Methods and compositions comprising ISCB variants

Abstract

Aspects herein include engineered endonucleases and / or engineered ωRNAs and methods of using the same.

Description

METHODS AND COMPOSITIONS COMPRISING ISCB VARIANTSCROSS REFERENCE TO RELATED APPLICATIONS

[0001] The present invention claims priority to U.S. Provisional Application Serial Nos. 63 / 523,862 filed on June 28, 2023 and 63 / 523,884 filed on June 28, 2023, both of which are herein incorporated by reference in their entirety.STATEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under R35GM118174 awarded by the National Institutes of Health. The government has certain rights in the invention.SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing which has been submitted in ST26 format and is hereby incorporated by reference in its entirety. Said ST26 copy, created on June 27, 2024, is named ARCD_P0812WO_SL.xml and is 28,283 bytes in size.BACKGROUND OF THE INVENTIONII. Field of the Invention

[0004] This invention relates to the field of molecular biology, genetic engineering, and medicine.III. Background

[0005] IscB is an RNA-guided endonuclease encoded in a distinct family of IS200 / IS605 transposons (Kapitonov et al., 2015; Altae-Tran et al., 2021; Meers et al., 2023). Despite being 1 / 3 the size of Cas9, IscB contains all the essential domains found in Cas9, including the HNH nuclease domain, the split RuvC nuclease domain, and in particular, the Cas9-specific arginine- rich bridge helix (FIG. 1A). IscB further encodes an N-terminal PLMP motif-containing domain (PLMP), a C-terminal target-associated motif (TAM) interaction domain (TID, shared with some Cas9 proteins), and a few other degenerate structural motifs. The a-helical recognition lobe (REC; -600 residues) commonly found in Cas9 is largely absent in IscB. In place of the CRISPR RNA (crRNA) and tracrRNA heteroduplex in the Cas9 ribonucleoprotein (RNP) is a single noncoding RNA, named OMEGA RNA (coRNA), the structured portion of which serves the equivalent function of the REC domain in Cas9 (Schuler et al., 2022; Kato et al., 2022; Hirano et al., 2022). Structural studies further revealed strong mechanistic similaritybetween IscB and Cas9 in target DNA recognition, R-loop formation, and conformational dynamics in the HNH nuclease (Schuler et al., 2022; Kato et al., 2022; Hirano et al., 2022).

[0006] While retaining the versatility of conventional Cas9 systems, the compact size renders the IscB / coRNA system highly attractive for in vivo genome-editing applications (Lino et al., 2018). Identified in the human gut metagenome, OgeuIscB / coRNA has been reported to generate double-stranded breaks (DSBs) in mammalian cells (Altae-Tran et al., 2021). However, the use of OgeuIscB for programmed genome editing is currently hindered by its overall low editing activity and unstable performance across different target sites.

[0007] Practical applications of IscB / coRNA as genome-editing agents also require careful assessment of its editing fidelity. The OgeuIscB / coRNA complex has been shown to specify a 16-nt region in target DNA through R-loop formation (Altae-Tran et al., 2021), which is 4-nt shorter than that by Streptococcus pyogenes Cas9 (SpCas9). This may potentially lead to a higher incidence of off-target cleavage. Nevertheless, structural studies showed that at least the first 14 base pairs of the coRNA / target DNA heteroduplex are extensively recognized by OgeuIscB upon R-loop formation (PDB: 8CSZ). In the case of SpCas9, trimming the spacer from 20-nt to 17-nt increased the mismatch sensitivity and reduced off-target DNA cleavage (Fu et al., 2014). Whether the specificity of IscB / coRNA is sufficient for mammalian genome editing has not been systematically evaluated.SUMMARY OF THE INVENTION

[0008] Aspects herein relate to the discovery that engineering an endonuclease, including IscB endonuclease variants, improves endonuclease and base editing activity and specificity. Aspects herein also relate to the discovery that engineering omega-RNAs also improve gene editing using the engineered endonucleases. Such engineered endonucleases can be used in genetic engineering and other uses.

[0009] Disclosed herein are engineered endonucleases. The engineered endonuclease may be an engineered OgeuIscB (enOgeuIscB) endonuclease. In some aspects, the enOgeuIscB comprises at least one mutation relative to a wild-type OgeuIscB endonuclease. The mutation(s) may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 mutation(s) of E84R, D96R, M102R, F137K, V159K, N281R, Q324R, Y327K, K392R, H368R, H368K, T406R, K481R, S437K, L393K, L351TDAT355KVSSPT361GS363P, K179MQKF183, and LVHT274DKEW>LVHKQQAW.

[0010] In some aspects, the enOgeuIscB comprises 1 mutation M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K. In some aspects, theenOgeuIscB comprises 2 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K. In some aspects, the enOgeuIscB comprises 3 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K. In some aspects, the enOgeuIscB comprises 4 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K. In some aspects, the enOgeuIscB comprises 5 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K. In some aspects, the enOgeuIscB comprises 6 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K. In some aspects, the enOgeuIscB comprises 7 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K. In some aspects, the enOgeuIscB comprises 8 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K. In some aspects, the enOgeuIscB comprises 9 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, S437K, and L393K. In some aspects, the engineered OgeuIscB endonuclease comprises one or more mutations of E84R, D96R, M102R, F137K, V159K, N281R, Q324R, Y327K, K392R, H368R, H368K, T406R, K481R, S437K, L393K, L351TDAT355KVSSPT361GS363P, K179MQKF183, andLVHT274DKEW>LVHKQQAW.

[0011] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, and L393K mutations.

[0012] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, and L393K mutations.

[0013] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K, and L393K mutations.

[0014] Also disclosed is anengineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, and E84R mutations.

[0015] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, E84R, and D96R mutations.

[0016] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K,N281R, Q324R, Y327K, H368K or H368R, L393K, E84R, D96R, Y100H, and K156R mutations.

[0017] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, K392R, and T406R mutations.

[0018] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, and L351TDAT355KVSSPT361GS363P mutations.

[0019] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, and K179MQKF183 mutations.

[0020] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, and LVHT274DKEW>LVHKQQAW mutations.

[0021] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, S430R, K481R, and LVHT274DKEW>LVHKQQAW mutations.

[0022] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, S430R, K481R,L351TDAT355KVSSPT361GS363P, and K179MQKF183 mutations.

[0023] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, S430R, K481R, and LVHT274DKEW>LVHKQQAW mutations.

[0024] Also disclosed is an engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, S430R, K481R,L351TDAT355KVSSPT361GS363P, K179MQKF183, andLVHT274DKEW>LVHKQQAW mutations.

[0025] In some aspects, the engineered endonuclease comprises one or more mutations described herein. In some aspects, the engineered endonuclease does not comprise an H368R mutation. In some aspects, the engineered endonuclease does not comprise a E84R, D96R, M102R, F137K, V159K, N281R, Q324R, Y327K, K392R, H368R, H368K, T406R, K481R, S437K, L393K, L351TDAT355KVSSPT361GS363P, K179MQKF183, orLVHT274DKEW>LVHKQQAW mutation.

[0026] Also disclosed are engineered endonucleases comprising the sequence of any one of SEQ ID NOs: l-69.

[0027] In certain aspects, the enOgeuIscB comprises at least one nuclear localization signal, including any nuclear localization signal disclosed herein. In certain aspects, the nuclear localization signal is located at the N-terminus and / or C-terminus of the enOgeuIscB. In certain aspects, the engineered endonuclease comprises at least one nickase mutation. In certain aspects, the engineered endonuclease comprises a D60A, H246A, E192A mutation, or a combination thereof. In certain aspects, the engineered endonuclease comprises a deaminase, including a cytosine deaminase or an adenosine deaminase. The deaminase may be a TadA8e deaminase. In certain aspects, the deaminase is fused to the engineered endonuclease. In certain aspects, the engineered endonuclease comprises a glycosylase. In certain aspects, the engineered endonuclease comprises a glycosylase inhibitor. In certain aspects, the engineered endonuclease comprises a reverse transcriptase, which may be fused to the engineered endonuclease.

[0028] Also disclosed are engineered omega-RNAs (coRNAs). The engineered coRNAs may comprise one or more mutations, deletions, additions, truncations, or exogenous or synthetic molecules that improve the efficiency, accuracy, and / or off target effects of an endonuclease, including any engineered endonuclease disclosed herein. The one or more mutations, deletions, additions, or truncations may be relative to a wild-type coRNA. In certain aspects, the engineered coRNA comprises a C24U, A88G, and / or C138U mutation. In certain aspects, the engineered coRNA comprises a U31-U45 deletion. In certain aspects, the engineered coRNA comprises any truncation disclosed herein in one or more Pl, P2, P3, P4, P5, JI, J2 regions of a coRNA, such as a wild-type coRNA. In certain aspects, the engineered coRNA comprises a sephadex-binding aptamer. In some aspects, the sephadex-binding aptamer is inserted between a P4 and JI region of the coRNA. In certain aspects, the engineered coRNA comprises U191- G222 of the coRNA replaced with GAAACAGAGAGAGTT. In certain aspects, the engineered coRNA comprises G147-U156 of the coRNA replaced with GAAA.

[0029] Also disclosed are engineered coRNAs of SEQ ID NOs:71-86.

[0030] In some aspects, the engineered coRNA comprises a prime editing guide RNA. In certain aspects, the prime editing guide RNA is attached to the 3’ end of the engineered coRNA.

[0031] Also disclosed are nucleic acids encoding any of the engineered endonucleases and / or coRNAs disclosed herein. Also disclosed are expression constructs encoding at least one engineered endonuclease disclosed herein and / or at least one engineered coRNA disclosed herein. Also disclosed are compositions comprising any nucleic acid disclosed herein. Also disclosed are compositions comprising any expression construct disclosed herein.

[0032] Also disclosed are compositions comprising at least one engineered endonuclease disclosed herein.

[0033] Also disclosed are compositions comprising at least one engineered coRNA disclosed herein.

[0034] Also disclosed are compositions comprising at least one engineered endonuclease disclosed herein and at least one engineered coRNA disclosed herein.

[0035] Also disclosed are compositions comprising at least one engineered endonuclease disclosed herein and a prime editing guide RNA.

[0036] Any of the compositions disclosed herein may further comprise a delivery moiety. The delivery moiety may be capable of introducing the composition to a patient, to a cell, and / or to a nucleic acid.

[0037] Also disclosed are methods of genetically engineering a cell, methods of genetically engineering at least one target gene in a cell, methods of introducing at least one genetic mutation in a cell, methods of correcting at least one genetic mutation in a cell, methods of changing the sequence of a nucleic acid, methods of editing at least one base in a nucleic acid, and methods of genetic engineering. In some aspects, the cell is a cell of a patient, including a human patient. The cell may be a germ cell. The cell may be a neoplastic cell. The cell may be a somatic cell.

[0038] Methods disclosed herein may comprise 1, 2, 3, 4 or more steps including any of the following: delivering to a cell at least one engineered endonuclease (including any engineered endonuclease disclosed herein), delivering to a cell at least one engineered coRNA (including any engineered coRNA disclosed herein), delivering to a cell a nucleic acid encoding any engineered endonuclease and / or engineered coRNA, delivering to a cell an expression construct encoding any engineered endonuclease and / or engineered coRNA.

[0039] Disclosed herein are methods comprising delivering to a cell at least one engineered endonuclease and / or at least one engineered coRNA disclosed herein.

[0040] Disclosed herein are methods comprising delivering to the cell an effective amount of any nucleic acid disclosed herein, any expression construct disclosed herein, or any composition disclosed herein.

[0041] In some aspects, the method comprises a glycosylase and / or glycosylase inhibitor to the cell, delivering a deaminase to the cell, delivering a reverse transcriptase to the cell, delivering at least one prime editing guide RNA to the cell, or a combination thereof.

[0042] Also disclosed are methods of treating a patient, methods of altering a genetic signature in a patient, methods of modifying a patient’s genome, methods of correcting a genetic abnormality in a patient, and methods of correcting a genetic disease in a patient. The method can comprise 1, 2, 3, 4, or more steps including any of the following: administering to the patient an effective amount of at least one engineered endonuclease disclosed herein, administering to the patient an effective amount of at least one engineered coRNA disclosed herein, administering to the patient an effective amount of a nucleic acid disclosed herein, administering to the patient an effective amount of an expression construct disclosed herein, and administering to the patient an effective amount of a composition disclosed herein.

[0043] In some aspects, the patient has a genetic disease. In some aspects, the patient has one or more mutations associated with a disease. The patient may be a human patient.

[0044] Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the measurement or quantitation method.

[0045] The use of the word “a” or “an” when used in conjunction with the term “comprising” may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”

[0046] The phrase “and / or” means “and” or “or”. To illustrate, A, B, and / or C includes: A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C. In other words, “and / or” operates as an inclusive or.

[0047] The words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0048] The compositions and methods for their use can “comprise,” “consist essentially of,” or “consist of’ any of the ingredients or steps disclosed throughout the specification. Compositions and methods “consisting essentially of’ any of the ingredients or steps disclosed limits the scope of the claim to the specified materials or steps which do not materially affect the basic and novel characteristic of the claimed invention.

[0049] It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve methods of the invention.

[0050] Other obj ects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS

[0051] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0052] FIGS. 1A-1F. Engineering OgeuIscB for increased genome-editing efficiency. FIG. 1A shows the domain architectures of SpCas9 and OgeuIscB. The PLMP, HNH endonuclease (HNH), alpha-helical recognition (REC), and RuvC-like nuclease (RuvC), P1D, and TID domains are denoted. Protein lengths are drawn to scale, aa: amino acids. FIG. IB shows multiple sequence alignment of OgeuIscB and seven IscB orthologs. Representative regions are shown, with candidates for mutagenesis denoted by a box and arrow. Full sequence alignment is provided in FIG. 17. FIG. 1C shows the workflow used to determine the cellular activity of OgeuIscB / coRNA and its derivatives. NLS: Nuclear localization signal; HA: hemagglutinin tag. FIG. ID shows insertion-deletion (indel) levels at VEGFA site 1 generated by wildtype OgeuIscB and OgeuIscB variants bearing single-point mutations. Mutations included in each OgeuIscB variant are listed in FIG. 28. Fold changes in indel frequencies are plotted in FIG. 18A. Wt nt: wildtype OgeuIscB and non-target coRNA. Three independent replicates were carried out in HEK293T cells (mean ± s.d.). Cells were harvested 48 hourspost-transfection. P values were determined by two-tailed paired Student’s t-test. * P < 0.05; ** P < 0.01; *** P < 0.001; **** p < 0.0001. FIG. IE shows a projection of all evaluated mutations onto the cryo-EM structure of the OgeuIscB / coRNA / DNA complex. PDB entry: 7UTN (Schuler et al., 2022). Beneficial mutations denoted by dark sphere along with amino acid position numbers; other mutations: light gray spheres without amino acid position numbers. The dashed line delineates a plausible path for the non-target strand to enter the RuvC active site upon locking of the R-loop by the HNH endonuclease domain. FIGS. IF shows a surface charge distributions of wildtype OgeuIscB and an OgeuIscB variant with beneficial mutations projected. The structures adopt the same orientation as in FIG. IE.

[0053] FIGS. 2A-2D. Characterization of enOgeuIscB in human cells and in vitro. FIG. 2A shows indel levels at VEGFA site 1 generated by OgeuIscB variants bearing 2-8 mutations. OgeuIscB-v2, 3, 4, 5, and 6 denote OgeuIscB variants carrying 2, 3, 4, 5-7, and 8 single-point mutations, respectively. FIG. 2B shows indel levels at EMX1 site 1 generated by selected OgeuIscB variants. FIG. 2C shows a metaplot showing the positions of insertions and deletions generated by wildtype OgeuIscB, OgeuIscB -v5.1, and enOgeuIscB. FIG. 2D shows an electrophoretic mobility shift assay of target DNA with OgeuIscB / coRNA and enOgeuIscB / coRNA. The experiment was repeated independently twice and the representative result is shown. For FIG. 2A and FIG. 2B, three independent replicates were carried out in HEK293T cells (mean ± s.d.). Cell were harvested 48 hours post-transfection. Fold changes in indel frequencies are plotted in FIGS. 18B-18C. Wt nt: wildtype OgeuIscB and non-target coRNA.

[0054] FIGS. 3A-3B. Structure-guided coRNA engineering. FIG. 3A shows a schematic of coRNA variants. FIG. 3B shows indel levels at VEGFA site 1 generated by coRNA variants paired with wildtype and engineered OgeuIscB. For each variant, the bars represent, in left to right order, coRNA, coRNA-vl, coRNA-v2, coRNA-v3, coRNA-v4, coRNA-v5, coRNA-v6, coRNA-v7, coRNA-v8, coRNA-v9, coRNA-vlO, coRNA-vl l, coRNA-vl2, coRNA-vl3, coRNA- vl4, coRNA-vl5, and coRNA-vl6. Sequences of coRNA variants are provided in FIG. 30. All coRNA variants were evaluated in HEK293T cells (mean ± s.d., n = 3). Cell were harvested 48 h post-transfection. Fold changes in indel frequencies are plotted in FIG. 8C.

