si, Sb, Al, Sn, As, Se, and Ge. A heterocycle can be any ring containing a ring atom that is not carbon. A heterocycle can be substituted with any number of substituents, for example, alkyl groups and halogen atoms. A heterocycle can be aromatic (heteroaryl) or non-aromatic. Non-limiting examples of heterocycles include pyrrole, pyrrolidine, pyridine, piperidine, succinamide, maleimide, morpholine, imidazole, thiophene, furan, tetrahydrofuran, pyran, and tetrahydropyran.

[0055] The term “heteroaryl” when used without the “substituted” modifier refers to a monovalent aromatic group with an aromatic carbon atom or nitrogen atom as the point of attachment, the carbon atom or nitrogen atom forming part of one or more aromatic ring structures wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the heteroaryl group consists of no atoms other than carbon, hydrogen, aromatic nitrogen, aromatic oxygen and aromatic sulfur. Heteroaryl rings may contain 1, 2, 3, or 4 ring atoms selected from are nitrogen, oxygen, and sulfur. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl, aryl, and / or aralkyl groups (carbon number limitation permitting) attached to the aromatic ring or aromatic ring system. Non-limiting examples of heteroaryl groups include furanyl, imidazolyl, indolyl, indazolyl (Im), isoxazolyl, methylpyridinyl, oxazolyl, phenylpyridinyl, pyridinyl (pyridyl), pyrrolyl, pyrimidinyl, pyrazinyl, quinolyl, quinazolyl, quinoxalinyl, triazinyl, tetrazolyl, thiazolyl, thienyl, and triazolyl. The term “A-heteroaryl” refers to a heteroaryl group with a nitrogen atom as the point of attachment. The term “heteroarenediyl” when used without the “substituted” modifier refers to an divalent aromatic group, with two aromatic carbon atoms, two aromatic nitrogen atoms, or one aromatic carbon atom and one aromatic nitrogen atom as the two points of attachment, the atoms forming part of one or more aromatic ring structure(s) wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the divalent group consists of no atoms other than carbon, hydrogen, aromatic nitrogen, aromatic oxygen and aromatic sulfur. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). As used herein, the term does not preclude the presence of one or more alkyl, aryl, and / or aralkyl groups (carbonnumber limitation permitting) attached to the aromatic ring or aromatic ring system. Non-limiting examples of heteroarenediyl groups include:

[0056] The term “heterocycloalkyl” when used without the “substituted” modifier refers to a monovalent non-aromatic group with a carbon atom or nitrogen atom as the point of attachment, the carbon atom or nitrogen atom forming part of one or more non-aromatic ring structures wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the heterocycloalkyl group consists of no atoms other than carbon, hydrogen, nitrogen, oxygen and sulfur. Heterocycloalkyl rings may contain 1, 2, 3, or 4 ring atoms selected from nitrogen, oxygen, or sulfur. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl groups (carbon number limitation permitting) attached to the ring or ring system. Also, the term does not preclude the presence of one or more double bonds in the ring or ring system, provided that the resulting group remains non-aromatic. Non-limiting examples of heterocycloalkyl groups include aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, tetrahydrofuranyl, tetrahydrothiofuranyl, tetrahydropyranyl, pyranyl, oxiranyl, and oxetanyl. The term “A-heterocycloalkyl” refers to a heterocycloalkyl group with a nitrogen atom as the point of attachment. A-pyrrolidinyl is an example of such a group. The term “heterocycloalkanediyl” when used without the “substituted” modifier refers to a divalent cyclic group, with two carbon atoms, two nitrogen atoms, or one carbon atom and one nitrogen atom as the two points of attachment, the atoms forming part of one or more ring structure(s) wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the divalent group consists of no atoms other than carbon, hydrogen, nitrogen, oxygen and sulfur. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). As used herein, the term does not preclude the presence of one or more alkyl groups (carbon number limitation permitting) attached to the ring or ring system. Also, the term does not preclude the presence of one or more double bonds in the ring or ring system, provided that the resulting group remains non-aromatic. Non-limiting examples of heterocycloalkanediyl groups include:When these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2.

[0057] The term “acyl” when used without the “substituted” modifier refers to the group -C(O)R, in which R is a hydrogen, alkyl, cycloalkyl, alkenyl, aryl, aralkyl or heteroaryl, as those terms are defined above. The groups, -CHO, -C(O)CH3 (acetyl, Ac), -C(O)CH2CH3, -C(O)CH2CH2CH3, -C(O)CH(CH3)2, -C(O)CH(CH2)2, -C(O)C6H5, -C(O)C6H4CH3, -C(O)CH2C6H5,-C(O)(imidazolyl) are non-limiting examples of acyl groups. A “thioacyl” is defined in an analogous manner, except that the oxygen atom of the group -C(O)R has been replaced with a sulfur atom, -C(S)R. The term “aldehyde” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with a -CHO group. When any of these terms are used with the “substituted” modifier one or more hydrogen atom (including a hydrogen atom directly attached to the carbon atom of the carbonyl or thiocarbonyl group, if any) has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2. The groups, -C(O)CH2CF3, -CO2H (carboxyl), -CO2CH3 (methylcarboxyl), -CO2CH2CH3, -C(O)NH2(carbamoyl), and -CON(CH3)2, are non-limiting examples of substituted acyl groups.

[0058] The term “alkoxy” when used without the “substituted” modifier refers to the group -OR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: -OCH3 (methoxy), -OCH2CH3 (ethoxy), -OCH2CH2CH3, -OCH(CH3)2 (isopropoxy), -OC(CH3)3 (tert- butoxy), -OCH(CH2)2, -O-cyclopentyl, and -O-cyclohexyl. The terms “cycloalkoxy”, “alkenyloxy”, “alkynyloxy”, “aryloxy”, “aralkoxy”, “heteroaryloxy”, “heterocycloalkoxy”, and “acyloxy”, when used without the “substituted” modifier, refers to groups, defined as -OR, in which R is cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl, and acyl, respectively. The term “alkoxydiyl” refers to the divalent group -O-alkanediyl-, -O-alkanediyl-O-, or -alkanediyl-O-alkanediyl- The term “alkylthio” and “acylthio” when used without the “substituted” modifier refers to the group -SR, in which R is an alkyl and acyl, respectively. The term “alcohol” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with a hydroxy group. The term “ether” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with an alkoxy group. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H,-CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -0C(0)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2.

[0059] The term “alkylamino” when used without the “substituted” modifier refers to the group -NHR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: -NHCH3 and -NHCH2CH3.

[0060] The term “dialkylamino” when used without the “substituted” modifier refers to the group -NRR', in which R and R' can be the same or different alkyl groups, or R and R' can be taken together to represent an alkanediyl. Non-limiting examples of dialkylamino groups include: - N(CH3)2 and -N(CH3)(CH2CH3). The terms “cycloalkylamino”, “alkenylamino”, “alkynylamino”, “arylamino”, “aralkylamino”, “heteroarylamino”, “heterocycloalkylamino”, “alkoxyamino”, and “alkylsulfonylamino” when used without the “substituted” modifier, refers to groups, defined as -NHR, in which R is cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl, alkoxy, and alkylsulfonyl, respectively. A non-limiting example of an arylamino group is -NHQHs. The term “alkylaminodiyl” refers to the divalent group -NH-alkanediyl-, -NH-alkanediyl-NH-, or -alkanediyl-NH-alkanediyl- The term “amido” (acylamino), when used without the “substituted” modifier, refers to the group -NHR, in which R is acyl, as that term is defined above. A non-limiting example of an amido group is -NHC(O)CH3. The term “alkylimino” when used without the “substituted” modifier refers to the divalent group =NR, in which R is an alkyl, as that term is defined above. When any of these terms is used with the “substituted” modifier one or more hydrogen atom attached to a carbon atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2. The groups -NHC(O)OCH3 and -NHC(O)NHCH3 are non-limiting examples of substituted amido groups.

[0061] The term “substituted” refers to moieties having substituents replacing a hydrogen on one or more carbons of the backbone. It will be understood that “substitution” or “substituted with” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc. As used herein, the term “substituted” is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic substituents of organic compounds. The permissible substituents can be one or more and the sameor different for appropriate organic compounds. For purposes of this invention, the heteroatoms such as nitrogen may have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. Substituents can include any substituents described herein, for example, a halogen, a hydroxyl, a carbonyl (such as a carboxyl, an alkoxycarbonyl, a formyl, or an acyl), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an alkoxyl, a phosphoryl, a phosphate, a phosphonate, a phosphinate, an amino, an amido, an amidine, an imine, a cyano, a nitro, an azido, a sulfhydryl, an alkylthio, a sulfate, a sulfonate, a sulfamoyl, a sulfonamido, a sulfonyl, a heterocyclyl, an aralkyl, or an aromatic or heteroaromatic moiety. It will be understood by those skilled in the art that the moieties substituted on the hydrocarbon chain can themselves be substituted, if appropriate. Unless specified otherwise, aliphatic, heteroaliphatic, oxyaliphatic, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, cycloalkyl, cycloalkylene, cycloalkenyl, cycloalkenylene, cycloalkynyl, cycloalkynylene, hydroxyalkyl, heterocycloalkyl, heterocycloalkylene, heterocycloalkenyl, heterocycloalkenylene, aryl, and heteroaryl mentioned herein include both substituted and unsubstituted moieties.

[0062] Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the present specification and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by the present application. Generally, the term “about,” as used herein when referring to a measurable value such as an amount of weight, time, dose, etc. is meant to encompass in one example variations of ± 20% or ± 10%, in another example ± 5%, in another example ± 3%, in another example ± 1%, and in yet another example ± 0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.

[0063] As used in this application, the term “average molecular weight” refers to the relationship between the number of moles of each polymer species and the molar mass of that species. In particular, each polymer molecule may have different levels of polymerization and thus a different molar mass. The average molecular weight can be used to represent the molecular weight of a plurality of polymer molecules. Average molecular weight is typically synonymous with average molar mass. In particular, there are three major types of average molecular weight: number average molar mass, weight (mass) average molar mass, and Z-average molar mass. In the context of this application, unless otherwise specified, the average molecular weight represents either the number average molar mass or weight average molar mass of the formula. In some embodiments,the average molecular weight is the number average molar mass. In some embodiments, the average molecular weight may be used to describe a PEG component present in a lipid.

[0064] The terms “comprise,” “have” and “include” are open-ended linking verbs. Any forms or tenses of one or more of these verbs, such as “comprises,” “comprising,” “has,” “having,” “includes” and “including,” are also open-ended. For example, any method that “comprises,” “has” or “includes” one or more steps is not limited to possessing only those one or more steps and also covers other unlisted steps.

[0065] The term “effective,” as that term is used in the specification and / or claims, means adequate to accomplish a desired, expected, or intended result. “Effective amount,” “Therapeutically effective amount” or “pharmaceutically effective amount” when used in the context of treating a patient or subject with a compound means that amount of the compound which, when administered to a subject or patient for treating a disease, is sufficient to effect such treatment for the disease.

[0066] As used herein, the term “patient” or “subject” refers to a living mammalian organism, such as a human, monkey, cow, sheep, goat, dog, cat, mouse, rat, guinea pig, or transgenic species thereof. In certain embodiments, the patient or subject is a primate (e.g., non-human primate). In certain embodiments, the patient or subject is a human. Non-limiting examples of human subjects are adults, juveniles, infants and fetuses.

[0067] The term “assemble” or “assembled,” as used herein, in context of delivery of a payload to target cell(s) generally refers to covalent or non-covalent interaction(s) or association(s), for example, such that a therapeutic or prophylactic agent be complexed with or encapsulated in a lipid composition.

[0068] As used herein, the term “lipid composition” generally refers to a composition comprising lipid compound(s), including but not limited to, a lipoplex, a liposome, a lipid particle. Examples of lipid compositions include suspensions, emulsions, and vesicular compositions.

[0069] As generally used herein “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and / or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0070] “Pharmaceutically acceptable salts” means salts of compounds of the present application which are pharmaceutically acceptable, as defined above, and which possess the desired pharmacological activity. Such salts include acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or with organic acids such as 1,2-ethanedisulfonic acid, 2 -hydroxy ethanesulfonic acid,2-naphthalenesulfonic acid, 3-phenylpropionic acid, 4,4'-methylenebis(3-hydroxy-2-ene- 1 -carboxylic acid), 4-methylbicyclo[2.2.2]oct-2-ene-l -carboxylic acid, acetic acid, aliphatic mono- and dicarboxylic acids, aliphatic sulfuric acids, aromatic sulfuric acids, benzenesulfonic acid, benzoic acid, camphorsulfonic acid, carbonic acid, cinnamic acid, citric acid, cyclopentanepropionic acid, ethanesulfonic acid, fumaric acid, glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid, heptanoic acid, hexanoic acid, hydroxynaphthoic acid, lactic acid, laurylsulfuric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, muconic acid, o-(4-hydroxybenzoyl)benzoic acid, oxalic acid, / ?-chlorobenzenesulfonic acid, phenyl -substituted alkanoic acids, propionic acid, / ?-toluenesulfonic acid, pyruvic acid, salicylic acid, stearic acid, succinic acid, tartaric acid, tertiarybutyl acetic acid, trimethylacetic acid, and the like. Pharmaceutically acceptable salts also include base addition salts which may be formed when acidic protons present are capable of reacting with inorganic or organic bases. Acceptable inorganic bases include sodium hydroxide, sodium carbonate, potassium hydroxide, aluminum hydroxide and calcium hydroxide. Acceptable organic bases include ethanolamine, diethanolamine, triethanolamine, tromethamine, V-methylglucamine and the like. It should be recognized that the particular anion or cation forming a part of any salt of this disclosure is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (P. H. Stahl & C. G. Wermuth eds., Verlag Helvetica Chimica Acta, 2002).

[0071] The term “pharmaceutically acceptable carrier,” as used herein means a pharmaceutically- acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a chemical agent.

[0072] “Prevention” or “preventing” includes: (1) inhibiting the onset of a disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease, and / or (2) slowing the onset of the pathology or symptomatology of a disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease.

[0073] The term “helper lipid” as used in this disclosure refers to a lipid that contributes to the stability or delivery efficacy of a lipid composition. A helper lipid can be a zwitterionic lipid, such as a phospholipid. A helper lipid can be phosphatidylcholine, distearoylphosphatidylcholine, di oleoylphosphatidylethanolamine, l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE) or l,2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC). In some cases, the term “helper lipid” refersto phospholipids or other zwitterionic lipids in the LNP composition. In some cases, when describing the formulation of an LNP using weight ratios of the lipid components (e.g., lipidoid, steroid, helper lipid, and polymer conjugated lipid), a helper lipid refers to a phospholipid or another zwitterionic lipid. For example, the weight ratio of the lipidoid / steroid / helper lipid / polymer conjugated lipid is about 4 / 1 / 1 / 1. “Helper lipid” can refer to any class of lipid molecules that improves the particle stability and fluidity of lipid nanoparticles (LNP). Several classes of molecules can be used as helper lipids such as phospholipids (e.g., phosphoethanolamine, phosphocholine), zwitterionic lipids, steroid derivatives, and polymer conjugated lipids (e.g., PEGylated lipid). Representative helper lipids include cholesterol, 1,2- dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE), l,2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC), Phosphatidylcholine (PC), Methoxy-Polyethyleneglycol (MW 2k)- distearoylphosphatidylethanolamine (mPEG2k-DSPE), and l,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG2k).Compositions

[0074] In one aspect, provided herein is a composition comprising a pharmaceutical agent assembled with a lipid composition, wherein the lipid composition comprises an ionizable lipid.

[0075] In embodiments, the composition comprises a pharmaceutical agent assembled with a lipid composition, the lipid composition comprises an ionizable lipid, wherein the ionizable lipid comprises an amine head group and at least one hydrophobic tail group RLipid, wherein each RL1Pldindependently comprises a structure of a structure of:or a pharmaceutically acceptable salt thereof, wherein:Rki and Rk3 are each independently a Cl -CIO alkyl;Rk2 is a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3- C20 heterocycloalkyl, aryl, or heteroaryl; andRk4and Rks are each independently H or Cl -CIO alkyl.

