Method for identifying and / or regulating spinal cord and body aging

Abstract

Provided is a method for using CHIT-1 as a biomarker to measure the degree of aging of the spinal cord and body of a subject. Also provided is a method for using CHIT-1 as a target to treat, prevent or delay the aging of the spinal cord and body of a subject.

Description

Methods for identifying and / or regulating spinal cord and body aging Technical Field

[0001] The present invention relates to the field of biomedicine. Specifically, the present invention provides methods for identifying and / or regulating aging. More specifically, the present invention provides methods for identifying the degree of spinal cord and body aging by detecting CHIT-1, or for preventing, treating, or delaying spinal cord and body aging by inhibiting CHIT-1. Background Art

[0002] The spinal cord is an important component of the central nervous system, responsible for transmitting sensory signals from peripheral nerves to the brain and transmitting brain commands to effector organs, controlling a variety of physiological processes. Studies on mammalian development have elucidated how the cascade of signaling pathways regulates the development and formation of the spinal cord, thereby executing the exchange of information between the brain and the body. Similarly, studies in injury and disease models have revealed how spinal cord injury affects voluntary movement and involuntary function, leading to muscle weakness and autonomic disorders (such as difficulty breathing and swallowing), and even paralysis and respiratory failure leading to death.

[0003] As an important bridge connecting the brain and the periphery, the aging of the spinal cord will inevitably cause functional disorders of the body. However, there are still some shortcomings in the current research on spinal cord aging, such as the lack of systematic research, the unclear molecular mechanism of spinal cord aging, and the relationship between spinal cord aging and spinal cord degenerative diseases (such as amyotrophic lateral sclerosis (ALS) and sarcopenia), not to mention whether spinal cord aging can be effectively intervened.

[0004] Horizontal sections of the spinal cord can be divided into an outer white matter region and an inner gray matter region, and further divided into ventral and dorsal regions along the dorsoventral axis. Motor neurons (MNs) are located in the ventral gray matter region and comprise less than 0.4% of the total number of cells in the mammalian spinal cord, yet they are the primary neuron type controlling both voluntary and involuntary movement. With aging, both the number and function of MNs decline. However, the molecular changes and underlying mechanisms underlying MN dysfunction and atrophy associated with aging remain unclear.

[0005] White matter primarily contains glial cells and myelinated axons, responsible for rapid communication throughout the central nervous system (CNS) and integration of gray matter. Furthermore, microglia are the predominant immune cell type in both gray and white matter of the spinal cord, but whether and how microglia regulate neuronal degeneration in the aged spinal cord remains unclear.

[0006] Furthermore, most current research focuses on rodent models. However, unlike rodents, the emergence of fine motor control in primates is manifested by a significant increase in the glial-neuron ratio. Therefore, studies in rodent models cannot effectively elucidate the mechanisms of human spinal cord aging and provide intervention methods. Non-human primates (NHPs), which are similar to humans in neuroanatomy and physiology, are the most ideal animal models for studying spinal cord degeneration, aging-related mechanisms, and translating them into therapeutic strategies for spinal cord injury and disease.

[0007] Therefore, there is an urgent need to conduct in-depth research on the impact of aging on different cell types of the spinal cord, changes in gene expression and regulation of specific mechanisms, in order to identify markers of the degree of spinal cord aging and molecular targets for intervention in spinal cord aging, especially markers and targets for humans or primates.

[0008] Summary of the Invention

[0009] To address this need, the inventors conducted the first single-cell resolution analysis of primate spinal cord aging using snRNA-seq and neuropathological analysis. Notably, they discovered a previously unknown microglial state that selectively accumulates around aging motor neurons and highly expresses chitinase-1 (CHIT-1), a secreted factor that drives motor neuron aging. In summary, our findings provide new avenues for exploring biomarkers and developing therapeutic strategies to prevent spinal cord degeneration.

[0010] In a first aspect, the present disclosure provides a method for identifying the degree of spinal cord aging in a subject, comprising:

[0011] a) detecting the level of chitinase-1 (CHIT-1), or the presence of CHIT-1 positive microglia, in a sample from the subject; and

[0012] b) comparing the detection result with a reference value of CHIT-1 level or CHIT-1 positive microglia,

[0013] wherein the subject is a primate.

[0014] The present disclosure also provides a kit for identifying spinal cord aging in a subject, comprising an agent for detecting the level of chitinase-1 (CHIT-1) or the presence of CHIT-1-positive microglia in a sample from the subject, wherein the subject is a primate.

[0015] The present disclosure also provides use of an agent for detecting the level of chitinase-1 (CHIT-1) in a sample from the subject, or the presence of CHIT-1-positive microglia, in the preparation of a kit for identifying spinal cord aging in a subject, wherein the subject is a primate.

[0016] In some embodiments, the reference value is obtained by testing a reference subject. In some embodiments, the reference value is obtained by testing a population of reference subjects. In some embodiments, the level of CHIT-1 is selected from the group consisting of CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, CHIT-1 encoding polynucleotide amount or concentration, and any combination thereof. In some embodiments, the sample is cerebrospinal fluid or a blood sample, such as whole blood, plasma, or serum.

[0017] In a second aspect, the present disclosure provides a method for treating or preventing spinal cord aging or motor neuron aging in a subject in need thereof, comprising administering a CHIT-1 inhibitor to the subject. In some embodiments, the method comprises removing CHIT-1 from the cerebrospinal fluid. In some embodiments, the CHIT-1 inhibitor is administered intrathecally. In some embodiments, the method comprises removing CHIT-1 from the blood. In some embodiments, the CHIT-1 inhibitor is administered intravenously.

[0018] The present disclosure also provides uses of CHIT-1 inhibitors in the preparation of a medicament for treating or preventing spinal cord aging or motor neuron aging in a subject in need thereof. In some embodiments, the medicament is formulated to clear CHIT-1 from cerebrospinal fluid. In some embodiments, the medicament is administered intrathecally. In some embodiments, the medicament is formulated to clear CHIT-1 from the blood. In some embodiments, the medicament is administered intravenously.

[0019] In some embodiments, the CHIT-1 inhibitor comprises an agent that inhibits the transcription and / or translation of a polynucleotide encoding CHIT-1 and / or inhibits CHIT-1 activity. In some embodiments, the CHIT-1 inhibitor is an inhibitory transcription factor, an antisense polynucleotide, an interfering RNA, a TGFBR inhibitor, or an agent that binds to CHIT-1. In some embodiments, the agent that binds to CHIT-1 is an anti-CHIT-1 antibody, such as a neutralizing antibody. In some embodiments, the TGFBR inhibitor is Galunisertib (LY2157299, Sellect, S2230).

[0020] The present disclosure also provides a method of treating or preventing spinal cord aging or motor neuron aging in a subject in need thereof, comprising administering ascorbic acid to the subject.

[0021] The present disclosure also provides use of ascorbic acid in the preparation of a medicament for treating spinal cord aging or motor neuron aging in a subject in need thereof.

[0022] In a third aspect, the present disclosure provides a method for identifying the degree of aging of a tissue or organ of a subject, comprising:

[0023] a) detecting the level of chitinase-1 (CHIT-1) in a sample from a tissue or organ of the subject; and

[0024] b) comparing the result of said detection with a reference value of CHIT-1 level,

[0025] wherein the subject is a primate.

[0026] The present disclosure also provides a kit for identifying senescence of a tissue or organ in a subject, comprising an agent for detecting the level of chitinase-1 (CHIT-1) in a sample from the subject, wherein the subject is a primate.

[0027] The present disclosure also provides use of an agent for detecting the level of chitinase-1 (CHIT-1) in a sample from the subject in the preparation of a kit for identifying tissue or organ aging in the subject, wherein the subject is a primate.

[0028] In some embodiments, the reference value is obtained by testing a reference subject. In some embodiments, the reference value is obtained by testing a population of reference subjects. In some embodiments, the level of CHIT-1 is selected from the group consisting of CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, CHIT-1 encoding polynucleotide amount or concentration, and any combination thereof. In some embodiments, the sample is from a tissue or organ selected from the group consisting of lung, liver, spleen, kidney, cerebellum, and parietal lobe.

[0029] In a fourth aspect, the present disclosure provides an animal model or cell model of motor neuron aging, wherein the animal or cell has elevated CHIT-1 levels.

[0030] The present disclosure also provides a method for constructing an animal model of motor neuron aging, comprising increasing the level of CHIT-1 in the animal.

[0031] The present disclosure also provides a method for constructing a cell model of motor neuron aging, comprising increasing the level of CHIT-1 in the cells or treating the cells with CHIT-1 protein or a TGFBR agonist.

[0032] In some embodiments, the level of CHIT-1 is selected from the group consisting of CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, CHIT-1 polynucleotide amount or concentration, and any combination thereof.

[0033] In some embodiments, increasing the level of CHIT-1 in the animal comprises administering to the animal a CHIT-1 protein or a TGFBR agonist. In some embodiments, the TGFBR agonist is SRI-011381 (Sellect, S6645).

[0034] In some embodiments, the animal is a non-human mammal.

[0035] In some embodiments, the cell is a motor neuron. In some embodiments, the neuron is a non-human mammalian motor neuron or a human motor neuron.

[0036] In some embodiments, the non-human mammal is a mouse or a cynomolgus monkey.

[0037] In a fifth aspect, the present disclosure provides a method for delaying motor neuron aging in a subject, comprising reducing the level of CHIT-1 in the cerebrospinal fluid and / or blood of the subject.

[0038] In some embodiments, the level of CHIT-1 is selected from the group consisting of CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, CHIT-1 polynucleotide amount or concentration, and any combination thereof. In some embodiments, the level of CHIT-1 is selected from the group consisting of CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, and any combination thereof.

[0039] In some embodiments, the method comprises administering to the subject an anti-CHIT-1 antibody, such as a neutralizing antibody. In some embodiments, the anti-CHIT-1 antibody is administered intrathecally or intravenously. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1: Hematoxylin (DNA) staining of young and old monkey spinal cords showing representative images (left) and quantification of the areas of the indicated regions (right).

[0041] Figure 2: SA-β-gal staining of the spinal cord WM, dorsal gray matter (dGM), and ventral gray matter (vGM) of young and old monkeys (n=8), showing representative images of the indicated regions (left) and quantification of SA-β-gal positive areas (right). Scale bar, 50 μm.

[0042] Figure 3: Immunohistochemical staining of γ-H2A.X in the WM, dGM, and vGM regions of the spinal cord of young and old monkeys (n=8). Black arrows indicate γ-H2A.X-positive cells. Representative images (left) and quantification of γH2A.X-positive cells (right) are shown. Scale bar, 50 μm. Scale bar (magnification), 10 μm.

[0043] Figure 4: 4-HNE immunofluorescence staining of the WM, dGM, and vGM regions of the spinal cord of young and old monkeys (n=8), showing representative images of the indicated regions (left) and quantification of 4-HNE fluorescence intensity (right). Scale bar, 50 μm.

[0044] Figure 5: Oil Red O staining of the WM, dGM, and vGM regions of the spinal cord of young and old monkeys (n=8). Black arrows indicate Oil Red O-positive areas. Representative images of the indicated areas (left) and quantification of Oil Red O-positive areas (right) are shown. Scale bar, 50 μm. Scale bar (magnification), 10 μm.

[0045] Figure 6: Quantitative data for Figures 3 and 5. Left, a bar graph showing the proportion of γ-H2A.X-positive cells in MNs and other cells in the spinal cord vGM from young and old monkeys (n=8) as shown in Figure 3. Right, a bar graph showing the proportion of Oil Red O-positive cells in MNs and other cells in the spinal cord vGM from young and old monkeys (n=8) as shown in Figure 5.

[0046] Figure 7: ChAT immunohistochemical staining of the vGM region of the spinal cord of young and old monkeys (n=8). Black arrows indicate ChAT-positive MNs. Representative images (left) and quantification of ChAT-positive MNs, as well as the proportion of ChAT-positive MNs (right) are shown. All MNs were counted in the LH and VH. LH, lateral horn. VH, ventral horn. Scale bar, 100 μm.

[0047] Figure 8: RNA in situ hybridization (RNA-ISH) of the spinal cord vGM region of young and old monkeys (n=8) using TNS1 riboprobe. Black arrows indicate TNS1-positive motor neurons. Representative images (left) and quantification (right) of TNS1-positive cells are shown.

[0048] Figures 9-11: Double staining of the spinal cord vGM region of young and old monkeys (n=8) for SA-β-gal and neuronal markers (NeuN for total neurons, ChAT for micronucleated neurons). Shown are representative images (Figure 9), the proportion of SA-β-gal-positive MNs and other cells relative to total SA-β-gal-positive cells (Figure 10), and quantification of SA-β-gal-positive cells within total neurons or MNs in the spinal cord vGM (Figure 11). Scale bar, 50 μm.

[0049] Figure 12: Detection of lipofuscin autofluorescence and ChAT staining in the spinal cord vGM region of young and old monkeys (n=8). Representative images of ChAT-positive MNs (left) and quantification of lipofuscin fluorescence intensity (right) are shown. Scale bar, 50 μm.

[0050] Figure 13: Immunofluorescence staining of 4-HNE and ChAT in the spinal cord vGM region (n=8). Representative images of ChAT-positive MNs (left) and quantification of 4-HNE fluorescence intensity (right) are shown. Scale bar, 20 μm.

[0051] Figure 14: Immunofluorescence staining of Lamin B2 and ChAT in the spinal cord vGM region (n=8). Representative images of the indicated areas (left) and quantification of Lamin B2 fluorescence intensity (right). Scale bar, 50 μm.

[0052] Figure 15: Immunofluorescence staining of H3K9me3 and ChAT in the spinal cord vGM region of young and old monkeys (n = 8). Representative images of ChAT-positive MNs (left) and quantification of H3K9me3 fluorescence intensity (right) are shown. Scale bar, 10 μm. Data are presented as mean ± SEM. NA, not applicable. AU, arbitrary units.

[0053] Figure 16: Immunofluorescence staining of 4-HNE and GFAP (astrocyte marker) in the spinal cord vGM region. Scale bar, 10 μm. No 4-HNE-positive signal was detected in astrocytes.

[0054] Figure 17: Immunofluorescence staining of 4-HNE and P2RY12 (microglial marker) in the spinal cord vGM region. Scale bar, 10 μm. No 4-HNE-positive signal was detected in microglia.

[0055] FIG18 : Quantification of the fluorescence intensity of 4-HNE in MN and other cells in the vGM region of the spinal cord (n=8).

[0056] Figure 19: Nissl staining of the vGM and dGM regions of the spinal cord of young and old monkeys (n=8). Black arrows indicate MNs. Representative images (left) and quantification of neuron number (right) are shown. ChAT-positive cells located only in the vGM region were defined as MNs when the cell body diameter was >30 μm. Scale bar, 50 μm. Data are expressed as mean ± SEM. Non-MN, non-motor neuron.

[0057] Figure 20: Co-staining of BTX and NF in neuromuscular junctions of skeletal muscle of young and old cynomolgus monkeys (n=8). Representative images (left) and the area of ​​nerve endings (BTX positive) per 0.2 cm are shown. 2 Percentage or axon area (NF positive) per 0.2 cm2 Scale bar, 50 μm.

[0058] Figure 21: Distance traveled by young and old cynomolgus monkeys within 4 hours (young, n=8; old, n=4).

[0059] Figure 22: Active time of young and old cynomolgus monkeys within 4 hours (young, n=8; old, n=4).

[0060] Figure 23: Number of times young and old cynomolgus monkeys grasped food within 5 hours (young, n=8; old, n=4).

[0061] FIG24 : Bar graph showing the number of genes called per bulk RNA-seq sample.

[0062] Figure 25: Differentially expressed genes (DEGs) between young and old monkey spinal cords identified by bulk RNA-seq (n=8).

[0063] Figure 26: Upregulated genes in aged monkey spinal cord identified by bulk RNA-seq (n=8).

[0064] Figure 27: Analysis of CHIT-1, SERPINA5 and GPNMB expression levels in the spinal cord of young and old monkeys by bulk RNA-seq (n=8).

[0065] Figure 28: Immunofluorescence staining of P2RY12 and IBA1 in the spinal cord and spinal cord of young and old monkeys (n=8). Left: Representative images (upper left, scale bar, 100 μm) and magnified images of the spinal cord margin, WM, and ventral GM regions of each group (lower left, scale bar, 25 μm) are shown. Right: The ratio of IBA1-negative and IBA1-positive cells to P2RY12-positive cells in the spinal cord of each group is shown (upper right), as well as the ratio of P2RY12-positive microglia to total spinal cord cells in the spinal cord of young and old monkeys (lower right). SPM, spinal pia mater. WM, white matter. vGM, ventral gray matter.

[0066] Figure 29: Single-nucleus transcriptome profiles of young and old monkey spinal cord, showing 14 color-coded cell types. 10x Genomics Chromium snRNA-seq, n = 8. STRT-seq of MNs, n = 4. OPC, oligodendrocyte progenitor cell; OL, oligodendrocyte; Schwann cell; Fib.Ast, fibrous astrocyte; Pro.Ast, protoplasmic astrocyte; Ependymal, ependymal cell; Meningeal, meningeal cell; EC, endothelial cell; MN, motor neuron; CNTN4.IN, CNTN4+ interneuron; RBFOX1.IN, RBFOX1+ interneuron; LGR5.IN, LGR5+ interneuron.

[0067] Figure 30: Expression levels of marker genes in different cell types in Figure 29. Colors from gray to blue represent low to high expression levels.

[0068] Figure 31: t-SNE plot showing the distribution of immune cells in the monkey spinal cord (left) and the expression levels of marker genes for different immune cell types (right). Colors ranging from gray to blue indicate low to high expression levels. ImmunOL, immune oligodendrocyte.

[0069] Figure 32: Dot plot showing the expression of different immune cell marker genes in monkey spinal cord.

[0070] Figure 33: Top 30 highly expressed genes in different cell types (left) and enriched pathways of these marker genes (right).

[0071] Figure 34: Density plot of the distribution of senescence-associated DEGs across cell types. The dot plot shows differentially expressed genes that are upregulated and downregulated across multiple cell types. The color key from blue to pink represents the Log(fold change) (LogFC) level from low to high.

[0072] Figure 35: Enrichment pathways for age-related differentially expressed genes in different cell types of the monkey spinal cord. The color key from white to pink (blue) represents the absolute value of the DE score from low to high. A positive or negative DE score indicates that the upregulated or downregulated DEG, respectively, contains more than half of the enriched genes in the corresponding pathway. The size of the dot indicates the number of genes. DE, differential expression.

[0073] Figure 36: Heatmap showing the relative expression of the top 5 upregulated aging DEGs in bulk RNA-seq of different cell types in young and old spinal cord (n=8). Expression levels were normalized and scaled along the row. Data are presented as mean ± SEM.

[0074] Figure 37: t-SNE plots showing microglial states in monkey spinal cord, colored by state (top) and age (bottom) (n=8).

[0075] Figure 38: Dot plot showing marker genes for three microglial states (sorted by adjusted P value).

[0076] Figure 39: Bar graph showing the proportion of microglia 1, microglia 2, and microglia 3 to total microglia.

[0077] FIG40 : Cell ratios of microglia 1 and microglia 2 in the young and old groups (n=8).

[0078] Figure 41: A bar graph showing the results of GO term analysis of the top 50 marker genes of microglia 2 and microglia 3 in the monkey spinal cord.

[0079] Figure 42: Expression of microglia marker genes (CHIT-1, GPNMB, LGALS3). The expression pattern of marker genes in all microglia (top) and the expression level of marker genes in microglia (bottom) are shown.

[0080] FIG43 : Cell ratio of microglia 3 in the young and old groups (n=8).

[0081] Figure 44: Immunofluorescence staining of CHIT-1 and P2RY12 in the SPM and spinal cord of young and old monkeys (n=8). Representative images (left) and the ratio of CHIT-1-positive cells to P2RY12-negative cells (upper right) and the ratio of CHIT-1-positive cells to P2RY12-positive microglia (lower right) in the young and old groups are shown. SPM, spinal pia mater. SC, spinal cord. Scale bar, 100 μm. Scale bar (magnification), 25 μm.

[0082] Figure 45: Western blot analysis of CHIT-1 protein levels in spinal cord of young and old monkeys (n=8). Representative images (left) and quantitative data (right) of CHIT-1 protein levels are shown. Loading control, GAPDH.

[0083] Figure 46: Immunofluorescence staining of CHIT-1 and P2RY12 in the spinal cord of young and elderly people (n=3). Shown are representative images (left) and quantification of the proportion of CHIT-1-positive cells among P2RY12-positive microglia in human spinal cord tissue (right). Scale bar, 20 μm.

[0084] Figure 47: Immunofluorescence staining of CHIT-1 and P2RY12 in the WM and vGM regions of the cervical (top), thoracic (middle), and lumbar (bottom) spinal cord of young and old monkeys (n=8). Shown are a schematic diagram of spinal cord segmentation (left), representative images (middle), and quantification of CHIT-1-positive cells among P2RY12-positive microglia (right). Scale bar, 25 μm.

[0085] Figure 48: Immunofluorescence staining of CHIT-1, NeuN, and IBA1 in the GM and WM regions of the frontal lobe of young and old monkeys. Scale bar, 100 μm. GM, gray matter. WM, white matter.

[0086] Figure 49: Immunofluorescence staining of CHIT-1 and IBA1 in the spinal cords of 2-, 13-, and 29-month-old C57 / B6 mice. Scale bar, 50 μm.

[0087] Figure 50: Single-nuclear transcriptome profiles of young and old mouse spinal cords colored by cell type (top) and age group (bottom). Ttn+, Ttn-positive cells.

[0088] Figure 51: Dot plot showing the expression of marker genes for different cell types in the mouse spinal cord.

[0089] Figure 52: t-SNE plot showing the distribution of microglia in the mouse spinal cord. Left, predicted microglia 3 highlighted in red. Right, points colored by age.

[0090] Figure 53: Expression levels of the indicated genes. Top: Expression levels of CHIT-1, Gpnmb, and Lgals3 in total mouse spinal cord microglia. Bottom: Expression levels of these three genes in spinal cord microglia from young and old mice.

[0091] Figure 54: Venn diagram showing the overlap between the top 50 marker genes for microglia in the monkey and mouse spinal cord.

[0092] Figure 55: Heatmap showing enriched pathways of 3 marker genes in the spinal cord microglia of monkeys and mice. From white to pink, it indicates -log 10 P from low to high.

[0093] Figures 56 and 57: Left, ELISA analysis of CHIT-1 levels in cerebrospinal fluid and serum of young and old cynomolgus monkeys (young, n=8; old, n=3). Right, ELISA analysis of CHIT-1 levels in cerebrospinal fluid and serum of young and old monkeys (cerebrospinal fluid, n=3; serum, n=40). Data are presented as mean ± SEM.

[0094] Figure 58: Distribution of microglia in the vGM region of the spinal cord of aged monkeys. Top: Representative images of immunohistochemical staining of CHIT-1+ microglia. Scale bar: 20 μm. Middle: Schematic diagram of the four patterns of CHIT-1+ microglia in the vGM region of the spinal cord of aged monkeys. Bottom: Quantitative data on the percentage of CHIT-1+ microglia in each pattern.

[0095] Figure 59: SA-β-Gal staining analysis and CHIT-1 immunohistochemical staining in the spinal cord vGM region of young and old monkeys (n=8). Shown are representative images (left) and the proportion of SA-β-gal-positive MNs surrounded by CHIT-1-positive microglia (patterns 1+2+3) (right). Scale bar, 50 μm.

[0096] Figure 60: Immunofluorescence staining of CHIT-1 and UCHL1 in the spinal cord WM region of young and old monkeys (n=8). Representative images (left) and quantification of CHIT-1-positive microglia surrounding MNs (right) are shown. Scale bar, 50 μm. Scale bar (magnification), 10 μm.

[0097] Figure 61: Representative images of Golgi staining in young and old monkey spinal cords. Scale bar, 500 μm.

[0098] Figure 62: Representative images of spinal cord MN morphology in young and old monkeys. Scale bar, 100 μm.

[0099] Figure 63: Sholl analysis of basal and apical dendrites from young and old monkey spinal cord across a series of concentric circles centered on the MN soma and spaced 15 μm apart (n=300 MN).

[0100] Figure 64: Golgi staining of young and old monkey spinal cord. Shown are representative images (left) and quantification of the number of spines per 10 μm of neuronal apical dendrites (n=8). Scale bar, 5 μm.

[0101] Figure 65: Immunofluorescence staining of VAChT and ChAT in the vGM region of the spinal cord of young and old monkeys (n=8). Representative images (left) and the number of puncta per MN (right) are shown. Scale bar, 25 μm.

[0102] Figure 66: Schematic representation of CHIT-1+ microglia surrounding MNs.

[0103] Figure 67: Schematic diagram of the CHIT-1-TGFBR-pSMAD2 pathway.

[0104] Figure 68: Immunohistochemical staining of p-SMAD2 in spinal MNs of young and old monkeys (n=8). Representative images (left) and quantification of p-SMAD2 intensity (right) are shown. Scale bar, 50 μm.

[0105] Figure 69: Violin plots showing gene set scores for the TGFBR signaling pathway (left) and neuronal apoptosis (right) in young and old monkey MNs.

[0106] Figure 70: Schematic diagram of the time course of treatment of 2-month-old nude mice with vehicle or CHIT-1 injected into the cerebrospinal fluid.

[0107] Figures 71-74: Staining of p-SMAD2 and ChAT (Figure 71, scale bar, 50 μm), SA-β-gal (Figure 72, scale bar, 100 μm), ChAT (Figure 73, scale bar, 50 μm), Lamin B2 and ChAT (MN) (Figure 74, scale bar, 20 μm) in the spinal cord of nude mice treated with vehicle or CHIT-1 (n=9). Representative images (left) and corresponding quantification (right) are shown.

[0108] Figure 75: Four-limb grip strength test of nude mice treated with vehicle or CHIT-1 (n=9-11). Data are presented as mean ± SEM.

[0109] FIG76 : Schematic diagram of the time course of intracerebrospinal fluid injection of vehicle or CHIT-1 in 2-month-old C57 / BL6 mice.

[0110] Figures 77-82: Staining of p-SMAD2 and ChAT (Figure 77, scale bar, 50 μm), SA-β-gal (Figure 78, scale bar, 200 μm; and Figure 79, scale bar, 100 μm), ChAT (Figure 80, scale bar 50 μm), Lamin B2 and γ-H2A.X in ChAT (Figure 81, scale bar 20 μm; and Figure 82, scale bar 20 μm) in spinal cord tissue from vehicle or CHIT-1 treated C57 / BL6 mice (n=9-11). Representative images (left) and corresponding quantification (right) are shown.

[0111] Figure 83: Evoked field currents in skeletal muscle of the limbs of mice treated with vehicle or CHIT-1 on day 11. The right panel shows the statistics of evoked current amplitudes. Data are presented as mean ± SEM.

[0112] Figure 84: BTX and NF staining in skeletal muscle NMJs of C57BL / 6 mice in the vehicle group and CHIT-1 group (n=8). Representative images (left) and nerve terminal area (BTX positive) per 0.2 cm are shown. 2 Percentage or axon area (NF positive) per 0.2 cm 2Scale bar, 50 μm.

[0113] Figure 85: Representative images of Golgi staining of spinal cords from C57BL / 6 mice treated with vehicle or CHIT-1. Scale bar, 500 μm.

[0114] Figure 86: Representative images of Golgi staining showing MN morphology in the spinal cords of C57BL / 6 mice treated with vehicle or CHIT-1. Magnified from (Figure 85). Scale bar, 50 μm. Sholll analysis of Golgi staining shows that basal and apical dendrites in the spinal cords of C57BL / 6 mice treated with vehicle or CHIT-1 extend through a series of concentric circles centered on the MN soma at 15 μm intervals.

[0115] Figure 87: Golgi staining of the spinal cord of CHIT-1-treated C57BL / 6 mice. Shown are representative images (left) and quantification of the number of apical dendritic spines per 10 μm (right). Apical dendrites of over 80 MNs were detected in three discrete transverse sections per mouse. Scale bar, 5 μm.

[0116] Figure 88: The left panel shows representative images of the open field test in C57BL / 6 mice treated with vehicle or CHIT-1. The right panel shows the total distance traveled and average speed of C57BL / 6 mice treated with vehicle or CHIT-1 over 10 minutes.

[0117] FIG89 : Distance traveled by vehicle or CHIT-1 treated C57BL / 6 mice in a treadmill test.

[0118] Figure 90: Four-limb grip strength test (left) and grid test (right) of vehicle or CHIT-1 treated C57BL / 6 mice.

[0119] Figure 91: Schematic diagram of the Ommaya reservoir implanted with vehicle or CHIT-1, with the assistance of a surgical robot, through the Ommaya reservoir for alternate-day injection of vehicle or CHIT-1.

[0120] Figure 92: Enzyme-linked immunosorbent assay (ELISA) analysis of CHIT-1 levels in monkeys treated with vehicle or CHIT-1.

[0121] Figure 93: Immunohistochemical staining of spinal cord ChAT. The dotted line indicates the border of the vGM. The arrow indicates the motor neuron.

[0122] Figure 94: Co-immunohistochemical staining of SA-β-Gal and ChAT in the spinal cord. Arrows indicate motor neurons.

[0123] Figures 95-97: Percent change in distance traveled compared to baseline over 4 hours (Figure 95), change in activity time after CHIT-1 treatment (Figure 96), and number of food grabs by designated groups over 5 hours (Figure 97).

[0124] Figure 98: Immunofluorescence staining of ChAT (motor neuron marker) and MAP2 (pan-neuronal marker) in hMNs differentiated from human embryonic stem cells (hESCs). