Vascular smooth muscle cell-tropic capsid, adeno-associated virus vector, pharmaceutical composition, therapeutic method, method for transfecting nucleic acid, and method for producing capsid

Abstract

The present invention provides a vascular smooth muscle cell-tropic capsid which has an enhanced rate of infection to a vascular smooth muscle.　The present invention provides a capsid of an adeno-associated virus, the capsid being characterized in that a factor of tropism for vascular smooth muscle cells is added thereto. The factor of tropism is a peptide that is presented on the surface of a virus particle.　The peptide includes any one of "RENKLGE", "KDTVPRE", "TETGKTA", "STPAAKE", "RNREPTE", "ARNGTTE", "KDTAERQ", "NRGGNQD", "NRPDTNS", and "TRATSQE" in cases where vascular smooth muscle cells of a mouse (Mus musculus) are to be infected. The peptide includes any one of "NRPETNP", "SHDPSKE", "SEIRRDQ", "NRNKHEE", "RQDNKME", "THPPAPQ", "TRGGGSE", "TEKQTNS", "RVTMGSE", and "ATKNQNE" in cases where vascular smooth muscle cells of human (Homo sapiens) are to be infected.

Description

Vascular smooth muscle cell-targeting capsid, adeno-associated virus vector, pharmaceutical composition, treatment method, nucleic acid transfer method, and capsid production method

[0001] The present invention relates to a vascular smooth muscle cell-targeting capsid of an adeno-associated virus that targets vascular smooth muscle cells, an adeno-associated virus vector, a pharmaceutical composition, a treatment method, a nucleic acid transfer method, and a method for producing the capsid.

[0002] Since its discovery in 1965, adeno-associated virus (hereinafter referred to as "AAV") has been known to exist as a non-pathogenic virus. AAV is a virus that is unable to replicate independently and can replicate within host cells only by relying on adenoviruses, herpes viruses, etc., and has not been reported to be pathogenic in humans. For this reason, in recent years, AAV has been expected to be used in gene therapy and regenerative medicine as a safe gene transfer tool due to its non-pathogenicity. To date, more than 100 types of wild-type AAV have been identified. These AAVs differ in the amino acid sequence of the envelope protein (hereinafter referred to as "capsid") that constitutes the outermost surface. Differences in the amino acid sequence of this capsid are related to the organ and cell type infection specificity (hereinafter referred to as "tropism") of each AAV.

[0003] Patent Document 1 describes an AAV capsid protein that has one or more modifications in its amino acid sequence relative to the parent AAV capsid protein, and that, when present in an AAV virion, confers increased infectivity of one or more muscle cells compared to the infectivity of muscle cells by an AAV virion containing the unmodified parent AAV capsid protein.

[0004] Special Publication No. 2020-537508

[0005] However, although the AAV using the capsid protein described in Patent Document 1 has increased infectivity in skeletal muscle, its infectivity in vascular smooth muscle is insufficient.

[0006] The present invention has been made in view of the above circumstances, and an object of the present invention is to solve the above-mentioned problems.

[0007] The vascular smooth muscle cell-targeting capsid of the present invention is an adeno-associated virus capsid to which a tropism factor for vascular smooth muscle cells has been added. The vascular smooth muscle cell-targeting capsid of the present invention is characterized in that the tropism factor is a peptide displayed on the surface of the virus particle. The vascular smooth muscle cell-targeting capsid of the present invention is characterized in that, when targeting vascular smooth muscle cells of mice (Mus musculus), the peptide comprises any of the amino acid sequences of "RENKLGE" (SEQ ID NO: 5), "KDTVPRE" (SEQ ID NO: 6), "TETGKTA" (SEQ ID NO: 7), "STPAAKE" (SEQ ID NO: 8), "RNREPTE" (SEQ ID NO: 9), "ARNGTTE" (SEQ ID NO: 10), "KDTAERQ" (SEQ ID NO: 11), "NRGGNQD" (SEQ ID NO: 12), "NRPDTNS" (SEQ ID NO: 13), and "TRATSQE" (SEQ ID NO: 14). The vascular smooth muscle cell-targeting capsid of the present invention is characterized in that, when the target of infection is human (Homo sapiens) vascular smooth muscle cells, the peptide comprises any of the amino acid sequences of "NRPETNP" (SEQ ID NO: 15), "SHDPSKE" (SEQ ID NO: 16), "SEIRRDQ" (SEQ ID NO: 17), "NRNKHEE" (SEQ ID NO: 18), "RQDNKME" (SEQ ID NO: 19), "THPPAPQ" (SEQ ID NO: 20), "TRGGGSE" (SEQ ID NO: 21), "TEKQTNS" (SEQ ID NO: 22), "RVTMGSE" (SEQ ID NO: 23), and "ATKNQNE" (SEQ ID NO: 24). The adeno-associated virus vector of the present invention is characterized in comprising the vascular smooth muscle cell-targeting capsid. The pharmaceutical composition of the present invention is characterized in comprising the vascular smooth muscle cell-targeting capsid. The pharmaceutical composition of the present invention is characterized in that the vascular smooth muscle cell-targeting capsid contains a composition for treating a disease. The therapeutic method of the present invention is a method for treating animals, which is characterized by introducing a therapeutic composition into the vascular smooth muscle cells using the vascular smooth muscle cell-targeting capsid.The nucleic acid transfer method of the present invention is characterized by introducing a nucleic acid molecule into the vascular smooth muscle cells using the adeno-associated virus vector.The method for producing a capsid of the present invention is a method for producing an adeno-associated virus capsid, characterized in that a tropism factor for vascular smooth muscle cells is added.

