Soybean transformant having reduced storage protein content and use thereof

Abstract

The present invention relates to a soybean transformant having a reduced storage protein content and use thereof and, more specifically, to: a transgenic soybean plant which is transformed with a recombinant plant RNA interference (RNAi) vector comprising a gene encoding β-conglycinin and / or glycinin protein(s) to thereby have inhibited expression of β-conglycinin and / or glycinin gene(s); and a method for producing a useful protein, using the transgenic plant.

Description

Soybean transformant with reduced storage protein content and use thereof

[0001] The present invention relates to a soybean transformant with reduced storage protein content and its use.

[0002] Soybean seeds are composed of 40% protein, a significantly higher protein content than other plant species, making them ideal for overexpressing useful proteins. The William 82 variety, in particular, has the advantage of being exportable as a foreign variety. However, because soybeans' endogenous storage proteins account for over 70% of their total protein, the accumulation of useful proteins, which are exogenous proteins, is hindered.

[0003] RNAi (RNA interference) is a method of selectively degrading mRNA containing specific information by inserting double-stranded small interfering RNA (siRNA), thereby blocking the pathway from mRNA to protein synthesis. In RNAi, siRNA transcribed from an inserted vector acts as a mediator of protein expression suppression. Therefore, the vector must persist over generations to maintain the protein suppression trait. While transformants created using RNAi are not exempt from being classified as GMOs (Genetically Modified Organisms), they are expected to be capable of knocking down large amounts of proteins because they completely block the mRNA-protein pathway.

[0004] Meanwhile, Korean Patent Publication No. 2011-0044211 discloses 'Improved protein production and storage in plants', and Korean Patent Publication No. 2014-0123783 discloses 'Transformant with improved composition of storage protein and method for producing same', but 'Soybean transformant with reduced storage protein content and use thereof' of the present invention is not described.

[0005] The present invention was derived from the above-mentioned needs, and the present inventors used RNAi technology to produce soybean transgenic plants in which the expression of glycinin (11S) and β-conglycinin (7S), which are soybean storage proteins, was suppressed, either individually or in combination, in order to increase the accumulation of exogenous useful proteins by suppressing endogenous storage proteins. Thereafter, the soybean transgenic plants were crossed with soybean plants producing thioredoxin (TRX) using a traditional method, and the production of thioredoxin was confirmed. As a result, it was confirmed that the production of thioredoxin in soybean plants produced through crossing with transgenic plants in which the expression of storage proteins was suppressed increased by about three times compared to the production of thioredoxin-producing soybean plants, thereby completing the present invention.

[0006] To solve the above problem, the present invention provides a method for producing a soybean transgenic plant having a reduced storage protein content in a seed, the method comprising the steps of: transforming a soybean plant cell with a recombinant plant RNAi (RNA interference) vector containing a storage protein coding gene to suppress the expression of the storage protein coding gene; and redifferentiating a transformed soybean plant from the transformed soybean plant cell.

[0007] In addition, the present invention provides a soybean transgenic plant with reduced storage protein content and a transformed seed thereof produced by the above method.

[0008] In addition, the present invention provides a method for mass-producing useful proteins from soybean seeds, comprising the step of artificially crossing a soybean transgenic plant with a reduced storage protein content with a soybean plant overexpressing a useful protein.

[0009] In addition, the present invention provides a method for producing a transgenic plant having increased productivity of useful protein in seeds compared to the parent plant, comprising the step of artificially crossing a soybean transgenic plant having a reduced storage protein content as a parent plant and a soybean plant overexpressing a useful protein as a parent plant.

[0010] In the present invention, soybean plants with suppressed storage protein expression are intended to be cultivated and utilized as transgenic soybeans for the production of useful proteins. Furthermore, transgenic soybeans with suppressed storage protein expression can be further transformed to overexpress useful proteins, or crossed with transformants overexpressing useful proteins to produce high yields of exogenous useful proteins.

[0011] Figure 1 shows the pCKLSL-Glycinin vector used to knock down the glycinin gene, the upper part showing a part of the sequence of the glycinin gene inserted into the vector, and the lower part showing a schematic diagram of the pCKLSL-Glycinin vector.

[0012] Figure 2 shows the pCKLSL-Glycinin / Conglycinin vector used to knock down the glycinin / conglycinin gene, the upper part showing a part of the sequence of the glycinin / conglycinin gene inserted into the vector, and the lower part showing a schematic diagram of the pCKLSL-Glycinin / Conglycinin vector.

[0013] Figure 3 shows the pCKLSL-Conglycinin vector used to knock down the conglycinin gene, the upper part showing a part of the sequence of the conglycinin gene inserted into the vector, and the lower part showing a schematic diagram of the pCKLSL-Conglycinin vector.

[0014] Figure 4 shows the Agrobacterium-mediated soybean transformation method, (a-1) is the appearance of soybean explants planted on CCM medium after Agrobacterium inoculation, (a-2) is the appearance after 5 days, (b) is the appearance of explants transferred to SIM-① medium and shoots induced for 14 days, (c) is the appearance of shoots cultured after transferring explants to SIM-② and selected with PPT for 14 days, (d) is the appearance of explants transferred to SEM medium for shoot elongation and cultured until shoots reached about 10 cm, (e) is the appearance of shoots transferred to RM medium for root induction and cultured for 21 days, (f) is the appearance of rooted shoots transferred to soil and acclimatized, (g) is the appearance of transformed plants, (h) is the result of PPT leaf painting, the leaves of non-transformants are sensitive to PPT (h-1), The leaves of the transformants showed resistance (h-2).

[0015] Figure 5 shows the results of confirming the introduced gene in a T0 transgenic plant by PCR.

[0016] Figure 6 shows the results of Southern blot analysis to confirm the copy number of the introduced gene in the T0 transgenic plant.

[0017] Figure 7 shows the results of confirming the expression level of the knockout target gene in T0 transgenic plants using qRT-PCR.

[0018] Figure 8 shows the results of analyzing the expression of storage proteins in T1 seeds of transgenic plants.

[0019] Figure 9 shows the results of comparing the productivity of TRX by crossing transgenic plants in which glycinin expression is inhibited with soybean plants producing thioredoxin (TRX).

[0020] Figure 10 shows the results of comparing the productivity of TRX in the progeny seeds of a cross between a transgenic plant in which glycinin expression is inhibited and a soybean plant producing thioredoxin (TRX).

[0021] In order to achieve the object of the present invention, the present invention provides a method for producing a soybean transgenic plant having a reduced storage protein content in a seed, the method comprising the steps of: transforming a soybean plant cell with a recombinant plant RNAi (RNA interference) vector containing a storage protein coding gene to suppress the expression of the storage protein coding gene; and redifferentiating a transformed soybean plant from the transformed soybean plant cell.

[0022] In the method for producing a soybean transgenic plant with reduced storage protein content in seeds according to the present invention, the storage protein may be at least one selected from the group consisting of β-conglycinin and glycinin proteins, but is not limited thereto.

[0023] In the present invention, the beta-conglycinin (7S) is a heterogeneous glycoprotein with a molecular weight ranging from 150 to 240 kDa, and is a protein composed of various combinations of three highly negatively charged subunits identified as alpha, alpha' and beta.

[0024] In addition, the above glycinin (11S) is a large protein with a molecular weight of approximately 360 kDa, and is a hexameric protein composed of various combinations of five major subunits identified as G1, G2, G3, G4, and G5.

[0025] In addition, the beta-conglycinin coding gene according to the present invention may include alpha, alpha' and beta subunit coding genes, and may preferably be, but is not limited to, the alpha subunit coding gene of Glyma20g28650 or Glyma20g38660, the alpha' subunit coding gene of Glyma10g39150 and the beta subunit coding gene of Glyma20g28460 or Glyma20g28640.

[0026] In addition, the glycinin coding gene according to the present invention may include G1, G2, G3, G4 and G5 subunit coding genes, and preferably, may be a gene of Glyma03g32030 (G1), Glyma03g32020 (G2), Glyma1g34780 (G3), Glyma10g04280 (G4) and Glyma13g18450 (G5), but is not limited thereto. Information on each of the above subunit coding genes can be found at SoyBase (https: / www.soybase.org / ).

[0027] The term "recombinant" as used herein refers to a cell that replicates a heterologous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. A recombinant cell may express a gene or gene fragment not found in the cell's native form, either in sense or antisense form. A recombinant cell may also express a gene found in the cell's native form, but in a modified form that has been reintroduced into the cell by artificial means.

[0028] Also, the term "RNAi" is an abbreviation for RNA interference, and refers to a phenomenon in which, when an agent that causes RNAi, such as double-stranded RNA (also called dsRNA), is introduced into a cell, homologous mRNA is specifically degraded to inhibit the synthesis of a gene product. RNAi as used here has the same meaning as the agent that causes RNAi. The RNAi is a process in which short double-stranded RNA selectively degrades target mRNA corresponding to its own base sequence to stop transcription and protein synthesis of the target gene, and there are two methods for producing siRNA (small interfering RNA) used to specifically induce this RNAi phenomenon: a method of directly synthesizing siRNA in vitro and then introducing it into cells through transfection, and a method of utilizing an shRNA (short hairpin RNA) expression vector that is designed to express siRNA in cells. When an shRNA expression vector is expressed in cells through transformation using a method that utilizes an expression vector, the sense and antisense sequences of the target base sequence are positioned between a linker and expressed from the promoter, and through this, a small hairpin structured shRNA is synthesized. The shRNA synthesized in this way is degraded by an RNase Ⅲ enzyme called Dicer present in the cell, and is converted into an siRNA of about 21 to 23 nucleotides with a precise structure, and it is obvious to those skilled in the art that it binds to a protein complex called RISC (RNA-induced Silencing Complex) to degrade the target mRNA (Plant Cell Physiol. "Simple RNAi Vectors for Stable and Transient Suppression of Gene Function in Rice" 45(4): 490-95 (2004)).

[0029] As used herein, the term "vector" refers to a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases, can integrate into the genome itself. In particular, a "vector for plant transformation" refers to a recombinant DNA molecule comprising a desired coding sequence and the appropriate nucleic acid sequences necessary for expressing the operably linked coding sequence in a particular plant host organism. Promoters, enhancers, termination signals, and polyadenylation signals usable in plant cells are well known to those skilled in the art. The vector of the present invention is most preferably a vector for plant transformation, but is not limited thereto.

[0030] The vector of the present invention can typically be constructed as a vector for cloning or expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the recombinant vector of the present invention is an expression vector and uses a prokaryotic cell as a host, it generally includes a strong promoter capable of driving transcription (e.g., pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.), a ribosome binding site for initiating translation, and a transcription / translation termination sequence.

[0031] In the present invention, the term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions, developmental states, or cell differentiation. A constitutive promoter may be preferred in the present invention because transformant selection can be performed in various tissues at various stages. Therefore, a constitutive promoter does not limit the possibilities of selection.

[0032] In the method for producing a soybean transgenic plant with reduced storage protein content in seeds according to the present invention, the storage protein coding gene may preferably be operably linked downstream of a beta-conglycinin promoter, but is not limited thereto.

[0033] The beta-conglycinin promoter according to the present invention may be composed of the base sequence of SEQ ID NO: 1, but is not limited thereto.

[0034] The recombinant vector may preferably include one or more selectable markers. These markers are typically nucleic acid sequences with properties that can be selected chemically. These markers include any gene that can distinguish transformed cells from non-transformed cells. These marker genes may include, but are not limited to, a dominant drug resistance gene.

[0035] The recombinant vector of the present invention can be constructed using methods well known to those skilled in the art. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques.

[0036] Any host cell known in the art, including microalgae and microorganisms, can be used as the host cell for stably and continuously cloning and expressing the vector of the present invention, and examples thereof include Bacillus strains such as Escherichia coli JM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, Bacillus subtilis, Bacillus thuringiensis, and enteric bacteria and strains such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species.

[0037] In addition, when transforming the vector of the present invention into a eukaryotic cell, yeast (e.g., Saccharomyce cerevisiae), insect cells, human cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN, and MDCK cell lines), and plant cells can be used as host cells, and plant cells are preferred.

[0038] The "plant cell" used in plant transformation may be any plant cell. Plant cells include cultured cells, cultured tissues, cultured organs, and whole plants. "Plant tissue" includes differentiated or undifferentiated plant tissues, such as, but not limited to, roots, stems, leaves, pollen, seeds, and cancer tissues, as well as various types of cells used in culture, such as single cells, protoplasts, shoots, and callus tissues. Plant tissues may be in planta, organ culture, tissue culture, or cell culture.

[0039] Plant transformation refers to any method for transferring DNA into plants. Such transformation methods do not necessarily require regeneration and / or tissue culture. Transformation of plant species is now commonplace, encompassing both dicotyledonous and monocotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA of the present invention into a suitable progenitor cell. Methods include calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., 1987, Plant Mol. Biol. 8, 363-373), electroporation of protoplasts (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection with plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185), particle bombardment of various plant elements (DNA or RNA-coated) (Klein TM et al., 1987, Nature 327, 70), Agrobacterium tumefaciens by infiltration of plants or transformation of mature pollen or microspores tumefaciens) mediated gene transfer, infection by (non-complete) viruses (EP 0 301 316), etc. A preferred method according to the present invention comprises Agrobacterium mediated DNA transfer.

[0040] Additionally, in the manufacturing method of the present invention, any method known in the art can be used to regenerate transformed plants from the transformed plant cells. The transformed plant cells must be regenerated into whole plants. Techniques for regenerating mature plants from callus or protoplast cultures are well known in the art for numerous different species.

[0041] The present invention also provides a soybean transgenic plant with reduced storage protein content produced by the above method and a transformed seed thereof.

[0042] The soybean transgenic plant with reduced storage protein content according to the present invention may be a plant in which the β-conglycinin and / or glycinin protein coding gene is knocked down by RNA interference.

[0043] The present invention also provides a method for mass-producing useful proteins from soybean seeds, comprising the step of artificially crossing a soybean transgenic plant with a reduced storage protein content with a soybean plant overexpressing a useful protein.