[0076] In embodiments, the composition comprises a pharmaceutical agent assembled with a lipid composition, and the lipid composition comprises an ionizable lipid, wherein the ionizable lipid comprises an amine head group and at least one hydrophobic tail group RLipid, wherein each RL1Pldindependently comprises a structure of:or a pharmaceutically acceptable salt thereof; wherein:Rki is independently a C1-C12 bivalent aliphatic or heteroaliphatic radical;Rk3 is independently a Cl -Cl 2 alkyl, C2-C12 alkenyl, C2-C12 alkynyl, C3-C12 cycloalkyl, C3- C12 heterocycloalkyl, aryl, or heteroaryl;Rk2 is independently a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3- C20 heterocycloalkyl, aryl, or heteroaryl;Rk4and Rks are each independently H or C1-C12 bivalent aliphatic radical;M is O or NRk6, whereinRk6is H or C1-C12 bivalent aliphatic radical; and the pharmaceutical agent comprises one or more nucleic acid molecules encoding one or more therapeutic peptides for cancer immunotherapy.

[0077] In an aspect, provided herein is a composition, comprising a pharmaceutical agent assembled with a lipid composition that comprises an ionizable lipid, wherein the ionizable lipid comprises an amine head group and at least two hydrophobic tail groups RLipid, wherein each RL1Pldindependently comprises a structure selected from the group consisting of:or a pharmaceutically acceptable salt thereof, wherein:Rki and Rk3 are each independently Cl -CIO alkyl; and each Rk2is independently a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3- C20 heterocycloalkyl, aryl, or heteroaryl; wherein the pharmaceutical agent comprises one or more nucleic acid molecules encoding a bispecific T-cell engager targeting glypican-3 and CD3 (GPC3 / CD3 BiTE).

[0078] In some embodiments, the composition comprises a pharmaceutical agent assembled with a lipid composition that comprises an ionizable lipid, wherein the ionizable lipid comprises an amine head group and at least one hydrophobic tail group RLipid, wherein each RL1Pldindependently comprises a structure of Formula (Va):or a pharmaceutically acceptable salt thereof; wherein:Rklis independently a C1-C12 bivalent aliphatic or heteroaliphatic radical;Rk3is independently a Cl -Cl 2 alkyl;Rk2is independently a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl,C1-C20 heteroalkyl, C3-C20 heterocycloalkyl, aryl, or heteroaryl; andwherein the pharmaceutical agent comprises one or more nucleic acid molecules encoding a bispecific T-cell engager targeting glypican-3 and CD3 (GPC3 / CD3 BiTE).

[0079] In some embodiments, the composition comprises a pharmaceutical agent assembled with a lipid composition that comprises an ionizable lipid, wherein the ionizable lipid comprises an amine head group and at least two hydrophobic tail groups RLipid, wherein each RL1Pldindependently comprises a structure of Formula (Fa):or a pharmaceutically acceptable salt thereof; wherein:Rki and Rk3 are each independently Cl -CIO alkyl; and each Rk2is independently a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3- C20 heterocycloalkyl, aryl, or heteroaryl; wherein the pharmaceutical agent comprises one or more nucleic acid molecules encoding a bispecific T-cell engager targeting glypican-3 and CD3 (GPC3 / CD3 BiTE).

[0080] In some embodiments, the ionizable lipid comprises at least two hydrophobic tail groups RLipid. In some embodiments, the ionizable lipid comprises at least three hydrophobic tail groups RLipid. In some embodiments, the ionizable lipid comprises three or four hydrophobic tail groups RLipid. In some embodiments, the ionizable lipid comprises four hydrophobic tail groups RLipid.

[0081] In some embodiments, each RL1Pldis independently selected from the group consisting ofor a pharmaceutically acceptable salt thereof, wherein:Rki and Rk3 are each independently Cl -CIO alkyl; andRk2 is a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3-C20 heterocycloalkyl, aryl, or heteroaryl.

[0082] In some embodiments, each RL1Pldis independently selected from the group consisting ofor a pharmaceutically acceptable salt thereof, wherein:Rki and Rk3 are each independently Cl -CIO alkyl; andRk2 is a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3-C20 heterocycloalkyl, aryl, or heteroaryl.

[0083] In some embodiments, each RL1Pldis independently selected from the group consisting ofor a pharmaceutically acceptable salt thereof, wherein:Rki and Rk3 are each independently Cl -CIO alkyl; andRk2 is a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl,C3- C20 heterocycloalkyl, aryl, or heteroaryl.

[0084] In some embodiments, each RL1Pldis independently selected fromor a pharmaceutically acceptable salt thereof, wherein:Rki and Rk3 are each independently Cl -CIO alkyl; andRk2 is a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3-C20 heterocycloalkyl, aryl, or heteroaryl.

[0085] In some embodiments, each RL1Pldis independently selected fromor a pharmaceutically acceptable salt thereof, wherein:Rki and Rk3 are each independently Cl -CIO alkyl; andRk2 is a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl,C3- C20 heterocycloalkyl, aryl, or heteroaryl.

[0086] In some embodiments, each RL1Pldis independently selected fromor a pharmaceutically acceptable salt thereof, wherein:Rki and Rk3 are each independently Cl -CIO alkyl; andRk2 is a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3-C20 heterocycloalkyl, aryl, or heteroaryl.

[0087] In some embodiments, each RL1Pldis independently selected fromor a pharmaceutically acceptable salt thereof, wherein:Rki and Rk3 are each independently Cl -CIO alkyl; andRk2 is a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3- C20 heterocycloalkyl, aryl, or heteroaryl.

[0088] In some embodiments of RLipid, Rk2 is selected from C1-C20 alkyl, C2-C20 alkenyl, C2- C20 alkynyl, and C1-C20 heteroalkyl. In some embodiments, Rk2 is selected from C1-C20 alkyl, C2-C20 alkenyl, and C1-C20 heteroalkyl. In some embodiments, Rk2 is selected from C1-C20 alkyl and C2-C20 alkenyl. In some embodiments, Rk2 is C1-C20 alkyl. In some embodiments, Rk2 is C2-C20 alkenyl.

[0089] In some embodiments, the ionizable lipid comprises an amine head group and at least one hydrophobic tail RL1Pldhaving a structure of Formula (I):or a pharmaceutically acceptable salt thereof; wherein:*indicates a point of attachment to a nitrogen in the amine head group;Ri and R2 are each independently a C1-C12 bivalent aliphatic or heteroaliphatic radical;in which each of Li, L2, L3, and L4 is, independently, a bond, O, S, orNRc; G is O, S, or NRd; Q is ORe, SRf, orNRgRh; and each of r and t is independently 1-6;each of Rc, Rd, Re, Rf, Rg, and Rhis independently H, Cl -CIO alkyl, Cl -CIO heteroalkyl, aryl, or heteroaryl;Y and U are each independently a bond, O, S, NR10, or Se; n is 0 or 1;R3 and R4, are each independently H, Cl -CIO alkyl, Cl -CIO heteroalkyl, aryl, or heteroaryl; or R3 and R4 together with the atom to which they are attached, form C=O;R5is a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3- C20 heterocycloalkyl, aryl, or heteroaryl; and the pharmaceutical agent comprises one or more nucleic acid molecules encoding one or more therapeutic peptides for cancer immunotherapy.

[0090] In some embodiments, n is 0. In some embodiments, n is 1.

[0091] In some embodiments, n is 1 and R3 and R4 together with the atom to which they are attached, form C=O. In some embodiments, Y is CH2 and U is O. In some embodiments, Y and U are both O. In some embodiments, U is CH2 and Y is O. In some embodiments, Y and U are NR10. In some embodiments, Y is O and U is NR10. In some embodiments, Y is S and U is NR10.

[0092] In some embodiments, n is 0, and Y and U are both S.

[0093] In some embodiments, n is 0, and one of Y and U is O.

[0094] In some embodiments, n is 0, and one of Y and U is Se.

[0095] In some embodiments, Ri is a C1-C12 alkyl, linear or branched. In some embodiments, Ri is a Cl -CIO alkyl, linear or branched. In some embodiments, Ri is a C1-C8 alkyl, linear or branched. In some embodiments, Ri is a C1-C6 alkyl, linear or branched. In some embodiments, Ri is a C1-C4 alkyl, linear or branched. In some embodiments, Ri is a C2 alkyl, e.g.,, yl. In some embodiments,Ri is a C1-C12 heteroaliphatic radical.

[0096] In some embodiments, R2 is a C1-C12 alkyl, linear or branched. In some embodiments, R2 is a Cl -CIO alkyl, linear or branched. In some embodiments, R2 is a C1-C8 alkyl, linear or branched. In some embodiments, R2 is a C1-C6 alkyl, linear or branched. In some embodiments,R2 is a C1-C4 alkyl, linear or branched. In some embodiments, R2 is a C2 alkyl, e.g.,In some embodiments, R2 is a C3 alkyl, e.g.,In some embodiments, R2 is a C4 alkyl. In some embodiments, R2 is a Cl -Cl 2 heteroaliphatic radical.

[0097] In some embodiments, Rki is a Cl -CIO alkyl, linear or branched. In some embodiments,Rki is a C1-C4 alkyl, linear or branched. In some embodiments, Rki is a C2 alkyl, e.g.,In some embodiments, Rki is a C3 alkyl, e.g.,In some embodiments, Rki is a C4 alkyl.

[0098] In some embodiments, Rk3 is a Cl -CIO alkyl, linear or branched. In some embodiments, Rk3 is a C1-C4 alkyl, linear or branched. In some embodiments, Rk3 is a C2 alkyl, e.g.,.In some embodiments, Rk3 is a C3 alkyl, e.g.,, or. In some embodiments, Rk3 is a C4 alkyl.

[0099] In some embodiments, Rk4 is H. In some embodiments, Rk4 is Cl -CIO alkyl. In some embodiments, Rk4 is C1-C4 alkyl. In some embodiments, Rk4 is C4-C10 alkyl.

[0100] In some embodiments, Rks is H. In some embodiments, Rks is C1-C10 alkyl. In some embodiments, Rks is C1-C4 alkyl. In some embodiments, Rks is C4-C10 alkyl.

[0101] In some embodiments, Rk2 is a C1-C20 alkyl. In some embodiments, Rk2 is a C2- C20 alkenyl. In some embodiments, Rk2 is a C2-C20 alkynyl. In some embodiments, Rk2 is a C3- C20 cycloalkyl. In some embodiments, Rk2 is a C1-C20 heteroalkyl. In some embodiments, Rk2 is a C3- C20 heterocycloalkyl, aryl, or heteroaryl.

[0102] In some embodiments, the at least one hydrophobic tail comprises

[0103] In some embodiments, the amine head group is represented bywherein Ra, Ra’, Ra”, and Ra’” are each independently, H, Cl -20 alkyl, C2-C20 alkenyl, C2- C20 alkynyl, C3-C20 cycloalkyl or heterocycloalkyl, C1-C20 heteroalkyl, C3-C20 aryl or heteroaryl,bivalent aliphatic radical, a C1-C20 bivalent heteroaliphatic radical, a bivalent aryl radical, or a bivalent heteroaryl radical.

[0104] In some embodiments, the ionizable lipid is represented by Formula (II):or a pharmaceutically acceptable salt thereof, wherein:Rbis a substituted or unsubstituted alkyl, hydroxyalkyl, alkoxyalkyl, or aryl; nl and n2 are each independently 1, 2, 3, 4, 5, or 6; andRbl, Rb2, Rb3and Rb4are each independently H, or RL1Pldwherein at least one of Rbl, Rb2, Rb3and Rb4is not H.

[0105] In some embodiments, ionizable lipid is represented by Formula (II):Rbl RbRb3or a pharmaceutically acceptable salt thereof, wherein:Rbis a substituted or unsubstituted Cl -CIO alkyl; nl and n2 are each independently 1, 2, 3, 4, 5, or 6; andRbl, Rb2, Rb3and Rb4are each independently H or RLipid;wherein at least one of Rbl, Rb2, Rb3and Rb4is not H.

[0106] In some embodiments, ionizable lipid is represented by Formula (II):or a pharmaceutically acceptable salt thereof, wherein:Rbis a C1-C4 alkyl which is optionally substituted with 1 to 4 groups selected from -OH; nl and n2 are each independently 1, 2, 3, or 4;Rbl, Rb2, Rb3and Rb4are each independently H or RLipid; wherein at least one of Rbl, Rb2, Rb3and Rb4is not H.

[0107] In some embodiment of Formula (II), Rbis a C1-C6 alkyl which is optionally substituted with 1 to 4 groups selected from -OH; nl and n2 are each independently 1, 2, 3, or 4; and Rbl, Rb2, Rb3and Rb4are each independently RL1Pld.

[0108] In some embodiment of Formula (II), Rbis unsubstituted C1-C6 alkyl; nl and n2 are each independently 1, 2, 3, or 4; and Rbl, Rb2, Rb3and Rb4are each independently RL1Pld

[0109] In some embodiments, Rbis a C1-C6 alkyl, linear or branched. In some embodiments, Rbis a substituted C1-C6 alkyl, linear or branched. In some embodiments, a substituent comprises hydroxyl, carbonyl, thiocarbonyl, alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino, amide, cyclic amine, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, aralkyl, or aromatic or heteroaromatic moiety. In some embodiments, the substituent comprises hydroxyl,

[0110] In some embodiments, nl is 1, 2, 3, 4, 5, or 6. In some embodiments, nl is 2 or 3.

[0111] In some embodiments, n2 is 1, 2, 3, 4, 5, or 6. In some embodiments, n2 is 2 or 3.

[0112] In some embodiments, nl and n2 are identical. In some embodiments, nl and n2 are different. In some embodiments, both nl and n2 are 2. In some embodiments, both nl and n2 are 3. In some embodiments, both nl and n2 are 4.

[0113] In some embodiments, Rblis not H. In some embodiments, Rb2is not H. In some embodiments, Rb3is not H. In some embodiments, Rb4is not H.

[0114] In some embodiments, at least two of Rbl, Rb2, Rb3and Rb4are not H. In some embodiments, at least three of Rbl, Rb2, Rb3and Rb4are not H. In some embodiments, none of Rbl, Rb2, Rb3and Rb4is H.

[0115] In some embodiments, the amine head group is selected from the group consisting

[0116] In some embodiments, the amine head group is selected from the group consisting

[0117] In some embodiments, the amine head group is selected from the group consisting

[0118] In some embodiments, the at least one hydrophobic tail is selected from theTABLE 1.TABLE 1. Exemplary Hydrophobic Tail

[0119] In some embodiments, the ionizable lipid comprises at least two hydrophobic tails.In some embodiments, the at least two hydrophobic tails are independently of structure. In some embodiments, the at least two hydrophobic tails are identical. In some embodiments, the at least two hydrophobic tails are not identical. In some embodiments, one of the at least two hydrophobic tails is different from the rest.

[0120] In some embodiments, the lipid composition comprises at least three hydrophobic tails. In some embodiments, the at least three hydrophobic tails are independently of structurein some embodiments, the at least three hydrophobic tails are identical. In some embodiments, the at least three hydrophobic tails are not identical. In some embodiments, one of the at least three hydrophobic tails is different from the rest.

[0121] In some embodiments, the lipid composition comprises two hydrophobic tails. In some embodiments, the two hydrophobic tails are independently of structure. In some embodiments, the two hydrophobic tails are identical. In some embodiments, the two hydrophobic tails are not identical.

[0122] In some embodiments, the lipid composition comprises three hydrophobic tails. In some embodiments, the three hydrophobic tails are independently of structure. In some embodiments, the three hydrophobic tails are identical. In some embodiments, two of the three hydrophobic tails are identical and the third hydrophobic tail is different. In some embodiments, all three hydrophobic tails are different.

[0123] In some embodiments, the lipid composition comprises four hydrophobic tails. In some embodiments, the four hydrophobic tails are independently of structure. In some embodiments, the four hydrophobic tails are identical. In some embodiments, three of the four hydrophobic tails are identical and the fourth hydrophobic tail is different. In some embodiments, two of the four hydrophobic tails are identical, the other two hydrophobic tails are identical, and the two are different from other two. In some embodiments, two of the four hydrophobic tails are identical while the other two are different from each other and are different from the two. In some embodiments, all four hydrophobic tails are different.