[0008] According to the present invention, a vascular smooth muscle cell-targeting capsid can be provided that has a tropism factor for vascular smooth muscle cells added thereto, thereby enabling the production of an AAV with a higher infection rate for vascular smooth muscle cells than conventional capsids.

[0009] Fig. 1 is a conceptual diagram of a method for producing a vascular smooth muscle-tropic AAV according to an example of the present invention. Fig. 2 is a conceptual diagram showing the structure of a plasmid other than the AAV capsid according to an example of the present invention. Fig. 3 is a conceptual diagram showing the structure of an AAV sequence-added capsid plasmid according to an example of the present invention. Fig. 4 is a photograph and graph showing the results of screening in mouse aortic smooth muscle cells according to an example of the present invention. Fig. 5 is a photograph and graph showing the results of screening in human cerebral small vessel smooth muscle cells according to an example of the present invention.

[0010] <Embodiment> Adeno-associated virus (AAV) vectors enable long-term, safe gene transfer. This is due to their non-pathogenicity and low integration into the host genome. Furthermore, AAV vectors do not proliferate in the absence of a helper virus, and the number of transgene copies per cell gradually decreases in actively dividing cells, further contributing to safety. Additionally, AAV vectors are characterized by their long-term storage potential and the ability to transfer genes highly efficiently into both dividing and non-dividing cells. Meanwhile, in recent years, the need for gene therapy specific to vascular smooth muscle has increased for a wide range of diseases, including cerebral small vessel disease. However, until now, no AAV vectors have been developed with clear tropism toward vascular smooth muscle. In other words, conventional AAV vectors have not been able to achieve high gene transfer efficiency into vascular smooth muscle. Furthermore, no AAV vectors have been developed that are intended for gene transfer into vascular smooth muscle.

[0011] For this reason, the present inventors conducted extensive experiments, randomly altering a portion of the amino acid sequence of the capsid protein, which is the surface structure of AAV, and infected cultured vascular smooth muscle cells with the modified protein. These cultured vascular smooth muscle cells were then collected and analyzed to identify an AAV amino acid sequence with tropism suitable for gene transfer into vascular smooth muscle. This resulted in the successful production of an AAV capsid with a tropism factor for vascular smooth muscle cells. Using this vascular smooth muscle cell-targeting capsid, it became possible to produce an AAV with clear tropism for vascular smooth muscle, thereby completing the present invention.

[0012] More specifically, wild-type AAV is a single-stranded DNA virus with a diameter of 25 nm, composed of two genes: Rep, which is mainly involved in replication, and Cap, which mainly encodes the capsid that forms the surface. Furthermore, since AAV does not have the ability to self-replicate, it is necessary to simultaneously introduce an adenovirus-derived helper gene into cultured cells for propagation. In this embodiment, an AAV was prepared by inserting seven random amino acids into a site predicted to be located at the outermost layer of the amino acid sequence of the AAV capsid. This AAV was infected into cultured vascular smooth muscle cells, and the AAV genome was recovered and amplified by PCR. This AAV was then re-prepared through a screening cycle, resulting in the preparation of an AAV vector with excellent gene transfer efficiency into vascular smooth muscle. Details of the vascular smooth muscle cell-targeting capsid according to this embodiment, as well as AAVs containing the same, pharmaceutical compositions, treatment methods, nucleic acid transfer methods, and capsid production methods are described below.

[0013] [Vascular smooth muscle cell-targeting capsid, capsid production method, AAV vector] The vascular smooth muscle cell-targeting capsid according to this embodiment is an AAV capsid characterized by the addition of a tropism factor for vascular smooth muscle cells.

[0014] In this embodiment, vascular smooth muscle cells are the main cells of the smooth muscle that constitute mature blood vessels. Vascular smooth muscle composed of these vascular smooth muscle cells regulates blood vessel diameter by contracting and relaxing. When smooth muscle contracts, the blood vessel diameter narrows and blood pressure increases.