[0055] FIGS. 4A-4G. Genome editing facilitated by engineered OgeuIscB / coRNA. FIG. 4A shows indel frequencies mediated by wildtype OgeuIscB and enOgeuIscB paired with wildtype coRNA in HEK293T cells. For each target site, left bar: OgeuIscB; right bar: enOgeuIscB. FIG. 4B shows a violin plot showing the distribution of indel levels achieved byOgeuIscB / coRNA and enOgeuIsc / coRNA across 26 target sites. FIG. 4C shows indel levels achieved by HA tag-bearing and HA tag-free enOgeuIsc and enlscB (Han et al., 2023) paired with wildtype coRNA across 26 target sites. FIG. 4D shows indel frequencies generated by enOgeuIscB / coRNA-v2 and enlscB / coRNA* at 6 target sites. FIG. 4E shows indel frequencies generated by enOgeuIscB / coRNA-v2 and enOgeuIscB / coRNA-vl3 encoded in a single plasmid at six target sites in HEK293T cells. Editing outcomes in A549 and HeLa cells are provided in FIGS. 12A-12B. FIG. 4F shows A:T-to-G:C editing at VEGFA site 1 generated by individual fusions of TadA8evl06Wand enOgeuIscB (D60A) paired with the wildtype coRNA, coRNA-v2, and coRNA-vl3. Heatmaps are plotted for the entire 16-nt protospacer using editing rates averaged from three independent experiments. FIG. 4G shows A:T-to-G:C editing achieved by wildtype OgeuIscB / coRNA, enOgeuIscB / coRNA-v2, enOgeuIscB / coRNA-vl3, and enlscB / coRNA* in the dual TadA8evl06Warchitecture across six target sites. The best edited A sites are plotted for individual target sites. Editing events occurred in the entire protospacers are plotted in FIG. 13. All genome-editing experiments shown in the figure were carried out in HEK293T cells (mean ± s.d.; n = 3 independent experiments). Cells were harvested 72 hours post-transfection. For both FIG. 4B and FIG. 4C, the width of the violin represents the density of data points at each value. The thick centerline and the plus sign within the violin indicate the median and mean, respectively, while the dashed lines represent the first and third quartiles. The violin plot is truncated at the minimum and maximum values, n = 26 target sites.

[0056] FIGS. 5A-5C. Genome-wide specificity of wildtype and engineered OgeuIscB / coRNA. FIG. 5A shows on-target indel and dsODN integration frequencies in GUIDE-seq samples. For each condition, left bar: indel (%); right bar: dsODN insertion (%). FIG. 5B shows the number of off-target sites captured by GUIDE-seq. Hits with up to seven mismatches to the 22-nt bait were retained. The TAM sequence was specified as NWRRNA. FIG. 5C shows top-ranked off-target editing loci for VEGFA site 1-, VEGFA site 2-, CXCR4_site 1-, and DYNCIHl site 1 -targeting OgeuIscB / coRNA reported by GUIDE-seq. Uncropped GUIDE-seq results for OgeuIscB / coRNA, enOgeuIscB / coRNA_v2, and enOgeuIscB / coRNA_vl3 targeting VEGFA_site 1, VEGFA_site 2, CXCR4_site 1, and DYNCIHl site 1 are provided in FIGS. 22-25. Mismatch positions are highlighted. Numbers of unique integration events detected by GUIDE-seq are provided to the right of the corresponding sequences. Black squares indicate the on-target loci. All GUIDE-seq experiments were carried out in HEK293T cells.

[0057] FIGS. 6A-6D. Mismatch tolerance and TAM preferences of OgeuIscB / coRNA. FIG. 6A shows sequence logos representing off-target sites bearing up to two mismatches with VEGFA site 1, VEGFA site 2, CXCR4_site 1, and DYNCIHl site 1 nominated in silico by Cas-OFFinder (top) and captured experimentally by GUIDE-seq (bottom). FIG. 6B shows mismatch tolerance at individual protospacer positions plotted as ratios of mismatches detected by GUIDE-seq and those identified by Cas-OFFinder. FIG. 6C shows sequence logos representing TAMs detected at off-target sites of up to two mismatches identified in silico by Cas-OFFinder (top) and experimentally by GUIDE-seq (bottom). FIG. 6D shows a close-up view of TAM interactions in the OgeuIscB / coRNA / DNA complex. PDB entry: 7UTN (Schuler et al., 2022). Similar plots for enOgeuIscB / coRNA-v2 and enOgeuIscB / coRNA-vl3 are provided in FIGS. 15-16. Plots considering numbers of unique integration events in GUIDE- seq are available in FIG. 26.

[0058] FIGS. 7A-7B. In vitro DNA cleavage activity of wildtype OgeuIscB and enOgeuIscB. FIG. 7A shows concentration-dependent in vitro DNA cleavage by wildtype OgeuIscB and enOgeuIscB. Target DNA was supplied at a concentration of 5 nM. FIG. 7B shows time-course in vitro DNA cleavage by wildtype OgeuIscB and enOgeuIscB. Target DNA: 5 nM; (en)OgeuIscB / coRNA: 500 nM. All experiments were repeated independently three times with similar results.

[0059] FIGS. 8A-8E. Structure-guided coRNA engineering. FIG. 8A shows a cryo-EM structure of the OgeuIscB RNP bound to target DNA illustrating the locations of the truncations in coRNA (PDB entry: 7UTN (Schuler et al., 2022)). Rectangle boxes indicate regions subject to truncation. FIG. 8B shows a schematic of coRNA variants. Changes in coRNA-v2 and coRNA-vl3 are indicated by boxes and arrows. FIG. 8C shows fold changes of indel levels at VEGFA site 1 generated by coRNA variants paired with wildtype and engineered OgeuIscB proteins. Sequences of coRNA variants are provided in FIG. 30. Raw indel frequencies are plotted in Figure 3B. FIG. 8D shows indel levels at VEGFA site 1 generated by wildtype coRNA paired with wildtype OgeuIscB and OgeuIscB-APLMP. FIG. 8E shows relative levels of coRNAs when co-expressed with wildtype OgeuIscB and enOgeuIscB. RNA levels were normalized to that of GAPDH. All experiments were carried out in HEK293T cells, with indel frequencies and RNA abundances quantified 48 hours post-transfection (mean ± s.d.; n = 3 independent experiments).

[0060] FIGS. 9A-9D. Genome editing facilitated by combining engineered OgeuIscB and coRNA variants. FIG. 9A shows indel frequencies generated by HA-tagged wildtypeOgeuIscB, OgeuIscB-v5.1, and enOgeuIscB paired with the wildtype coRNA, coRNA- v2, and coRNA-vl3 at eight target sites. FIG. 9B shows indels generated by enOgeuIscB paired with wildtype and coRNA-v2 at 26 genomic sites. FIG. 9C shows a violin plot showing the distribution of indel levels achieved by enOgeuIscB / coRNA and enOgeuIsc / coRNA-v2 across 26 target sites. The width of the violin represents the density of data points at each value. The thick centerline and the plus sign within the violin indicate the median and the mean, respectively, while the dashed lines represent the first and third quartiles. The violin plot is truncated at the minimum and maximum values. FIG. 9D shows relative levels of EMX1 site / -targeting coRNA when co-expressed with wildtype OgeuIscB and enOgeuIscB. RNA levels were normalized to that of GAPDH. All experiments were carried out in HEK293T cells (mean ± s.d.; n = 3 independent experiments), with indel frequencies quantified 72 hours posttransfection (FIGS. 9A-9C) and RNA levels quantified 48 hours post-transfection (FIG. 9D). Statistical analysis was done using a two-tailed Student's t-test. n.s. P > 0.05; *** P = 0.0002.

[0061] FIGS. 10A-10C. The HA tag negatively impacted the editing activity of OgeuIscB / coRNA. FIG. 10A shows the design of plasmid constructs used for activity evaluation. FIG. 10B shows indel frequencies generated by HA tag-free wildtype OgeuIscB, OgeuIscB-v5.1, and enOgeuIscB paired with the wildtype coRNA, coRNA-v2, and coRNA-vl3 at eight target sites. FIG. 10C shows box plot of indel frequencies achieved by HA tag-bearing and HA tag-free wildtype OgeuIscB, OgeuIscB-v5.1, and enOgeuIscB across eight target sites. The whiskers extend to minima and maxima. Lower and upper hinges denote first and third quartiles. The central line and plus sign represent the median and mean, respectively, n = 8 target sites. All experiments were carried out in HEK293T cells (mean ± s.d.; n = 3 independent experiments). Cells were harvested 72 hours post-transfection.

[0062] FIGS. 11A-11B Side-by-side comparison of the indel formation activity of enOgeuIscB and enlscB (Han et al., 2023). Indel frequencies mediated by HA tag-bearing (FIG. 11 A) and HA tag-free (FIG. 11B) enOgeuIscB and enlscB paired with the wildtype coRNA. For each target site, left bar: enOgeuIscB_HA / coRNA; right bar: enIscB_HA / coRNA. All experiments were carried out in HEK293T cells (mean ± s.d.; n = 3 independent experiments). Cells were harvested 72 hours post-transfection.

[0063] FIGS. 12A-12B. Indel frequencies generated by enOgeuIscB / coRNA-v2 and enOgeuIscB / coRNA-vl3 at six target sites in A549 (FIG. 12A) and HeLa (FIG. 12B) cells. For each target site, left bar: coRNA- v2; right bar: coRNA-vl3. enOgeuIscB and the engineeredcoRNA were encoded in a single plasmid to facilitate delivery. Three independent replicates were carried out (mean ± s.d.). Cells were harvested 72 hours post-transfection.

[0064] FIGS. 13A-13B. Adenine base editing by engineered OgeuIscB / coRNA. FIG. 13A shows A:T-to-G:C editing at VEGFA site 1 by three versions of TadA8evl06Wand enOgeuIscB (D60A) fusions, programmed with the wildtype coRNA, coRNA- v2, or coRNA-vl3. FIG. 13B shows A:T-to-G:C editing achieved by wildtype OgeuIscB / coRNA, enOgeuIscB / coRNA-v2, enOgeuIscB / coRNA-vl3, and enlscB / coRNA*, in the dual TadA8evl06Wfusion scheme, across six target sites. The editing efficiency at each adenosine residue across the entire protospacer region was plotted. Three independent replicates were carried out in HEK293T cells (mean ± s.d.). Cells were harvested 72 hours post-transfection.

[0065] FIGS. 14A-14B. Off-target (OT) editing at GUIDE-seq-nominated OT sites. Indel frequencies generated by OgeuIscB / coRNA, enOgeuIscB / coRNA-v2, and enOgeuIscB / coRNA- vl3 in GUIDE-seq samples (FIG. 14A) and cells independently transfected in the absence of GUIDE-seq dsODN (FIG. 14B). All experiments shown in the figure were carried out in HEK293T cells. Cells were harvested 72 hours post-transfection (FIG. 14A, n = 1; FIG. 14B, mean ± s.d., n = 3 independent experiments).

[0066] FIGS. 15A-15B. Mismatch tolerance of enOgeuIscB / coRNA-v2 and enOgeuIscB / coRNA-vl3. FIG. 15A shows sequence logos representing off-target sites captured expeirmentally by GUIDE-seq for enOgeuIscB / coRNA-v2 and enOgeuIscB / coRNA- vl3 targeting VEGFA site 1, VEGFA site 2, CXCR4 site 1, nd. DYNC1H1 site 1. Off-target sites bearing up to two mismatches with the 16-nt spacer were included in the analysis. FIG. 15B shows mismatch tolerance at individual positions plotted as ratios of mismatches detected by GUIDE-seq and those identified by Cas-OFFinder. Similar analyses for wildtype OgeuIscB / coRNA are provided in FIGS. 6A-6B.

[0067] FIG. 16 shows sequence logos representing putative TAMs at off-target sites captured by GUIDE-seq. Off-target sites bearing up to two mismatches with the 16-nt spacer were included in the analysis. Similar analyses for wildtype OgeuIscB / coRNA are provided in FIG. 6C

[0068] FIG. 17 shows multiple sequence alignment of OgeuIscB and 98 orthologs. Candidate for mutagenesis are highlighted. Selected sequences are shown in FIG. 1. NCBI accessions are provided in FIG. 28. The alignment was conducted using Clustal Omega with default settings (https: / / ebi.ac.uk / Tools / msa / clustalo / ).

[0069] FIGS. 18A-18C. Engineering OgeuIscB for increased genome-editing efficiency. FIGS. 18A-18B show fold changes of indel levels at VEGFA site 1 generated by wildtype OgeuIscB and OgeuIscB variants bearing single (FIG. 18A) and multiple mutations (FIG. 18B). FIG. 18C shows fold changes of indel levels at EMX1 site 1 by wildtype and selected OgeuIscB variants. The specific mutations carried by each OgeuIscB variant are listed in FIG. 29. Indel frequencies were averaged from three independent replicates from HEK293T editing experiments, 48 hours post-transfection (mean ± s.d.; n = 3). P values were determined by two- tailed Student’s t-tests. * P < 0.05; ** P < 0.01; *** P < 0.001; **** p < 0.0001. wt_nt: wildtype OgeuIscB programmed with a non-targeting coRNA. Raw indel frequencies are plotted in FIGS. ID, 2A, and 2B

[0070] FIGS. 19A-19B. Editing patterns generated by wildtype OgeuIscB and representative OgeuIscB variants. FIG. 19A shows frequencies of insertions, deletions, and substitutions observed near the target site in wildtype OgeuIscB-, OgeuIscB-v5.1-, and enOgeuIscB-edited cells. FIG. 19B shows mapped raw sequencing reads obtained from wildtype OgeuIscB-, OgeuIscB -v5.1-, and enOgeuIscB-edited cells. The top 15 sequence variants with the highest read counts are shown.

[0071] FIGS. 20A-20B. The HA tag negatively impacted the editing activity of OgeuIscB / coRNA. FIGS. 20A-20B show indel frequencies generated by HA (net charge: -6), CBP (+8), TAT (+8), and Antp (+7) tagged wildtype OgeuIscB and enOgeuIscB paired with the wildtype coRNA, coRNA-v2, and coRNA-vl3 at VEGFA_site 2 (FIG. 20A) and EMXl_site 2 (FIG. 20B) All experiments were carried out in HEK293T cells (mean ± s.d.; n = 3 independent experiments). Cells were harvested 72 hours post-transfection.

[0072] FIG. 21 shows off-target editing loci for VEGFA site 1-targeting OgeuIscB / coRNA, enOgeuIscB / coRNA-v2, and enOgeuIscB / coRNA-vl3 reported by GUIDEseq in HEK293T cells.

[0073] FIG. 22 shows off-target editing loci for VEGFA_site 2-targeting OgeuIscB / coRNA, enOgeuIscB / coRNA-v2, and enOgeuIscB / coRNA-vl3 reported by GUIDEseq in HEK293T cells.

[0074] FIG. 23 shows off-target editing loci for CXCR4_site 1-targeting OgeuIscB / coRNA, enOgeuIscB / coRNA-v2, and enOgeuIscB / coRNA-vl3 reported by GUIDEseq in HEK293T cells.

[0075] FIG. 24 shows off-target editing loci for DYNCIHl site 1 -targeting OgeuIscB / coRNA, enOgeuIscB / coRNA-v2, and enOgeu!scB / coRNA-vl3 reported by GUIDEseq in HEK293T cells.

[0076] FIG. 25 shows sequence logos for off-target sites captured by GUIDE-seq. Sequence logos represent off-target sites bearing up to seven mismatches with the 22-nt bait, consisting of a 16-nt protospacer and a 6-nt degenerate NWRRNA TAM.

[0077] FIGS. 26A-26C. Mismatch tolerance and TAM preferences of OgeuIscB / coRNA, enOgeuIscB / coRNA-v2, and enOgeu!scB / coRNA-vl3 analyzed using off-target sites weight by GUIDE-seq read counts. FIG. 26A shows sequence logos representing off-target sites identified in silico by Cas-OFFinder and captured experimentally by GUIDE-seq for OgeuIscB / coRNA, enOgeuIscB / coRNA-v2, and enOgeuIscB / coRNA-vl3 targeting VEGFA site 1, VEGFA site 2, CXCR4_site 1, and DYNCIHl site 1. FIG. 26B shows mismatch tolerance at individual positions plotted as ratios of mismatches detected by GUIDE- seq and those identified by Cas-OFFinder. FIG. 26C shows sequence logos representing putative TAMs at off-target sites identified in silico by Cas-OFFinder and captured experimentally by GUIDE-seq. For all analyses shown in this figure, off-target sites bearing up to two mismatches with the 16-nt spacer were considered. Site representation is weight by GUIDE-seq read counts.

[0078] FIG. 27 shows a projection of mutations in enlscB and enOgeuIscB onto the cryo- EM structure of the OgeuIscB / coRNA / DNA complex. PDB entry: 7UTN1. Mutations unique to enlscB denoted by light spheres (i.e., S386, S456, E84); mutations unique to enOgeuIscB denoted by dark spheres (i.e., L393, M102, F137, V159, Y327, and Q324); mutation shared by both denoted by H368 sphere. The dashed line delineates a plausible path for the non-target strand to enter the RuvC active site upon locking of the R-loop by the HNH endonuclease domain. The structure adopts the same orientation as in FIG. IE.

[0079] FIG. 28 shows NCBI accession codes of putative IscB proteins used for multiple sequence alignments.

[0080] FIG. 29 shows mutations in OgeuIscB variants.