[0124] In some embodiments, the ionizable lipid comprises:

[0126] In some embodiments, the ionizable lipid is selected from TABLE 2.TABLE 2. Exemplary Ionizable Lipid

[0127] In some embodiments, the composition provided herein further comprises a steroid. In some embodiments, the steroid comprises a cholesterol or a cholesterol derivative. In some embodiments, the composition provided herein further comprises a helper lipid. In some embodiments, the helper lipid comprises a phospholipid, such as l,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE) or l,2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC). In some embodiments, the composition provided herein further comprises a polymer conjugated lipid. In some embodiments, the polymer conjugated lipid comprises l,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[methoxy(poly ethylene glycol)-2000 (DSPE-PEG2k) or 1,2- dimyristoyl-rac-glycero-3-methoxypoly ethylene gly col-2000 (DMG-PEG2k).

[0128] In some embodiments, the lipid composition comprises an ionizable lipid disclosed in this application, a steroid, a helper lipid, and a polymer conjugated lipid.

[0129] In some embodiments, the ionizable lipid is present in the lipid composition at a weight percentage from about 10% to about 20%, about 10% to about 30%, about 10% to about 40%, about 10% to about 50%, about 10% to about 60%, about 10% to about 80%, about 10% to about 90%, from about 20% to about 30%, from about 20% to about 30%, from about 20% to about 40%, from about 20% to about 50%, from about 20% to about 60%, from about 20% to about 70%, from about 20% to about 80%, from about 20% to about 90%, from about 30% to about 40%, from about 30% to about 50%, from about 30% to about 60%, from about 30% to about 70%, from about 30% to about 80%, from about 30% to about 90%, from about 40% to about 50%, from about 40% to about 60%, from about 40% to about 70%, from about 40% to about 80%, from about 40% to about 90%, from about 50% to about 60%, from about 50% to about 70%, from about 50% to about 80%, from about 50% to about 90%, from about 60% to about 70%, from about 60% to about 80%, from about 60% to about 90%, from about 70% to about 80%, from about 70% to about 90%, or from about 80% to about 90%.

[0130] In some embodiments, the helper lipid is present in the lipid composition at a weight percentage from about 1% to about 5%, from about 1% to about 10%, from about 1% to about 20%, from about 5% to about 10%, from about 5% to about 20%, or from about 10% to about 20%.

[0131] In some embodiments, the steroid is present in the lipid composition at a weight percentage from about 10% to about 20%, from about 10% to about 30%, from about 10% to about 40%, from about 20% to about 30%, from about 20% to about 40%, or from about 30% to about 40%.

[0132] In some embodiments, the polymer conjugated lipid is present in the lipid composition at a weight percentage from about 1% to about 5%, from about 1% to about 10%, from about 1% to about 20%, from about 5% to about 10%, from about 5% to about 20%, or from about 10% to about 20%.

[0133] In some embodiments, the weight ratio of the ionizable lipid / steroid / helper lipid / polymer conjugated lipid is about 14 / 4 / 1 / 1, about 15 / 4 / 1 / 1, about 16 / 4 / 1 / 1, about 17 / 4 / 1 / 1, about 18 / 4 / 1 / 1, about 19 / 4 / 1 / 1, about 20 / 4 / 1 / 1, about 14 / 4 / 2 / 1, about 15 / 4 / 2 / 1, about 16 / 4 / 2 / 1, about 16.8 / 4 / 2 / 1, about 17 / 4 / 2 / 1, about 18 / 4 / 2 / 1, about 19 / 4 / 2 / 1, or about 20 / 4 / 2 / 1.

[0134] In some embodiments, the lipid composition comprises an ionizable lipid disclosed in this application, a steroid and a helper lipid. In some embodiments, the ionizable lipid is present in the lipid composition at a weight percentage from about 30% to about 90%. In some embodiments, the helper lipid is present in the lipid composition at a weight percentage from about 5% to about 40%. In some embodiments, the steroid is present in the lipid composition at a weight percentage from about 5% to about 40%. In some embodiments, the weight ratio of the ionizable lipid / steroid / helper lipid is about 1 / 1 / 1, 2 / 1 / 1, about 3 / 1 / 1, about 4 / 1 / 1, about 5 / 1 / 1, about 6 / 1 / 1, about 2 / 2 / 1, about 3 / 2 / 1, about 4 / 2 / 1, about 5 / 2 / 1, or about 6 / 2 / 1.

[0135] In some embodiments, the lipid composition further comprises a pharmaceutically acceptable carrier. In some embodiments, a carrier comprises a pharmaceutically acceptable excipient. The carrier can comprise a sugar, wherein the sugar comprises mannitol, sucrose, maltose, or trehalose. The carrier can comprise EC- 16, (2-hydroxypropyl)-P-cyclodextrin ((HP-P- CD), stearic acid, Perfluoroundecanoic, Saponin, Mannitol, Borneol, Amikacin-EC16, Kanamycin-EC16, Neomycin-EC16, or Bile salts. In some embodiments, the carrier is present in the composition at a weight percentage from about 5% to about 60%. In some embodiments, the excipient is present in the composition at a weight percentage from about 1% to about 70%, from about 5% to about 60%, from about 5% to about 50%, from about 5% to about 40%, from about 5% to about 30%, from about 10% to about 50%, from about 10% to about 40%, from about 10% to about 30%, or from about 10% to about 20%.

[0136] In some embodiments, the pharmaceutical agent comprises a polynucleotide, an oligonucleotide, a polypeptide, an oligopeptide, a small molecule compound, or any combination thereof. In some embodiments, the polynucleotide is a messenger ribonucleic acid (mRNA).

[0137] In some embodiments, the pharmaceutical agent comprises a polynucleotide that encodes a gene product thereof.

[0138] In some embodiments, the pharmaceutical agent comprises an mRNA encoding at least one therapeutic peptide for cancer immunotherapy. In some embodiments, the pharmaceutical agent comprises an mRNA encoding an antibody or a fragment thereof. In some embodiments, the mRNA encodes a bispecific T cell engager (BiTE). In some embodiments, the mRNA encoding the GPC3-CD3 BiTE is codon-optimized to increase expression in a subject. In some embodiments, the subject comprises a mammal. In some embodiments, the subject comprises a rodent, human or a non-human primate. In some embodiments, the mRNA encoding the GPC3-CD3 BiTE comprises the nucleic acid sequence of SEQ ID NO: 1.

[0139] In some embodiments, the pharmaceutical agent is used for cancer immunotherapy. In some embodiments, the cancer immunotherapy is T-cell mediated immunotherapy. In some embodiments, the pharmaceutical agent comprises one or more nucleic acid molecules encoding a bispecific T-cell engager targeting glypican-3 and CD3 (GPC3 / CD3 BiTE). In some embodiments, the pharmaceutical agent comprises an mRNA encoding the GPC3 / CD3 BiTE.

[0140] In some embodiments, pharmaceutical agent is assembled in the lipid composition at a weight ratio of the pharmaceutical agent / lipid composition of from about 1 :200 to about 1 : 100, from about 1 :200 to about 1 :50, from about 1 :200 to about 1 :40, from about 1 :200 to about 1 :30, from about 1 :200 to about 1 :20, from about 1 :200 to about 1 : 10, from about 1 :200 to about 1 :5, from about 1 :200 to about 1 : 1, from about 1 : 100 to about 1 :50, from about 1 : 100 to about 1 :40, from about 1 : 100 to about 1 :25, from about 1 : 100 to about 1 :20, from about 1 : 100 to about 1 : 15, from about 1 : 100 to about 1 : 10, from about 1 : 100 to about 1 :5 or from about 1 : 100 to about 1 : 1.

[0141] In some embodiments, the composition is formulated for systemic or local administration. In some embodiments, the composition is formulated for intravenous administration. In some embodiments, the composition is formulated for intramuscular administration.Additional Lipids

[0142] In some embodiments, the lipid composition further comprises an additional lipid comprising a steroid or a steroid derivative, a PEG lipid, and a helper lipid (e.g., phospholipids or other zwitterionic lipids).

[0143] In some embodiments, the lipid composition further comprises a helper lipid. In some embodiments, the helper lipid comprises a lipid that contributes to the stability or delivery efficiency of the lipid compositions. In some embodiments, the helper lipid comprises a zwitterionic lipid. In some embodiments, the helper lipid comprises a phospholipid. In someembodiments, the phospholipid may contain one or two long chain (e.g., C6-C24) alkyl or alkenyl groups, a glycerol or a sphingosine, one or two phosphate groups, and, optionally, a small organic molecule. The small organic molecule may be an amino acid, a sugar, or an amino substituted alkoxy group, such as choline or ethanolamine. In some embodiments, the phospholipid is a phosphatidylcholine. In some embodiments, the phospholipid is distearoylphosphatidylcholine or dioleoylphosphatidylethanolamine. In some embodiments, other zwitterionic lipids are used, where zwitterionic lipid defines lipid and lipid-like molecules with both a positive charge and a negative charge. In some embodiments of the lipid compositions, the phospholipid is not an ethylphosphocholine. In some embodiments, the helper lipid can comprise 1,2-dioleoyl-sn- glycero-3 -phosphoethanolamine (DOPE) or l,2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC).

[0144] In some embodiments, the compositions may further comprise a molar percentage of the phospholipid to the total lipid composition from about 5 to about 30.

[0145] In some embodiments, the helper lipid is present in the lipid composition at a weight percentage from about 1% to about 5%, from about 1% to about 10%, from about 1% to about 20%, from about 5% to about 10%, from about 5% to about 20%, or from about 10% to about 20%.

[0146] In some embodiments, the lipid composition comprises the phospholipid at a molar percentage from about 8% to about 23%. In some embodiments, the lipid composition comprises the phospholipid at a molar percentage from about 10% to about 20%. In some embodiments, the lipid composition comprises the phospholipid at a molar percentage from about 15% to about 20%. In some embodiments, the lipid composition comprises the phospholipid at a molar percentage from about 8% to about 15%. In some embodiments, the lipid composition comprises the phospholipid at a molar percentage from about 10% to about 15%. In some embodiments, the lipid composition comprises the phospholipid at a molar percentage from about 12% to about 18%. In some embodiments, the lipid composition comprises the phospholipid at a molar percentage of at least about 8%, at least about 10%, at least about 12%, at least about 15%, at least about 18%, at least about 20%, or at least about 23%. In some embodiments, the lipid composition comprises the phospholipid at a molar percentage of at most about 8%, at most about 10%, at most about 12%, at most about 15%, at most about 18%, at most about 20%, or at most about 23%.

[0147] In some embodiments, the lipid composition further comprises a steroid or steroid derivative. In some embodiments, the steroid or steroid derivative comprises any steroid or steroid derivative. As used herein, in some embodiments, the term “steroid” is a class of compounds with a four ring 17 carbon cyclic structure which can further comprises one or more substitutions including alkyl groups, alkoxy groups, hydroxy groups, oxo groups, acyl groups, or a double bondbetween two or more carbon atoms. In one aspect, the ring structure of a steroid comprises three fused cyclohexyl rings and a fused cyclopentyl ring as shown in the formula:In some embodiments, a steroid derivative comprises the ring structure above with one or more non-alkyl substitutions. In some embodiments, the steroid or steroid derivative is a sterol wherein the formula is further defined as:. In some embodiments, the steroid or steroid derivative is a cholestane or cholestane derivative. In a cholestane, the ring structure is further defined by the formula:. As described above, a cholestane derivative includes one or more non-alkyl substitution of the above ring system. In some embodiments, the cholestane or cholestane derivative is a cholestene or cholestene derivative or a sterol or a sterol derivative. In other embodiments, the cholestane or cholestane derivative is both a cholesterol and a sterol or a derivative thereof.

[0148] In some embodiments, the compositions may further comprise a molar percentage of the steroid to the total lipid composition from about 20 to about 60. In some embodiments, the steroid is present in the lipid composition at a weight percentage from about 10% to about 20%, from about 10% to about 30%, from about 10% to about 40%, from about 20% to about 30%, from about 20% to about 40%, or from about 30% to about 40%.

[0149] In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage from about 15% to about 46%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage from about 20% to about 40%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage from about 25% to about 35%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage from about 30% to about 40%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage from about 20% to about 30%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage of at least about 15%, at least about 20%, atleast about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 46%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage of at most about 15%, at most about 20%, at most about 25%, at most about 30%, at most about 35%, at most about 40%, at most about 45%, or at most about 46%.

[0150] In some embodiments, the lipid composition further comprises a polymer conjugated lipid. In some embodiments, the polymer conjugated lipid is a PEG lipid. In some embodiments, the PEG lipid is a diglyceride which also comprises a PEG chain attached to the glycerol group. In other embodiments, the PEG lipid is a compound which contains one or more C6-C24 long chain alkyl or alkenyl group or a C6-C24 fatty acid group attached to a linker group with a PEG chain. Some non-limiting examples of a PEG lipid includes a PEG modified phosphatidylethanolamine and phosphatidic acid, a PEG ceramide conjugated, PEG modified dialkylamines and PEG modified l,2-diacyloxypropan-3 -amines, PEG modified diacylglycerols and dialkylglycerols. In some embodiments, PEG modified diastearoylphosphatidylethanolamine or PEG modified dimyristoyl- w-glycerol. In some embodiments, the PEG modification is measured by the molecular weight of PEG component of the lipid. In some embodiments, the PEG modification has a molecular weight from about 100 to about 15,000. In some embodiments, the molecular weight is from about 200 to about 500, from about 400 to about 5,000, from about 500 to about 3,000, or from about 1,200 to about 3,000. The molecular weight of the PEG modification is from about 100, 200, 400, 500, 600, 800, 1,000, 1,250, 1,500, 1,750, 2,000, 2,250, 2,500, 2,750, 3,000, 3,500, 4,000, 4,500, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 12,500, to about 15,000. Some non-limiting examples of lipids that may be used in the present application are taught by U.S. Patent 5,820,873, WO 2010 / 141069, or U.S. Patent 8,450,298, which is incorporated herein by reference.

[0151] In some embodiments, the PEG lipid has a structural formula:, wherein: R12 and R13 are each independently alkyl(c<24), alkenyl(c<24), or a substituted version of either of these groups; Reis hydrogen, alkyl(c<8), or substituted alkyl(c<8); and x is 1-250. In some embodiments, Re is alkyl(c<8) such as methyl. R12 and R13 are each independently alkyl(c<4-20). In some embodiments, x is 5-250. In one embodiment, x is 5-125 or x is 100-250. In some embodiments, the PEG lipid is 1,2-dimyristoyl-sw-glycerol, methoxypolyethylene glycol.

[0152] In some embodiments, the PEG lipid has a structural formula:, wherein: ni is an integer between 1 and 100 and n2 and ns are each independently selected from an integer between 1 and 29. In some embodiments, m is 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100, or any range derivable therein. In some embodiments, is from about 30 to about 50. In some embodiments, n2 is from 5 to 23. In some embodiments, n2 is 11 to about 17. In some embodiments, ns is from 5 to 23. In some embodiments, ns is 11 to about 17.

[0153] In some embodiments, the polymer conjugated lipid comprises 1,2-distearoyl-sn- glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000 (DSPE-PEG2k) or 1,2- dimyristoyl-rac-glycero-3-methoxypoly ethylene gly col-2000 (DMG-PEG2k).

[0154] In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 0.5% to about 20%. In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 1% to about 8%. In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 2% to about 7%. In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 3% to about 5%. In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 5% to about 10%. In some embodiments, the lipid composition comprises the polymer- conjugated lipid at a molar percentage of at least about 0.5%, at least about 1%, at least about 1.5%, at least about 2%, at least about 2.5%, at least about 3%, at least about 3.5%, at least about 4%, at least about 4.5%, at least about 5%, at least about 5.5%, at least about 6%, at least about 6.5%, at least about 7%, at least about 7.5%, at least about 8%, at least about 8.5%, at least about 9%, at least about 9.5%, or at least about 10%. In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage of at most about 0.5%, at most about 1%, at most about 1.5%, at most about 2%, at most about 2.5%, at most about 3%, at most about 3.5%, at most about 4%, at most about 4.5%, at most about 5%, at most about 5.5%, at most about 6%, at most about 6.5%, at most about 7%, at most about 7.5%, at most about 8%, at most about 8.5%, at most about 9%, at most about 9.5%, at most about 10%, at most about 15%, or at most 20%.

[0155] In some embodiments, the polymer conjugated lipid is present in the lipid composition at a weight percentage from about 1% to about 5%, from about 1% to about 10%, from about 1% to about 20%, from about 5% to about 10%, from about 5% to about 20%, or from about 10% to about 20%.Cancer Immunotherapy

[0156] Cancer immunotherapy is the science of modulating the immune system against cancer. Immune checkpoint inhibitors targeting the CTLA-4 and PD1 / PD-L1 pathways emerged as a revolutionary cancer treatment strategy, due to impressive clinical responses and overall outcome benefits in certain tumor types. Novel immunotherapies that redirect T-cells against tumor antigens through antibody fragments independent of major histocompatibility complex (MHC) presentation have been under investigation. In particular, chimeric antigen-receptor- modified (CAR) T cells and bispecific T-cell engagers (BiTEs) have demonstrated remarkable clinical responses in hematologic malignancies.