[0015] In this embodiment, the tropism factor for vascular smooth muscle cells may be a peptide presented on the surface of the viral particle. More specifically, this peptide serving as a tropism factor for vascular smooth muscle cells may be presented on the surface of the capsid after AAV assembly. For example, this peptide may be added to a position between amino acids 587 and 588 of VP1 of wild-type AAV2, which is known to be presented on the surface of the capsid. Furthermore, this peptide does not have to be added to this position as long as it is presented on the surface of the capsid. In addition, to avoid steric hindrance, this peptide may be added via a sequence such as a linker or spacer. The sequence of this linker or spacer may be, for example, a sequence commonly known to those skilled in the art, such as a GS linker having a sequence of "GGGGS" x 3.

[0016] More specifically, in this embodiment, when the target of infection is vascular smooth muscle cells of mice (Mus musculus), the peptide may include any of the amino acid sequences of "RENKLGE" (SEQ ID NO: 5), "KDTVPRE" (SEQ ID NO: 6), "TETGKTA" (SEQ ID NO: 7), "STPAAKE" (SEQ ID NO: 8), "RNREPTE" (SEQ ID NO: 9), "ARNGTTE" (SEQ ID NO: 10), "KDTAERQ" (SEQ ID NO: 11), "NRGGNQD" (SEQ ID NO: 12), "NRPDTNS" (SEQ ID NO: 13), and "TRATSQE" (SEQ ID NO: 14). Of these, the peptides of SEQ ID NOs: 5 and 6 are particularly highly specific to mouse vascular smooth muscle cells and can be preferably used.

[0017] Furthermore, in this embodiment, when the target of infection is human (Homo sapiens) vascular smooth muscle cells, the peptide may contain, for example, any of the amino acid sequences of "NRPETNP" (SEQ ID NO: 15), "SHDPSKE" (SEQ ID NO: 16), "SEIRRDQ" (SEQ ID NO: 17), "NRNKHEE" (SEQ ID NO: 18), "RQDNKME" (SEQ ID NO: 19), "THPPAPQ" (SEQ ID NO: 20), "TRGGGSE" (SEQ ID NO: 21), "TEKQTNS" (SEQ ID NO: 22), "RVTMGSE" (SEQ ID NO: 23), and "ATKNQNE" (SEQ ID NO: 24). Of these, the peptides of SEQ ID NOs: 15 and 16 are particularly highly directed toward human vascular smooth muscle cells and can be preferably used.

[0018] The capsid production method according to this embodiment is a method for producing AAV capsids, characterized by the addition of a tropism factor for vascular smooth muscle cells. That is, the vascular smooth muscle cell-targeted capsid according to this embodiment can be configured to produce one to which a tropism factor for vascular smooth muscle cells, such as the peptide described above, has been added. Therefore, the DNA or RNA sequence from which the capsid according to this embodiment is translated may contain a codon sequence from which the peptide described above is translated. That is, the DNA or RNA required for AAV production as the tropism factor according to this embodiment may contain a codon from which the peptide sequence is translated. This codon may be optimized, for example, to be more easily translated depending on the species of organism, facilitating the production of the AAV described below.

[0019] Furthermore, the AAV vector according to this embodiment is characterized by comprising this vascular smooth muscle cell-targeting capsid. That is, the AAV vector according to this embodiment may be composed of a DNA or RNA sequence for various AAVs that, upon translation, generates a vascular smooth muscle cell-targeting capsid and assembles it with other AAV components. Here, the AAV vector according to this embodiment may be prepared as a single AAV vector containing the DNA or RNA sequence of the capsid to which the above-mentioned peptide has been added. Alternatively, as shown in the examples below, it may be provided as an AAV vector whose capsid is not translated and a vector whose capsid has the above-mentioned peptide added thereto.

[0020] As the type of AAV used in the AAV vector according to this embodiment, AAV2 or AAV9 is particularly suitable because it confers tropism to vascular smooth muscle. In addition, a cross between multiple AAVs, an artificially produced AAV, another type of AAV, an AAV with mutations, etc. may also be used.

[0021] The AAV vector and AAV production method according to this embodiment can be produced using techniques common to those skilled in the art by intracellularly translating the above-mentioned AAV vector together with a helper gene derived from adenovirus, herpesvirus, etc. to generate AAV virus particles, which can then be purified by various techniques such as ultracentrifugation. The produced AAV can be stored for long periods of time using techniques common to those skilled in the art, for example, by placing it in a specific preservation solution, or by drying it and refrigerating or freezing it.

[0022] [Pharmaceutical Composition] The medical composition (medicine, pharmaceutical composition) according to this embodiment is characterized by comprising the above-mentioned vascular smooth muscle cell-targeting capsid. Specifically, the pharmaceutical composition according to this embodiment is a vascular smooth muscle cell-targeting capsid containing a disease treatment composition, and is characterized by introducing this treatment composition into vascular smooth muscle cells. In other words, the pharmaceutical composition according to this embodiment delivers into vascular smooth muscle cells a substance (therapeutic composition) that treats a vascular disease for which vascular smooth muscle cells are the treatment target.