[0044] In the method for mass-producing useful proteins from soybean seeds of the present invention, the useful proteins may be at least one selected from the group consisting of antigens, antibodies, cell receptors, enzymes, structural proteins, serum, and cell proteins, but are not limited thereto.

[0045] Additionally, the artificial crossbreeding can be performed according to a method known to those skilled in the art in relation to plant breeding.

[0046] A method for mass-producing useful proteins from soybean seeds according to one embodiment of the present invention utilizes the fact that the content of useful proteins is significantly increased in the offspring generation after artificial crossing of a soybean transgenic plant having a reduced storage protein content according to the present invention with a soybean plant overexpressing useful proteins, compared to a soybean plant overexpressing useful proteins.

[0047] The present invention also provides a method for producing a transgenic plant having increased productivity of useful protein in seeds compared to the parent plant, comprising the step of artificially crossing a soybean transgenic plant having a reduced storage protein content as a parent plant and a soybean plant overexpressing a useful protein as a parent plant.

[0048]

[0049] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0050]

[0051] Materials and Methods

[0052] 1. Vector construction and Agrobacterium preparation

[0053] RNAi-mediated transformation was performed by constructing a hairpin-structured insert to produce double-stranded siRNA and inserting it into the pCKLSL vector. A total of three vectors were constructed: pCKLSL-Glycinin (sense size: 320 bp; SEQ ID NO: 2) targeting glycinin (11S), pCKLSL-Glycinin / Conglycinin (sense size: 364 bp; SEQ ID NO: 3) targeting glycinin and conglycinin (7S), and pCKLSL-Conglycinin (sense size: 174 bp; SEQ ID NO: 4) targeting conglycinin. The 11S target gene was extracted from Monica et al. (Plant Physiology, 2011, 156; 330-345), and the 7S target gene was constructed by the Crop Molecular Breeding and Transformation Laboratory at Dong-A University. In addition, the bar gene, a selection gene, was introduced into the T-DNA.

[0054] Plasmid DNA was extracted from the E. coli strain DH5α into which T-DNA was introduced, and the extracted plasmid DNA was inserted into the EHA105 strain, an Agrobacterium competent cell, by electroporation. EHA105 was cultured in liquid SOC medium for 1 hour and then cultured on solid medium containing antibiotics for 2 days. A single colony selected through antibiotics was cultured in liquid YEP medium and OD 600nmWhen the value reached 0.5 to 0.7, storage stock and inoculation stock were made and stored at -70℃.

[0055]

[0056] 2. Plant body

[0057] The William 82 variety (Glycine maxcv. Williams 82) used in the transformation experiment was selected from seeds that were smooth, unwrinkled, and free of spots or blemishes when viewed with the naked eye. First, 100 selected seeds were transferred to a petri dish (90 mm × 20 mm) lined with sterilized 3 mm filter paper, and the seed surfaces were initially disinfected with chlorine gas generated by mixing 95 ml of 8% sodium hypochlorite solution and 5 ml of 12 N hydrochloric acid in a desiccator for 20 hours. The gas-disinfected seeds were stored in a petri dish sealed with parafilm.

[0058] Two days before inoculation, to prevent seed splitting, 5 ml of sterilized triple-distilled water was added to the gas-sterilized seeds and incubated in a humidified atmosphere at 25°C for 20 hours.

[0059] One day before inoculation, the seeds that had completed wet culture were divided equally into three 50-mL conical tubes. 45 mL of 1% sodium hypochlorite and 3–5 drops of Tween 20 were added to each tube, and the tubes were stirred for 10 minutes to perform secondary seed disinfection. After secondary disinfection, the disinfection solution was discarded and the seeds were washed three times for 10 minutes each with sterilized, distilled water. After washing, the seeds were soaked in sterilized water at 25°C for 20 hours.

[0060]

[0061] 3. Preparing Agrobacterium for Inoculation

[0062] One day before inoculation, 300-500 ㎕ of Agrobacterium stock for inoculation was added to 200 ㎖ of liquid YEP medium supplemented with 100 ppm of kanamycin and 25 ppm of rifampicin and incubated in a shaking incubator at 28℃ and 200 rpm until OD 600nm The culture was incubated for 15 to 18 hours until the OD value reached 0.5 to 0.6. On the day of inoculation, the OD of the culture 600nm After measuring the values, the culture medium was dispensed into three 50-mL centrifuge tubes, 30 mL each. Centrifuged at 20°C, 7,000 rpm for 15 min, the liquid YEP medium was removed, and only the Agrobacterium pellet was used. The pellet was dissolved in 15 mL of liquid CCM medium and used as a dipping solution (Table 1).

[0063]

[0064]

[0065] 4. Production of transgenic soybean plants

[0066] 4-1. Agrobacterium inoculation

[0067] On the day of inoculation, seeds soaked in sterile water were split vertically with a scalpel blade (Feather, No. 11), leaving only the explant with the embryonic axis attached, and the seed coat was removed. The hypocotyl half and the hypocotyl attached to the explant were completely removed, and the area where the embryonic axis was was wounded 10 times with a scalpel blade soaked in soaking solution. The wounded explants were placed in the soaking solution and co-cultured for 30 minutes. The moisture from the co-cultured seeds was removed in a Petri dish lined with sterile 3 mm filter paper and tissue paper. Seven explants were inoculated onto the solid CCM dispensed in each Petri dish, with sterile 3 mm filter paper placed on the dish, with the adaxial direction facing the medium. The petri dish was sealed with a micropore and cultured for 5 days at 25°C under 18 h / 6 h (light / dark) conditions.

[0068]

[0069] 4-2. Washing and new shoot induction

[0070] After 5 days of co-culture, two-thirds of the hypocotyl and the hypocotyl were removed from the explants using a scalpel blade (Feather, No. 15). The explants were evenly distributed into 50-mL conical tubes and washed three times with 45-mL liquid SIM medium for 10 minutes each to remove Agrobacterium. Afterwards, the moisture from the explants was removed in a Petri dish lined with sterilized 3-mm filter paper. Six explants were plated on solid SIM-① distributed in each Petri dish with the adaxial direction facing upward. The Petri dishes were sealed with micropores and cultured for 2 weeks at 25°C under 18 h / 6 h (light / dark) conditions. After 2 weeks of culture, half of the explants and the primary shoot were removed using a scalpel blade (Feather, No. 15). Five to six sections were placed on solid SIM-② containing 10 mg / L of PPT, sealed in a microporous petri dish, and cultured for two weeks at 25°C under conditions of 18 hours / 6 hours (light / dark).

[0071]

[0072] 4-3. Induction of shoot elongation and rooting

[0073] After two weeks of culture, the browned shoots and the lower part of the pads were removed by thinly shaving with a scalpel blade (Feather, No. 15). Five to six explants were placed on solid SEM plates in Petri dishes (100 mm × 40 mm) to ensure nutrient absorption. Subculture was performed every two weeks with fresh SEM medium, and browned shoots and pads were removed at each subculture to ensure nutrient absorption. When the shoot grew long, two petri dishes were connected to allow the shoot to elongate sufficiently. When the shoot grew to about 10 cm, the lower part of the stem was cut diagonally with a scalpel blade (Feather, No. 11), and the bottom of the stem was treated with IBA (Indole butyric acid, 1 mg / ㎖) solution for 3 minutes. Then, 30 ㎖ was dispensed into sterilized glass test tubes (30 mm × 200 mm) and transplanted onto solid RM. The root zone was grown for about 3 weeks under conditions of 25℃, 18 hours / 6 hours (light / dark).

[0074]

[0075] 4-4. Purification and secondary selection

[0076] When the root zone grew in the RM medium, it was washed with distilled water to remove as much of the medium as possible and transplanted into a small pot (6 cm × 5.6 cm). The soil was a mixture of topsoil (10% pearl, 10% FG, 300 L, Sungro Horticulture Co., Ltd.) and vermiculite in a 3:1 ratio. The transplanted plants were acclimatized in a magenta box (25℃, 18 h / 6 h light / dark) so that they could gradually adapt to the external environment. During the acclimatization, when the stems and leaves grew, PPT leaf painting (100 mg / L) was performed on the surface of the leaves for a second selection. The plants selected in the second selection were transplanted to larger pots (20 cm × 25 cm) and grown in a greenhouse under the conditions of 25℃, 18 h / 6 h (light / dark).

[0077]

[0078] 4-5. Leaf sampling and seed harvesting

[0079] Approximately 1 g of young leaves were sampled from the T0 transgenic plants for analysis. The harvested leaves were rapidly frozen in liquid nitrogen and stored at -70°C. Finally, T1 seeds were harvested from the transgenic plants, completely dried, and stored at -20°C. The harvested seeds were used for generational expansion and protein analysis.

[0080]

[0081] 5. Confirmation of T-DNA and gene expression in transgenic plants

[0082] 5-1. PCR analysis

[0083] To confirm the introduction of the T0 transformant, PCR analysis was performed. For comparison, leaves sampled from the T0 transformant were finely ground in a mortar and pestle using liquid nitrogen, and leaves from non-transgenic plants were ground. Genomic DNAs were extracted from the finely ground leaves using the CTAB method. The extracted DNAs were analyzed by PCR to confirm whether the T-DNA was introduced into the transformant plants. PCR analysis was performed using the bar gene and the β-conglycinin promoter-sense gene sequences of pCKLSL-Glycinin, pCKLSL-Glycinin / Conglycinin, and pCKLSL-Conglycinin, which were RNAi-mediated, for pCKLSL-Glycinin. The primers used to confirm the introduction of the gene are as follows.

[0084] Primer information used to confirm gene introduction Primer name Sequence (5'→3') Sequence number Bar gene primer FTCTACCATGAGCCCAGAACG8 Bar gene primer RGAAGTCCAGCTGCCAGAAAC9 β-Conglycinin promoter primer FTCAGTTACTTATCCTTCCTCCATC10 Glycinin (sense) primer RCCCGGTACCAGCCACCGCAAAGTTTTGTGG11 Glycinin / Conglycinin (sense) primer RGCCAACAAGTTCAATGTTTGCATC12 Conglycinin (sense) primer RGCCAACAAGTTCAATGTTTGCATC13

[0085] PCR was performed using a pre-mix taq PCR kit (GenetBio) and a thermal cycler (Bio-Rad), and the size of the PCR amplification product was confirmed by loading it onto a 1% agarose gel.

[0086]

[0087] 5-2. Genomic DNA Southern blot analysis

[0088] Southern blot was performed to confirm the copy number of vectors introduced into pCKLSL-Glycinin and pCKLSL-Glycinin / Conglycinin T0 transgenic plants. Genomic DNAs were extracted from 1 g leaf samples of finely ground non-transgenic and T0 transgenic plants using the CTAB method. The extracted genomic DNA was adjusted to a concentration of 15–20 ng / ㎕. On the first day, 10X enzyme buffer was added to the DNA and treated at 4℃ for 4 hours. 5 ㎕ of enzyme (HindⅢ (Roche)) was added and treated at 4℃ for 2 minutes and 40 seconds, followed by treatment at 37℃ for 30 minutes. 5 ㎕ of HindⅢ enzyme was additionally added and treated at 4℃ for 2 minutes and 40 seconds, followed by reaction at 37℃ overnight. On the second day, the band cut by the restriction enzyme was confirmed through electrophoresis. If the restriction enzyme was well treated, the same amount of isopropanol was added and the DNA was purified by reacting at -4℃ for more than 30 minutes. 5 ㎕ of 10X loading dye was added to the DNA purified on a 0.8% agarose gel and developed at 50 V. After that, unnecessary parts of the gel were removed, and the gel was treated with a depurination solution (HCl 1.54 ㎖ + DW 198.6 ㎖) for 15 minutes, and then washed twice with sterile water. After treating with a denaturation solution (NaOH 20 g + NaCl 58.44 g) for 30 minutes, it was washed once with sterile water. The gel bands were transferred to the membrane in the following order: Glass - 3 mm bridge - gel - membrane - 3 mm filter paper (2 sheets / wet) - 3 mm filter paper (2 sheets / dry) - wiper roll (one pack) - weighted book. On the third day, the transferred membrane was treated with 2X SSC solution (sodium citrate tribasic dihydrate 88.23 g + NaCl 175.32 g, pH 7.0) for 5 minutes.After that, the membrane was completely dried using a 3 mm filter paper and UV cross-linked using a spectro Linker XL-1000 UV crosslinker. The membrane was sealed with 12 ml of DIG Easy hyb buffer and pre-hybridized (blocked) for 3 hours in a shaking incubator at 42°C and 110 rpm. After 3 hours of treatment, hybridization was performed overnight using a DIG Probe Synthesis Kit (Roche) amplified by PCR. On the 4th day, the membrane was treated with 2X SSC + 0.1% SDS buffer for 2 minutes and then with 0.5X SSC + 0.1% SDS buffer at 68°C for 30 minutes with shaking. After washing with DIG wash and block buffer set (Roche), it was developed with CDP-Star in a darkroom.

[0089]

[0090] 5-3. RT-PCR analysis

[0091] RT-PCR analysis was performed to confirm gene expression in T0 transgenic plants. RNA from transgenic and non-transgenic plants was extracted using the Plant RNA Reagent System. RT-PCR was performed using SubPrimeScript RT-PCR Premix (2X) (GeNet Bio). pCKLSL-Glycinin, pCKLSL-Glycinin / Conglycinin, and pCKLSL-Conglycinin, which were RNAi-mediated, were subjected to bar gene PCR analysis, and the use of tublin, a housekeeping gene, confirmed that RNAs from the same sample were used.

[0092] Primer information used in RT-PCR Primer name Sequence (5'→3') Sequence number Bar gene primer FAAGCACGGTCAACTTCCGTA14 Bar gene primer RGAAGTCCAGCTGCCAGAAAC9 Tublin gene primer FTGAGCAGTTCACGGCCATGCT15 Tublin gene primer RCTCGGCAGTGGCATCCTGGT16

[0093]

[0094] 5-4. Real-time PCR analysis

[0095] Real-time PCR was performed to confirm gene expression in T0 transgenic plants mediated by RNAi. In the case of pCKLSL-Glycinin, pCKLSL-Glycinin / Conglycinin, and pCKLSL-Conglycinin transformants mediated by RNAi, the expression levels of glycinin and conglycinin genes cannot be accurately confirmed by RT-PCR, which simply amplifies RNA and confirms it, because mRNA is degraded and protein expression is suppressed. Therefore, real-time PCR was used to confirm the expression levels of the genes. Real-time PCR was performed using TB Green ® The assay was performed using Premix Ex TaqTM (Takara). 96-well hard-shell PCR Plates (Bio-rad) were used, and analysis was performed using the CFX96TM Real-Time System.