[0157] BiTEs are recombinant proteins composed of two different single-chain variable fragment (scFv) regions from two different monoclonal antibodies. The scFv constructs are covalently connected by a flexible small peptide linker, altogether comprising a ~55 kDa polypeptide chain. One scFv-binding domain is engineered to target a select tumor-associated antigen (TAA) and the other scFv domain is typically specific for CD3, the invariant component of the T-cell receptor (TCR) complex. The length of the inter-scFv linker varies depending on construct, but linker size does not directly impact tumor-killing activity. However, linker length must account for flexibility, stability, and the orientation of binding interaction between TAA and epitope. In comparison with alternative bsAbs formats and monoclonal IgG antibodies, BiTEs have a 100-to- 10,000-fold higher efficacy in tumor cell lysis with a low ratio of T-cells to target tumor cells in cellular models. Subsequent to BiTE-induced T-cell activation, the diffusion of released cytokines in the immune synapse also plays a role in upregulation of cell surface molecules of the surrounding cells, further contributing to the antitumor activity of BiTEs, commonly named the “bystander effect”. Furthermore, BiTEs can be produced in large quantities by mammalian cell lines, minimizing interpatient variability and providing “off-the-shelf’ therapies that now are undergoing investigation in a multitude of tumor types. Despite the impressive results of BiTEs in hematological malignancies, illustrated by blinatumomab efficacy in B-ALL, first-generation compounds have failed to demonstrate significant antitumor activity in solid tumors. Challenges of implementing BiTEs in solid tumors include the lack of target antigen expression, tumor inaccessibility, and the impact of an immunosuppressive tumor microenvironment.

[0158] Glypican-3 (GPC3) is highly expressed in hepatocellular carcinoma (HCC) and various types of lung cancers in human. Provided herein are lipid nanoparticle compositions comprising a pharmaceutical agent encapsulated by the lipid composition provided herein, wherein the pharmaceutical agent comprises one or more nucleic acid molecules encoding one or more therapeutic peptides targeting the tumor marker GPC3 for cancer immunotherapy. In some embodiments, the cancer immunotherapy comprises T-cell based therapies. In some embodiments, the one or more therapeutic peptides for cancer immunotherapy comprise an antibody or a fragment thereof.

[0159] In some embodiments, the antibody encoded by the mRNA comprises a multispecific antibody. In some embodiments, the multispecific antibody comprises a bispecific T-cell engager (BiTE). In some embodiments, the BiTE binds to a surface protein on an immune cell (e.g., CD3 on a T-cell) and a tumor antigen. A tumor antigen is a protein derived from a tumor or a cancer cell. A tumor antigen can be over-expressed or uniquely expressed on or in a tumor or a cancer cell, which allows tumor targeting. In some embodiments, the BiTE binds to CD3 and glypican-3 (GPC3).

[0160] In some embodiments, the pharmaceutical agent comprises one or more nucleic acid molecules encoding a bispecific T-cell engager targeting glypican-3 and CD3 (GPC3 / CD3 BiTE). In some embodiments, the pharmaceutical agent comprises an mRNA encoding the GPC3 / CD3 BiTE. In some embodiments, the mRNA encoding the GPC3 / CD3 BiTE comprises a sequence having at least 70% sequence identity to SEQ ID NO: 1. In some embodiments, the mRNA encoding the GPC3 / CD3 BiTE comprises a sequence having at least 90% sequence identity to SEQ ID NO: 1. In some embodiments, the mRNA encoding the GPC3 / CD3 BiTE comprises a sequence having at least 95% sequence identity to SEQ ID NO: 1. In some embodiments, the mRNA encoding the GPC3 / CD3 BiTE comprises the sequence of SEQ ID NO: 1.

[0161] In some cases, the therapeutic peptides encoded by the mRNA encapsulated by the LNPs of the present disclosure comprise a protein tag (e.g., a 6X His tag). In some cases, the protein tag can facilitate identification or purification of the therapeutic peptide.

[0162] In some cases, more than one therapeutic peptide can be encoded by the mRNA encapsulated by the LNPs of the present disclosure. In some cases, the LNPs of the present disclosure comprises mRNA encoding at least 1, 2, 3, 4, 5, 6 or more therapeutic peptides.

[0163] In some embodiments, the LNPs comprises mRNAs that encode a multispecific antigen-binding peptide for immunotherapy. In some cases, a multispecific antigen-binding peptide comprises a first domain that binds to an antigen expressed by an immune cell and a second domain that binds to an antigen expressed by a tumor cell. The multispecific antigen-bindingpeptide can bind to an antigen expressed by any one of the immune cells provided herein.

[0164] In some embodiments, the LNPs of the disclosure comprises mRNAs that encode a chimeric antigen receptor derived from a neutralizing antibody comprising an antigen-binding fragment, a transmembrane domain, and an intracellular signaling domain described herein. The term “signaling domain” refers to the functional portion of a protein which acts by transmitting information within the cell to regulate cellular activity via defined signaling pathways by generating second messengers or functioning as effectors by responding to such messengers.

[0165] An “intracellular signaling domain,” as the term is used herein, refers to an intracellular portion of a molecule. The intracellular signaling domain generates a signal that promotes an immune effector function of the CAR containing cell, e.g., a CART cell. Examples of immune effector function, e.g., in a CART cell, include cytolytic activity and helper activity, including the secretion of cytokines. In some cases, the intracellular signaling domain can comprise a primary intracellular signaling domain. Exemplary primary intracellular signaling domains include those derived from the molecules responsible for primary stimulation, or antigen dependent simulation. In some cases, the intracellular signaling domain can comprise a costimulatory intracellular domain. Exemplary costimulatory intracellular signaling domains include those derived from molecules responsible for costimulatory signals, or antigen independent stimulation. A primary intracellular signaling domain can comprise a signaling motif which is known as an immunoreceptor tyrosine-based activation motif or ITAM. Examples of ITAM containing primary cytoplasmic signaling sequences include, but are not limited to, those derived from CD3 zeta, FcR gamma, FcRbeta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d DAP10 and DAP 12.

[0166] The term “costimulatory molecule” refers to the cognate binding partner on a T cell that specifically binds with a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation. Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that can be used for an efficient immune response. Costimulatory molecules include, but are not limited to, an MHC class I molecule, BTLA and a Toll ligand receptor, as well as 0X40, CD2, CD27, CD28, CD5, ICAM-1, LFA-1 (CD1 la / CD18) and 4-1BB (CD137).

[0167] A costimulatory intracellular signaling domain can be derived from the intracellular portion of a costimulatory molecule. A costimulatory molecule can be represented in the following protein families: TNF receptor proteins, Immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocytic activation molecules (SLAM proteins), and activating NK cell receptors. Examples of such molecules include CD27, CD28, 4-1BB (CD137), 0X40, GITR,CD30, CD40, ICOS, BAFFR, HVEM, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, and a ligand that specifically binds with CD83, and the like.

[0168] The intracellular signaling domain can comprise the entire intracellular portion, or the entire native intracellular signaling domain, of the molecule from which it is derived, or a functional fragment thereof.

[0169] With respect to the transmembrane domain, in various embodiments, a CAR can be designed to comprise a transmembrane domain that is attached to the extracellular domain of the CAR. A transmembrane domain can include one or more additional amino acids adjacent to the transmembrane region, e.g., one or more amino acid associated with the extracellular region of the protein from which the transmembrane was derived (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 up to 15 amino acids of the extracellular region) and / or one or more additional amino acids associated with the intracellular region of the protein from which the transmembrane protein is derived (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 up to 15 amino acids of the intracellular region). In one aspect, the transmembrane domain is one that is associated with one of the other domains of the CAR is used. In some cases, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins, e.g., to minimize interactions with other members of the receptor complex. In some cases, the transmembrane domain is capable of homodimerization with another CAR on the CAR T-cell surface. In some cases, the amino acid sequence of the transmembrane domain can be modified or substituted so as to minimize interactions with the binding domains of the native binding partner present in the same CAR T-cell.

[0170] The transmembrane domain can be derived either from a natural or from a recombinant source. Where the source is natural, the domain may be derived from any membranebound or transmembrane protein. In some cases, the transmembrane domain is capable of signaling to the intracellular domain(s) whenever the CAR has bound to a target. In some cases, the transmembrane domain can include at least the transmembrane region(s) of e.g., the alpha, beta, or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154.

[0171] In some cases, the transmembrane domain can be attached to the extracellular region of the CAR, e.g., the antigen-binding domain of the CAR, via a hinge or a spacer, e.g., a hinge from a human protein. In some cases, the hinge can be a human Ig (immunoglobulin) hinge, e.g., an IgG4 hinge, or a CD8a hinge. In one aspect, the hinge or spacer comprises an IgG4 hinge.

[0172] The cytoplasmic domain or region of the CAR includes an intracellular signalingdomain. An intracellular signaling domain is generally responsible for activation of at least one of the normal effector functions of the immune cell in which the CAR has been introduced. The term “effector function” refers to a specialized function of a cell. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines. The term “intracellular signaling domain” refers to the portion of a protein which transduces the effector function signal and directs the cell to perform a specialized function. While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal. The term intracellular signaling domain is thus meant to include any truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal.

[0173] Examples of intracellular signaling domains for use in the present disclosure include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivative or variant of these sequences and any recombinant sequence that has the same functional capability.

[0174] It is known that signals generated through the TCR alone are insufficient for full activation of the T cell and that a secondary and / or costimulatory signal can also be involved. Thus, T cell activation can be said to be mediated by two distinct classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation through the TCR (primary intracellular signaling domains) and those that act in an antigen-independent manner to provide a secondary or costimulatory signal (secondary cytoplasmic signaling domain, e.g., a costimulatory domain).

[0175] A primary signaling domain regulates primary activation of the TCR complex either in a stimulatory way, or in an inhibitory way. Primary intracellular signaling domains that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyrosine-based activation motifs or IT AMs.

[0176] Examples of IT AM containing primary intracellular signaling domains that are of particular use herein include those of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d. In some cases, a CAR comprises an intracellular signaling domain, e.g., a primary signaling domain, of CD3-zeta. In one embodiment, a primary signaling domain comprises a modified ITAM domain, e.g., a mutated ITAM domain which has altered (e.g., increased or decreased) activity as compared to the native ITAM domain. In one embodiment, a primary signaling domain comprises a modified ITAM-containing primary intracellular signaling domain, e.g., an optimized and / or truncated ITAM-containing primaryintracellular signaling domain. In an embodiment, a primary signaling domain comprises one, two, three, four or more IT AM motifs.

[0177] A costimulatory molecule is a cell surface molecule other than an antigen receptor or its ligands that can play a role for an efficient response of lymphocytes to an antigen. Examples of such molecules include CD27, CD28, 4-1BB (CD137), 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83, and the like. For example, CD27 costimulation has been demonstrated to enhance expansion, effector function, and survival of human CART cells in vitro and augments human T cell persistence and antitumor activity in vivo (Song et al. Blood. 2012; 119(3) :696-706).

[0178] A short oligo- or polypeptide linker, for example, between 2 and 10 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) in length may form the linkage between intracellular signaling sequence. In one embodiment, a glycine-serine doublet can be used as a suitable linker. In one embodiment, a single amino acid, e.g., an alanine, a glycine, can be used as a suitable linker.

[0179] In one aspect, the intracellular signaling domain is designed to comprise two or more, e.g., 2, 3, 4, 5, or more, costimulatory signaling domains. In some cases, the two or more, e.g., 2, 3, 4, 5, or more, costimulatory signaling domains, are separated by a linker molecule, e.g., a linker molecule described herein. In some cases, the intracellular signaling domain comprises two costimulatory signaling domains. In some cases, the linker molecule is a glycine residue. In some embodiments, the linker is an alanine residue.

[0180] In some embodiments, the mRNA-encoded therapeutic peptides for cancer immunotherapy comprises an immunomodulator. In some cases, an immunomodulator comprises a cytokine, cytokine receptor, chemokine, chemokine receptor, immune co-receptor, or immune co-receptor ligand. Expression of the immunomodulator can be driven by an expression regulatory region disclosed herein.

[0181] In some cases, the therapeutic peptides for cancer immunotherapy comprises a cytokine or a functional fragment thereof, for example, G-CSF, GITRL, GM-CSF, IFN-a, IFN-P, IFN-y, IL-IRA, IL-la, IL-ip, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-20, IL-23, LIF, LIGHT, LT-P, M-CSF, MSP, OSM, OX40L, SCF, TALL-1, TGF-P, TGF-pi, TGF-P2, TGF-P3, TNF-a, TNF-P, TRAIL, TRANCE, or TWEAK.

[0182] In some cases, the therapeutic peptides for cancer immunotherapy comprises a cytokine receptor or a functional fragment thereof, for example, a common gamma chain receptor, a common beta chain receptor, an interferon receptor, a TNF family receptor, a TGF-B receptor,Apo3, CD114, CD115, CD116, CD117, CD118, CD120, CD120a, CD120b, CD121, CD121a, CD121b, CD122, CD123, CD124, CD126, CD127, CD130, CD131, CD132, CD212, CD213, CD213al, CD213al3, CD213a2, CD25, CD27, CD30, CD4, CD40, CD95 (Fas), CDwl l9, CDwl21b, CDwl25, CDwl31, CDwl36, CDwl37 (41BB), CDw210, CDw217, GITR, HVEM, IL-11R, IL-l lRa, IL-14R, IL-15R, IL-15Ra, IL-18R, IL-18Ra, IL-18RP, IL-20R, IL-20Ra, IL- 20RP, IL-9R, LIFR, LTpR, OPG, OSMR, 0X40, RANK, TACI, TGF-PR1, TGF-PR2, TGF-PR3, TRAILR1, TRAILR2, TRAILR3, or TRAILR4.

[0183] In some cases, the therapeutic peptides for cancer immunotherapy comprises a chemokine or a functional fragment thereof, for example, ACT-2, AMAC-a, ATAC, ATAC, BLC, CCL1, CCL11, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL2, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CCL3, CCL4, CCL5, CCL7, CCL8, CKb-6, CKb-8, CTACK, CX3CL1, CXCL1, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, DC-CK1, ELC, ENA- 78, eotaxin, eotaxin-2, eotaxin-3, Eskine, exodus-1, exodus-2, exodus-3, fractalkine, GCP-2, GROa, GROb, GROg, HCC-1, HCC-2, HCC-4, 1-309, IL-8, ILC, IP- 10, LTAC, LAG-1, LARC, LCC-1, LD78a, LEC, Lkn-1, LMC, lymphoactin, lymphoactin b, MCAF, MCP-1, MCP-2, MCP- 3, MCP-4, MDC, MDNCF, MGSA-a, MGSA-b, MGSA-g, Mig, MIP-ld, MIP-la, MIP-ip, MIP- 2a, MIP-2b, MIP-3, MIP-3a, MIP-3P, MIP-4, MIP-4a, MIP-5, MPIF-1, MPIF-2, NAF, NAP-1, NAP-2, oncostatin, PARC, PF4, PPBP, RANTES, SCM-la, SCM-lb, SDF-la / p, SLC, STCP-1, TARC, TECK, XCL1, or XCL2.

[0184] In some cases, the therapeutic peptides for cancer immunotherapy comprises a chemokine receptor or a functional fragment thereof, for example, CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CCR10, CX3CR1, CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, XCR1, or XCRL

[0185] In some cases, the therapeutic peptides for cancer immunotherapy comprises costimulatory immune receptor, or a functional fragment thereof, for example, CD28, 2B4 (CD244, SLAMF4), 4-1BB (CD137), CD2 (LFA2, 0X34), CD21, CD226 (DNAM1), CD27 (TNFRSF7), CD30 (TNFRSF8), CD4, CD40, CD8, CD84 (SLAMF5), CRACC (CD319, BLAME), CRTAM (CD355), DcR3, DR3 (TNFRSF25), GITR (CD357), HVEM (CD270), ICOS (CD278), LIGHT, LTpR (TNFRSF3), Lyl08 (NTBA,CD352,SLAMF6), Ly9 (CD229,SLAMF3), 0X40 (CD134), SLAM (CD150,SLAMFl), TIM1 (HAVCR1,KIM1), or TIM2.