[0023] More specifically, the nucleic acid molecule is introduced into vascular smooth muscle cells using an AAV vector equipped with a vascular smooth muscle cell-targeting capsid. By transcribing, translating, or otherwise enabling the nucleic acid molecule to function in vascular smooth muscle cells, the effects of pharmaceutical gene therapy and the like can be achieved. That is, in this embodiment, the nucleic acid molecule may be a therapeutic composition. This makes it possible to produce therapeutic proteins, such as enzymes, structural proteins, functional proteins, metabolites, and other pharmacological substances required for diseases, or to regulate gene expression, thereby improving pathological conditions. Furthermore, in addition to the above-mentioned therapeutic proteins, the nucleic acid molecule can also be a pharmaceutical drug, such as an antisense nucleic acid molecule, siRNA, or ribozyme. Furthermore, gene therapy can be performed via an action on a gene or pathway whose expression is to be regulated. In this way, the AAV vector of this embodiment can be used as a tool for treating diseases.

[0024] Furthermore, the pharmaceutical composition of this embodiment may contain a drug, which is a therapeutic composition other than nucleic acids, within the vascular smooth muscle cell-targeting capsid. This drug may be a small molecule drug, an antibody drug, a neurotransmitter, a hormone, other drugs, a health-promoting drug, a nutritional supplement, or the like, for the various diseases, disorders, and symptoms (hereinafter simply referred to as "diseases") associated with vascular smooth muscle cells listed below. In other words, the vascular smooth muscle cell-targeting capsid of this embodiment can also be used as a vascular smooth muscle cell-targeting DDS (Drug Delivery System).

[0025] The target of the medical composition according to this embodiment may be a disease related to vascular smooth muscle cells, etc. More specifically, the medical composition according to this embodiment can be used for treating, for example, cerebral small vessel disease (cerebral SVD).

[0026] Cerebral small vessel disease according to this embodiment is a broad concept and is classified into Types 1 to 6. Type 1 is a lifestyle-related disease of arteriosclerosis, with typical pathological conditions including fibrinoid necrosis, lipohyaline degeneration, microplaques, microaneurysms, etc. Type 2 is cerebral amyloid angiopathy. Type 3 is a hereditary cerebral small vessel disease, and includes Fabry disease, CADASIL (cerebral autosomal dominant arteriopathies with subcortical infarcts and leukoencephalopathy), CARASIL (cerebral autosomal recessive arteriopathies with subcortical ischaemic strokes and leukoencephalopathy), and CARASAL (cathepsin A related arteriopathies with strokes and leukoencephalopathy). Type 4 is an immune-mediated small vessel disease, such as Wegener's granulomatosis, Churg-Strauss syndrome, and IgA vasculitis. Type 5 is venous collagenosis. Type 6 is other diseases, such as post-radiotherapy vasculitis and non-amyloidotic microvascular degeneration. More specifically, the medical composition according to this embodiment can be used in gene therapy for hereditary cerebral small vessel diseases in which a single gene abnormality is present congenitally, such as Faby disease and CADASIL.

[0027] In addition, the medical composition according to this embodiment can also be used to treat diseases other than cerebral small vessel disease that involve pathologies related to vascular smooth muscle cells. Treatment of these diseases may involve, for example, the removal of atheromatous plaques of oxidized LDL associated with systemic arteriosclerosis by the immune system or the like. Alternatively, the composition can be used in treatments to remove abnormal proteins such as beta-amyloid that have accumulated in vascular smooth muscle cells. Furthermore, treatments such as increasing vascular plasticity or controlling the permeability of the blood-brain barrier are also possible.

[0028] The medical composition according to this embodiment may also contain any pharmaceutically acceptable carrier, such as a liposome carrier, colloidal gold particles, polypeptide, lipopolysaccharide, polysaccharide, or lipid membrane.

[0029] Furthermore, the medical composition according to this embodiment may contain, as a pharmaceutically acceptable carrier, for example, physiological saline, an isotonic solution containing glucose or other auxiliary agents, such as D-sorbitol, D-mannose, D-mannitol, sodium chloride, etc. Furthermore, it can be administered together with an appropriate solubilizing agent, for example, alcohol, specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, nonionic surfactants such as polysorbate 80™ and HCO-50, etc. Furthermore, it may further contain an appropriate excipient, etc.

[0030] The medical composition according to the present invention may also contain a suitable pharmaceutically acceptable carrier to prepare a pharmaceutically acceptable carrier. The carrier may include a biocompatible material such as silicone, collagen, or gelatin. The carrier may also be provided as an emulsion. Furthermore, the medical composition according to the present invention may contain any one or any combination of pharmaceutical additives, such as diluents, flavorings, preservatives, excipients, disintegrants, lubricants, binders, emulsifiers, and plasticizers.