[0081] FIG. 30 shows sequences of engineered coRNAs.

[0082] FIG. 31 shows target genomic sites and spacer sequences.

[0083] FIG. 32 shows numbers of off-target sited identified in silico by Cas-OFFinder and captured experimentally by GUIDE-seq with up to 2 mismatches in the protospacer.

[0084] FIG. 33 shows DNA sequences of NLS, linker, and protein tag peptides.

[0085] FIG. 34 shows primers for targeted deep sequencing and RT-PCR.

[0086] FIGS. 35A-35B show indel frequencies generated by HA tag-free enOgeu!scB / coRNA-v2 and enOgeuIscB / coRNA-vl3, delivered via a single plasmid, at seven target sites in A549 (FIG. 35A) and HeLa cells (FIG. 35B). For each target site, left bar: coRNA-v2; right bar: coRNA-vl3 (mean ± s.d., n = 3). Cell were harvested 72 hours posttransfection.

[0087] FIG. 36 shows indel frequencies generated by HA tag-bearing and HA tag-free wildtype OgeuIscB, OgeuIscB_v5.1, or enOgeuIscB paired with wildtype coRNA, coRNA- v2, and coRNA-vl3 at eight target sites. For each condition, left bar: coRNA, middle bar: coRNA- v2, right bar: coRNA-vl3.

[0088] FIG. 37 shows off-target editing loci for VEGFA site 1-, VEGFA site 2-, CXCR4_site 1-, and DYNCIHl site 1 -targeting OgeuIscB / coRNA reported by GUIDE-seq. Uncropped GUIDE-seq results for OgeuIscB / coRNA, enOgeuIscB / coRNA_v2, and enOgeuIscB / coRNA_vl3 targeting VEGFA_site 1, VEGFA_site 2, CXCR4_site 1, and DYNCIHl site 1 are provided in FIGS. 21-24. Mismatch positions are highlighted. Numbers of unique integration events detected by GUIDE-seq are provided to the right of the corresponding sequences. All GUIDE-seq experiments were carried out in HEK293T cells.

[0089] FIG. 38 shows the time course of target DNA cleavage by OgeuIscB / coRNA and enOgeuIscB / coRNA.

[0090] FIG. 39. Binding affinity between OgeuIscB / coRNA and target DNA measured by EMSA (Electrophoretic Mobility Shift Assay). FIG. 39 shows electrophoretic mobility of target DNA in the presence of different concentrations of OgeuIscB / coRNA or enOgeuIscB / coRNA.

[0091] FIGS. 40A-40B. enOgeuIscB-Based Adenine Base Editing. FIG. 40A shows indel frequencies generated by TadA8e-fused enOgeuIscB / coRNA_v2 and enOgeuIscB / coRNA_vl3 at VEGFA site 1 in HEK293T cells (mean ± s.d., n = 3). Cell were harvested 72 hours posttransfection. FIG. 40B shows A-to-G editing generated by TadA8e-fused enOgeuIscB / coRNA_v2 and enOgeuIscB / coRNA_vl3 at VEGFA site 1 in HEK293T cells (mean ± s.d., n = 3). Cell were harvested 72 hours post-transfection.

[0092] FIG. 41 shows shows indel activity of OgeuIscB variants in HEK293T.

[0093] FIGS. 42A-42C. Engineering OgeuIscB for genome editing in human cells. FIG. 42A shows a table of mutants and their respective mutations. FIG. 42B shows indel frequency generated by each mutant as measured by next-generation sequencing. Positive control: pCMV-IscB-8mut at VEGFA site 1. FIG. 42C shows indel frequency generated by eachmutant as measured by next-generation sequencing, lambda 1 : Lambda N peptide / RNA interaction module repeat 1; lambda 2: Lambda N peptide / RNA interaction module repeat 2.

[0094] FIGS. 43A-43B. FIG. 43A shows T7E1 assay results for mutants from FIG. 42A. FIG. 43B shows next-generation sequencing (NGS) results for mutants from FIG. 42A.

[0095] FIG. 44 shows indel frequency (%) for various mutants. Positive control: pCMV- IscB-8mut at VEGFA site 1; Combinel : D96R+E84R+Y100H+K156R; Combine2: S430R+K481R; Combine3: revert L393K back to L393, introduce K392R+T406R;Combined: L351TDAT355KVSSPT361GS363P; Combine5: change K179VQKI183 to KMQKF; Combined: LVHT274DKEW.LVHKQQAW; lambda 1 : Lambda N peptide / RNA interaction module repeat 1; lambda 2: Lambda N peptide / RNA interaction module repeat 2.

[0096] FIG. 45 shows a gel of a T7E1 assay for testing editing efficiency. 1 : pCMV-IscB- 8mut at VEGFA site 1; 2: L351TDAT355KVSSPT361GS363P; 3:D96R+E84R+Y100H+K156R; 4: S430R+K481R; 5: revert L393K back to L393, introduce K392R+T406R; 6: change K179VQKI183 to KMQKF; 7: LVHT274DKEW.LVHKQQAW; 8: Lambda N peptide / RNA interaction module repeat 1; 9: Lambda N peptide / RNA interaction module repeat 2; 10: Lambda N peptide / RNA interaction module repeat 3; 11 : positive control (VEGFA-sitel 17% cleavage).DETAILED DESCRIPTION OF THE INVENTIONI. Proteinaceous Compositions

[0097] As used herein, a “protein” “peptide” or “polypeptide” refers to a molecule comprising at least five amino acid residues. As used herein, the term “wild-type” refers to the endogenous version of a molecule that occurs naturally in an organism. In some aspects, wildtype versions of a protein or polypeptide are employed, however, in many aspects of the disclosure, a modified protein or polypeptide is employed to generate an immune response. The terms described above may be used interchangeably. A “modified protein” or “modified polypeptide” or a “variant” refers to a protein or polypeptide whose chemical structure, particularly its amino acid sequence, is altered with respect to the wild-type protein or polypeptide. In some aspects, a modified / variant protein or polypeptide has at least one modified activity or function (recognizing that proteins or polypeptides may have multiple activities or functions). It is specifically contemplated that a modified / variant protein or polypeptide may be altered with respect to one activity or function yet retain a wild-type activity or function in other respects, such as immunogenicity.

[0098] Where a protein is specifically mentioned herein, it is in general a reference to a native (wild-type) or recombinant (modified) protein or, optionally, a protein in which any signal sequence has been removed. The protein may be isolated directly from the organism of which it is native, produced by recombinant DNA / exogenous expression methods, or produced by solid-phase peptide synthesis (SPPS) or other in vitro methods. In particular aspects, there are isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences that encode a polypeptide (e.g., an engineered endonuclease or fragment thereof). The term “recombinant” may be used in conjunction with a polypeptide or the name of a specific polypeptide, and this generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or that is a replication product of such a molecule.

[0099] In certain aspects the size of a protein or polypeptide (wild-type or modified) may comprise, but is not limited to, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72,73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97,98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 1000, 1200, 1400, 1600, 1800, or 2000 amino acid residues or nucleic acid residues or greater, and any range derivable therein, or derivative of a corresponding amino sequence described or referenced herein. It is contemplated that polypeptides may be mutated by truncation, rendering them shorter than their corresponding wild-type form, also, they might be altered by fusing or conjugating a heterologous protein or polypeptide sequence with a particular function (e.g., for targeting or localization, for enhanced immunogenicity, for purification purposes, etc.).

[0100] The polypeptides, proteins, or polynucleotides encoding such polypeptides or proteins of the disclosure may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 (or any derivable range therein) or more variant amino acids or nucleic acid substitutions or be at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% (or any derivable range therein) similar, identical, or homologous to at least, or at most 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123,124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142,143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161,162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180,181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199,200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200 or more contiguous amino acids, or any range derivable therein, of a sequence disclosed herein. In specific aspects, the peptide or polypeptide is or is based on a human sequence. In certain aspects, the peptide or polypeptide is not naturally occurring and / or is in a combination of peptides or polypeptides.

[0101] The polypeptides of the disclosure may include at least, at most, or exactly 1, 2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55,56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123,124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142,143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161,162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180,181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200 substitutions (or any range derivable therein).

[0102] In some aspects, the polypeptide comprises one or more substitutions at one or more amino acid positions selected from amino acid 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66,67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91,92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131,132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150,151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169,170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188,189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, and / or 1200 of any of the sequences disclosed herein, wherein each substitution is independently chosen from an amino acid selected from alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine; and wherein the polypeptide is or is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% (or any derivable range therein) sequence identity to one sequence disclosed herein.

[0103] In some aspects, the protein or polypeptide may comprise amino acids 1 to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81,82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104,105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123,124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142,143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161,162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180,181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199,200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200 (or any derivable range therein) of any sequence disclosed herein.

[0104] In some aspects, the protein or polypeptide may comprise amino acids 1 to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81,82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104,105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123,124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142,143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161,162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180,181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199,200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200 (or any derivable range therein) of a sequence disclosed herein and have or have at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% (or any derivable range therein) sequence identity to one sequence disclosed herein.

[0105] In some aspects, the protein may comprise, comprise at least, or comprise at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122,123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141,142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160,161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179,180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198,199, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200 (or any derivable range therein) contiguous amino acids or nucleic acids of a sequence disclosed herein..

[0106] In some aspects, the polypeptide, protein, or nucleic acid may comprise at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118,119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137,138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156,157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175,176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194,195, 196, 197, 198, 199, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200 (or any derivable range therein) contiguous amino acids of a sequence disclosed herein that are at least, at most, or exactly 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% (or any derivable range therein) similar, identical, or homologous to one of a sequence disclosed herein.

[0107] In some aspects there is a nucleic acid molecule or polypeptide starting at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200 of any sequence disclosed herein and comprising at least, at most, or exactly 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111,112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130,131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149,150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168,169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187,188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 300, 400, 500, 600, 700, 800,900, 1000, 1100, 1200 (or any derivable range therein) contiguous amino acids or nucleotides of any sequence disclosed herein.

[0108] The nucleotide as well as the protein, polypeptide, and peptide sequences for various genes have been previously disclosed, and may be found in the recognized computerized databases. Two commonly used databases are the National Center for Biotechnology Information’s Genbank and GenPept databases (on the World Wide Web at ncbi.nlm.nih.gov / ) and The Universal Protein Resource (UniProt; on the World Wide Web at uniprot.org). The coding regions for these genes may be amplified and / or expressed using the techniques disclosed herein or as would be known to those of ordinary skill in the art.

[0109] It is contemplated that in compositions of the disclosure, there is between about 0.001 mg and about 10 mg of total polypeptide, peptide, and / or protein per ml. The concentration of protein in a composition can be about, at least about or at most about 0.001, 0.010, 0.050, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0 mg / ml or more (or any range derivable therein).

[0110] The following is a discussion of changing the amino acid subunits of a protein to create an equivalent, or even improved, second-generation variant polypeptide or peptide. For example, certain amino acids may be substituted for other amino acids in a protein or polypeptide sequence with or without appreciable loss of binding capacity or enzymatic activity. Since it is the interactive capacity and nature of a protein that defines that protein’s functional activity, certain amino acid substitutions can be made in a protein sequence and in its corresponding DNA coding sequence, and nevertheless produce a protein with similar or desirable properties. It is thus contemplated by the inventors that various changes may be made in the DNA sequences of genes which encode proteins without appreciable loss of their biological utility or activity.

[0111] The term “functionally equivalent codon” is used herein to refer to codons that encode the same amino acid, such as the six different codons for arginine. Also considered are “neutral substitutions” or “neutral mutations” which refers to a change in the codon or codons that encode biologically equivalent amino acids.

[0112] Amino acid sequence variants of the disclosure can be substitutional, insertional, or deletion variants. A variation in a polypeptide of the disclosure may affect 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more non-contiguous or contiguous amino acids of the protein or polypeptide, as compared to wild-type (or any range derivable therein). A variant can comprise an amino acid sequence that is at least 50%, 60%, 70%, 80%, or 90%, including all values and ranges there between, identical to any sequence provided or referenced herein. A variant can include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more substitute amino acids.

[0113] It also will be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids, or 5' or 3' sequences, respectively, and yet still be essentially identical as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region.

[0114] Deletion variants typically lack one or more residues of the native or wild type protein. Individual residues can be deleted or a number of contiguous amino acids can bedeleted. A stop codon may be introduced (by substitution or insertion) into an encoding nucleic acid sequence to generate a truncated protein.

[0115] Insertional mutants typically involve the addition of amino acid residues at a nonterminal point in the polypeptide. This may include the insertion of one or more amino acid residues. Terminal additions may also be generated and can include fusion proteins which are multimers or concatemers of one or more peptides or polypeptides described or referenced herein.

[0116] Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein or polypeptide, and may be designed to modulate one or more properties of the polypeptide, with or without the loss of other functions or properties. Substitutions may be conservative, that is, one amino acid is replaced with one of similar chemical properties. “Conservative amino acid substitutions” may involve exchange of a member of one amino acid class with another member of the same class. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine. Conservative amino acid substitutions may encompass non-naturally occurring amino acid residues, which are typically incorporated by chemical peptide synthesis rather than by synthesis in biological systems. These include peptidomimetics or other reversed or inverted forms of amino acid moieties.

[0117] Alternatively, substitutions may be “non-conservative”, such that a function or activity of the polypeptide is affected. Non-conservative changes typically involve substituting an amino acid residue with one that is chemically dissimilar, such as a polar or charged amino acid for a nonpolar or uncharged amino acid, and vice versa. Non-conservative substitutions may involve the exchange of a member of one of the amino acid classes for a member from another class.

[0118] One skilled in the art can determine suitable variants of polypeptides as set forth herein using well-known techniques. One skilled in the art may identify suitable areas of the molecule that may be changed without destroying activity by targeting regions not believed tobe important for activity. The skilled artisan will also be able to identify amino acid residues and portions of the molecules that are conserved among similar proteins or polypeptides. In further aspects, areas that may be important for biological activity or for structure may be subject to conservative amino acid substitutions without significantly altering the biological activity or without adversely affecting the protein or polypeptide structure.

[0119] In making such changes, the hydropathy index of amino acids may be considered. The hydropathy profile of a protein is calculated by assigning each amino acid a numerical value (“hydropathy index”) and then repetitively averaging these values along the peptide chain. Each amino acid has been assigned a value based on its hydrophobicity and charge characteristics. They are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine / cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (—0.4); threonine (—0.7); serine (—0.8); tryptophan (-0.9); tyrosine (-1.3); proline (1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5). The importance of the hydropathy amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte et al., J. Mol. Biol. 157: 105-131 (1982)). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein or polypeptide, which in turn defines the interaction of the protein or polypeptide with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and others. It is also known that certain amino acids may be substituted for other amino acids having a similar hydropathy index or score, and still retain a similar biological activity. In making changes based upon the hydropathy index, in certain aspects, the substitution of amino acids whose hydropathy indices are within ±2 is included. In some aspects of the invention, those that are within ±1 are included, and in other aspects of the invention, those within ±0.5 are included.

[0120] It also is understood in the art that the substitution of like amino acids can be effectively made based on hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. In certain aspects, the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity and antigen binding, that is, as a biological property of the protein. The following hydrophilicity values have been assigned to these amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0+1); glutamate (+3.0+1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0);threonine (—0.4); proline (-0.5±l); alanine (—0.5); histidine (—0.5); cysteine (—1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4). In making changes based upon similar hydrophilicity values, in certain aspects, the substitution of amino acids whose hydrophilicity values are within ±2 are included, in other aspects, those which are within ±1 are included, and in still other aspects, those within ±0.5 are included. In some instances, one may also identify epitopes from primary amino acid sequences based on hydrophilicity. These regions are also referred to as “epitopic core regions.” It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still produce a biologically equivalent and immunologically equivalent protein.

[0121] Additionally, one skilled in the art can review structure-function studies identifying residues in similar polypeptides or proteins that are important for activity or structure. In view of such a comparison, one can predict the importance of amino acid residues in a protein that correspond to amino acid residues important for activity or structure in similar proteins. One skilled in the art may opt for chemically similar amino acid substitutions for such predicted important amino acid residues.

[0122] One skilled in the art can also analyze the three-dimensional structure and amino acid sequence in relation to that structure in similar proteins or polypeptides. In view of such information, one skilled in the art may predict the alignment of amino acid residues of an protein with respect to its three-dimensional structure. One skilled in the art may choose not to make changes to amino acid residues predicted to be on the surface of the protein, since such residues may be involved in important interactions with other molecules. Moreover, one skilled in the art may generate test variants containing a single amino acid substitution at each desired amino acid residue. These variants can then be screened using standard assays for binding and / or activity, thus yielding information gathered from such routine experiments, which may allow one skilled in the art to determine the amino acid positions where further substitutions should be avoided either alone or in combination with other mutations. Various tools available to determine secondary structure can be found on the world wide web at expasy.org / proteomics / protein structure.