[0186] In some cases, the therapeutic peptides for cancer immunotherapy comprises an activating NK receptor, or a functional fragment thereof, for example, CD 100 (SEMA4D), CD 16(FcgRIIIA), CD160 (BY55), CD244 (2B4, SLAMF4), CD27, CD94- NKG2C, CD94- NKG2E, CD94-NKG2H, CD96, CRTAM, DAP12, DNAM1 (CD226), KIR2DL4, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, Ly49, NCR, NKG2D (KLRK1, CD314), NKp30 (NCR3), NKp44 (NCR2), NKp46 (NCR1), NKp80 (KLRF1, CLEC5C), NTB-A (SLAMF6), PSGL1, or SLAMF7 (CRACC, CS1, CD319).

[0187] In some cases, the therapeutic peptides for cancer immunotherapy comprises an Fey receptor (FcyR), an Fes receptor (FcsR), an Fea receptor (FcaR), an Fcp receptor (FcpR), neonatal Fc receptor (FcRn), CD4, CD5, CD8, CD21, CD22, CD27, CD28, CD32, CD40, CD45, CD66d, CD79a, CD79b, CD80, CD86, CD278 (ICOS), CD247< CD247q, 4 IBB, DAP 10, DAP12, FYN, LAT, Lek, MAPK, MHC complex, NF AT, NF-KB, PLC-y, iC3b, C3dg, C3d, Zap70, MyD88, a functional fragment thereof, or a combination thereof.

[0188] In some cases, the therapeutic peptides for cancer immunotherapy comprises a domain that is, is derived from, interacts with, increases expression of, or activates a transcription factor, such as, for example, E2A, Pax5, EBF, PU.1, Ikaros, GATA3, Th-POK, Tbet, Bcl6, NF- KB, NFAT, AP-1, NFAT, STAT1, STAT2, STAT3, STAT4, STAT5, STAT5A, STAT5B, STAT6, STAT7, IRF I , IRF2, IRF3, IRF4, IRF5, IRF6, IRF7, IRF8, IRF9, AP-1, Eomes, FoxP3, Id2, PLZF, ROR-gamma-T, TCF7, ThPOK, or any combination thereof.Nucleic acids

[0189] The LNPs provided herein comprise nucleic acid molecules (e.g., mRNA) encoding a therapeutic peptide for cancer immunotherapy (e.g., GPC3 / CD3 BiTE). In some cases, the mRNA encapsulated by the lipid composition provided herein further comprises regulatory sequences that can facilitate and / or promote expression of the therapeutic peptide for cancer immunotherapy (e.g., GPC3 / CD3 BiTE). The regulatory sequences can comprise a 5’ cap, a 5’ untranslated region, a promoter, a signal peptide sequence, a 3 ’ untranslated region, and a poly-A tail. In some cases, the regulatory sequences comprise an enhancer (e.g., CMV enhancer) to further enhance expression of the therapeutic peptide.

[0190] In some embodiments, the nucleic acid molecules (e.g., mRNA) comprise a nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% sequence identity to SEQ ID NO: 1. In some embodiments, the mRNA comprises the nucleic acid sequence of SEQ ID NO: 1.

[0191] In some cases, the mRNA encoding the GPC3 / CD3 BiTE comprises a nucleic acid sequence encoding a signal peptide, wherein the signal peptide can be cleaved during post- translational processing. In some cases, the mRNA comprises a promoter sequence. In some embodiments, the promoter sequence comprises a tissue-specific promoter. In some embodiments,the tissue specific promoter comprises a hepatocyte-specific promoter or a lung-specific promoter. In some cases, the mRNA comprises a strong promoter that enhances the expression of the therapeutic peptide for immunotherapy (e.g., GPC3 / CD3 BiTE). The strong promoter can comprise a Human cytomegalovirus (hCMV), chicken beta-actin / CMV enhancer (CAG), elongation factor- 1 alpha (EFla), or phosphoglycerokinase (PGK) promoter.

[0192] In some cases, the mRNA encapsulated by the LNPs of the present disclosure comprises a naturally occurring or an artificial promoter. In some cases, the mRNA comprises a promoter that is specific for expression in immune cells as compared to non-immune cells. In some cases, the mRNA comprises a T-cell specific promoter and the LNPs comprising the mRNA encoding a therapeutic peptide can be used for CAR-T therapy. In some cases, the T-cell specific promoter comprises promoters that drive endogenous expression of T-cell specific proteins comprising CD3 (e.g., CD3 gamma, CD3 delta, CD3 epsilon, CD3 zeta), CD4, CD8, CD28, TCRB or TRAC. In some cases, the promoter can result in stronger expression of therapeutic peptides in immune cells comprising lymphocytes, T cells, CD4+ T cells, CD8+ T cells, alpha-beta T cells, gamma-delta T cells, T regulatory cells (Tregs), cytotoxic T lymphocytes, Thl cells, Th2 cells, Th 17 cells, Th9 cells, naive T cells, memory T cells, effector T cells, effector-memory T cells (TEM), central memory T cells (TCM), resident memory T cells (TRM), follicular helper T cells (TFH), Natural killer T cells (NKTs), tumor-infiltrating lymphocytes (TILs), Natural killer cells (NKs), Innate Lymphoid Cells (ILCs), ILC1 cells, ILC2 cells, ILC3 cells, lymphoid tissue inducer (LTi) cells, B cells, Bl cells, Bia cells, Bib cells, B2 cells, plasma cells, B regulatory cells, memory B cells, marginal zone B cells, follicular B cells, germinal center B cells, antigen presenting cells (APCs), monocytes, macrophages, Ml macrophages, M2 macrophages, tissue- associated macrophages, dendritic cells, plasmacytoid dendritic cells, neutrophils, mast cells, basophils, eosinophils, common myeloid progenitors, common lymphoid progenitors, or any combination thereof.

[0193] In some cases, an mRNA encoding the GPC3 / CD3 BiTE comprises natural, synthetic, and / or artificial nucleotide analogues or bases. In some cases, the synthetic or artificial nucleotide analogues or bases comprise modifications at one or more of a deoxyribose moiety, ribose moiety, phosphate moiety, nucleoside moiety, or a combination thereof.

[0194] In some cases, a nucleotide analogue or artificial nucleotide base comprises a nucleic acid with a modification at a 2' hydroxyl group of the ribose moiety. In some instances, the modification includes an H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety. Illustrative alkyl moiety includes, but are not limited to, halogens, sulfurs, thiols, thioethers, thioesters, amines (primary, secondary, or tertiary), amides, ethers, esters, alcohols andoxygen. In some instances, the alkyl moiety further comprises a modification. In some instances, the modification comprises an azo group, a keto group, an aldehyde group, a carboxyl group, a nitro group, a nitroso, group, a nitrile group, a heterocycle (e.g., imidazole, hydrazino or hydroxylamino) group, an isocyanate or cyanate group, or a sulfur containing group (e.g., sulfoxide, sulfone, sulfide, or disulfide). In some instances, the alkyl moiety further comprises a hetero substitution. In some instances, the carbon of the heterocyclic group is substituted by a nitrogen, oxygen or sulfur. In some instances, the heterocyclic substitution includes but is not limited to, morpholino, imidazole, and pyrrolidino.

[0195] In some cases, the modification at the 2' hydroxyl group is a 2'-O-methyl modification or a 2 '-O-m ethoxy ethyl (2’-0-M0E) modification. In some cases, the 2'-O-methyl modification adds a methyl group to the 2' hydroxyl group of the ribose moiety whereas the 2'0- methoxyethyl modification adds a methoxyethyl group to the 2' hydroxyl group of the ribose moiety.

[0196] In some cases, the modification at the 2' hydroxyl group is a 2'-O-aminopropyl modification in which an extended amine group comprising a propyl linker binds the amine group to the 2' oxygen. In some instances, this modification neutralizes the phosphate-derived overall negative charge of the oligonucleotide molecule by introducing one positive charge from the amine group per sugar and thereby improves cellular uptake properties due to its zwitterionic properties.

[0197] In some cases, the modification at the 2' hydroxyl group is a locked or bridged ribose modification (e.g., locked nucleic acid or LNA) in which the oxygen molecule bound at the 2' carbon is linked to the 4' carbon by a methylene group, thus forming a 2'-C,4'-C-oxy-methylene- linked bicyclic ribonucleotide monomer.

[0198] In some cases, additional modifications at the 2' hydroxyl group include 2'-deoxy, T-deoxy -2 '-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-0-DMA0E), 2'-O- dimethylaminopropyl (2'-O-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'- O-N-methylacetamido (2'-0-NMA).

[0199] In some cases, a nucleotide analogue comprises a modified base, for example, Nl- methylpseudouridine, 5-propynyluridine, 5-propynylcytidine, 6- methyladenine, 6- methylguanine, N, N, -dimethyladenine, 2-propyladenine, 2propylguanine, 2-aminoadenine, 1- methylinosine, 3 -methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides having a modification at the 5 position, 5- (2- amino) propyl uridine, 5-halocytidine, 5-halouridine, 4- acetylcytidine, 1- methyladenosine, 2-methyladenosine, 3 -methylcytidine, 6-m ethyluridine, 2- methylguanosine, 7-methylguanosine, 2, 2-dimethylguanosine, 5- methylaminoethyluridine, 5- methyloxyuridine, deazanucleotides (such as 7-deaza- adenosine, 6-azouridine, 6-azocytidine, or6-azothymidine), 5-methyl-2-thiouridine, other thio bases (such as 2-thiouridine, 4-thiouridine, and 2-thiocytidine), dihydrouridine, pseudouridine, queuosine, archaeosine, naphthyl and substituted naphthyl groups, any O-and N-alkylated purines and pyrimidines (such as N6- methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, or pyridine-2-one), phenyl and modified phenyl groups such as aminophenol or 2,4, 6-trimethoxy benzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5-substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyi nucleotides, and alkylcarbonylalkylated nucleotides. Modified nucleotides also include those nucleotides that are modified with respect to the sugar moiety, as well as nucleotides having sugars or analogs thereof that are not ribosyl. For example, the sugar moieties, in some cases are or are based on, mannoses, arabinoses, glucopyranoses, galactopyranoses, 4'-thioribose, and other sugars, heterocycles, or carbocycles. The term nucleotide also includes universal bases. By way of example, universal bases include but are not limited to 3 -nitropyrrole, 5-nitroindole, or nebularine.

[0200] In some cases, one or more modifications optionally occur at the internucleotide linkage. In some instances, a modified intemucleotide linkages can include, but is not limited to, phosphorothioates; phosphorodithioates; methylphosphonates; 5'- alkylenephosphonates; 5'- methylphosphonate; 3 '-alkylene phosphonates; borontrifluoridates; borano phosphate esters and selenophosphates of 3'-5'linkage or 2'-5'linkage; phosphotriesters; thionoalkylphosphotriesters; hydrogen phosphonate linkages; alkyl phosphonates; alkylphosphonothioates; arylphosphonothioates; phosphoroselenoates; phosphorodiselenoates; phosphinates; phosphoramidates; 3'- alkylphosphoramidates; aminoalkylphosphoramidates; thionophosphoramidates; phosphoropiperazidates; phosphoroanilothioates; phosphoroanilidates; ketones; sulfones; sulfonamides; carbonates; carbamates; methylenehydrazos; methylenedimethylhydrazos; formacetals; thioformacetals; oximes; methyleneiminos; methylenemethyliminos; thioamidates; linkages with riboacetyl groups; aminoethyl glycine; silyl or siloxane linkages; alkyl or cycloalkyl linkages with or without heteroatoms of, for example, 1 to 10 carbons that are saturated or unsaturated and / or substituted and / or contain heteroatoms; linkages with morpholino structures, amides, or polyamides wherein the bases are attached to the aza nitrogens of the backbone directly or indirectly; and combinations thereof.

[0201] In some cases, one or more modifications comprise a modified phosphate backbone in which the modification generates a neutral or uncharged backbone. In some instances, the phosphate backbone is modified by alkylation to generate an uncharged or neutral phosphate backbone. As used herein, alkylation includes methylation, ethylation, and propylation. In somecases, an alkyl group, as used herein in the context of alkylation, refers to a linear or branched saturated hydrocarbon group containing from 1 to 6 carbon atoms. In some instances, exemplary alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n- pentyl, isopentyl, neopentyl, hexyl, isohexyl, 1, 1 -dimethylbutyl, 2,2- dimethylbutyl, 3.3- dimethylbutyl, and 2-ethylbutyl groups. In some cases, a modified phosphate is a phosphate group as described in U.S. Patent No. 9481905.

[0202] In some embodiments, additional modified phosphate backbones comprise methylphosphonate, ethylphosphonate, methylthiophosphonate, or methoxyphosphonate. In some cases, the modified phosphate is methylphosphonate. In some cases, the modified phosphate is ethylphosphonate. In some cases, the modified phosphate is methylthiophosphonate. In some cases, the modified phosphate is methoxyphosphonate.

[0203] In some cases, one or more modifications further optionally include modifications of the ribose moiety, phosphate backbone and the nucleoside, or modifications of the nucleotide analogues at the 3' or the 5' terminus. For example, the 3' terminus optionally include a 3' cationic group, or by inverting the nucleoside at the 3 '-terminus with a 3 '-3' linkage. In another alternative, the 3 '-terminus is optionally conjugated with an aminoalkyl group, e.g., a 3' C5-aminoalkyl dT. In an additional alternative, the 3 '-terminus is optionally conjugated with an abasic site, e.g., with an apurinic or apyrimidinic site. In some instances, the 5 '-terminus is conjugated with an aminoalkyl group, e.g., a 5'-O-alkylamino substituent. In some cases, the 5 '-terminus is conjugated with an abasic site, e.g., with an apurinic or apyrimidinic site.Methods

[0204] The present disclosure provides methods for treating a cancer using the lipid nanoparticle (LNP) compositions described herein, wherein the LNPs comprise nucleic acid molecules (e.g., mRNA) encoding one or more therapeutic peptides (e.g., BiTE) for cancer immunotherapy. The present disclosure also provides a method for delivering a pharmaceutical agent (e.g., mRNA encoding BiTE) to a target organ in a subject in need thereof, the method comprising administering an effective amount of the composition provided herein. In some embodiments, the target organ comprises a liver, lung or secondary lymphoid tissue (e.g., spleen or lymph nodes). In some embodiments, the target organ is a liver. In some embodiments, the target organ is a lung.

[0205] In some embodiments, the cancer comprises a leukemia. In some embodiments, the cancer comprises a solid-state tumor. In some embodiments, the leukemia comprises acute lymphocytic leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, acute myeloid leukemia, hairy cell leukemia, acute promyelocytic leukemia, T-cell prolymphocytic leukemia,lymphoid leukemia, large granular lymphocytic leukemia, B-cell prolymphocytic leukemia, myeloproliferative neoplasm, or mastocytosis.

[0206] In some embodiments, the present disclosure provides a method for treating a solid- state tumor in a subject in need thereof, comprising administering an effective amount of the composition provided herein. In some embodiments, the solid-state tumor comprises hepatocellular carcinoma. In some embodiments, the solid-state tumor comprises lung cancer. In some embodiments, the lung cancer comprises non-small cell lung cancer. In some embodiments, the administering comprises administering the composition intravenously or intramuscularly to a subject in need thereof. In some embodiments, the subject comprises a mammal. In some embodiments, the subject comprises a human or a non-human primate. In some embodiments, the subject comprises a rodent.

[0207] In some embodiments, the solid-state tumor expresses glypican-3 (GPC3). In some embodiments, the solid-state tumor comprises breast cancer, liver cancer, lung cancer, brain cancer, lymphoma, colorectal cancer, prostate cancer, sarcoma, melanoma, pancreatic cancer, kidney cancer, thyroid cancer, Kaposi sarcoma, uterine cancer, bladder cancer, soft-tissue sarcoma, oropharyngeal cancer, non-small cell lung carcinoma, or multiple myeloma. In some embodiments, the cancer comprises small cell lung carcinoma or non-small cell lung carcinoma. In some embodiments, the non-small cell carcinoma comprises adenocarcinoma, squamous cell carcinoma, or large cell carcinoma. In some embodiments, the cancer comprises hepatocellular carcinomas (HCC).

[0208] In some embodiments of the method, the composition of the present application can be administrated through any suitable routes comprising parenteral delivery (e.g., injections), such as intravenous, intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intraperitoneal, intranasal, or intraocular injections. In some embodiments, the method for delivering a pharmaceutical agent to a target organ in a subject in need thereof provides a greater amount or activity of the pharmaceutical agent in the target organ in the subject as compared to that achieved absent the lipid composition. In some embodiments, the method for delivering a pharmaceutical agent to a target organ in a subject in need thereof provides a greater amount or activity of the pharmaceutical agent in the target organ in the subject as compared to a non-target organ.

[0209] In some embodiments, the amount of the pharmaceutical agent is measured by pharmacokinetic parameters. In some embodiments, pharmacokinetic parameters comprise Cmax, Tmax, half-life, or area under curve (AUC). In some embodiments, the greater amount of the pharmaceutical agent comprises a larger Cmax, a longer half-life, or a larger area under curve(AUC).

[0210] In some embodiments, the methods provided herein result in greater the pharmacokinetic parameters of the pharmaceutical agent, and wherein the pharmacokinetic parameters of the pharmaceutical agent comprise Cmax, Tmax, half-life, or area under curve (AUC). In some embodiments, after the compositions are administered to a subject, the half-life of the pharmaceutical agent is at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, at least 12 hours or more.

[0211] In some embodiments, after the compositions are administered to a subject, the AUC of the pharmaceutical agent is at least 5%, at least 10%, at least 15% , at least 20% , at least 25% , at least 30% , at least 35% , at least 40% , at least 45% , at least 50% , at least 55% , at least 60% , at least 65% , at least 70%, at least 75% , at least 80%, at least 85% , at least 90% , at least 95% , at least 100%, at least 150%, at least 200% or more higher than the AUC of the pharmaceutical agent delivered in other compositions.

[0212] In some embodiments, after the compositions are administered to a subject, the Cmax of the pharmaceutical agent is at least 5%, at least 10%, at least 15% , at least 20% , at least 25% , at least 30% , at least 35% , at least 40% , at least 45% , at least 50% , at least 55% , at least 60% , at least 65% , at least 70%, at least 75% , at least 80%, at least 85% , at least 90% , at least 95% , at least 100%, at least 150%, at least 200% or more higher than the Cmax of the pharmaceutical agent delivered in other compositions.

[0213] In some embodiments, the method provides potent delivery of the pharmaceutical agent to a cell of a subject. In some embodiments, the method comprising administering the composition provided herein results in targeted delivery of the pharmaceutical agent to a target organ. In some embodiments, the target organ comprises liver. In some embodiments, the target organ comprises lung.

[0214] In some embodiments, the method delivers a pharmaceutical agent to a target organ (e.g., liver or lung) or a target cell (e.g., a cell of the target organ or an immune cell) of a subject, wherein the method comprises administering a composition described herein, and thereby providing an effective amount or activity of the pharmaceutical agent in the target organ or target cell that is at least 1.1 -fold greater than a corresponding amount or activity of the pharmaceutical agent achieved in a non-target organ or non-target cell of the subject. In some embodiments, the effective amount or activity of the pharmaceutical agent in the target organ or target cell is at least 1.1-fold greater, at least 1.5-fold greater, at least 2-fold greater, at least 2.5-fold greater, at least 3- fold greater, at least 3.5-fold greater, at least 4-fold greater, at least 4.5-fold greater, at least 5-foldgreater, at least 5.5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, at least 10-fold greater, at least 15-fold greater, at least 18-fold greater, at least 20-fold greater, at least 30-fold greater, at least 40-fold greater, at least 50-fold greater, at least 75-fold greater, at least 100-fold greater, at least 200-fold greater, or at least 300-fold greater, than a corresponding amount or activity of the pharmaceutical agent achieved in non-target organ or non-target cell of the subject.

[0215] In some embodiments, the methods of delivery comprise administering a lipid composition described herein provides an effective amount or activity of a pharmaceutical agent at least 1.1 -fold greater than a corresponding amount or activity of the pharmaceutical agent achieved by administering other compositions. In some embodiments, the effective amount or activity of the pharmaceutical agent results from administering a lipid composition described herein is at least 1.1-fold greater, at least 1.5-fold greater, at least 2-fold greater, at least 2.5-fold greater, at least 3-fold greater, at least 3.5-fold greater, at least 4-fold greater, at least 4.5-fold greater, at least 5-fold greater, at least 5.5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, at least 10-fold greater, at least 15-fold greater, at least 18-fold greater, at least 20-fold greater, at least 30-fold greater, at least 40-fold greater, at least 50-fold greater, at least 75-fold greater, at least 100-fold greater, at least 200-fold greater, or at least 300-fold greater, than a corresponding amount or activity of the pharmaceutical agent achieved by administering other compositions.

[0216] In some embodiments, the methods of delivery comprise administering a lipid described herein provides an effective amount or activity of a pharmaceutical agent at least 1.1- fold greater than a corresponding amount or activity of the pharmaceutical agent achieved by administering other lipids. In some embodiments, the effective amount or activity of the pharmaceutical agent results from administering a lipid described herein is at least 1.1-fold greater, at least 1.5-fold greater, at least 2-fold greater, at least 2.5-fold greater, at least 3-fold greater, at least 3.5-fold greater, at least 4-fold greater, at least 4.5-fold greater, at least 5-fold greater, at least 5.5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, at least 10-fold greater, at least 15-fold greater, at least 18-fold greater, at least 20-fold greater, at least 30-fold greater, at least 40-fold greater, at least 50-fold greater, at least 75-fold greater, at least 100-fold greater, at least 200-fold greater, or at least 300-fold greater, than a corresponding amount or activity of the pharmaceutical agent achieved by administering other lipids.

[0217] In some embodiments, the delivery of the pharmaceutical agent to a cell may cause cell death, such as apoptosis of the cell.

[0218] In another aspect, provided is high-potency dosage form of a pharmaceutical agent formulated with an ionizable lipid, the dosage form comprising a pharmaceutical agent (e.g., mRNA encoding the GPC3 / CD3 BiTE) assembled with a lipid composition as described herein.

[0219] In some embodiments, the pharmaceutical agent is present in the dosage form at a dose of about 10, 9, 8, 7, 6, 5, 4, 3, 2, 1.5, 1.0, 0.5, 0.2, 0.1, 0.05, 0.02, 0.01, .005, 0.002, or 0.001 milligram per kilogram (mg / kg, or mpk) body weight, or of a range between (inclusive) any two of the foregoing values.

[0220] In some embodiments, the pharmaceutical agent is present in the dosage form at a dose of no more than about 10 milligram per kilogram (mg / kg, or mpk) body weight. In some embodiments, the pharmaceutical agent is present in the dosage form at a dose of no more than about 9 mg / kg, no more than about 8 mg / kg , no more than about 7 mg / kg, no more than about 6 mg / kg, no more than about 5 mg / kg, no more than about 4 mg / kg, no more than about 3 mg / kg, no more than about 2 mg / kg, no more than about 1 mg / kg, no more than about 0.5 mg / kg, no more than about 0.2 mg / kg, no more than about 0.1 mg / kg, no more than about 0.05 mg / kg, or no more than about 0.01 mg / kg. In some embodiments, the pharmaceutical agent is present in the dosage form at a concentration of no more than about 5 milligram per milliliter (mg / mL).

[0221] In some embodiments, the pharmaceutical agent is present in the dosage form at a concentration of about 5, 4, 3, 2, 1, 0.5, 0.2, or 0.1 milligram per milliliter (mg / mL), or of a range between (inclusive) any two of the foregoing values.

[0222] In some embodiments, the pharmaceutical agent is present in the dosage form at a concentration of no more than about 5 milligram per milliliter (mg / mL). In some embodiments, the pharmaceutical agent is present in the dosage form at a concentration of no more than about 2 milligram per milliliter (mg / mL). In some embodiments, the pharmaceutical agent is present in the dosage form at a concentration of no more than about 1 milligram per milliliter (mg / mL). In some embodiments, the pharmaceutical agent is present in the dosage form at a concentration of no more than about 0.5 milligram per milliliter (mg / mL). In some embodiments, the pharmaceutical agent is present in the dosage form at a concentration of no more than about 0.1 milligram per milliliter (mg / mL).

[0223] In some embodiments, the pharmaceutical agent (e.g., nucleic acids, mRNA) is present in the dosage form at a concentration of about 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5, 0.2, or 0.1 microgram per milliliter (pg / mL), or of a range between (inclusive) any two of the foregoing values. In some embodiments, the pharmaceutical agent is present in the dosage form at a concentration of no more than about 10, no more than about 9, no more than about 8, no more than about 7, no more than about 6, no more than about 5, no more than about 4, no more than about 3,no more than about 2, no more than about 1, no more than about 0.5, no more than about 0.2, no more than about 0.1 microgram per milliliter (pg / mL).

[0224] Any suitable dosage form can be prepared for delivery, for example, via oral, rectal, vaginal, transmucosal, pulmonary including intratracheal or inhaled, or intestinal administration; parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections.

[0225] In some embodiments, the pharmaceutical agent is administered at a dosage of no more than about 10 milligram per kilogram (mg / kg, or mpk) body weight, no more than about 9 mg / kg, no more than about 8 mg / kg , no more than about 7 mg / kg, no more than about 6 mg / kg, no more than about 5 mg / kg, no more than about 4 mg / kg, no more than about 3 mg / kg, no more than about 2 mg / kg, no more than about 1 mg / kg, no more than about 0.5 mg / kg, no more than about 0.2 mg / kg, no more than about 0.1 mg / kg, no more than about 0.05 mg / kg, or no more than about 0.01 mg / kg body weight. In some embodiments, the pharmaceutical agent is administered at a dosage from about 1 pg / kg body weight to about 3 mg / kg body weight.

[0226] In some embodiments, the administration of a dose of the lipid composition provided here can be repeated. If desired, the effective dose of the active lipid composition can be administered as one, two, three, four, five, six or more doses administered separately at appropriate intervals throughout the course of treatment. In some embodiments, the lipid composition can be administered two or three times daily. In some embodiments, the lipid composition will be administered once daily. In some embodiments, the lipid composition is administered about every 1 week, about every 2 weeks, about every 3 weeks, about every 4 weeks, about every 5 weeks, about every 6 weeks, about every 7 weeks, about every 8 weeks, about every 9 weeks, about every 10 weeks, about every 11 weeks, about every 12 weeks, about every 13 weeks, about every 14 weeks, about every 15 weeks, about every 16 weeks, about every 17 weeks, or about every 18 weeks. In some embodiments, the lipid composition is administered about every 1 month, about every 2 months, about every 3 months, about every 4 months, about every 5 months, about every 6 months, about every 7 months, about every 8 months, about every 9 months, about every 10 months, about every 11 months, about every 12 months, about every 13 months, about every 14 months, about every 15 months, about every 16 months, about every 17 months, about every 18 months, about every 2 years, about every 2.5 years, about every 3 years, about every 3.5 years, about every 4 years, about every 4.5 years, or about every 5 years. Any subject in need thereof can be treated with the method of the present application.

[0227] In some embodiments, the subject has been determined to have a mutation in atarget gene. In some embodiments, the mutation in the target gene is associated with a cancer or a tumor. In some embodiments, the subject has been determined to exhibit an aberrant expression or activity of a protein or polynucleotide that corresponds to a target gene. In some embodiments, the aberrant expression or activity of the protein or polynucleotide is associated with a cancer or a tumor. In some embodiments, the subject comprises a mammal. In some embodiments, the mammal comprises a rodent, a non-human primate, or human. In some embodiments, the subject is a non-human primate.

[0228] In some embodiments, provided herein is a method for targeted delivery of a pharmaceutical agent to a cell type comprising contacting the cell with the composition of the present application. In some embodiments of the method, the pharmaceutical composition comprises a pharmaceutical agent (e.g., mRNA) assembled with a lipid composition as described in the present application, e.g., wherein the lipid composition comprises any of the head or tail groups disclosed herein.

[0229] In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is in vivo. In some embodiments, the contacting comprises administering to a subject the composition comprising the therapeutic agent assembled with the lipid composition.Pharmaceutical compositions

[0230] The compositions and methods of the present disclosure may be utilized to treat an individual in need thereof. The pharmaceutical composition described herein may comprise a therapeutic or prophylactic composition, or any combination thereof. In some embodiments, the lipidoid compositions can be assembled with mRNA encoding a therapeutic peptide (e.g., BiTE) for cancer immunotherapy. In some embodiments, the individual is a mammal (e.g., a human or a non-human mammal). When administered to an animal (e.g., a human or a non-human animal) the composition or the lipidoid composition is preferably administered as a pharmaceutical composition comprising, for example, a lipidoid composition of the invention and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known in the art and include, for example, aqueous solutions such as water or physiologically buffered saline or other solvents or vehicles such as glycols, glycerol, oils such as olive oil, or injectable organic esters. In preferred embodiments, when such pharmaceutical compositions are for human administration, particularly for invasive routes of administration (i.e., routes, such as intravenous or intramuscular injection, that circumvent transport or diffusion through an epithelial barrier), the aqueous solution is pyrogen-free, or substantially pyrogen-free. The excipients can be chosen, for example, to effect delayed release of an agent or to selectively target one or more cells, tissues ororgans. The pharmaceutical composition can be in dosage unit form such as tablet, capsule (including sprinkle capsule and gelatin capsule), granule, lyophile for reconstitution, powder, solution, syrup, suppository, injection or the like. The composition can also be present in a transdermal delivery system, e.g., a skin patch. The composition can also be present in a solution suitable for topical administration, such as a lotion, cream, or ointment.

[0231] A pharmaceutically acceptable carrier can contain physiologically acceptable agents that act, for example, to stabilize, increase solubility or to increase the absorption of a lipidoid composition such as a lipidoid composition of the invention. Such physiologically acceptable agents include, for example, carbohydrates, such as glucose, sucrose or dextrans, antioxidants, such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers or excipients. The choice of a pharmaceutically acceptable carrier, including a physiologically acceptable agent, depends, for example, on the route of administration of the composition. The preparation or pharmaceutical composition can be a self-emulsifying drug delivery system or a self-microemulsifying drug delivery system. The pharmaceutical composition (preparation) also can be a liposome or other polymer matrix, which can have incorporated therein, for example, a lipidoid composition of the invention. Liposomes, for example, which comprise phospholipids or other lipids, are nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer.

[0232] The phrase "pharmaceutically acceptable" is employed herein to refer to those lipidoid compositions, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0233] The phrase "pharmaceutically acceptable carrier" as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, mannose, trehalose, and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyloleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.

[0234] A pharmaceutical composition (preparation) can be administered to a subject by any of a number of routes of administration including, for example, orally (for example, drenches as in aqueous or non-aqueous solutions or suspensions, tablets, capsules (including sprinkle capsules and gelatin capsules), boluses, powders, granules, pastes for application to the tongue); absorption through the oral mucosa (e.g., sublingually); subcutaneously; transdermally (for example as a patch applied to the skin); and topically (for example, as a cream, ointment or spray applied to the skin). The lipidoid composition may also be formulated for inhalation. In some embodiments, a lipidoid composition may be simply dissolved or suspended in sterile water. Details of appropriate routes of administration and compositions suitable for same can be found in, for example, U.S. Pat. Nos. 6,110,973, 5,763,493, 5,731,000, 5,541,231, 5,427,798, 5,358,970 and 4,172,896, as well as in patents cited therein.

[0235] The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of the lipidoid composition which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 1 percent to about ninety -nine percent of active ingredient, preferably from about 5 percent to about 70 percent, most preferably from about 10 percent to about 30 percent.

[0236] Methods of preparing these formulations or compositions include the step of bringing into association an active composition, such as a lipidoid (e.g., nanoparticle) composition as described herein, with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a lipidoid (e.g., nanoparticle) composition as described herein with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

[0237] The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous,subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion. In some embodiments, the pharmaceutical compositions comprising the mRNA / LNPs provided herein are administered through parenteral routes (e.g., intravenous injection or intramuscular injection). Pharmaceutical compositions suitable for parenteral administration comprise one or more active lipidoid compositions in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.

[0238] Examples of suitable aqueous and nonaqueous carriers that may be employed in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0239] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents that delay absorption such as aluminum monostearate and gelatin.

[0240] In some cases, in order to prolong the effect of a drug, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution, which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.

[0241] Injectable depot forms are made by forming microencapsulated matrices of the subject lipidoid compositions in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared byentrapping the drug in liposomes or microemulsions that are compatible with body tissue.

[0242] For use in the methods of this invention, active lipidoid compositions can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99.5% (more preferably, 0.5 to 90%) of active ingredient in combination with a pharmaceutically acceptable carrier.

[0243] Methods of introduction may also be provided by rechargeable or biodegradable devices. Various slow-release polymeric devices have been developed and tested in vivo in recent years for the controlled delivery of drugs, including proteinaceous biopharmaceuticals. A variety of biocompatible polymers (including hydrogels), including both biodegradable and non- degradable polymers, can be used to form an implant for the sustained release of a lipidoid composition at a particular target site.

[0244] Actual dosage levels of the active ingredients in the pharmaceutical compositions may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

[0245] The selected dosage level will depend upon a variety of factors including the activity of the particular lipidoid composition or combination of lipidoid compositions employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular lipidoid composition(s) being employed, the duration of the treatment, other drugs, lipidoid compositions and / or materials used in combination with the particular lipidoid composition(s) employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

[0246] A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the therapeutically effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the pharmaceutical composition or lipidoid composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. By “therapeutically effective amount” is meant the concentration of a lipidoid composition that is sufficient to elicit the desired therapeutic effect. It is generally understood that the effective amount of the lipidoid composition will vary according to the weight, sex, age, and medical history of the subject. Other factors which influence the effective amount may include, but are not limited to, the severity of the patient's condition, the disorder being treated, the stability of the lipidoid composition, and, if desired, another type of therapeutic agent being administered with the lipidoid composition of the invention. A larger total dose can be delivered by multiple administrations of the agent. Methods to determine efficacy and dosage are known to those skilled in the art (Isselbacher et al. (1996)Harrison’s Principles of Internal Medicine 13 ed., 1814-1882, herein incorporated by reference).

[0247] In general, a suitable daily dose of an active lipidoid composition used in the compositions and methods of the invention will be that amount of the lipidoid composition that is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above.

[0248] If desired, the effective dose of the active lipidoid composition may be administered as one, two, three, four, five, six or more doses administered separately at appropriate intervals throughout the course of treatment, optionally, in unit dosage forms. In some embodiments of the present invention, the active lipidoid composition may be administered two or three times daily. In some embodiments, the active lipidoid composition will be administered once daily.

[0249] The patient or subject receiving this treatment is any animal in need, including primates, in particular humans; and other mammals such as equines, cattle, swine, sheep, cats, and dogs; poultry; and pets in general.

[0250] In some embodiments, lipidoid compositions of the invention may be used alone or conjointly administered with another type of therapeutic agent.

[0251] The present disclosure includes the use of pharmaceutically acceptable salts of lipidoid compositions of the invention in the compositions and methods of the present invention. In some embodiments, contemplated salts of the invention include, but are not limited to, alkyl, dialkyl, trialkyl or tetra-alkyl ammonium salts. In some embodiments, contemplated salts of the invention include, but are not limited to, L-arginine, benenthamine, benzathine, betaine, calcium hydroxide, choline, deanol, diethanolamine, diethylamine, 2-(diethylamino)ethanol, ethanolamine, ethylenediamine, N-methylglucamine, hydrabamine, IH-imidazole, lithium, L- lysine, magnesium, 4-(2-hydroxyethyl)morpholine, piperazine, potassium, l-(2- hydroxyethyljpyrrolidine, sodium, triethanolamine, tromethamine, and zinc salts. In some embodiments, contemplated salts of the invention include, but are not limited to, Na, Ca, K, Mg, Zn or other metal salts. In some embodiments, contemplated salts of the invention include, but are not limited to, l-hydroxy-2-naphthoic acid, 2, 2-di chloroacetic acid, 2-hydroxy ethanesulfonic acid, 2-oxoglutaric acid, 4-acetamidobenzoic acid, 4-aminosalicylic acid, acetic acid, adipic acid, 1-ascorbic acid, 1-aspartic acid, benzenesulfonic acid, benzoic acid, (+)-camphoric acid, (+)- camphor- 10-sulfonic acid, capric acid (decanoic acid), caproic acid (hexanoic acid), caprylic acid (octanoic acid), carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-l,2-disulfonic acid, ethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, d glucoheptonic acid, d gluconic acid, d glucuronic acid, glutamic acid, glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, hydrobromic acid, hydrochloric acid,isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, 1-malic acid, malonic acid, mandelic acid, methanesulfonic acid , naphthalene- 1,5-disulfonic acid, naphthal ene-2-sulfonic acid, nicotinic acid, nitric acid, oleic acid, oxalic acid, palmitic acid, pamoic acid, phosphoric acid, proprionic acid, 1 -pyroglutamic acid, salicylic acid, sebacic acid, stearic acid, succinic acid, sulfuric acid, 1 tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, and undecylenic acid salts.

[0252] The pharmaceutically acceptable acid addition salts can also exist as various solvates, such as with water, methanol, ethanol, dimethylformamide, and the like. Mixtures of such solvates can also be prepared. The source of such solvate can be from the solvent of crystallization, inherent in the solvent of preparation or crystallization, or adventitious to such solvent.

[0253] Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

[0254] Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BEIT), lecithin, propyl gallate, alphatocopherol, and the like; and (3) metal-chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.Kits

[0255] Another aspect provides a kit comprising the pharmaceutical composition and / or lipid nanoparticle (LNP) formulations described herein. In some embodiments, the kit can further comprise an apparatus for administering the compositions provided herein, such as appropriate syringes for intravenous or intramuscular administration.

[0256] In any herein-disclosed method, the method further comprises providing instructions for use (IFU), the IFU including instructions for administering the LNP compositions to a subject. In some embodiments, the user instruction directs a user to inject the LNP compositions comprising mRNA intravenously or intramuscularly for use in cancer immunotherapy.EXAMPLES

[0257] The following examples are provided to further illustrate some embodiments of the present disclosure but are not intended to limit the scope of the disclosure; it will be understood by their exemplary nature that other procedures, methodologies, or techniques known to thoseskilled in the art may alternatively be used.Example 1: Lipid nanoparticle (LNP) formulation and characterization

[0258] All test lipids were synthesized through a solvent free Michael Addition reaction between an amine head and an alkyl-acrylate lipid tail.

[0259] In the cases of homogenous tailed lipids, which comprises one kind of hydrophobic tails, the aliphatic amine head (3,3’-Diamino-N-methyldipropylamine) and the corresponding acrylate tail were mixed at 1 to 5 molar ratio in Teflon-lined glass screw-top vials at 70 °C for 48 h. The crude products were purified using a Teledyne Isco Chromatography system using the mobile phase of methanol / DCM. The purified lipidiods were characterized by electrospray ionization mass spectrometry (ESI-MS).

[0260] In the cases of asymmetric heterogenous lipids, the amine head was mixed with the major lipid tail at 1 to 3.5 molar ratio. After 48 hours stirring at 70 °C, three tailed lipids were purified similarly and reacted with the fourth tail subsequently at 1 : 1.5 molar ratio. The final products were isolated and verified by ESI-MS.

[0261] In the cases of symmetric heterogenous lipids, boc protected amine head was reacted with one lipid tail at 1 to 2.5 molar ratio. After mixing at 70 °C for 48 hour, the half assembled lipid was purified, boc-protection group was removed by trifluoroacetic acid in DCM, and the half lipid was further reacted with the second lipid tail to afford the full heterogenous but symmetric lipid product.

[0262] For synthesis of lipid L0088 tail, 4-Nitrophenyl chloroformate was added to a solution of 2-butyl-l -octanol and triethylamine in THF (500 ml) under Argon in a round flask with a magnetic stir bar at rt. The reaction mixture was stirred for 2-3 hours until completion, monitored by TLC. Then the reaction mixture was diluted with ethyl acetate, and washed successively with IN HC1 solution, saturated NaHCCE solution and brine. The organic layers were dried over MgSO4, filtered and concentrated. The residue was purified by flash column chromatography on silica (0-10% ethyl acetate in hexanes) to afford 3 (88% yield).

[0263] 3 was added to a solution of 2-hydroxyethyl acrylate in DMF under Argon. The reaction mixture was heated to 50 ° C, and K2CO3 was added to the reaction mixture after 10 min. Then the whole reaction mixture was heated at 800C for 2-3 hours until completion, checked byTLC. DMF was removed by rotary evaporation and the residue was partitioned by addition of water and ethyl acetate. The aqueous layer was extracted with ethyl acetate three times. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered and concentrated. The residue was purified carefully by flash column chromatography on silica (10- 30% ethyl acetate in hexanes) to afford 4 (70%).Example 2. Formulation of BiTE encoding mRNA using cationic lipid nanoparticles

[0264] Test lipids in TABLE 3 were formulated with cholesterol, DOPC, DMG-PEG, and the mRNA encoding GPC3-CD3 BiTE (SEQ ID NO: 1). In general, component lipids (ionizable cationic lipids, cholesterol, DOPC, and DMG-PEG) were dissolved in ethanol at appropriate molar ratios of 46 / 42 / 10 / 1.6. Each lipid was dissolved in ethanol and mixed to reach the specified molar ratios in the organic phase. Nucleic acids were dissolved in 25 mM sodium acetate pH 5.2 buffer to reach 0.134 mg / mL. The aqueous and organic solutions were mixed in the NanoAssemblr® (Precision NanoSystems) at a flow rate ratio of 3: 1 (v / v; respectively) and a total flow rate of 20 mL / min. The resultant mixture was dialyzed directly against at least 1000-fold volume of 10 mM Tris-HCl pH 7.5 buffer overnight using a Slide- A-Lyzer MINI Dialysis Device (MWCO, 3.5 KDa). Sucrose was then added to formulations to the final concentration of 1.32 mg / mL followed by 0.22 pm filtration and stored in -4 °C, -80 °C for short-term and long-term storage, respectively.

[0265] TABLE 3. Non-limiting exemplary chemical structures of lipids tested.

[0266] SEQ ID NO: !:ATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCCGAC GTGGTGATGACCCAAAGCCCCCTGAGCCTGCCCGTGACCCCAGGAGAACCCGCCAG CATAAGCTGCAGAAGCAGCCAGAGCCTGGTGCACAGCAACAGAAACACCTATCTGCACTGGTATCTGCAGAAACCCGGACAAAGCCCCCAACTCCTGATCTACAAAGTGTCC AACAGATTCAGCGGCGTGCCCGACAGATTCAGCGGAAGCGGAAGCGGGACCGACTT CACCCTGAAGATCAGCAGAGTGGAAGCCGAGGACGTCGGAGTGTACTACTGCAGCCAGAATACCCACGTTCCACCTACCTTCGGCCAGGGGACAAAGCTGGAGATCAAAGGT GGTGGCGGATCAGGTGGGGGAGGCTCTGGTGGAGGCGGTAGTCAGGTCCAACTCGT CCAAAGCGGCGCAGAAGTCAAAAAACCCGGCGCATCAGTCAAAGTTAGCTGCAAGGCCAGCGGCTACACCTTCACAGACTACGAAATGCATTGGGTCAGACAAGCACCCGGC CAAGGCCTCGAATGGATGGGAGCCCTCGACCCTAAAACCGGCGATACCGCTTACAG CCAGAAATTCAAAGGCAGAGTGACCCTGACCGCCGACAAAAGCACCAGCACCGCCTACATGGAGCTGAGCAGCCTGACCAGCGAAGACACCGCCGTGTACTACTGCACCAGA TTCTACAGCTACACCTACTGGGGACAAGGCACCCTGGTTACCGTGAGCAGCGGTGG CGGTGGATCTGGAGGCGGAGGTAGTGGTGGGGGAGGTTCAGAGGTGCAGCTGGTGGAGAGCGGGGGGGGACTGGTGCAGCCAGGAGGAAGCCTGAAGCTGAGCTGTGCCGC AAGCGGGTTCACATTTAATAAGTACGCAATGAACTGGGTGAGACAGGCTCCTGGCA AAGGACTGGAGTGGGTGGCTAGAATTAGAAGCAAGTACAACAACTACGCCACATACTATGCCGACAGTGTGAAGGACCGGTTCACCATAAGCAGAGACGATAGCAAGAATAC CGCTTACCTGCAAATGAACAACCTGAAGACCGAGGACACCGCCGTCTACTACTGTGT GAGGCACGGAAACTTCGGCAACAGCTACATCTCCTACTGGGCCTACTGGGGACAAGGGACCCTGGTGACCGTCAGCAGCGGAGGCGGTGGAAGTGGCGGAGGAGGGTCAGG GGGAGGTGGATCTCAGACCGTCGTGACCCAAGAGCCCAGCCTCACCGTGAGCCCCG GCGGAACAGTGACCCTCACCTGCGGAAGCAGCACAGGAGCCGTGACCAGCGGATACTACCCCAACTGGGTCCAACAGAAACCCGGCCAAGCCCCCAGAGGCCTGATCGGAGG AACCAAGTTTCTCGCCCCCGGCACACCCGCAAGATTCAGCGGAAGCCTGCTCGGAG GCAAGGCCGCCCTGACCCTGAGCGGAGTGCAACCTGAAGACGAGGCAGAGTACTACTGCGCTCTGTGGTACTCCAACAGATGGGTGTTCGGAGGAGGCACAAAGCTGACCGTCCTGCACCATCACCATCATCACTGAExample 3. Characterization of cationic lipid nanoparticles

[0267] LNPs were formulated with different cationic lipids (test lipids and a reference lipid) and mRNA encoding luciferase, and the physical properties of the LNPs were evaluated. The particle size, poly dispersity index (PDI), and encapsulation of all lipid nanoparticles werecharacterized. LNPs were diluted in PBS pH = 7.4 and transferred into a quartz cuvette (ZEN2112) to measure size by Dynamic Light Scattering (DLS) in the Zetasizer Nano ZS (Malvern Panalytical) using particle RI of 1.45 and absorption of 0.001 in PBS at 25 °C with viscosity of 0.888 cP and RI of 1.335. Measurements were made using a 173° backscatter angle of detection previously equilibrated to 25 °C for 30 s in duplicates, each with 5 runs and 10 s run duration, without delay between measurements. Each measurement had a fixed position of 4.65mm in the quartz cuvette with an automatic attenuation selection. Encapsulation efficiency (EE%) was tested using the RiboGreen Assay.Example 4. L88-GPC3 / CD3 BiTE eliminates orthotopic hepatocellular carcinomas in vivo

[0268] FIG. 1 is a schematic representation of the constructs of glypican-3 (GPC3) / CD3 encoding mRNA. TABLE 4. Shows the 3 groups in the study.TABLE 4. Study arms

[0269] FIG. 2 depicts a schematic diagram of dose regiments and blood collection at indicated timepoints for PK profiling of plasma GPC3 / CD3 BiTE protein, BiTE mRNA and ionizable lipid.

[0270] FIGs. 3A-3B depicts protein PK profiling of single dose IV administration of LNP-GPC3 / CD3 BiTE mRNA in CD1 mice. FIG. 3A shows GPC3-CD3 BiTE protein concentration in the plasma of CD1 mice after i.v. administration of 0.5 and 0.1 mg / kg LNP-GPC3 / CD3 BiTE mRNA (L88-008), and 0.25 mg / kg of recombinant GPC3 / CD3 BiTE protein (rPR008). 5 mice in each treatment group were blood draw of indicated timepoints for plasma BiTE quantification by CD3 ELISA assay. Concentrations from technical ELISA duplicates are shown. FIG. 3B shows ex vivo concentration-dependent cytotoxicity against GPC3+ HepG2-luc cells induced by BiTE protein produced in vivo, which was collected at 48h post-dose of 0.5 mg / kg L88-008, were measured by luminescence-based assay. hPBMCs were used as effectors at effector target (E:T) cell ratio of 5: 1 and detect luminescence single of target cell following 24h incubation. % of specific lysis were calculated as ([number of live target cells without treatment - number of livetarget cells with treatment] / [number of live target cells without treatment] x 100%.TABLE 5. Pharmacokinetic parameters of GPC3 / CD3 BiTE protein after L88 LNP injection inWT CD1 mouse.