[0031] The administration route of the medical composition according to this embodiment is not particularly limited, and it can be administered parenterally or orally. Parenteral administration can be, for example, intravenous, intraarterial, nasal, subcutaneous, intradermal, intramuscular, or intraperitoneal administration, or direct administration to cerebral blood vessels, etc. The pharmaceutical agent for vascular smooth muscle according to the embodiment of the present invention can be formulated using a pharmaceutically acceptable carrier well known in the art in an administration form suitable for parenteral or oral administration.

[0032] When the medical composition according to this embodiment is used for the above-mentioned treatment, the administration interval and dosage can be selected and changed as appropriate depending on various conditions, such as the state of the disease and the condition of the subject. The single dose and number of administrations of the medical composition according to this embodiment can be selected and changed as appropriate depending on the purpose of administration, as well as various conditions, such as the age and weight of the patient, and the symptoms and severity of the disease. The number and duration of administration may be just one time, or may be administered once to several times a day for several weeks, and the condition of the disease may be monitored, and then administration may be repeated or repeated depending on the condition.

[0033] In addition, the medical composition according to this embodiment can be used in combination with other compositions. The composition of the present invention may be administered simultaneously with the other compositions, or may be administered at intervals, with no particular restriction on the order of administration. In addition, in the embodiment of the present invention, the period during which the disease is improved or alleviated is not particularly limited, and may be temporary, or may be for a certain period of time.

[0034] [Therapeutic Method, Drug Discovery Method] The therapeutic method according to this embodiment is a method for treating animals, characterized in that a medical composition containing the above-mentioned vascular smooth muscle cell-targeting capsid is introduced into vascular smooth muscle cells. When gene therapy is performed, the nucleic acid introduction method according to this embodiment may involve introducing a nucleic acid molecule into vascular smooth muscle cells using an AAV vector containing the above-mentioned vascular smooth muscle cell-targeting capsid. Alternatively, if a drug is contained in the above-mentioned vascular smooth muscle cell-targeting capsid, the drug may be introduced into vascular smooth muscle cells to treat a disease.

[0035] Specifically, the pharmaceutical agent for vascular smooth muscle according to the embodiment of the present invention can also be used in animal therapy. The animal may be, for example, a mammal such as a mouse (Mus musculus), rat, ferret, hamster, guinea pig, rabbit, dog, cat, sheep, pig, cow, horse, human (Homo sapiens), or a non-human primate such as a monkey or ape. In addition to mammals, the pharmaceutical agent may also include fish, birds including poultry, reptiles, etc.

[0036] That is, the pharmaceutical for vascular smooth muscle according to the embodiment of the present invention can be used not only for the treatment of humans but also for the treatment of various animals, the promotion of growth in livestock, etc. In countries including Japan where the treatment methods performed by doctors are not industrially applicable, the treatment method according to the present embodiment may exclude the treatment for humans.

[0037] In addition, the pharmaceutical agent for vascular smooth muscle according to the embodiment of the present invention can be used to treat a part of the body of an animal, or an organ or tissue extracted or excreted from an animal. Furthermore, this treatment is in a broad sense, and can be applied to culture in a bioreactor or model animal, culture of cultured organs for human transplantation, etc.

[0038] Furthermore, by introducing a nucleic acid molecule into vascular smooth muscle cells using an AAV vector containing the above-described vascular smooth muscle cell-targeting capsid according to this embodiment, it is possible to treat disease model cells or to prepare disease model cells themselves for use in drug discovery. In this case, the nucleic acid molecule is translated in the cytoplasm, allowing the effect of a medical composition on the disease model to be confirmed.

[0039] Alternatively, the AAV vector according to this embodiment can be used to create disease model animals. In this case, since AAV genes are difficult to transfer into the nucleus, a reverse transcriptase gene or the like may be included so that it can be incorporated into the nucleus. In this way, the AAV vector according to this embodiment can be used for drug discovery for the development of gene therapy for human diseases.

[0040] The above-described configuration can achieve the following effects. Conventionally, there has been hope for treatment using non-pathogenic AAV vectors. However, as described above, conventional AAVs have not been found to have a high efficiency of gene transfer into vascular smooth muscle, and none have shown clear vascular smooth muscle tropism. Therefore, there has been a technical need for AAVs aimed at gene transfer into vascular smooth muscle for the treatment of vascular diseases.

[0041] In contrast, the vascular smooth muscle cell-tropic capsid according to the present embodiment has a tropism factor for vascular smooth muscle cells added thereto, making it possible to produce an AAV with a higher infection rate for vascular smooth muscle cells than conventional AAV vectors. That is, it is possible to provide an AAV vector with superior tropism for gene transfer into vascular smooth muscle cells than conventional AAV vectors.

[0042] This enables effective gene transfer into vascular smooth muscle for the treatment of vascular diseases. Specifically, by loading any gene into the AAV vector of this embodiment and administering it, improved gene transfer efficiency into vascular smooth muscle can be expected. Furthermore, the AAV vector of this embodiment can be loaded with a substance that serves as a therapeutic agent for a disease and used for the treatment. Therefore, effective gene therapy for vascular diseases is expected. In particular, effective treatment can be expected by sufficient gene transfer for hereditary cerebral small vessel disease, in which a single gene abnormality is congenitally present, and for the treatment of vascular diseases such as cerebral infarction. Furthermore, AAV vectors themselves are non-pathogenic and do not have the ability to self-replicate. Therefore, in tissues with poor division ability, such as vascular smooth muscle, sustained therapeutic effects due to long-term expression can be expected.

[0043] The pharmaceutical according to the embodiment of the present invention can be used in combination with other compositions, etc. The composition of the present invention may be administered, sprayed, applied, etc. simultaneously with other compositions. In addition, the AAV vector can also be used for purposes other than pharmaceuticals.

[0044] The AAV vector according to the embodiment of the present invention will be described in more detail below as an example based on experiments, but this example is merely an example and is not intended to be limiting.

[0045] [Materials and Methods] In this example, wild-type AAV2 and AAV9 were used to carry out artificial modifications by inserting seven random amino acids between the 587th and 588th amino acids in the sequence of the capsid protein VP1, which is thought to protrude from the surface, mainly in the Cap region encoding the capsid, and screening was performed using cultured vascular smooth muscle cells.

[0046] Specifically, in this example, an adeno-associated virus vector conferred tropism to vascular smooth muscle cells was prepared by repeating the following screening process multiple times: (1) A construct using the sequences of SEQ ID NOS: 1, 2, and 3 was used to add a randomized amino acid sequence of 7 amino acids to a portion of the capsid protein, which is the surface structure of the AAV vector. (2) An AAV having a capsid with the randomized amino acid sequence added was prepared and used to infect cultured vascular smooth muscle cells. (3) Vascular smooth muscle cells infected with the AAV were recovered using the sequences of SEQ ID NOS: 1, 2, and 4, and the relationship between the amino acid sequence of the capsid of the infectious virus and infectivity was analyzed. (4) As a result, an amino acid sequence added to the capsid protein of an AAV that has high infectivity for vascular smooth muscle cells (high tropism, excellent gene transfer) was identified as a tropism factor for vascular smooth muscle cells. Details of the production and screening of this AAV vector are described below.

[0047] (Preparation of Artificially Modified AAV2) As shown in Figure 2, Assembly-Activating Protein (AAP), encoded by a portion of Cap, is also necessary for AAV particle formation. Therefore, for the purpose of expressing AAP, a plasmid (pUC-GW-Amp_Rep2_Cap9Stop_AAP, 6633 bp) was prepared by modifying the pUC-GW-Amp vector (manufactured by Azenta Life Sciences) so that a mutation resulting in a stop codon was present only in the capsid protein reading frame of Cap of AAV9 (Genbank AY530579.1) (synthesis requested from GENEWIZ). That is, this plasmid expresses Rep and AAP but does not express capsid protein, and therefore is hereinafter referred to as the "non-capsid plasmid."

[0048] Next, a template sequence for inserting a random sequence of 7 amino acids between positions 587 and 588 of the AAV2 capsid protein VP1 was prepared (synthesis was requested from Azenta Life Sciences). This template sequence is shown in SEQ ID NO: 1. For the assembly described below, this template sequence was prepared by changing the "CTC" of the restriction enzyme XhoI recognition site from the wild-type strain sequence in Genbank NC_001401.2 to "CTT" and by changing "GTC" to "GTT" to create a new recognition site for the restriction enzyme HpaI.

[0049] Then, for the template sequence, a linear chain into which a random sequence had been inserted was amplified by PCR using the Fwd primer "CAGACGCCGCGGCCCTCGAGCA" shown in SEQ ID NO: 2 and the Rev primer "GCCTTGTGTGTTAACATCTGCGGTAGCTGCTTGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGCCTCTCTGGAGGTTGGTAGA." The base "N" in SEQ ID NO: 3 is random (arbitrary) and is either A, G, C, or T. That is, 21 bases correspond to the translation of 7 codons of random peptides. PCR was carried out using Toyobo Co., Ltd.'s #KMM-201 KOD One (registered trademark) PCR Master Mix, with 30 cycles of 98°C for 10 seconds, 58°C for 5 seconds, and 68°C for 1 second to obtain a PCR product.

[0050] As shown in Figure 3, pAAV-2Cap-acceptor, an AAV2 capsid plasmid into which this PCR product is to be incorporated, was prepared (synthesis was requested from Azenta Life Sciences). This plasmid was linearized by treating with restriction enzymes XhoI and HpaI. Similarly, the above-mentioned PCR product was also linearized by treating with restriction enzymes XhoI and HpaI. These were recombined with NEBuilder HiFi DNA Assembly Master Mix (registered trademark) (New England Biolabs, #E2621) to form a circular construct (hereinafter referred to as the "sequence-added capsid plasmid").

[0051] Similarly, an AAV9 capsid plasmid, pAAV-9Cap-acceptor, was prepared (synthesis was requested from Azenta Life Sciences), and this was also recombined with the PCR product to prepare a sequence-added capsid plasmid.

[0052] Thereafter, in a manner similar to AAV production methods commonly known to those skilled in the art, the above-mentioned "non-capsid plasmid," the AAV2 or AAV9 "sequence-added capsid plasmid," and an adenovirus-derived helper plasmid (Agilent Technologies) were transfected into 293 cells (ATGC), and AAV was collected 72 hours later. These produced AAVs are hereinafter referred to as "randomized AAVs."

[0053] (Screening of candidate sequences) The randomized AAVs thus prepared were administered to culture media containing mouse aortic smooth muscle cells (ATCC, #CRL2797) or human brain small vessel smooth muscle cells (Human Brain Vascular Smooth Muscle Cells, ScienceCell Research Laboratories, #1100). Cells infected with AAV express the fluorescent protein mCherry. After 72 hours, mCherry-expressing cells were collected using a cell sorter (BD FACSAria™ II cell sorter, Becton Dickinson). DNA from the collected cells was extracted using DNeasy Blood & Tissue Kit (50) (Qiagen, #69504).

[0054] The extracted DNA was used as a template for PCR amplification using the collection Fwd primer "CAGACGCCGCGGCCCTCGAGCA" shown in SEQ ID NO: 2 and the Rev primer "AGAACGCCTTGTGTGTTAACATCTGCG" shown in SEQ ID NO: 4. PCR was performed using Toyobo, #KMM-201, KOD One (registered trademark) PCR Master Mix, with 30 cycles of 98°C for 10 seconds, 58°C for 5 seconds, and 68°C for 1 second. This amplified product was digested with restriction enzymes XhoI and HpaI, as in the above example. Then, the pAAV-2Cap-acceptor plasmid shown in Figure 3 or the pAAV-9Cap-acceptor plasmid for AAV9 (not shown) was recombined with NEBuilder HiFi DNA Assembly Master Mix (registered trademark) to form a circular plasmid. This circular plasmid contains either a sequence added to the sequence of the capsid plasmid or a randomized sequence.

[0055] This circular plasmid was purified and administered again to cultured smooth muscle cells together with the non-capsid plasmid and helper plasmid, as described above, for infection. After 72 hours, the cells were harvested, and mCherry-expressing cells were recovered as described above. Sequence analysis was performed (outsourced to FASMAC) on each of the harvested mCherry-expressing cells to confirm the DNA sequence of the peptide site added to the capsid. These infection and harvest cycles, or screening, were performed multiple times to examine the distribution of the inserted peptide sequence. Hereinafter, the period up to the first cell sorter harvest is referred to as the "first screening," the period up to the second cell sorter harvest is referred to as the "second screening," and subsequent screenings are referred to as the "third," "fourth," etc.

[0056] [Results] (Experimental Results of AAV Tropical to Vascular Smooth Muscle) Figure 4 shows the results of screening mouse aortic smooth muscle cells. Figure 4(a) is a photograph showing PCR products confirmed during the first recovery. The two lanes to the left of the DNA marker lane, underlined and marked with "2," are positive controls for AAV2, and the next lane, underlined and marked with "9," is a positive control for AAV9. This positive control was obtained by PCR of the randomized AAV as prepared and examining the expression of bands. The next two lanes from the left show PCR products for AAV2 and AAV9, respectively, obtained when mCherry-positive cells in the first screening were recovered using a cell sorter. These products are underlined and marked with "2" and "9," respectively. After recovery using the cell sorter, a band was observed for AAV2, but not for AAV9. This suggests that only AAV2 infects mouse aortic smooth muscle cells.

[0057] 4(b) is a graph showing the proportion of sequences obtained after infection of mouse aortic smooth muscle cells and subsequent recovery. In the second screening cycle of infection of cultured cells and subsequent recovery, the proportion of the top two sequences in terms of frequency increased. In other words, the proportion (frequency) of cells infected with AAV2 capsids carrying these top two peptide sequences was high among the recovered cells. Specifically, in screening using mouse vascular smooth muscle cells, during the second screening, it was found that the amino acid sequences "RENKLGE" (SEQ ID NO: 5), "KDTVPRE" (SEQ ID NO: 6), "TETGKTA" (SEQ ID NO: 7), "STPAAKE" (SEQ ID NO: 8), "RNREPTE" (SEQ ID NO: 9), "ARNGTTE" (SEQ ID NO: 10), "KDTAERQ" (SEQ ID NO: 11), "NRGGNQD" (SEQ ID NO: 12), "NRPDTNS" (SEQ ID NO: 13), and "TRATSQE" (SEQ ID NO: 14), in order of frequency from top to bottom, were added between the 587th and 588th amino acids of VP1 of wild-type AAV2. Furthermore, as the screening cycle continued, the proportions of the top two sequences in terms of frequency further increased, but the frequencies of the sequences below them sometimes changed.

[0058] Figure 5 shows the results of screening human cerebral small vessel smooth muscle cells. Figure 5(a) is a photograph showing PCR products for AAV2 and AAV9 when mCherry-positive cells from the first screening were collected using a cell sorter. These products are underlined and indicated by "2" and "9," respectively. As with the mouse aortic smooth muscle cells described above, after collection using the cell sorter, a band was observed for AAV2, but no band was observed for AAV9. This suggests that only AAV2 infects human cerebral small vessel smooth muscle cells as well.

[0059] 5(b) is a graph showing the proportion of sequences obtained after infection and recovery of human cerebral small vessel smooth muscle cells, similar to FIG. 4(b). In this screening cycle using human cerebral small vessel smooth muscle cells, the top two sequences in terms of frequency were predominant from the first round. Specifically, in the screening using human vascular smooth muscle cells, the amino acid sequences "NRPETNP" (SEQ ID NO: 15), "SHDPSKE" (SEQ ID NO: 16), "SEIRRDQ" (SEQ ID NO: 17), "NRNKHEE" (SEQ ID NO: 18), "RQDNKME" (SEQ ID NO: 19), "THPPAPQ" (SEQ ID NO: 20), "TRGGGSE" (SEQ ID NO: 21), "TEKQTNS" (SEQ ID NO: 22), "RVTMGSE" (SEQ ID NO: 23), and "ATKNQNE" (SEQ ID NO: 24), in order of frequency from top to bottom, were found to be added between the 587th and 588th amino acids of wild-type AAV2 VP1. Furthermore, as the screening cycle continued, the proportion of the top two sequences in terms of frequency increased further and became almost dominant.

[0060] As described above, by artificially inserting the sequences corresponding to the codons of these peptides into AAV, excellent gene transfer efficiency into vascular smooth muscle was achieved.

[0061] It goes without saying that the configurations and operations of the above-described embodiments are merely examples, and can be modified as appropriate within the scope of the present invention.

[0062] According to the present invention, by using an AAV vector present in blood as a vascular smooth muscle-specific biomarker, it is expected that pharmaceuticals for the early diagnosis and treatment of vascular smooth muscle will be provided, and the present invention is industrially applicable.

Claims

1. A vascular smooth muscle cell-targeting capsid, which is an adeno-associated virus capsid having a tropism factor for vascular smooth muscle cells added thereto.

2. The vascular smooth muscle cell-targeting capsid according to claim 1, characterized in that the tropism factor is a peptide displayed on the surface of the viral particle.

3. The vascular smooth muscle cell-targeting capsid according to claim 2, characterized in that the peptide, when used to infect vascular smooth muscle cells of mice (Mus musculus), comprises any one of the amino acid sequences of "RENKLGE" (SEQ ID NO: 5), "KDTVPRE" (SEQ ID NO: 6), "TETGKTA" (SEQ ID NO: 7), "STPAAKE" (SEQ ID NO: 8), "RNREPTE" (SEQ ID NO: 9), "ARNGTTE" (SEQ ID NO: 10), "KDTAERQ" (SEQ ID NO: 11), "NRGGNQD" (SEQ ID NO: 12), "NRPDTNS" (SEQ ID NO: 13), and "TRATSQE" (SEQ ID NO: 14).

4. The vascular smooth muscle cell-targeting capsid of claim 2, characterized in that the peptide, when targeting human (Homo sapiens) vascular smooth muscle cells, includes any of the amino acid sequences of "NRPETNP" (SEQ ID NO: 15), "SHDPSKE" (SEQ ID NO: 16), "SEIRRDQ" (SEQ ID NO: 17), "NRNKHEE" (SEQ ID NO: 18), "RQDNKME" (SEQ ID NO: 19), "THPPAPQ" (SEQ ID NO: 20), "TRGGGSE" (SEQ ID NO: 21), "TEKQTNS" (SEQ ID NO: 22), "RVTMGSE" (SEQ ID NO: 23), and "ATKNQNE" (SEQ ID NO: 24).

5. An adeno-associated virus vector comprising a vascular smooth muscle cell-targeting capsid according to any one of claims 1 to 4.

6. A pharmaceutical composition comprising a vascular smooth muscle cell-targeting capsid according to any one of claims 1 to 4.

7. A pharmaceutical composition comprising the vascular smooth muscle cell-targeting capsid according to any one of claims 1 to 4, which comprises a composition for treating a disease.

8. A method for treating an animal, comprising introducing a therapeutic composition into said vascular smooth muscle cells using the vascular smooth muscle cell-targeting capsid described in any one of claims 1 to 4.

9. A method for introducing a nucleic acid, comprising introducing a nucleic acid molecule into said vascular smooth muscle cells using the adeno-associated virus vector described in claim 5.

10. A method for producing an adeno-associated virus capsid, comprising adding a tropism factor for vascular smooth muscle cells.

Images