[0123] In some aspects of the invention, amino acid substitutions are made that: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter ligand or antigen binding affinities, and / or (5) confer or modify other physicochemical or functional properties on such polypeptides. For example,single or multiple amino acid substitutions (in certain aspects, conservative amino acid substitutions) may be made in the naturally occurring sequence. In such aspects, conservative amino acid substitutions can be used that do not substantially change the structural characteristics of the protein or polypeptide (e.g., one or more replacement amino acids that do not disrupt the secondary structure that characterizes the native protein).II. Nucleic Acids

[0124] In certain aspects, nucleic acid sequences can exist in a variety of instances such as: isolated segments and recombinant vectors of incorporated sequences or recombinant polynucleotides encoding a protein (including any polypeptide disclosed herein), or a fragment, derivative, mutein, or variant thereof, polynucleotides sufficient for use as hybridization probes, PCR primers or sequencing primers for identifying, analyzing, mutating or amplifying a polynucleotide encoding a polypeptide, anti-sense nucleic acids for inhibiting expression of a polynucleotide, and complementary sequences of the foregoing described herein. Nucleic acids that encode one or multiple domains of the polypeptides disclosed herein are provided herein are also provided. Nucleic acids encoding fusion proteins that include these peptides are also provided. The nucleic acids can be single-stranded or double-stranded and can comprise RNA and / or DNA nucleotides and artificial variants thereof (e.g., peptide nucleic acids).

[0125] The term “polynucleotide” refers to a nucleic acid molecule that either is recombinant or has been isolated from total genomic nucleic acid. Included within the term “polynucleotide” are oligonucleotides (nucleic acids 100 residues or less in length), recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like. Polynucleotides include, in certain aspects, regulatory sequences, isolated substantially away from their naturally occurring genes or protein encoding sequences. Polynucleotides may be single- stranded (coding or antisense) or double- stranded, and may be RNA, DNA (genomic, cDNA or synthetic), analogs thereof, or a combination thereof. Additional coding or noncoding sequences may, but need not, be present within a polynucleotide.

[0126] In this respect, the term “gene,” “polynucleotide,” or “nucleic acid” is used to refer to a nucleic acid that encodes a protein, polypeptide, or peptide (including any sequences required for proper transcription, post-translational modification, or localization). As will be understood by those in the art, this term encompasses genomic sequences, expression cassettes, cDNA sequences, and smaller engineered nucleic acid segments that express, or may be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins, and mutants. Anucleic acid encoding all or part of a polypeptide may contain a contiguous nucleic acid sequence encoding all or a portion of such a polypeptide. It also is contemplated that a particular polypeptide may be encoded by nucleic acids containing variations having slightly different nucleic acid sequences but, nonetheless, encode the same or substantially similar protein.

[0127] In certain aspects, there are polynucleotide variants having substantial identity to the sequences disclosed herein; those comprising at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity, including all values and ranges there between, compared to a polynucleotide sequence provided herein using the methods described herein (e.g., BLAST analysis using standard parameters). In certain aspects, the isolated polynucleotide will comprise a nucleotide sequence encoding a polypeptide that has at least 90%, preferably 95% and above, identity to an amino acid sequence described herein, over the entire length of the sequence; or a nucleotide sequence complementary to said isolated polynucleotide.

[0128] The nucleic acid segments, regardless of the length of the coding sequence itself, may be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. The nucleic acids can be any length. They can be, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000 or more nucleotides in length, and / or can comprise one or more additional sequences, for example, regulatory sequences, and / or be a part of a larger nucleic acid, for example, a vector. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant nucleic acid protocol. In some cases, a nucleic acid sequence may encode a polypeptide sequence with additional heterologous coding sequences, for example to allow for purification of the polypeptide, transport, secretion, post-translational modification, or for therapeutic benefits such as targeting or efficacy. As discussed above, a tag or other heterologous polypeptide may be added to the modified polypeptide-encoding sequence, wherein “heterologous” refers to a polypeptide that is not the same as the modified polypeptide.A. Hybridization

[0129] The nucleic acids that hybridize to other nucleic acids under particular hybridization conditions. Methods for hybridizing nucleic acids are well known in the art. See, e.g., Current Protocols in Molecular Biology, John Wiley and Sons, N.Y. (1989), 6.3.1-6.3.6. As defined herein, a moderately stringent hybridization condition uses a prewashing solution containing 5* sodium chloride / sodium citrate (SSC), 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization buffer of about 50% formamide, 6* SSC, and a hybridization temperature of 55° C. (or other similar hybridization solutions, such as one containing about 50% formamide, with a hybridization temperature of 42° C), and washing conditions of 60° C. in 0.5* SSC, 0.1% SDS. A stringent hybridization condition hybridizes in 6* SSC at 45° C., followed by one or more washes in 0.1 * SSC, 0.2% SDS at 68° C. Furthermore, one of skill in the art can manipulate the hybridization and / or washing conditions to increase or decrease the stringency of hybridization such that nucleic acids comprising nucleotide sequence that are at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to each other typically remain hybridized to each other.

[0130] The parameters affecting the choice of hybridization conditions and guidance for devising suitable conditions are set forth by, for example, Sambrook, Fritsch, and Maniatis (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., chapters 9 and 11 (1989); Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley and Sons, Inc., sections 2.10 and 6.3-6.4 (1995), both of which are herein incorporated by reference in their entirety for all purposes) and can be readily determined by those having ordinary skill in the art based on, for example, the length and / or base composition of the DNA.B. Mutation

[0131] Changes can be introduced by mutation into a nucleic acid, thereby leading to changes in the amino acid sequence of a polypeptide that it encodes. Mutations can be introduced using any technique known in the art. In one aspect, one or more particular amino acid residues are changed using, for example, a site-directed mutagenesis protocol. In another aspect, one or more randomly selected residues are changed using, for example, a random mutagenesis protocol. However it is made, a mutant polypeptide can be expressed and screened for a desired property.

[0132] Mutations can be introduced into a nucleic acid without significantly altering the biological activity of a polypeptide that it encodes. For example, one can make nucleotide substitutions leading to amino acid substitutions at non-essential amino acid residues. Alternatively, one or more mutations can be introduced into a nucleic acid that selectively changes the biological activity of a polypeptide that it encodes. See, eg., Romain Studer et al., Biochem. J. 449:581-594 (2013). For example, the mutation can quantitatively or qualitatively change the biological activity. Examples of quantitative changes include increasing, reducing or eliminating the activity.C. Probes

[0133] In another aspect, nucleic acid molecules are suitable for use as primers or hybridization probes for the detection of nucleic acid sequences. A nucleic acid molecule can comprise only a portion of a nucleic acid sequence encoding a full-length polypeptide, for example, a fragment that can be used as a probe or primer or a fragment encoding an active portion of a given polypeptide.

[0134] In another aspect, the nucleic acid molecules may be used as probes or PCR primers for specific protein sequences. For instance, a nucleic acid molecule probe may be used in diagnostic methods or a nucleic acid molecule PCR primer may be used to amplify regions of DNA that could be used, inter alia, to isolate nucleic acid sequences for use in producing proteins. See, eg., Gaily Kivi et al., BMC Biotechnol. 16:2 (2016). In a preferred aspect, the nucleic acid molecules are oligonucleotides.

[0135] Probes based on the desired sequence of a nucleic acid can be used to detect the nucleic acid or similar nucleic acids, for example, transcripts encoding a polypeptide of interest. The probe can comprise a label group, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Such probes can be used to identify a cell that expresses the polypeptide.III. Polypeptide Expression

[0136] In some aspects, there are nucleic acid molecule encoding polypeptides or peptides of the disclosure. These may be generated by methods known in the art, e.g., expressed in any suitable recombinant expression system and allowed to assemble to form protein compositions.A. Expression

[0137] The nucleic acid molecules may be used to express large quantities of polypeptides.B. Vectors

[0138] In some aspects, contemplated are expression vectors comprising a nucleic acid molecule encoding a polypeptide of the desired sequence or a portion thereof (e.g., a fragment containing one or more polypeptide or protein domains). In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well.

[0139] To express the polypeptides or peptides of the disclosure, DNAs encoding the polypeptides or peptides are inserted into expression vectors such that the gene area is operatively linked to transcriptional and translational control sequences. Typically, expression vectors used in any of the host cells contain sequences for plasmid or virus maintenance and for cloning and expression of exogenous nucleotide sequences. Such sequences, collectively referred to as “flanking sequences” typically include one or more of the following operatively linked nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcriptional termination sequence, a complete intron sequence containing a donor and acceptor splice site, a sequence encoding a leader sequence for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a polylinker region for inserting the nucleic acid encoding the polypeptide to be expressed, and a selectable marker element. Such sequences and methods of using the same are well known in the art.C. Expression Systems

[0140] Numerous expression systems exist that comprise at least a part or all of the expression vectors discussed above. Prokaryote- and / or eukaryote-based systems can be employed for use with an aspect to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides. Commercially and widely available systems include in but are not limited to bacterial, mammalian, yeast, and insect cell systems. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. Those skilled in the art are able to express a vector to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide using an appropriate expression system.IV. Methods of Gene Transfer

[0141] Suitable methods for nucleic acid delivery to effect expression of compositions are anticipated to include virtually any method by which a nucleic acid (e.g., DNA, including viraland nonviral vectors) can be introduced into a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by injection (U.S. Patents 5,994,624,5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including micro injection (Harland and Weintraub, 1985; U.S. Patent 5,789,215, incorporated herein by reference); by electroporation (U.S. Patent No. 5,384,253, incorporated herein by reference); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); by using DEAE dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al., 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991); by microprojectile bombardment (PCT Application Nos. WO 94 / 09699 and 95 / 06128; U.S. Patents 5,610,042; 5,322,783, 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Patents 5,302,523 and 5,464,765, each incorporated herein by reference); by Agrobacterium mediated transformation (U.S. Patents 5,591,616 and 5,563,055, each incorporated herein by reference); or by PEG mediated transformation of protoplasts (Omirulleh et al., 1993; U.S. Patents 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation / inhibition mediated DNA uptake (Potrykus et al., 1985). Other methods include viral transduction, such as gene transfer by lentiviral or retroviral transduction.A. Host Cells

[0142] In another aspect, contemplated are the use of host cells into which a recombinant expression vector has been introduced. Proteins can be expressed in a variety of cell types. An expression construct encoding an protein can be transfected into cells according to a variety of methods known in the art. Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. Some vectors may employ control sequences that allow it to be replicated and / or expressed in both prokaryotic and eukaryotic cells. In certain aspects, the protein expression construct can be placed under control of a promoter that is linked to a disease-associated RNA. One of skill in the art would understand the conditions under which to incubate host cells to maintain them and to permit replication of a vector. Also understood and known are techniques and conditions that would allow large- scale production of vectors, as well as production of the nucleic acids encoded by vectors and their cognate polypeptides, proteins, or peptides.

[0143] For stable transfection of mammalian cells, it is known, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a selectable marker (e.g., for resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die), among other methods known in the arts.B. Isolation

[0144] The nucleic acid molecule encoding the polypeptides may be obtained from any source that produces proteins. Methods of isolating mRNA encoding an protein are well known in the art. See e.g., Sambrook et al., supra. The sequences of human heavy and light chain constant region genes are also known in the art. See, e.g., Kabat et al., 1991, supra.V. Kits

[0145] The present disclosure additionally provides kits for modifying and / or detecting modified nucleotides in a target DNA. Each kit may also include additional components that are useful for amplifying the nucleic acid, or sequencing the nucleic acid, or other applications of the present disclosure as described herein. The kit may optionally provide additional components that are useful in the procedure. These optional components include buffers, capture reagents, developing reagents, labels, reacting surfaces, means for detection, control samples, instructions, and interpretive information. The kit may also include reagents for DNA isolation and / or purification.VI. Sequences

[0146] The present disclosure provides polypeptides capable of modifying nucleotides. Disclosed are engineered polypeptides containing one or more mutations, which are relative to a wild-type IscB protein. The wild-type IscB protein includes an IscB protein described in Altae-Tran, et al. (Science. 2021 Oct; 374(6563): 57-65). The polypeptide sequences of the described polypeptides capable of modifying nucleotides can include any of the following:

[0147] The present disclosure also provides RNAs, which, in some aspects, can be used with engineered endonucleases. The RNAs may have one or more changes relative to a wildtype coRNA. The wild-type coRNA includes SEQ ID NO: 70.AAAAGAGUGAACGAGAGGCUCUUCCAACUUUAUGGUUGCGACCGUAGGUUGA AAGAGCACAGGCUGAGACAUUCGUAAGGCCGAAAGACCGGACGCACCCUGGGA UUUCCCCAGUCCCCGGAACUGCAUAGCGGAUGCCAGUUGAUGGAGCAAUCUAU CAGAUAAGCCAGGGGGAACAAUCACCUCUCUGUAUCAGAGAGAGUUUUACAA AAGGAGGAACGGUUUUUU (SEQ ID NO: 70)

[0148] The engineered coRNAs include:VII. Examples

[0149] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.Example 1 - Assessing and engineering the IscB-coRNA system for programmed genome editing

[0150] The inventors engineered the OgeuIscB / coRNA system for programmed genome editing by developing enhanced OgeuIscB variants showing boosted DNA cleavage activity both in vitro and in human cells. The enhanced activity of engineered OgeuIscB / coRNA further translated to more robust base editing, an advanced genome-editing technology that directly alters the nucleobase identity without requiring a DSB (Komor et al., 2016; Nishida et al., 2016; Gaudelli et al., 2017). The inventors assessed the fidelity of the OgeuIscB / coRNA system using genome-wide, unbiased identification of DSBs enabled by sequencing (GUIDE-seq) (Tsai et al., 2015). The inventors detected off-target cleavage in the human genome by the wildtype complex and found that its moderate fidelity was inherited by the engineered OgeuIscB / coRNA systems. Collectively, the inventors demonstrated, at least, that transposon-associated RNA- guided endonuclease IscB, despite being much smaller and more evolutionarily ancient than Cas9, can be engineered into a robust genome-editing agent.1. Rational engineering of OgeuIscB

[0151] An RNA-guided nuclease may function poorly in eukaryotic cells for many reasons. The nuclease may be a poor DNA binder or cleaver inherently; have trouble accessing target DNA wrapped inside nucleosomes; or have problems with expression or RNP assembly. The first line of investigation by the inventors was using an electrophoretic mobility shift assay (EMSA) that revealed that OgeuIscB / coRNA binds DNA very poorly at concentrations lowerthan 125 nM. This stands in sharp contrast to the 10-30 nM dissociation constant (Kd) reported for RNA-guided Cas nucleases (Stenberg et al., 2014; Xiao et al., 2017; Hu et al., 2022).

[0152] The inventors reasoned that introduction of positively charged residues such as lysine (K) and arginine (R) may increase the affinity of OgeuIscB to nucleic acids, which could in turn improve its DNA cleavage activity. Similar strategies have successfully increased the activity and targeting ranges of SpCas911 (Walton et al., 2020), CjCas9 (Nakagawa et al.,2022), AsCasl2a (Kleinstiver et al., 2019), BhCasl2b (Strecker et al., 2019), Casl2i2 (McGaw et al., 2022), UnCasl2fl (Xu et al., 2021), AsCasl2fl (Wu et al.), OsCasl2fl (Kong et al.,2023), and RhCasl2fl (Kong et al., 2023). The inventors chose target residues based on sequence homology with IscB orthologs (FIGS. 17 and 28), rather than focusing solely on residues near the coRNA and target DNA, as revealed by the cryo-EM structures (Schuler et al., 2022; Kato et al., 2022). Aligned positions that harbor positively charged residues in IscB orthologs, but neutral or negatively charged residues in OgeuIscB, were selected for mutagenesis (FIG. IB) The inventors chose this strategy over a structure-guided approach because the available structures may not have captured all relevant conformational states. This strategy also helps to avoid testing protein variants with major defects in folding or complex formation, as the introduced substitutions are found naturally among IscB orthologs.

[0153] The inventors evaluated 36 variants of OgeuIscB, each bearing a single-point mutation, for insertion / deletion (indel) formation at VEGFA site 1 in human embryonic stem (HEK) 293T cells (FIGS. 1C and 29). Nuclear localization signal (NLS) peptides were appended to both termini of OgeuIscB to facilitate nuclear import. Wildtype OgeuIscB generated 2.0 ± 0.2% (mean ± s.d.) indels at VEGFA site 1 (FIG. ID). This editing level is consistent with previous studies (Altae-Tran et al., 2021; Kato et al., 2022). Among the 36 single-point mutations, nine increased DNA cleavage in comparison to wildtype OgeuIscB; twelve significantly reduced the indel level; and the rest were neutral (FIG. ID). The inventors followed up with eight beneficial single-point mutations, M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, and L393K, which increased the indel frequency by 1.6-fold to 2.6- fold (FIG. 18A).

[0154] Although these eight hotspot mutations were not chosen using a structure-guided approach, their beneficial effects can be rationalized to a good extent based on their locations in the OgeuIscB / coRNA / R-loop structure (PDBs: 8CSZ, 8CTL) (Schuler et al., 2022). For example, M102 resides in the bridge helix (residues 85-122) that contacts the guide region of the coRNA at positions 9 to 16 together with a cluster of arginine residues (Fig. IE) (Schuler et al., 2022; Kato et al., 2022). Removal of a single arginine from the bridge helix abolishedDNA cleavage in DtlsrB (R104A), a nickase homologous to OgeuIscB (Hirano et al., 2022). The inventors reason that M102R further strengthens the bridge helix / coRNA interactions and helps with guide RNA display, which in turn promotes R-loop formation. F137 and V159 are both constituents of the REC linker that connects the bridge helix to RuvC II. F137K and V159K add two positive charges to stabilize the mid-region of the RNA / DNA heteroduplex (Fig. IF). N281 belongs to the HNH endonuclease domain that undergoes conformational changes to lock and stabilize the RNA / DNA heteroduplex; N281R may stabilize the locked R- loop state, which in turn promotes target-strand cleavage by HNH. Q324, Y327, and H368 reside on the surface of the RuvC domain. They are close to the path through which the nontarget strand (NTS) DNA enters the RuvC active site. Q324R, Y327K, and H368R likely promote the recruitment and cleavage of NTS by RuvC. L393K may improve the DNA-binding affinity of OgeuIscB by creating a favorable contact with the backbone of TAM-containing DNA. The inventors noted that structural studies have not captured the pre-R-loop formation state, nor the partial R-loop state, in which these residues may have different modes of DNA contact. Alternatively, some of the identified mutations may promote DNA binding and cleavage through mechanisms beyond supplementing electrostatic interactions.2. Combining beneficial mutations led to enhanced OgeuIscB

[0155] Next, the inventors investigated whether OgeuIscB activity could be further improved by combining beneficial mutations. OgeuIscB variants carrying double mutations were generally more active than their single-mutation counterparts (FIGS. 2A, 18B, and 29), suggesting that the beneficial effects are additive. Indeed, activity continued to build as the inventors combined three, four, five, and eight mutations. The best variant OgeuIscB-v6.1, combining all eight mutations(M102R / F137K / V159K / N281R / Q324R / Y327K / H368R / L393K), boosted the indel level at VEGFA site 1 to 18.6 ± 2.2%, a 9.2-fold increase over the wildtype protein activity. Importantly, the same pattern was recapitulated when the inventors programmed the combinatorial OgeuIscB variants to target EMX1 site 7, albeitto a lesser extent (18.9% ± 0.8% indels with OgeuIscB -v6.1, compared to 6.7% ± 0.3% by wildtype OgeuIscB; FIGS. 2B and 18C). These findings suggested that the activity improvement to OgeuIscB is independent of target sequences. OgeuIscB-v6.1 is referred to as enhanced OgeuIscB, or enOgeuIscB.

[0156] Deep sequencing analysis (Clement et al., 2019) revealed that all OgeuIscB variants caused predominantly small deletions rather than insertions at the target site (FIG. 19), which is consistent with a previous study (Altae-Tran et al., 2021). The indel pattern formed byenOgeuIscB was similar to that by wildtype OgeuIscB (FIG. 2C), indicating that the mutations did not alter the cleavage pattern of the RNA-guided nuclease.

[0157] To investigate whether the engineering efforts improved the DNA binding or cleavage activity of OgeuIscB / coRNA, the inventors purified wildtype and enhanced OgeuIscB in complex with the VEGFA site / -targeting coRNA from E. coli for biochemical analysis. In EMSA experiments, enOgeuIscB / coRNA bound the DNA target at concentrations as low as 31 nM, corresponding to a 4-fold improvement over the wildtype complex (FIG. 2D). A similar 4-fold improvement was recapitulated in the concentration-dependent cleavage assay, where DNA cleavage was apparent in the presence of 31 nM of enOgeuIscB / coRNA, as opposed to 125 nM of the wildtype complex (FIG. 7A). These results suggested the mutations improved the affinity of OgeuIscB for the DNA target. In contrast, little activity difference was found between wildtype and enhanced OgeuIscB in the time-course cleavage assay at a higher RNP concentration (500 nM; FIG. 7B), suggesting that the mutations did not alter the rate-limiting steps in RNA-guided DNA cleavage. Collectively, the inventors concluded that the identified mutations enabled enOgeuIscB to locate the DNA target more efficiently, a feature that may prove particularly beneficial within the complex context of the human genome.3. Structure-guided engineering of coRNA

[0158] Guide RNA engineering has been shown to enhance the genome-editing performance of several Cas nucleases (Xu et al., 2021; Wu et al., 2023; Dang et al., 2015; Moon et al., 2019; Kim et al., 2022). The 222-nt coRNA folds into a tertiary structure significantly more sophisticated than its counterpart in the CRISPR-Cas9 system (FIG. 8A) (Schuler et al., 2022; Kato et al., 2022). It also makes more extensive interactions with its protein partner, OgeuIscB. Given that RNA folding and assembly may represent a unique challenge to IscB / coRNA, the inventors explored ways to engineer the coRNA as an orthogonal strategy to further improve editing efficiency.

[0159] The inventors removed twenty nucleotides 3' to P5 as they do not contribute to the assembly of OgeuIscB / coRNA4, (Kato et al., 2022); P5 was repurposed as a transcription terminator for human pol III by appending six consecutive Us to its 3' end. The inventors further truncated a significant portion of Pl, P4, and P5 helices in coRNA because these distal regions are not contacted by OgeuIscB, hence their removal would be unlikely to disrupt the RNA-guided DNA cleavage (Schuler et al., 2022; Kato et al., 2022). Specifically, the poorly defined distal region of Pl (U31-U45) was replaced with a GAAA tetraloop; the distal region of P4 (G147-U156) was replaced with either a sephadex-binding aptamer D830 (coRNA-vl) or a GAAA tetraloop (coRNA-v2); and the P5 triloop (U191 A192A193) was optimized to a morestable GAAA tetraloop. The OgeuIscB / coRNA structures further define three A»C mismatches in Pl, P2, and J2. Lacking obvious functions in the OgeuIscB / coRNA structure, the inventors consider these mismatches “weak spots” as they may lead to alternative RNA structure formation, especially in the context of truncated coRNAs. Therefore, the inventors introduced three point mutations, C24U, A88G, and C138U, to reinstate perfect Watson-Crick base pairing in Pl, P2, and J2, respectively (FIGS. 3 A, 8B, and 30).

[0160] When directed to VEGFA_site 1, coRNA-vl and coRNA-v2 led to a global increase in indel levels across all tested OgeuIscB variants: wildtype OgeuIscB, OgeuIscB-vl.3, OgeuIscB-v3.3, OgeuIscB-v5.1, and enOgeuIscB (FIGS. 3B and 8C). coRNA-v2 was particularly potent, generating 1.2-fold to 4.3-fold more indels than the wildtype coRNA. These results confirmed that the peripheral regions of Pl and P4, along with extra nucleotides succeeding P5, are dispensable in the OgeuIscB / coRNA complex.

[0161] Encouraged by the orthogonal boost from coRNA engineering, the inventors constructed 14 more coRNA variants to explore additional ways to improve the editing activity (FIG. 3). Protecting the guide region by appending 5'-to-3' exoribonuclease-resistant RNA (xrRNA)(Steckelberg et al., 2018) (coRNA-vl vs. v3 and coRNA-v2 vs. v5) or Csy4 RNA (Haurwitz et al., 2010) (coRNA-v2 vs. v7 and coRNA-v2 vs. v8) to the 5' end of the coRNA did not improve indel formation. Removal of an internal nucleotide flip-out in P5 (A201) lowered the indel levels (coRNA-v4 vs. v5 and coRNA-v6 vs. v7), whereas reintroduction of extra sequences following P5 had no discernible effect (coRNA-v2 vs. v9). P5 interacts with the PLMP domain of OgeuIscB, deletion of which only mildly reduced the DNA cleavage activity of the OgeuIscB / coRNA RNP in vitro (Schuler et al., 2022). However, OgeuIscB-APLMP failed to generate appreciable levels of indels in human cells (FIG. 8D), suggesting that the interactions between P5 and PLMP, albeit dispensable for target DNA cleavage, are likely essential for RNP assembly or stability. Consistently, deletion of the PLMP domain in DtlsrB was shown detrimental to its nickase activity (Hirano et al., 2022). Collectively, both the accessibility of the 5' end and the integrity of P5 in coRNA promote indel formation by OgeuIscB / coRNA in human cells.

[0162] In coRNA-vlO through vl2, the inventors further truncated coRNA-v2 at Pl, P2, and P4. While activity was not affected by removing two more nucleotides from Pl, a 4-nt truncation in P2 or P4 deletion abolished indel formation (FIGS. 3B and 8C). The apical loop of P3 and residues trailing JI form a pseudoknot integral to the coRNA tertiary structure. Disruption of the pseudoknot inactivates OgeuIscB / coRNA (Kato et al., 2022). As a result, the inventors deemed alteration to P3 not an option. Thus, coRNA-v2 represents a minimizedcoRNA sensitive to additional stem-loop truncations. While further coRNA consolidation is conceivable, such effort demands editing of long-range interactions and possible rearrangement of the core structure of the coRNA.

[0163] Lastly, the inventors evaluated the contribution of the three mismatch-correcting mutations (C24U, A88G, and C138U, in Pl, P2, and J2, respectively) by reverting them individually and collectively in coRNA-v2. Reverting A88G in P2 (coRNA-vl4) or all three mutations (coRNA-vl6) markedly reduced the indel levels, whereas reverting C24U in Pl (coRNA-vl3) or C138U in J2 (coRNA-vl5) had minimal impact (FIGS. 3B and 8C). These results suggested that A88G was the main contributor to activity improvement in the truncated coRNA.

[0164] An observation worth noting was that all engineered coRNA variants had lower expression levels than that of the wildtype coRNA except for coRNA-vl3 and coRNA-vl6 (FIG. 8E). However, coRNAs co-expressed with enOgeuIscB consistently showed higher abundances than those paired with wildtype OgeuIscB. This enhanced protection may arise from more efficient assembly between enOgeuIscB and coRNA, although this hypothesis requires additional evidence to substantiate. Collectively, despite its complex tertiary structure and multifaceted function, the inventors successfully engineered the coRNA with shortened sequences (186 nt vs. 222 nt for the wildtype coRNA) and increased potency. The inventors proceeded with coRNA-v2 and coRNA-vl3.4. Evaluating the indel formation efficiency of enOgenlscB / coRNA

[0165] The inventors evaluated the genome-editing performance of OgeuIscB / coRNA across 26 target sites in HEK293T cells (FIG. 31). All target sites feature 3'-NWRRNA (W = A or T; R = A or G), a TAM determined by an in vitro plasmid cleavage assay (Altae-Tran et al., 2021). Wildtype OgeuIscB / coRNA generated 1.6% ± 2.2% indels across the 26 target sites (median: 0.6%; FIGS. 4A-4B). These results were consistent with a previous study showing that although OgeuIscB / coRNA can generate double stranded breaks (DSBs) in human cells, its activity is generally low and fluctuates across target sites (Altae-Tran et al., 2021). In contrast, enOgeuIscB / coRNA produced 18.6% ± 12.2% indels across the 26 target sites (median: 17.9%), corresponding to an average 30.4-fold increase in activity. Specifically, enOgeuIscB edited the 12 sites rejected by the wildtype protein (<0.5% indels; 0.2 ± 0.1%) to 10.6 ± 6.3%. The enhanced activity, coupled with broader access to target sites, underscored the success of the protein engineering efforts by the inventors.

[0166] The inventors next assayed coRNA-v2 and coRNA-vl3 in combination with either wildtype OgeuIscB or enOgeuIscB across eight genomic loci. At VEGFA site 1, VEGFA site2, EMXl_site 2, and TTLLl l_site 3, coRNA-v2 and coRNA-vl3 boosted indel levels by 1.3- fold to 4.1-fold and 1.3-fold to 3.4-fold, respectively, compared to the wildtype coRNA (FIG. 9A). However, editing levels with coRNA-v2 and coRNA-vl3 at CXCR4_site 1 and DYNClHl_site 1 were comparable to wildtype coRNA levels and decreased at EMXl_site 1 and DNMTl_site 3. Similar trends persisted when testing enOgeuIscB / coRNA-v2 across 26 genomic loci — while the average indel level increased compared to enOgeuIscB / coRNA (20.2% ± 17.7% vs. 18.6% ± 12.2%), not all genomic sites benefited from the engineered coRNA scaffold (FIGS. 9B-9C). These results suggested that the sequence in the guide region may influence coRNA folding, which could in turn affect RNP assembly. Consistent with this speculation, the extra protective effect observed with enOgeuIscB for VEGFA site 1-targeting coRNA-v2 and coRNA-vl3 diminished when these coRNAs were targeting EMXl_site 1 (FIG. 9D) Additional engineering effort is required to further improve the robustness of coRNA folding and reduce its activity fluctuation.

[0167] The OgeuIscB constructs carry three consecutive human influenza hemagglutinin (HA) epitopes at the C terminus, each bearing two aspartic acid residues. These negative charges may repel nucleic acids. Indeed, eliminating the 3x HA tag improved indel formation efficiency at all target sties, regardless of the protein identity — 1.7-fold to 6.5-fold, 1.3-fold to 3.7-fold, and 1.0-fold to 2.3-fold more indels were observed with wildtype OgeuIscB, OgeuIscB-v5.1, and enOgeuIscB, respectively (FIGS. 9A, and 10A-10C). The activity improvement persisted when transitioning from the wildtype coRNA to coRNA-v2 and coRNA- vl3. Consistent with the interpretation that the negative charges on the 3x HA tag reduced indel formation, the inventors found that positively charged tags slightly increased the activity of wildtype OgeuIscB / coRNA (FIG. 20). However, the same tags on enOgeuIscB decreased the indel frequency, likely due to an oversaturation effect from an excess amount of positively charged residues. These results supported that electrostatic interactions between OgeuIscB, coRNA, and target DNA have a major impact on the DNA targeting and cleavage activity of the complex.

[0168] The inventors further compared the performance of enOgeuIscB with a recently published engineered OgeuIscB variant enlscB (Han et al., 2018). This variant was previously evaluated after sorting cells for IscB expression, whereas the inventors’ indel frequency measurement did not include this pre-selection step. To enable an equal-footing comparison, the inventors cloned the two OgeuIscB variants into the same vectors, and compared their indel-generating capacities without pre-selection. When paired with the wildtype coRNA, the two variants showed nicely correlated editing levels across 26 target sites. In the HA-taggedformat, the enOgeuIscB outperformed enlscB by 1.47-fold (FIG. 4C and FIG. 11A). Upon HA tag removal, the two variants generated comparable levels of indels (FIG. 4C and FIG. 11B) When paired with their corresponding best-performing coRNA, the indel frequencies increased steadily (FIG. 4D). Collectively, enOgeuIscB demonstrated similar indel-forming capacity and better compatibility with the HA tag compared to the reported enlscB.

[0169] Considering the uptake challenges associated with co-administration of OgeuIscB- and coRNA-encoding plasmids, the inventors cloned OgeuIscB and coRNA into a single plasmid and reassessed their performance. The inventors observed 64.5% to 87.3% indels with enOgeuIscB / coRN A- v2 and enOgeuIscB / coRNA-vl3 across six genomic loci, without imposing any means of selection (FIG. 4E). These indel levels approach the practical limit for gene editing in HEK293T cells via plasmid transfection.

[0170] Since IscB-mediated genome editing has not been reported for cell lines beyond HEK293, the inventors carried parallel experiments in A549 and HeLa cells, and attained indel levels up to 15.8% and 23.7%, respectively (FIG. 12). The inventors noted that these two cell lines are known to be more refractory to lipid-mediated plasmid delivery, which could have caused the reduced indel levels. Editing potency broadly translated from HEK293T to A549 and HeLa cells across different target sites. One exception was TTLL1 I site 3 in HeLa cells, which hosts a single-nucleotide variation 3 nt into the TAM-proximal R-loop region. enOgeuIscB / coRNA rejected this mismatch in the TAM-proximal RNA-guided region, as indel formation was reduced to the background level. Collectively, enOgeuIscB / coRNA variants showed robust indel formation activity across multiple sites in human cells.5. Off-target effects of OgeuIscB / coRNA systems

[0171] The inventors employed GUIDE-seq to assess the genome-wide specificity of OgeuIscB / coRNA (Tsai et al., 2015). Compared to widely used in vitro off-target profiling methods such as Digenome-seq (Kim et al., 2015), CIRCLE-seq (Tsai et al., 2017), and ONE- seq (Petri et al., 2021), GUIDE-seq reports all DSB events in live cells — on-target cleavage, off-target cleavage, or natural DSBs — through the integration of a phosphorylated doublestranded oligonucleotide (dsODN). As dsODN integration favors blunt-end over sticky-end DSBs, the inventors first investigated whether GUIDE-seq is sensitive enough to detect IscB- mediated cleavage, which generates 5 '-end protruding sticky-ends. The inventors coadministered the dsODN and the OgeuIscB- and coRNA-encoding plasmids into HEK293T cells via transient transfection. OgeuIscB / coRNA, enOgeuIscB / coRNA-v2, and enOgeuIscB / coRNA-vl3 produced indels at frequencies of 4.4% to 19.3%, 26.2% to 47.6%, and 25.8% to 38.6%, respectively, at VEGFA_site 1, VEGFA_site 2, CXCR4_site 1, andDYNClHl_site 1 (FIG. 5A); indel rates were lower due to co-delivery of the dsODN. Importantly, the inventors detected integration rates of 0.3% to 2.2% across the four target sites. Although lower than the values obtained for the blunt-end cutter SpCas9, these integration rates are sufficient for GUIDE-seq profiling. Similar integration rates have been reported from GUIDE-seq analyses of other Cas nucleases producing sticky ends, such as AsCasl2a, LbCasl2a, and AsCasl2fl (Wu et al., 2023; KI einstiver et al., 2016).

[0172] The TAM preference of OgeuIscB was previously defined as NWRRNA in biochemical assays (Altae-Rae et al., 2021). Given the short spacer (16 nt) and degenerate TAM (6 nt), the inventors allowed up to 7 mismatches within the 22-nt bait in GUIDE-seq analysis (FIGS. 5B-5C and FIGS. 21-24) and detected 148 potential off-target sites for VEGFA site 1 -targeting OgeuIscB / coRNA. The on-target site ranked second among all hits, supporting the programmable nature of OgeuIscB / coRNA. GUIDE-seq also captured another site in the human genome identical to VEGFA site 1 with a slightly altered TAM (GGAGTG) (FIG.21)

[0173] VEGFA_site 2-targeting OgeuIscB / coRNA generated dsODN integration at 43 genomic loci, with the on-target site ranking second. The top-ranked hit carries an A1G mismatch and a perfectly complied TAM (CAGACA; FIG. 5C and FIG. 22). When targeting CXCR4_site 1 and DYNCIHl site 1, the inventors detected 38 and 8 potential off-target sites, respectively, for OgeuIscB / coRNA (FIG. 5C and FIGS. 23-24). Similar to the observations for VEGFA_site 1- and VEGFA_site 2-targeting OgeuIscB / coRNA, on-target sites consistently ranked among the top hits. The number of potential off-target sites increased from OgeuIscB / coRNA to enOgeuIscB / coRNA-v2 and enOgeuIscB / coRNA-vl3 (FIG. 5B). The concurrent trend in on-target and off-target activity pointed to similar specificity between the engineered and wildtype OgeuIscB / coRNA systems.

[0174] To verify the off-target sites identified by GUIDE-seq, the inventors measured indel levels at a total of 16 off-target sites (FIG. 14). As anticipated, the indel frequencies increased from wildtype OgeuIscB / coRNA to the engineered systems, indicating a potential tradeoff between potency and specificity. Nevertheless, the on-target sites remained the top edited sites in all cases. Collectively, the GUIDE-seq results corroborated well with targeted deep sequencing results.6. Mismatch and TAM tolerance inferred from GUIDE-seq

[0175] Next, the inventors inspected mismatch tolerance and TAM preferences of the OgeuIscB / coRNA system in its off-target profiles. The inventors considered two factors that may dictate whether an off-target site is captured by GUIDE-seq — the incompleterepresentation of all possible off-target sequence combinations in the human genome and the preferences of OgeuIscB / coRNA among the available off-target sites. To this end, the inventors extracted potential off-target sites from the human genome by Cas-OFFinder (Bae et al., 2014) (FIG. 6A). The inventors consider hits of <2 mismatches with the 16-nt spacer as a surrogate for “all available off-target sites in the human genome” (FIG. 32). Meanwhile, the inventors reanalyzed GUTDE-seq data, allowing up to 2 mismatches to the spacer without specifying a TAM. The resulting sites serve as a surrogate for “the subset of off-target sites recognized by OgeuIscB / coRNA”. Mismatch tolerance of OgeuIscB / coRNA at individual protospacer positions was defined as the ratio of mismatches detected experimentally by GUIDE-seq to those identified in silico by Cas-OFFinder.

[0176] Mismatches were mostly rejected at positions 3-16 by wildtype OgeuIscB for all four spacers (FIGS. 6A-6B) (Schneider et al., 1990). Weaker stringency for the first two nucleotides bordering the TAM-distal side can be rationalized by the cryo-EM structure as this region of the coRNA / target strand (TS) heteroduplex is not contacted by OgeuIscB, whereas the rest of the coRNA / TS heteroduplex is sandwiched between the body of OgeuIscB and the latched HNH nuclease domain — mismatches are indirectly sensed from distortions in the heteroduplex backbone (Schuler et al., 2022). Similar PAM-distal (1-3) mismatch tolerance has been reported for SpCas9 (Sternberg et al., 2015; Chen et al., 2017; Bravo et al., 2022), and is likely a shared feature among IscB and its derived RNA-guided endonucleases.

[0177] Increased mismatch tolerance was observed at position 16 (first nucleotide 5' to the TAM) for VEGFA site 2-, and to a lesser extent, VEGFA site 1- and CXCR4 site / -targeting OgeuIscB / coRNA (FIG. 6B). This tolerance appeared to be negatively correlated with the basepairing strength, as all three of these mismatch sites contain an A or T. In contrast, DYNC1H1 site 1 containing a C at position 16 did not tolerate any mismatches therein. Given that the TS is rotated 180° above position 16, and stacking is suboptimal at this base pair; it is plausible that a weaker nucleotide (A / T) in the guide may tolerate mismatches through sheared base-pair formation. Detailed structural biology study is required to understand the cause of this mismatch tolerance.

[0178] To dissect the TAM preferences of OgeuIscB / coRNA in human cell editing experiments, the inventors expanded their analysis to include the 6-nt sequence downstream of the target site (FIG. 6C). While Cas-OFFinder hits showed minimal enrichment at these six positions, an NARRNN motif emerged in GUIDE-seq-identified off-target sites. Similar TAM preferences were also observed using the default GUIDE-seq analysis pipeline with a pre-specified NWRRNA TAM (FIG. 25). The RR requirement at TAM-3 and 4 is stringent; few pyrimidines were found at off-target sites. This RR preference is specified by hydrogen bonds between N7s of A3 and G4 and the main-chain amide groups of G460 and R461, as shown in the cryo-EM structure (FIG. 6D); pyrimidines could not accommodate the same contacts (Schuler et al., 2022). TAM-2 showed a preference for A in GUIDE-seq. This position is specified from the minor groove side by PID linker residues His397 towards 02 of T2 in the NTS, and K380 towards N3 of A2 in the TS (FIG. 6D) (Schuler et al., 2022; Kato et al., 2022). G:C pairs in either orientation would be rejected due to steric clashes with the N2 of guanosine. Here, the data further suggested that only one A:T orientation is preferred.

[0179] A weak preference for adenosine at TAM-6 was observed in the in vitro plasmid cleavage assay, which was attributed to a favorable hydrophobic contact with the methyl group of T6 in the NTS (Schuler et al., 2022). Here, GUIDE-seq data did not support a strong TAM- 6 specification in human cells. Overall, the findings suggested that the TAM contacts in cellular settings are weighted slightly differently from those in vitro. This will have implications in target selection practice.

[0180] Lastly, the inventors analyzed off-target sites impacted by enOgeuIscB / coRNA-v2 and enOgeuIscB / coRNA-vl3 and obtained similar results (FIGS. 15-16), suggesting that the engineered derivatives retained the specificity and TAM preferences of wildtype OgeuIscB / coRNA. The correlation between the number of unique dsODN integration events and indel propensity also prompted the inventors to reassess mismatch tolerance and TAM preferences of the OgeuIscB / coRNA systems, weighting off-target sites based on their GUIDE- seq read counts; the results remained consistent (FIG. 26). The inventors noted that three of the four chosen target sites are A:T rich. Whether the observed genome-wide specificity translates fully to more GC-rich target sites awaits future investigation. Collectively, the OgeuIscB / coRNA system specifies an “NARR” TAM when searching for targets in human cells, favors complementarity at positions 3-16, and tolerates mismatches at positions 1-2. Information here will guide the design of future editing experiments; sites with weak TAMs or many competing off-target sites can be computationally avoided.7. Discussion

[0181] The inventors explored ways to improve the potential of the OgeuIscB / coRNA system for programmed genome editing. Using rational protein engineering, the inventors increased the in vitro DNA binding affinity of OgeuIscB by 4-fold and the ex vivo indel formation activity by 30.4-fold. It is worth noting that although the coevolutionary approach (Russ et al., 2020) is efficient at avoiding deleterious mutations, it may miss potential mutationsin regions of extremely high or low sequence homology. Utilizing exhaustive arginine- scanning mutagenesis, a recent study identified enlscB, which carries four indel-boosting mutations— E84R, H368R, S386R and S456R (FIG. 27) (Han et al., 2023). There the mutations were denoted E85R, H369R, S387R and S457R due to the inclusion of an extra M at the N terminus. In addition to the shared H368R, the two studies independently identified S386R (enlscB) and L393K (the inventors’ enOgeuIscB), two mutations closely positioned at the protein / DNA interface (FIG. 27). While the two independent solutions lead to a similar level of activity improvement, some target sites are edited more efficiently by one variant and vice versa. This suggests neither variant has reached the plateau in robustness. Considering that the two variants share only one mutual mutation, future effort to combine mutations may yield an even more robust IscB variant.

[0182] Since large RNAs have a tendency to either adopt multiple conformations or be kinetically trapped at misfolded states, optimization of coRNA represents an additional challenge for the IscB / coRNA system. The inventors’ best RNP combination, enOgeuIscB / coRNA-v2, delivered up to 87.3% indels in HEK293T cells. Nevertheless, its editing efficiency still fluctuated among target sites, suggesting that the folding of the coRNA core structure is not robust enough. Moreover, despite the substantial improvement in activity, enOgeuIscB / coRNA remained a weak DNA binder in vitro in comparison to SpCas9. As such, the inventors believe that the full potential of the OgeuIscB / coRNA system remains to be found.

[0183] Prokaryotes rely on CRISPR-Cas systems to survive the constant bombardment by phages and other mobile genetic elements. There is a high evolutionary demand for the CRISPR-Cas effectors to be both efficient and accurate. The coRNA-guided nucleases in transposable elements are not held to the same standard — they only need to mediate occasional site-specific homing or transposition (Meers et al., 2023; Karvelis et al., 2021). The moderate activity and fidelity of the IscB / coRNA system is consistent with its natural function. Numerous studies have demonstrated that transposase activity can be readily improved through gain-of- function selection (Geurts et al., 2003; Zayed et al., 2004; Yant et al., 2004; Lampe et al., 1999); the inventors’ progress so far reinforces this view. The inventors envision that the IscB / coRNA system may be further improved for genome-editing applications through rational engineering or directed evolution.

[0184] With its small stature and controllable strand scission activity, IscB / coRNA is a particularly attractive system for CRISPR2.0 applications, such as base editing (Komor et al., 2016; Nishida et al., 2016; Gaudelli et al., 2017) and prime editing (Anzalone et al., 2019). The inventors and others have demonstrated the compatibility of TadA8e (Richter et al., 2020) andAP0BEC3A (Gehrke et al., 2018) with IscB; however, the base-editing window remained too wide to deliver controllable clinical outcomes (Han et al., 2023). The inventors envision that this problem can be solved by coupling IscB with effectors of intrinsic target specification properties, such as context-specific deaminases for base editing and pegRNAs for prime editing. The inventors are optimistic that the enhanced OgeuIscB / coRNA systems serve as a steppingstone towards a robust, compact, and programmable genome-editing tool.Example 2 - Base editing mediated by enOgenlscB / coRNA

[0185] Compared to existing type-V mini-CRISPR proteins that process DNA with a single RuvC domain (Harrington et al., 2018; Karvelis et al., 2020; Wu et al., 2022; Chen et al., 2023), IscB hosts two separate nuclease domains, each dedicated to the cleavage of one DNA strand. This makes IscB a more versatile platform to support CRISPR 2.0 applications, such as base editing (Komor et al., 2016; Nishida et al., 2016; Gaudelli et al., 2017). Herein, the inventors evaluated TadA8e-fused (Richter et al., 2020) RuvC-inactivated (D60A) OgeuIscB nickase for A:T-to-G:C editing in HEK293T cells. A V106W mutation was installed to improve the editing fidelity of TadA8e (Richter et al., 2020; Rees et al., 2019). While single TadA8eV106W fusions at either the N or C terminus of enOgeuIscB showed moderate activity (15.3% to 28.5% editing in the presence of the wildtype coRNA, coRNA-v2, or coRNA-vl3, considering the best edited A at VEGFA site 1), the dual TadA8eV106W fusion (TadA8eV106W-enOgeuIscB- TadA8eV106W) boosted the editing level to 45.6% to 57.2% (a 1.9-fold to 3.5-fold increase compared to single TadA8eV106W fusions, FIGS. 4F and 13A). Consistent with a previous report (Han et al., 2023), IscB-derived base editors cover a broad editing window; editing was observed across Al to Al 1 in the R-loop, with peak activity at A6 (FIG. 4F).

[0186] The inventors next evaluated the activity of adenine base editors derived from wildtype OgeuIscB, the inventors’ enOgeuIscB, and the reported enlscB in the same fusion architecture (TadA8eV106W-OgeuIscB-TadA8eV106W) across six genomic loci. As expected, both engineered OgeuIscB variants outperformed the wildtype enzyme (36.1% ± 21.1% editing for enOgeuIscB / coRNA-vl3 and 35.2% ± 24.3% editing for enlscB / coRNA* versus 20.3% ± 21.2% editing for wildtype OgeuIscB / coRNA; FIGS. 4G and 13B), while enOgeuIscB / coRNA-vl3 generated base editing at levels comparable to enlscB / coRNA*. Collectively, these findings suggested that although the engineering efforts of the inventors were devoted to increase cleavage-induced indel formation, the improvements directly translate to base editing. These observations further supported the notion that the bottleneck in IscB-mediated DNA cleavage is at the target searching rather than the DNA cleavage step, andthat the mutation combination generate by the inventors specifically improved this activity (FIGS. 7A-7B)Example 3 - OgeuIscB variants

[0187] The inventors extended their efforts to find new mutation that could further improve the editing efficiency of OgeuIscB. To this end, they tested the effect of combining single cluster mutations. Nucleotide editing efficiency was assessed by T7E1 assays and next generation sequencing (NGS).

[0188] Based on NGS results the inventors found that mutation H368K significantly increased the activity of OgeuIscB in cells compared to H368R mutation (FIG. 41).

[0189] A series of 12 mutants were created by combining different mutations (FIG. 42A). The T7E1 assay results indicated that mutant 2 was the weakest, followed by mutant 4, with mutants 5, 6, and 7 being stronger, and mutant 3 being the strongest. Among the new mutants, mutant 10 showed the best performance (FIG. 43 A). The following mutation clusters were found to further improve the editing efficiency of 8-mut OgeuIscB (enOgeuIscB) in both T7E1 and NGS assays: 1) S430R+K481R, 2) T355K+T361G+S363P, 3) V180M+I183F, and 4) T274K+D275Q+K276Q+E277A.

[0190] Based on NGS results, the inventors found that mutation combinations 2, 4, 5, and 6 significantly enhanced performance (FIG. 44).

[0191] T7E1 assays showed that every mutation combination appeared to edit polynucleotides just as well, if not better, than the IscB with 8 mutations, but the mutant that had a lambda N peptide showed a weaker editing capability (FIG. 45).Example 4 - Methods

[0192] Plasmid construction: Oligonucleotides were ordered from Integrated DNA Technologies (IDT). Plasmids encoding wildtype OgeuIscB and the coRNA scaffold were gifts from Feng Zhang (Addgene plasmids #176540 and #176541) (Altae-Tran et al., 2021). ABE8e (TadA8evl06W) was a gift from David Liu (Addgene plasmid # 138495) (Richter et al., 2020. For cloning of plasmids encoding OgeuIscB variants, polymerase chain reactions (PCR) were carried out using Phusion U Hot Start DNA Polymerase (Fisher Scientific, F555L). Plasmids were constructed by USER assembly (New England Biolabs, M5505L) following the manufacture’ s protocol. Plasmids encoding coRNA were constructed by Golden Gate assembly. Specifically, DNA fragments were amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs, M0491L). The fragments were digested by Type IIS restriction enzyme BsmBI-v2 (New England Biolabs, R0739L) and assembled by T4 DNA ligase (Ml 804) per manufacture’s protocol. DH5-alpha FIqcompetent cells (New England Biolabs, C2992I) wereused for cloning and plasmid propagation. The sequence of all plasmids was confirmed by Sanger sequencing (Azenta Life Science) or Nanopore sequencing (Plasmidsaurus).

[0193] For mammalian genome editing, OgeuIscB variants were expressed under a cytomegalovirus (CMV) promotor; coRNAs were expressed with a U6 promoter. In adenine base editors containing a single TadA8evl06Wdomain, a 32 amino acid linker (linker 1) was used to connect OgeuIscB and TadA8evl06W. For dual TadA8evl06Weditors, linker 1 was used to connect the N terminus of OgeuIscB to one TadA8evl06Wmonomer and a 34 amino acid linker (linker 2) was used to connect the C terminus of OgeuIscB to the second TadA8evl06Wmonomer. All OgeuIscB variants and the derived adenine base editor fusions were flanked by two NLS peptides. The sequences of linkers and NLS peptides are provided in FIG. 33. Key plasmids generated by this work will be deposited to Addgene.

[0194] Cell culture and transfection: A549, HeLa, and HEK293T cells were cultured in Dulbecco’s Modified Eagle’s Medium with high glucose, sodium pyruvate, and L-Glutamine (DMEM, Sigma-Aldrich, D5796) supplemented with 10% fetal bovine serum (Coming, 10- 013-CV). Cells were maintained in 5% CO2 at 37 °C and passaged regularly upon reaching 80% confluence. Cells were seeded 24 hours prior to transfection to ensure -50% confluence at the time of transfection. Transfection was performed with jetOPTIMUS DNA transfection reagent (Polyplus, 101000006) or Lipofectamine 3000 transfection reagent (Invitrogen, L3000015) following the manufacturers’ instructions.

[0195] Indel-generating activity of OgeuIscB variants: OgeuIscB variant screening and coRNA engineering (related to FIGS. 1-3, FIG. 8, FIG. 9D, and FIGS. 18-19) were carried out in 96-well plates with jetOPTIMUS DNA transfection reagent. Specifically, 120 ng of the OgeuIscB plasmid and 80 ng of the coRNA plasmid were delivered with 0.2 pL of jetOPTIMUS DNA transfection reagent in 12.5 pL of jetOPTIMUS buffer. Cells were incubated for 48 hours post-transfection before harvest. The same protocol was used for genome editing across 26 target sites in HEK293T cells (related to FIGS. 4A-4D, FIGS. 9A-9C, FIGS. 10-11, and FIG. 20) with a minor modification in workflow that cells were incubated for 72 hours instead of 48 hours post-transfection.

[0196] Lipofectamine 3000 transfection reagent was used to deliver enOgeuIscB and engineered coRNA as a single plasmid (related to FIG. 4E, and FIG. 12). Specifically, 200 ng of plasmid DNA and 0.2 pL of P3000 reagent were mixed in 10 pL of Opti-MEM reduced serum medium (Thermo Fisher Scientific, 31985-062). Meanwhile, 0.3 pL of Lipofectamine3000 was diluted in 10 pL of Opti-MEM and added to the above solution. The mixture was incubated at room temperature for 15 min before adding to cells seeded in 96-well plates. Cells were harvested 72 hours post-transfection. The same transfection protocol was used for A549, HeLa, and HEK293T cells.

[0197] Adenine base editing by engineered OgeuIscB / coRNA: Adenine base editing experiments were carried out in 96-well plates. Two separate plasmids that encode coRNAs and base editors (fusion proteins of OgeuIscB nickase and TadA8evl06W) were delivered into HEK293T cells using Lipofectamine 3000 transfection reagent (related to FIG. 4F-4G and FIG. 13). Briefly, 200 ng of base editor plasmid and 100 ng of coRNA plasmid were mixed with 0.2 pL of P3000 reagent in 10 pL of Opti-MEM reduced serum medium. To the solution was added 0.3 pL of Lipofectamine 3000 reagent pre-diluted in 10 pL of Opti-MEM. The mixture was incubated at room temperature for 15 min before adding to cells seeded in 96-well plates. Cells were harvested 72 hours post-transfection.

[0198] Amplicon deep sequencing: Cells were washed with PBS and lysed in 50 pL of lysis buffer (10 mM Tris-HCl, 0.05% SDS, 25 pg / mL proteinase K; pH 8.0). The lysate was incubated at 37 °C for 15 min, 55 °C for 60 min, 85 °C for 15 min, and 95 °C for 10 min. 1 pL of the cell lysate was subjected to two rounds of PCR to add Illumina adaptors and barcodes. The sequences of primers used for library preparation are listed in FIG. 34. The pooled library underwent gel purification and 150 bp paired-end sequencing on an Illumina MiSeq instrument. Indel frequencies were analyzed by CRISPResso2 using the batch mode (Clement et al., 2019). For adenine base editing, MiSeq reads were aligned to reference sequences with BWA-MEM (Li et al., 2009) and sorted using Samtools 1.13 (Danecek et al., 2021). A:T-to-G:C editing rates at given positions were calculated as number-of-G-reads / number-of-total-reads.

[0199] Quantification of coRNA expression: Cells were transfected with jetOPTIMUS DNA transfection reagent as described above and incubated for 48 hours. Total RNA was extracted by Direct-zol RNA Microprep Kits (Zymo Research, R2053-A) with on-column DNA digestion per the manufacture’s instruction. RNA was reverse transcribed using GoScript reverse transcriptase (Promega, A501D) with target-specific primers (FIG. 34). The relative levels of coRNAs were determined by quantitative PCR normalized to GAPDH.

[0200] In vitro DNA binding and cleavage: OgeuIscB / coRNA complexes were expressed and purified following a published protocol (Schuler et al., 2022). Briefly, T7 Express Competent A. coli cells (New England Biolabs) were transformed with OgeuIscB- and coRNA--n -encoding plasmids. The transformed E. colt, supplemented with 0.75 mg / ml L-cysteine in the culture, were grown until the OD 600 nm reached 0.8. Protein expression was induced by adding isopropyl-P-D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM. Bacteria were grown at 16 °C for an additional 16 hours prior to harvest. The OgeuIscB / coRNA complexes were purified following a protocol reported previously (Schuler et al., 2022). Protein concentrations were quantified using BioTek Cytation 5 (Agilent).

[0201] Target DNA was prepared by PCR. Forward primer, / Cy5 / CTGTCTCTTATACACATCT; reverse primer, / FAM / CAAGCAGAAGACGGCATAC; template, CTGTCTCTTATACACATCTGAGGGCCCCACGAATTCTTCTTCAGACTTCTAGTCTC GTTCACTCTTTTTGATGATGCTTCGTAACTCGTGGGAAGTCGAGGTCAGCCCGTC GTAGTATGCCGTCTTCTGCTTG. The fluorophore labeled PCR products were purified with a GeneJet gel extraction kit (Thermo Scientific).

[0202] For time-course DNA cleavage, 5 nM of target DNA was incubated with 500 nM of OgeuIscB / coRNA in a cleavage buffer (100 mM NaCl, 50 mM HEPES, 2 mM DTT, 5 mM MgCh, 10 pM ZnCh; pH 7.5) at 37°C. The reaction was stopped with 20 mM of EDTA at designated time points followed by additional incubation at 95 °C for 5 min. The sample was then treated with 0.8 U proteinase K at 37 °C for 15 min. To each sample, an equal volume of 100% formamide was added, and the samples were heated to 95 °C for 10 min before being analyzed by 12% urea-polyacrylamide gel electrophoresis (PAGE). The fluorescent signal was captured using ChemiDoc (Bio-Rad). For protein dose-dependent cleavage, the same protocol was followed with a fixed 30 min incubation period. For EMSA, 5 nM of target DNA was incubated with different concentrations of OgeuIscB / coRNA at 37 °C for 30 min. The mixture was then directly analyzed by a 1.5% Tris-borate (TB) gel. The fluorescent signals were captured using a Typhoon scanner.

[0203] GUIDE-seq: OgeuIscB and coRNA were delivered as a single plasmid into cells preseeded in a 24-well plate. To each well, 800 ng of plasmid DNA and 4 pmol of dsODN were co-delivered with 0.8 pL of jetOPTIMUS DNA transfection reagent in 50 pL of jetOPTIMUS buffer. Cells were incubated for 72 hours followed by genomic DNA extraction with the Quick- DNA Miniprep kit (Zymo Research, D3025). Amplicon deep sequencing was performed as described above to measure indel and dsODN integration frequencies.

[0204] GUIDE-seq libraries were prepared with 500 ng of genomic DNA following a reported protocol (Tsai et al., 2015) and sequenced on an Illumina Nextseq 2000 platform using paired-end sequencing (R1 40 cycle, Il 8 cycle, 12 16 cycle, R2 70 cycle). Sequencing data were mapped to human genome reference (GrCh37) and processed using the open-source guideseq software (https: / / github.com / tsailabSJ / guideseq) (Malinin et al., 2021). For genomewide specificity analysis, the PAM was set to NWRRNA with a maximum mismatch number of 7. For mismatch tolerance analysis, the PAM was set to NNNNNN with a maximum mismatch number of 2 in the protospacer.

[0205] In silico off-target prediction: To evaluate mismatch tolerance of the OgeuIscB / coRNA systems, Cas-OFFinder (Bae et al., 2014) was employed to predict potential off-target sites. Genomic loci carrying up to 2 mismatches to the on-target sequence were extracted. The inventors did not specify a PAM for in silico off-target prediction. Sequence logos were plotted using WebLogo 3 (Crooks et a., 2004).

[0206] Statistical analysis: Unpaired Student's t-tests (two tailed) were used to compare samples (GraphPad Prism 9.0). n.s. P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001. Investigators were not blinded to experimental conditions or outcome assessments.

[0207] Data availability: The cryo-EM structure of the OgeuIscB / coRNA / DNA complex were available at PDB (entry: 7UTN, https: / / www.rcsb.org / ). The human reference genome GRCh37 is available at EBI (https: / / ftp.ebi.ac.uk / ). Deep sequencing data generated by this study have been deposited to the NCBI Sequence Read Archive under accession number PRJNA983934.

[0208] Code availability: Sequencing data was processed using open-source software: CRISPResso2, BWA-MEM, Samtools 1.13 and GUIDE-seq. Cas-OFFinder were used for off- targeting evaluation.* * *

[0209] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described hereinwhile the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.REFERENCESThe following references and the references cited throughout the disclosure, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.Kapitonov, V.V., Makarova, K.S. & Koonin, E.V. ISC, a novel group of bacterial and archaeal DNA transposons that encode Cas9 homologs. J. Bacterio!. 198, 797-807 (2015).Altae-Tran, H., Kannan, S., Demircioglu, F.E., Oshiro, R., Nety, S.P., McKay, L.J., Dlakic, M., Inskeep, W.P., Makarova, K.S., Macrae, R.K., Koonin, E.V. & Zhang, F. The widespread IS200 / IS605 transposon family encodes diverse programmable RNA-guided endonucleases. Science 374, 57-65 (2021).Meers, C., Le, H.C., Pesari, S.R., Hoffmann, F.T., Walker, M.W.G., Gezelle, J., Tang, S. & Sternberg, S.H. Transposon-encoded nucleases use guide RNAs to promote their selfish spread. Nature 622, 863-871 (2023).Schuler, G., Hu, C. & Ke, A. Structural basis for RNA-guided DNA cleavage by IscB- omegaRNA and mechanistic comparison with Cas9. Science 376, 1476-1481 (2022).Kato, K., Okazaki, S., Kannan, S., Altae-Tran, H., Esra Demircioglu, F., Isayama, Y., Ishikawa, J., Fukuda, M., Macrae, R.K., Nishizawa, T., Makarova, K.S., Koonin, E.V., Zhang, F. & Nishimasu, H. Structure of the IscB-omegaRNA ribonucleoprotein complex, the likely ancestor of CRISPR-Cas9. Nat. Commun. 13, 6719 (2022).Hirano, S., Kappel, K., Altae-Tran, H., Faure, G., Wilkinson, M.E., Kannan, S., Demircioglu, F.E., Yan, R., Shiozaki, M., Yu, Z., Makarova, K.S., Koonin, E.V., Macrae, R.K. & Zhang, F. Structure of the OMEGA nickase IsrB in complex with omegaRNA and target DNA. Nature 610, 575-581 (2022).Lino, C.A., Harper, J.C., Carney, J.P. & Timlin, J.A. Delivering CRISPR: a review of the challenges and approaches. Drug Deliv. 25, 1234-1257 (2018).Fu, Y., Sander, J.D., Reyon, D., Cascio, V.M. & Joung, J.K. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat. BiotechnoL 32, 279-284 (2014).Komor, A.C., Kim, Y.B., Packer, M.S., Zuris, J.A. & Liu, D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533, 420-424 (2016).Nishida, K., Arazoe, T., Yachie, N., Banno, S., Kakimoto, M., Tabata, M., Mochizuki, M., Miyabe, A., Araki, M., Hara, K.Y., Shimatani, Z. & Kondo, A. Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science 353, DOI: 10.1126 / science.aaf8729 (2016).Gaudelli, N.M., Komor, A.C., Rees, H.A., Packer, M.S., Badran, A.H., Bryson, D.I. & Liu, D.R. Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage. Nature 551, 464-471 (2017).Tsai, S.Q., Zheng, Z., Nguyen, N.T., Liebers, M., Topkar, V.V., Thapar, V., Wyvekens, N., Khayter, C., lafrate, A.J., Le, L.P., Aryee, M.J. & Joung, J.K. GUIDE-seq enables genomewide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat. BiotechnoL 33, 187-197 (2015).Sternberg, S.H., Redding, S., Jinek, M., Greene, E.C. & Doudna, J.A. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 507, 62-67 (2014).Xiao, Y., Luo, M., Hayes, R.P., Kim, J., Ng, S., Ding, F., Liao, M. & Ke, A. Structure Basis for Directional R-loop Formation and Substrate Handover Mechanisms in Type I CRISPR-Cas System. Cell 170, 48-60 el l (2017).Hu, C., Ni, D., Nam, K.H., Majumdar, S., McLean, J., Stahlberg, H., Terns, M.P. & Ke, A. Allosteric control of type LA CRISPR-Cas3 complexes and establishment as effective nucleic acid detection and human genome editing tools. MoL Cell 82, 2754-2768 e2755 (2022).Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T., Abudayyeh, O.O., Gootenberg, J.S., Mori, H., Oura, S., Holmes, B., Tanaka, M., Seki, M., Hirano, H., Aburatani, H., Ishitani, R., Ikawa, M., Yachie, N., Zhang, F. & Nureki, O. Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science 361, 1259-1262 (2018).Walton, R.T., Christie, K.A., Whittaker, M.N. & Kleinstiver, B.P. Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants. Science 368, 290-296 (2020). Nakagawa, R., Ishiguro, S., Okazaki, S., Mori, H., Tanaka, M., Aburatani, H., Yachie, N., Nishimasu, H. & Nureki, O. Engineered Campylobacter jejuni Cas9 variant with enhanced activity and broader targeting range. Commun Biol 5, 211 (2022).Kleinstiver, B.P., Sousa, A.A., Walton, R.T., Tak, Y.E., Hsu, J.Y., Clement, K., Welch, M.M., Horng, J.E., Malagon-Lopez, J., Scarfo, I., Maus, M.V., Pinello, L., Aryee, M.J. & Joung, J.K. Engineered CRISPR-Cas 12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing. Nat. BiotechnoL 37, 276-282 (2019).Strecker, J., Jones, S., Koopal, B., Schmid-Burgk, J., Zetsche, B., Gao, L., Makarova, K.S., Koonin, E.V. & Zhang, F. Engineering of CRISPR-Casl2b for human genome editing. Nat. Commun. 10, 212 (2019).McGaw, C., Garrity, A.J., Munoz, G.Z., Haswell, J.R., Sengupta, S., Keston-Smith, E., Hunnewell, P., Ornstein, A., Bose, M., Wessells, Q., Jakimo, N., Yan, P., Zhang, H., Alfonse, L.E., Ziblat, R., Carte, J.M., Lu, W.C., Cerchione, D., Hilbert, B., Sothiselvam, S., Yan, W.X., Cheng, D.R., Scott, D.A., DiTommaso, T. & Chong, S. Engineered Casl2i2 is a versatile high- efficiency platform for therapeutic genome editing. Nat. Commun. 13, 2833 (2022).Xu, X., Chemparathy, A., Zeng, L., Kempton, H.R., Shang, S., Nakamura, M. & Qi, L.S. Engineered miniature CRISPR-Cas system for mammalian genome regulation and editing. Mol. Cell ' 81, 4333-4345 (2021).Wu, T., Liu, C., Zou, S., Lyu, R., Yang, B., Yan, H., Zhao, M. & Tang, W. An engineered hypercompact CRISPR-Casl2f system with boosted gene-editing activity. Nat. Chem. Biol. 19, 1384-1393 (2023).Kong, X., Zhang, H., Li, G., Wang, Z., Kong, X., Wang, L., Xue, M., Zhang, W ., Wang, Y., Lin, J., Zhou, J., Shen, X., Wei, Y., Zhong, N., Bai, W ., Yuan, Y., Shi, L., Zhou, Y. & Yang, H. Engineered CRISPR-OsCasl2fl and RhCasl2fl with robust activities and expanded target range for genome editing. Nat. Commun. 14, 2046 (2023).Saito, M., Xu, P., Faure, G., Maguire, S., Kannan, S., Altae-Tran, H., Vo, S., Desimone, A., Macrae, R.K. & Zhang, F. Fanzor is a eukaryotic programmable RNA-guided endonuclease. Nature (2023).Clement, K., Rees, H., Canver, M.C., Gehrke, J.M., Farouni, R., Hsu, J.Y., Cole, M.A., Liu, D.R., Joung, J.K., Bauer, D.E. & Pinello, L. CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nature Biotechnology 37, 224-226 (2019).Dang, Y., Jia, G., Choi, J., Ma, H., Anaya, E., Ye, C., Shankar, P. & Wu, H. Optimizing sgRNA structure to improve CRISPR-Cas9 knockout efficiency. Genome Biology 16, 280 (2015).Moon, S B., Kim, D.Y., Ko, J.-H., Kim, J.-S. & Kim, Y.-S. Improving CRISPR Genome Editing by Engineering Guide RNAs. Trends in Biotechnology 37, 870-881 (2019).Kim, D.Y., Lee, J.M., Moon, S B., Chin, H.J., Park, S., Lim, Y., Kim, D., Koo, T., Ko, J.-H. & Kim, Y.-S. Efficient CRISPR editing with a hypercompact Casl2fl and engineered guide RNAs delivered by adeno-associated virus. Nature Biotechnology 40, 94-102 (2022).Srisawat, C., Goldstein, I. J. & Engelke, D.R. Sephadex-binding RNA ligands: rapid affinity purification of RNA from complex RNA mixtures. Nucleic Acids Res. 29, E4 (2001).Steckelberg, A.L., Akiyama, B.M., Costantino, D.A., Sit, T.L., Nix, J.C. & Kieft, J.S. A folded viral noncoding RNA blocks host cell exoribonucleases through a conformationally dynamic RNA structure. Proc. Natl. Acad. Sci. U. S. A. 115, 6404-6409 (2018).Haurwitz, R.E., Jinek, M., Wiedenheft, B., Zhou, K. & Doudna, J. A. Sequence- and structurespecific RNA processing by a CRISPR endonuclease. Science 329, 1355-1358 (2010).Han, D., Xiao, Q., Wang, Y., Zhang, H., Dong, X., Li, G., Kong, X., Wang, S., Song, J., Zhang, W., Zhou, J., Bi, L., Yuan, Y., Shi, L., Zhong, N., Yang, H. & Zhou, Y. Development of miniature base editors using engineered IscB nickase. Nat. Methods 20, 1029-1036 (2023).Harrington, L.B., Burstein, D., Chen, J.S., Paez-Espino, D., Ma, E., Witte, I.P., Cofsky, J.C., Kyrpides, N.C., Banfield, J.F. & Doudna, J.A. Programmed DNA destruction by miniature CRISPR-Casl4 enzymes. Science 362, 839-842 (2018).Karvelis, T., Bigelyte, G., Young, J.K., Hou, Z., Zedaveinyte, R., Budre, K., Paulraj, S., Djukanovic, V., Gasior, S., Silanskas, A., Venclovas, C. & Siksnys, V. PAM recognition by miniature CRISPR-Casl2f nucleases triggers programmable double-stranded DNA target cleavage. Nucleic Acids Res. 48, 5016-5023 (2020).Wu, W.Y., Mohanraju, P., Liao, C., Adiego-Perez, B., Creutzburg, S.C.A., Makarova, K.S., Keessen, K., Lindeboom, T.A., Khan, T.S., Prinsen, S., Joosten, R., Yan, W.X., Migur, A., Laffeber, C., Scott, D.A., Lebbink, J.H.G., Koonin, E.V., Beisel, C.L. & van der Oost, J. The miniature CRISPR-Casl2m effector binds DNA to block transcription. Mol. Cell 82, 4487- 4502 e4487 (2022).Chen, W., Ma, J., Wu, Z., Wang, Z., Zhang, H., Fu, W ., Pan, D., Shi, J. & Ji, Q. Casl2n nucleases, early evolutionary intermediates of type V CRISPR, comprise a distinct family of miniature genome editors. Mol. Cell 83, 2768-2780 e2766 (2023).Richter, M.F., Zhao, K.T., Eton, E., Lapinaite, A., Newby, G.A., Thuronyi, B.W., Wilson, C., Koblan, L.W., Zeng, J., Bauer, D.E., Doudna, J.A. & Liu, D.R. Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Nat. BiotechnoL 38, 883-891 (2020).Rees, H.A., Wilson, C., Doman, J.L. & Liu, D.R. Analysis and minimization of cellular RNA editing by DNA adenine base editors. Sci. Adv. 5, eaax5717 (2019).Kim, D., Bae, S., Park, J., Kim, E., Kim, S., Yu, H.R., Hwang, J., Kim, J. I. & Kim, J.S. Digenome-seq: genome-wide profiling of CRISPR-Cas9 off-target effects in human cells. Nat. Methods 12, 237-243, 231 p following 243 (2015).Tsai, S.Q., Nguyen, N.T., Malagon-Lopez, J., Topkar, V.V., Aryee, M.J. & Joung, J.K. CIRCLE-seq: a highly sensitive in vitro screen for genome-wide CRISPR-Cas9 nuclease off- targets. Nat. Methods 14, 607-614 (2017).Petri, K., Kim, D.Y., Sasaki, K.E., Canver, M.C., Wang, X., Shah, H., Lee, H., Horng, J.E., Clement, K., Iyer, S., Garcia, S.P., Guo, J. A., Newby, G.A., Pinello, L., Liu, D.R., Aryee, M.J., Musunuru, K., Keith Joung, J. & Pattanayak, V. Global-scale CRISPR gene editor specificity profiling by ONE-seq identifies population-specific, variant off-target effects. BioRxiv (2021). Kleinstiver, B.P., Tsai, S.Q., Prew, M.S., Nguyen, N.T., Welch, M.M., Lopez, J.M., McCaw, Z.R., Aryee, M.J. & Joung, J.K. Genome-wide specificities of CRISPR-Cas Cpfl nucleases in human cells. Nat. Biotechnol. 34, 869-874 (2016).Bae, S., Park, J. & Kim, J.S. Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30, 1473-1475 (2014).Schneider, T.D. & Stephens, R.M. Sequence logos: a new way to display consensus sequences. Nucleic Acids Res. 18, 6097-6100 (1990).Sternberg, S.H., LaFrance, B., Kaplan, M. & Doudna, J. A. Conformational control of DNA target cleavage by CRISPR-Cas9. Nature 527, 110-113 (2015).Chen, J.S., Dagdas, Y.S., Kleinstiver, B.P., Welch, M.M., Sousa, A. A., Harrington, L.B., Sternberg, S.H., Joung, J.K., Yildiz, A. & Doudna, J.A. Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature 550, 407-410 (2017).Bravo, J.P.K., Liu, M.S., Hibshman, G.N., Dangerfield, T.L., Jung, K., McCool, R.S., Johnson, K.A. & Taylor, D.W. Structural basis for mismatch surveillance by CRISPR-Cas9. Nature 603, 343-347 (2022).Russ, W.P., Figliuzzi, M., Stocker, C., Barrat-Charlaix, P., Socolich, M., Kast, P., Hilvert, D., Monasson, R., Cocco, S., Weigt, M. & Ranganathan, R. An evolution-based model for designing chorismate mutase enzymes. Science 369, 440-445 (2020).Karvelis, T., Druteika, G., Bigelyte, G., Budre, K., Zedaveinyte, R., Silanskas, A., Kazlauskas, D., Venclovas, C. & Siksnys, V. Transposon-associated TnpB is a programmable RNA-guided DNA endonuclease. Nature 599, 692-696 (2021).Geurts, A.M., Yang, Y., Clark, K.J., Liu, G., Cui, Z., Dupuy, A.J., Bell, J.B., Largaespada, D.A. & Hackett, P.B. Gene transfer into genomes of human cells by the sleeping beauty transposon system. Mol. Ther. 8, 108-117 (2003).Zayed, H., Izsvak, Z., Walisko, O. & Ivies, Z. Development of hyperactive sleeping beauty transposon vectors by mutational analysis. Mol. Ther. 9, 292-304 (2004).Yant, S.R., Park, J., Huang, Y., Mikkelsen, J.G. & Kay, M.A. Mutational analysis of the N- terminal DNA-binding domain of sleeping beauty transposase: critical residues for DNA binding and hyperactivity in mammalian cells. Mol. Cell. Biol. 24, 9239-9247 (2004).Lampe, D.J., Akerley, B.J., Rubin, E.J., Mekalanos, J. J. & Robertson, H.M. Hyperactive transposase mutants of the Himarl mariner transposon. Proc. Natl. Acad. Sci. U. S. A. 96, 11428-11433 (1999).Anzalone, A.V., Randolph, P.B., Davis, J.R., Sousa, A.A., Koblan, L.W., Levy, J.M., Chen, P.J., Wilson, C., Newby, G.A., Raguram, A. & Liu, D.R. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149-157 (2019).Gehrke, J.M., Cervantes, O., Clement, M.K., Wu, Y., Zeng, J., Bauer, D.E., Pinello, L. & Joung, J.K. An APOBEC3A-Cas9 base editor with minimized bystander and off-target activities. Nat. Biotechnol. 36, 977-982 (2018).Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760 (2009).Danecek, P., Bonfield, J.K., Liddle, J., Marshall, J., Ohan, V., Pollard, M.O., Whitwham, A., Keane, T., McCarthy, S.A., Davies, R.M. & Li, H. Twelve years of SAMtools and BCFtools. Gigascience 10 (2021).Malinin, N.L., Lee, G., Lazzarotto, C.R., Li, Y ., Zheng, Z., Nguyen, N.T., Liebers, M., Topkar, V.V., lafrate, A.J., Le, L.P., Aryee, M.J., Joung, J.K. & Tsai, S.Q. Defining genome-wide CRISPR-Cas genome-editing nuclease activity with GUIDE-seq. Nat. Protoc. 16, 5592-5615 (2021).Crooks, G.E., Hon, G., Chandonia, J.M. & Brenner, S.E. WebLogo: a sequence logo generator. Genome Res. 14, 1188-1190 (2004).

Claims

CLAIMS1. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises at least one mutation of E84R, D96R, M102R, F137K, V159K, N281R, Q324R, Y327K, K392R, H368R, H368K, T406R, K481R, S437K, L393K, L351TDAT355KVSSPT361GS363P, K179MQKF183,LVHT274DKEW>LVHKQQAW, or a combination thereof.

2. The engineered endonuclease of claim 1, wherein the enOgeuIscB comprises 2 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K.

3. The engineered endonuclease of claim 1, wherein the enOgeuIscB comprises 3 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K.

4. The engineered endonuclease of claim 1, wherein the enOgeuIscB comprises 4 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K.

5. The engineered endonuclease of claim 1, wherein the enOgeuIscB comprises 5 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K.

6. The engineered endonuclease of claim 1, wherein the enOgeuIscB comprises 6 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K.

7. The engineered endonuclease of claim 1, wherein the enOgeuIscB comprises 7 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K.

8. The engineered endonuclease of claim 1, wherein the enOgeuIscB comprises 8 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K.

9. The engineered endonuclease of claim 1, wherein the enOgeuIscB comprises 9 mutations of M102R, F137K, V159K, N281R, Q324R, Y327K, H368R, H368K, S437K, and L393K.

10. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368R or H368K, and L393K mutations.

11. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, and L393K mutations.

12. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K, and L393K mutations.

13. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, and E84R mutations.

14. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, E84R, and D96R mutations.

15. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, E84R, D96R, Y100H, and K156R mutations.

16. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, K392R, and T406R mutations.

17. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, and L351TDAT355KVSSPT361GS363P mutations.

18. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, and K179MQKF183 mutations.

19. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, and LVHT274DKEW>LVHKQQAW mutations.

20. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, S430R, K481R, and LVHT274DKEW>LVHKQQAW mutations.

21. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R,Y327K, H368K or H368R, L393K, S430R, K481R, L351TDAT355KVSSPT361GS363P, and K179MQKF183 mutations.

22. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, S430R, K481R, and LVHT274DKEW>LVHKQQAW mutations.

23. An engineered endonuclease comprising an engineered OgeuIscB (enOgeuIscB) endonuclease, wherein the enOgeuIscB comprises M102R, F137K, V159K, N281R, Q324R, Y327K, H368K or H368R, L393K, S430R, K481R, L351TDAT355KVSSPT361GS363P, K179MQKF183, and LVHT274DKEW>LVHKQQAW mutations.

24. An engineered endonuclease comprising a sequence of one of SEQ ID NOs: 1-69.

25. The engineered endonuclease of any one of claims 1 to 24, wherein the enOgeuIscB comprises at least one nuclear localization signal.

26. The engineered endonuclease of claim 25, wherein the nuclear localization signal is located at the N-terminus and / or C-terminus of the enOgeuIscB.

27. The engineered endonuclease of any one of claims 1 to 26, further comprising at least one nickase mutation.

28. The engineered endonuclease of any one of claims 1 to 27, further comprising a D60A, H246A, El 92 A mutation, or a combination thereof.

29. The engineered endonuclease of any one of claims 1 to 28, further comprising a deaminase.

30. The engineered endonuclease of claim 29, wherein the deaminase is a cytosine deaminase.

31. The engineered endonuclease of claim 29, wherein the deaminase is an adenosine deaminase.

32. The engineered endonuclease of claim 29, wherein the deaminase comprises TadA8e.

33. The engineered endonuclease of any one of claims 29 to 32, further comprising a glycosylase.

34. The engineered endonuclease of any one of claims 29 to 33, further comprising a glycosylase inhibitor.

35. The engineered endonuclease of any one of claims 29 to 34, wherein the deaminase is fused to the engineered endonuclease.

36. The engineered endonuclease of any one of claims 1 to 35, further comprising a reverse transcriptase.

37. The engineered endonuclease of claim 36, wherein the reverse transcriptase is fused to the engineered endonuclease.

38. An engineered coRNA comprising a C24U, A88G, and / or C138U mutation; a U31-U45 deletion; a truncation in one or more Pl, P2, P3, P4, P5, JI, J2 regions of a coRNA; a sephadex- binding aptamer; U191-G222 replaced with GAAACAGAGAGAGTT; G147-U156 replaced with a GAAA tetramer or a sephadex-binding aptamer; or a combination thereof.

39. The engineered coRNA of claim 38 comprising a C24U, A88G, and / or C138U mutation40. The engineered coRNA of claim 38 or 39 comprising a U31-U45 deletion.

41. The engineered coRNA of any one of claims 38 to 40 comprising a truncation in one or more Pl, P2, P3, P4, P5, JI, J2 regions of a coRNA.

42. The engineered coRNA of any one of claims 38 to 41 comprising a sephadex-binding aptamer.

43. The engineered coRNA of claim 42, wherein the sephadex-binding aptamer is inserted between a P4 and JI region.

44. The engineered coRNA of any one of claims 38 to 43 comprising U191 -G222 replaced with GAAACAGAGAGAGTT.

45. The engineered coRNA of any one of claims 38 to 44 comprising G147-U156 replaced with a GAAA tetramer, a sephadex-binding aptamer, or a combination thereof.

46. An engineered coRNA comprising SEQ ID NOs:71-86, or a combination thereof.

47. The engineered coRNA of 27 to 36, further comprising a prime editing guide RNA.

48. The engineered coRNA of claim 47, wherein the prime editing guide RNA is attached to the 3 ’ end of the engineered coRNA.

49. A nucleic acid encoding for at least one engineered endonuclease of any one of claims 1 to 37 and / or at least one engineered coRNA of any one of claims 38 to 48.

50. An expression construct encoding for at least one engineered endonuclease of any one of claims 1 to 37 and / or at least one engineered coRNA of any one of claims 38 to 48.

51. A composition comprising at least one engineered endonuclease of any one of claims 1 to 38.

52. A composition comprising at least one engineered coRNA of any one of claim 38 to 48.

53. A composition comprising at least one engineered endonuclease of any one of claims 1 to 37 and at least one engineered coRNA of any one of claim 38 to 48.

54. A composition comprising at least one engineered endonuclease of claim 36 or 37 and a prime editing guide RNA.

55. A composition comprising the nucleic acid of claim 49.

56. A composition comprising the expression construct of claim 50.

57. The composition of any one of claims 51 to 56, further comprising a delivery moiety.

58. A method of genetically engineering a cell, the method comprising delivering to the cell at least one engineered endonuclease of any one of claims 1 to 37 and / or at least one engineered coRNA of any one of claims 38 to 48.

59. A method of genetically engineering a cell, the method comprising delivering to the cell an effective amount of the nucleic acid of claim 49, the expression construct of claim 50, or the composition of any one of claims 51 to 57.

60. A method of genetically engineering a target gene in a cell, the method comprising delivering to the cell at least one engineered endonuclease of any one of claims 1 to 37 and / or at least one engineered coRNA of any one of claims 38 to 48.

61. A method of genetically engineering a target gene in a cell, the method comprising delivering to the cell an effective amount of the nucleic acid of claim 49, the expression construct of claim 50, or the composition of any one of claims 51 to 57.

62. A method of base editing a target nucleic acid in a cell, the method comprising delivering to the cell at least one engineered endonuclease of any one of claims 29 to 37.

63. A method of base editing a target nucleic acid in a cell, comprising delivering to the cell at least one engineered coRNA of any one of claims 38 to 48.

64. A method of base editing a target nucleic acid in a cell, the method comprising delivering to the cell at least one engineered endonuclease of any one of claims 29 to 37 and at least one engineered coRNA of any one of claims 38 to 48.

65. The method of claims 62 to 64, further comprising delivering a glycosylase and / or glycosylase inhibitor to the cell.

66. A method of prime editing a target nucleic acid in a cell, the method comprising delivering to the cell at least one engineered endonuclease of any one of claims 36 or 37.

67. A method of prime editing a target nucleic acid in a cell, the method comprising delivering to the cell at least one engineered coRNA of any one of claims 38 to 46.

68. The method of claim 66 or 67, further comprising delivering to the cell at least one prime editing guide RNA.

69. A method of prime editing a target nucleic acid in a cell, the method comprising delivering to the cell at least one engineered endonuclease of any one of claims 1 to 37 and a reverse transcriptase.

70. The method of claim 69, further comprising administering to the cell at least one prime editing guide RNA.

71. A method of treating a patient, the method comprising administering to the patient an effective amount of at least one engineered endonuclease of any one of claims 1 to 37 and / or at least one engineered coRNA of any one of claims 38 to 48.

72. A method of treating a patient, the method comprising administering to the patient an effective amount of the nucleic acid of claim 49, the expression construct of claim 50, or the composition of any one of claims 51 to 57.

Images