[0271] FIG. 4 depicts mRNA PK profiling of single dose IV administration of LNP- GPC3 / CD3 BiTE mRNA in CD1 mice. GPC3-CD3 BiTE mRNA concentration in the plasma of CD1 mice after i.v. administration of 0.5 and 0.1 mg / kg L88-008 were quantified by bDNA assay. Data are presented as means ± SD and dotted line depicts the LLOQ of 1 pg / ml

[0272] FIG. 5 depicts ionizable lipid L88 PK profiling of single dose IV administration of LNP-GPC3 / CD3 BiTE mRNA in CD1 mice. L88 lipid concentration in the plasma of CD1 mice after i.v. administration of 0.5 and 0.1 mg / kg L88-008 were quantified by LC-MS. Data are presented as means ± SD and dotted line depicts the LLOQ of 1 ng / ml.TABLE 6. Pharmacokinetic parameters of GPC3 / CD3 BiTE protein after different doses of L88 LNP injection in WT CD1 mouse.

[0273] FIG. 6 is a schematic diagram of an efficacy study design. The study uses hPBMC- reconstituted Hep3B-Luciferase orthotopic hepatocellular carcinomas (HCC) mouse model with tumor cell and hPBMC inoculation and dose regiment of 3 treatment groups (n=4 for each group) including 0.5mg / kg of LNP-mRNA (L88-008), recombinant BiTE protein (rPR008), and vehicle. TABLE 7. Below shows study arms.

[0274] FIGs 7A-7E depicts the results of the efficacy study. Efficacy study of L88-008 was performed in in hPBMC -reconstituted Hep3B-Luciferase orthotopic HCC mouse model. FIG. 7A shows the total photon flux images of individual mice in each group captured at indicated timepoints by IVIS. FIG. 7B shows the bioluminescence signal quantitated as photons / sec using living Image 4.7 software for each treatment group. Each dot represent mean bioluminescence signal of each group and statistical analysis were compared to G1 PBS control group by 2-way ANOVA test with multiple comparisons analysis at D38 after tumor inoculation. **** p<0.0001. FIGs 7C-7E show total flux (TF) changes of each mouse in individual groups during the treatment were analysis.

[0275] FIG. 8 shows the relative body weight change of each mouse during the treatment were normalized to baseline timepoint (t=0) and each point represent as means ± SD. The statistical analysis was compared to G1_PBS control group by 2-way ANOVA test with multiple comparisons analysis at D38 after tumor inoculation. *** p<0.001.

[0276] FIGs 9A-9C show the liver and spleen tissue images and weight at end-timepoint (D38 after tumor inoculation). FIG. 9A depicts the terminal liver and spleen tissues from each mouse collected. FIG. 9B and FIG. 9C show liver including tumor tissue and spleen weighted at end-timepoint. Each dots represent 1 mouse data and statistical analysis were compared to G1 PBS control by paired two-tailed t-test. Ns, not significant; * P< 0.05, ** P< 0.01. Example 5. Lung-targeting LNPs with GPC3 / CD3 BiTE mRNA for lung cancers

[0277] Lung-targeting LNPs were formulated with the GPC3-CD3 BiTE mRNA and lungtargeting lipids (e.g., L202, L618 and L669) and characterized as described in Examples 1-3. The lung-targeting GPC3-CD3 BiTE LNPs were added to the lung cancer cell lines at 200 ng LNP- BiTE mRNA per 10,000 cells. The following lung cancer cell lines were transfected: Lung Adenocarcinoma (A549), Lung squamous cell carcinoma (SK-MES-1, NCI-H226) and Small Cell Lung Cancer (NCI-H446). BiTE protein expression in the cell media was quantified by ELISA. FIG. 10 shows the concentration of the BiTE protein (ng / ml) in the cell media of the lung cancercell lines transfected by the LNPs (e.g., L202-GPC3 / CD3 BiTE, L618-GPC3 / CD3 BiTE and L669-GPC3 / CD3 BiTE).

[0278] The lung-targeting GPC3-CD3 BiTE LNPs will also be tested in animal models of various types of human lung cancers. For example, the immunodeficient B-NDG B2M mice (female, 5 or 6 weeks old) will be used to establish an orthotopic xenograft tumor model. H446- Luc, human lung cancer cells with high GPC3 and luciferase expression, will be mixed with equal volume of Matrigel and inoculated into mouse lung under anesthesia. Tumor growth will be assessed by measuring the luminescence signal from H446-Luc cells using IVIS spectrum CT biophotonic imager. After about 8-14 days, the H446-Luc orthotopic tumor model will be established and will be groups by the values of luminescence and body weight. Each group of mice will be intravenously (i.v.) infused with human PBMCs and followed by repeat i.v. injection of lung LNP formulated with the GPC3-CD3 mRNA or a corresponding recombinant BiTE protein control. In vivo luciferase signal measured by IVIS will be quantified for monitoring tumor growth until the humane endpoints. Body weight will also be monitored to assess tolerability of the LNP treatment during the study.

Claims

CLAIMSWhat is claimed is:

1. A composition comprising a pharmaceutical agent assembled with a lipid composition that comprises an ionizable lipid, wherein the ionizable lipid comprises an amine head group and at least two hydrophobic tail groups RLipid, wherein each RL1Pldindependently comprises a structure selected from the group consisting of:or a pharmaceutically acceptable salt thereof, wherein:Rki and Rk3 are each independently Cl -CIO alkyl; and each Rk2is independently a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3- C20 heterocycloalkyl, aryl, or heteroaryl; wherein the pharmaceutical agent comprises one or more nucleic acid molecules encoding a bispecific T-cell engager targeting glypican-3 and CD3 (GPC3 / CD3 BiTE).

2. The composition of claim 1, wherein each RL1Pldis independently selected from the group3. The composition of claim 1, wherein each RL1Pldis independently selected from the group4. A composition comprising a pharmaceutical agent assembled with a lipid composition that comprises an ionizable lipid, wherein the ionizable lipid comprises an amine head group and at least two hydrophobic tail groups RLipid, wherein each RL1Pldindependently comprise a structure of Formula (I / a):or a pharmaceutically acceptable salt thereof; wherein:Rki and Rk3 are each independently Cl -CIO alkyl; and each Rk2is independently a C1-C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C20 cycloalkyl, C1-C20 heteroalkyl, C3- C20 heterocycloalkyl, aryl, or heteroaryl; wherein the pharmaceutical agent comprises one or more nucleic acid molecules encoding a bispecific T-cell engager targeting glypican-3 and CD3 (GPC3 / CD3 BiTE).

5. The composition of any one of claims 1-4, wherein each Rk2 is independently a C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl.

6. The composition of claim 5, wherein each Rk2 is independently a C1-C20 alkyl or C2-C20 alkenyl.

7. The composition of any one of claims 1-6, wherein each Rki is independently C1-C4 alkyl and each Rk3 is independently C1-C4 alkyl.

8. The composition of any one of claims 1-7, wherein the ionizable lipid is represented by Formula (II):or a pharmaceutically acceptable salt thereof, wherein:Rbis a substituted or unsubstituted Cl -CIO alkyl; nl and n2 are each independently 1, 2, 3, 4, 5, or 6; andRbl, Rb2, Rb3and Rb4are each independently H or RLipid; wherein at least one of Rbl, Rb2, Rb3and Rb4is not H.

9. The composition of claim 8, whereinRbis a C1-C4 alkyl which is optionally substituted with 1 to 4 groups selected from -OH; and nl and n2 are each independently 1, 2, 3, or 4.

10. The composition of claim 8 or 9, wherein each of Rbl, Rb2, Rb3and Rb4is not H.

11. The composition of any one of claims 1-10, wherein the amine head group is selected from the group consisting of12. The composition of any one of claims 1-11, wherein the amine head group is selected from13. The composition of any one of claims 1-12, wherein the ionizable lipid comprises14. The composition of any one of claims 1-13, wherein the ionizable lipid comprises15. The composition of any one of claims 1-14, wherein the lipid composition further comprises a steroid.

16. The composition of claim 15, wherein the steroid comprises cholesterol or a cholesterol derivative.

17. The composition of any one of claims 1-16, wherein the lipid composition further comprises a helper lipid.

18. The composition of claim 17, wherein the helper lipid comprises phospholipids or zwitterionic lipids comprising l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE) or l,2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC).

19. The composition of any one of claims 1-18, wherein the lipid composition further comprises a polymer conjugated lipid.

20. The composition of claim 19, wherein the polymer conjugated lipid comprises a polyethylene glycol (PEG) conjugated lipid.

21. The composition of claim 19, wherein the polymer conjugated lipid comprises 1,2- distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000 (DSPE-PEG2k) or l,2-dimyristoyl-rac-glycero-3 -methoxypoly ethylene gly col-2000 (DMG- PEG2k).

22. The composition of any one of claims 1-21, wherein the lipid composition further comprises a steroid, a helper lipid, and a polymer conjugated lipid.

23. The composition of claims 1-22, wherein the ionizable lipid is present in the lipid composition at a weight percentage from about 30% to about 90%.

24. The composition of claims 1-23, wherein the steroid is present in the lipid composition at a weight percentage from about 10% to about 40%.

25. The composition of any one of claims 17-24, wherein the helper lipid is present in the lipid composition at a weight percentage from about 1% to about 20%.

26. The composition of any one of claims 19-25, wherein the polymer conjugated lipid is present in the lipid composition at a weight percentage from about 1% to about 20%.

27. The composition of any one of claims 22-25, wherein the weight ratio of the ionizable lipid / steroid / helper lipid / polymer conjugated lipid is about 4 / 1 / 1 / 1.

28. The composition of any one of claims 21-26, wherein the weight ratio of the pharmaceutical agent / lipid composition is from about 1 :200 to about 1 :5.

29. The composition of any one of claims 1-19, wherein the lipid composition further comprises a steroid and a helper lipid.

30. The composition of claim 29, wherein the ionizable lipid is present in the lipid composition at a weight percentage from about 30% to about 90%.

31. The composition of claim 29 or 30, wherein the helper lipid is present in the lipid composition at a weight percentage from about 5% to about 40%.

32. The composition of any one of claims 29-31, wherein the steroid is present in the lipid composition at a weight percentage from about 5% to about 40%.

33. The composition of any one of claims 29-32, wherein the weight ratio of the ionizable lipid / steroid / helper lipid is about 2 / 1 / 1.

34. The composition of any one of claims 1-33, wherein the lipid composition further comprises a pharmaceutically acceptable carrier.

35. The composition of claim 34, wherein the pharmaceutically acceptable carrier comprises a sugar, and wherein the sugar comprises mannitol, sucrose, maltose, or trehalose.

36. The composition of claims 34-35, wherein the carrier is present in the composition at a weight percentage from about 5% to about 60%.

37. The composition of any one of claims 1-36, wherein the ionizable lipid comprises at least two hydrophobic tails, wherein not all hydrophobic tails are identical.

38. The composition of any one of claims 1-36, wherein the ionizable lipid comprises at least two hydrophobic tails, wherein two or more hydrophobic tails are identical.

39. The composition of any one of claims 1-38, wherein the pharmaceutical agent comprises one or more mRNA molecules encoding a bispecific T-cell engager targeting glypican-3 and CD3 (GPC3 / CD3 BiTE) or optionally the pharmaceutical agent comprises a nucleic acid sequence having at least 70% sequence identity to SEQ ID NO: 1, or optionally the pharmaceutical agent comprises SEQ ID NO: 1.

40. The composition of any one of claims 1-39, wherein the pharmaceutical agent further comprises a polynucleotide, an oligonucleotide, a polypeptide, an oligopeptide, a small molecule compound, or any combination thereof.

41. The composition of claim 40, wherein the small molecule compound comprises a drug for chemotherapy.

42. The composition of any one of claims 1-41, wherein the physical properties of the lipid composition are stable for at least 2 months, at least 3 months, at least 4 months, at least 5 months, or at least 6 months or more when stored at 4°C, -20°C, or -80°C43. The composition of any one of claims 1-42, wherein the physical properties of the lipid composition are stable for at least 5 months when stored at 4°C, -20°C, or -80°C.

44. The composition of any one of claims 42-43, wherein the physical properties of the lipid composition comprises size, poly dispersity index (PDI), encapsulation efficacy (EE%), or pKa of the lipid composition.

45. The composition of any one of claims 1-44, wherein the lipid composition targets a target organ after being administered to a subject.

46. The composition of claim 45, wherein the target organ comprises a liver, lung or spleen.

47. The composition of any one of claims 1-46, wherein the composition targets a target cell after being administered to a subject.

48. The composition of claim 47, wherein the target cell comprises a hepatocyte, a Kupffer cell, a liver sinusoidal endothelial cell (LSEC), a B cell, a T cell, a dendritic cell, a macrophage, a myeloid cell, a hematopoietic stem cells, or a leukocyte.

49. The composition of any one of claims 1-48, wherein after being administered to a subject the composition has a faster rate of clearance compared to other compositions.

50. The composition of any one of claims 1-48, wherein after being administered to a subject the composition has a longer half-life compared to other compositions.

51. The composition of claim 50, wherein after being administered to a subject the composition has a half-life of at least 2 hours, at least 3 hours, at least 4 hours, or at least 5 hours.

52. The composition of any one of claims 1-48, wherein after the composition is administered to a subject the composition has a larger area under curve (AUC) compared to other compositions.

53. The composition of claim 52, wherein after the composition is administered to a subject the composition has an AUC of that is at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60% or larger compared to other compositions.

54. A method for delivering a pharmaceutical agent to a target organ in a subj ect in need thereof, the method comprising administering an effective amount of the composition according to any one of claims 1-53.

55. A method for delivering a pharmaceutical agent to a target organ in a subj ect in need thereof, the method comprising: administering to the subject an effective amount of the pharmaceutical agent assembled with a lipid composition according to any one of claims 1-53; and thereby providing a greater amount or activity of the pharmaceutical agent in the target organ in the subject as compared to that achieved absent the lipid composition.

56. A method for delivering a pharmaceutical agent to a target organ in a subj ect in need thereof, the method comprising administering to the subject an effective amount of the pharmaceutical agent assembled with a lipid composition according to any one of claims 1-53; and thereby providing a greater amount or activity of the pharmaceutical agent in the target organ in the subject as compared to a non-target organ.

57. The method of any one of claims 54-56, wherein the administering is through systemic administration.

58. The method of any one of claims 54-56, wherein the administering is through intramuscular administration.

59. The method of any one of claims 54-56, wherein the administering is through intravenous administration.

60. The method of any one of claims 54-59, wherein the pharmaceutical agent is delivered at a dosage of no more than 3 mg / kg body weight.

61. The method of claim 60, wherein the pharmaceutical agent is delivered at a dosage from about 0.25 mg / kg to about 1 mg / kg body weight.

62. The method of any one of claims 54-61, wherein the pharmaceutical agent is delivered in one or more doses.

63. The method of any one of claims 54-62, wherein the subject is a mammal, and wherein the mammal comprises a rodent or a non-human primate.

64. The method of any one of claim 55 or 56, wherein the activity of the pharmaceutical agent comprises cancer cell killing.

65. The method of any one of claim 55 or 56, wherein the amount of the pharmaceutical agent is measured by pharmacokinetic parameters, and wherein the pharmacokinetic parameters comprise Cmax, Tmax, half-life, or area under curve (AUC).

66. The method of any one of claim 55 or 56, wherein the greater amount of the pharmaceutical agent comprises a larger Cmax, a longer half-life, or a larger area under curve (AUC).

67. The method of any one of claims 54-66, wherein the method results in greater cancer cell killing.

68. The method of any one of claims 54-67, wherein the method results in greater the pharmacokinetic parameters of the pharmaceutical agent, and wherein the pharmacokinetic parameters of the pharmaceutical agent comprise Cmax, Tmax, half-life, or area under curve (AUC).

69. The method of claim 68, wherein the half-life of the pharmaceutical agent is at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, or at least 6 hours or more.

70. The method of any one of claim 54-69, wherein the target organ comprises a liver, lung or spleen.

71. A method for treating a solid-state tumor in a subject in need thereof, comprising administering an effective amount of the composition according to any one of claims 1-53.

72. The method of claim 71, wherein the solid-state tumor comprises hepatocellular carcinoma.

73. The method of claim 71, wherein the solid-state tumor comprises lung cancer.

74. The method of claim 73, wherein the lung cancer comprises non-small cell lung cancer.

75. The method of any one of claims 71-74, wherein the administering comprises administering the composition intravenously or intramuscularly to a subject in need thereof.

76. The method of any one of claims 71-75, wherein the subject comprises a mammal.

Images