[0096] Primer information used in real-time PCRPrimer nameSequence (5'→3')Sequence numberglycinin 1 primer FAGCCACAGTGCAAGGGTAAA17glycinin 1 primer RCGAACATTGCATTCTTGCGGA18glycinin 2 primer FCTCCGCAAGAATGCTATGTTCG19glycinin 2 primer RTCCTCTGGCAATGCGTTCAA20glycinin 3 primer FTCTCAGCGTGATAAGCCCAC21glycinin 3 primer RACGAACATAGCATTCTTGCGG22glycinin 4 primer FAGTGTTCGACGGTGAGCTAAG23glycinin 4 primer RTTGATACTTGAGCTGACGCACT24glycinin 5 primer FATCATCGCCCAAGGGAAAGG25glycinin 5 primer RACTGGTTCATCGCCAGTGTT26β-conglycinin α primer FACAGACTTCAATCTGTGATGC27β-conglycinin α primer RTCGAATTTGGTATCGTAGGAGGC28β-conglycinin β primer FGTCCTTAGCGGGAGAGCCAT29β-conglycinin β primer RAGTAGGACTGTTGGCTTGAGT30

[0097]

[0098] 6. Protein expression in transgenic soybean seeds

[0099] Protein analysis was performed on seeds harvested from the produced transformants. The harvested seeds were soaked in triple-distilled water for one day. The soaked soybeans were split in half, and the weight of the explants without the hypocotyl attached was measured. The explants were ground in 2 ml of sample buffer (62.5 mM Tris-HCl (pH 6.8), 2.5% SDS, 5% β-mercaptoethanol, 10% glycerol), stirred at 25°C for 1 hour, and then treated at 95°C for 10 minutes. The supernatant was then extracted by centrifugation at 12,000 rpm for 5 minutes at 25°C. The extracted supernatant was quantified, mixed with 6X loading dye, and loaded onto a gel.

[0100]

[0101] Example 1. Production of soybean transgenic plants

[0102] To produce soybean transformants with low storage protein content, a 1,465 bp glycinin gene (SEQ ID NO: 5, Figure 1), a 3,190 bp glycinin / conglycinin gene (SEQ ID NO: 6, Figure 2), and a 1,161 bp conglycinin gene (SEQ ID NO: 7, Figure 3) were introduced into the pCKLSL vector via RNAi. To knock down soybean storage proteins, Agrobacterium transformation and regeneration experiments were performed using William 82 seeds using the half-seed method (Figure 4).

[0103] As a result of transformation, 20 pCKLSL-Glycinin transgenic plants (transformation rate: 0.9%), 20 pCKLSL-Glycinin / Conglycinin transgenic plants (transformation rate: 1.41%), and 10 pCKLSLS-Conglycinin transgenic plants (transformation rate: 0.58%) were confirmed. In addition, T1 seeds were harvested from each T0 transgenic plant.

[0104]

[0105]

[0106]

[0107] Example 2. Confirmation of introduced genes in T0 transgenic plants

[0108] To confirm whether the gene was introduced into the produced transgenic plants, genomic DNAs were extracted from leaves and PCR analysis was performed. RNAi-mediated transformants were subjected to PCR using the T-DNA region, including the β-conglycinin promoter-sense gene and the bar gene. Gene introduction was confirmed in pCKLSL-Glycinin transgenic plants, and the glycinin and bar genes were finally introduced in 11 plants (Fig. 5a). pCKLSL-Glycinin / Conglycinin confirmed that the glycinin / conglycinin gene and the bar gene were finally introduced in 15 plants (Fig. 5b). In pCKLSL-Conglycinin transgenic plants, the conglycinin gene and the bar gene were finally introduced in 5 plants (Fig. 5c).

[0109] The copy numbers of the introduced genes were confirmed through Southern blot in pCKLSL-Glycinin and pCKLSL-Glycinin / Conglycinin transgenic plants mediated by RNAi. The analysis results showed that pCKLSL-Glycinin had one copy in #9, #13, #15, and #17, while #2, #8, and #16 had multiple copies (Fig. 6a). pCKLSL-Glycinin / Conglycinin had one copy in #4, #6, and #15, while #8, #17, and #18 had multiple copies (Fig. 6b).

[0110] After confirming the introduction of the gene into the transgenic plant, RT-PCR was performed to confirm the expression of the introduced gene, the bar gene, and the housekeeping gene tublin gene was used as an internal control. In addition, due to the nature of RNAi, it was difficult to accurately analyze the expression levels of the targeted glycinin and conglycinin genes simply by RT-PCR, so analysis was performed using qRT-PCR. As a result of RT-PCR, pCKLSL-Glycinin selected #2, #3, #4, #8, #9, #11, #13, #14, #15, #16, #17, and #18, and the qRT-PCR analysis results confirmed that the expression levels of the storage proteins were generally reduced in #2, #8, #9, #13, #15, #16, and #17 (Fig. 7a). pCKLSL-Glycinin / Conglycinin selected #2, #4, #5, #6, #7, #8, #9, #12, #15, #16, #17, #18, and #19 as RT-PCR results, and qRT-PCR confirmed that the expression levels of storage proteins were generally reduced in #4, #6, #8, #15, #17, and #18 (Fig. 7b). Compared to pCKLSL-Glycinin, it was confirmed that the conglycinin gene changed more rapidly. pCKLSL-Conglycinin selected #5, #6, #7, #8, #9, and #10 as RT-PCR, and qRT-PCR results confirmed that the expression levels were not overall reduced like the previous two genes, but that the target gene conglycinin α was reduced in #5 (Fig. 7c).

[0111]

[0112] Example 3. Protein expression analysis in T1 seeds

[0113] Seeds were harvested from the produced transformants and subjected to protein analysis via SDS-PAGE. Protein analysis of the T1 seeds of RNAi-mediated transformants was performed at Mediprogen. Two seeds from non-transformed plants were used for comparison with seeds of transgenic plants. The harvested seeds of pCKLSL-Glycinin and pCKLSL-Glycinin / Conglycinin were analyzed, and knockdown results were confirmed in #2 for pCKLSL-Glycinin and #4 for pCKLSL-Glycinin / Conglycinin (Fig. 8). As expected from real-time PCR, redistribution between proteins was confirmed, as evidenced by the fainter target glycinin and non-target conglycinin bands in pCKLSL-Glycinin.

[0114]

[0115] Example 4. Production of useful proteins using transgenic soybeans with knocked-down storage protein production.

[0116] We investigated whether the productivity of an exogenous protein increased when plants with suppressed expression of a storage protein were used. The T1 plants of glycinin-suppressed rice #2 by RNAi were crossed with homologous plants of a thioredoxin (TRX) overexpressing transgenic plant bred by Celltrion, and seeds were harvested. The productivity of thioredoxin in the seeds harvested by the cross (F1) was analyzed by Western blot and SDS-PAGE.

[0117] As a result, as disclosed in Fig. 9, it was confirmed that the level of thioredoxin protein produced in the cross between a transgenic plant in which glycinin expression was suppressed and a thioredoxin-producing soybean plant was about three times higher than the level of thioredoxin protein produced in the thioredoxin-producing soybean plant.

[0118] In addition, as a result of generation advancement through seed cultivation of the above hybrid, it was confirmed that the F2 seeds contained thioredoxin protein at a level approximately 10 times higher than the thioredoxin protein level of thioredoxin-producing soybean plants (Fig. 10).

Claims

1. A step of transforming soybean plant cells with a recombinant plant RNAi (RNA interference) vector containing a storage protein coding gene to suppress the expression of the storage protein coding gene; and A method for producing a soybean transgenic plant having reduced storage protein content in seeds, comprising the step of redifferentiating a transformed soybean plant from the transformed soybean plant cell.

2. A method for producing a soybean transgenic plant with reduced storage protein content in seeds, characterized in that in paragraph 1, the storage protein is at least one selected from the group consisting of beta-conglycinin and glycinin proteins.

3. A method for producing a soybean transgenic plant with reduced storage protein content in seeds, characterized in that the storage protein coding gene in paragraph 1 is operably linked downstream of a beta-conglycinin promoter.

4. A method for producing a soybean transgenic plant with reduced storage protein content in seeds, characterized in that the beta-conglycinin promoter in the third paragraph consists of the base sequence of sequence number 1.

5. A soybean transgenic plant having a reduced storage protein content in seeds produced by the method of any one of claims 1 to 4.

6. Transformed seeds of the soybean transgenic plant according to Article 5.

7. A method for mass-producing a useful protein from soybean seeds, comprising a step of artificially crossing a soybean transgenic plant according to Article 5 with a soybean plant overexpressing a useful protein.

8. A method for mass producing useful proteins from soybean seeds, characterized in that in paragraph 7, the useful proteins are at least one selected from the group consisting of antigens, antibodies, cell receptors, enzymes, structural proteins, serum, and cell proteins.

9. A method for producing a transgenic plant having increased productivity of useful proteins in seeds compared to the parent plant, comprising the step of artificially crossing a soybean transgenic plant according to Article 5 as a parent plant and a soybean plant overexpressing useful proteins as a parent plant.

Images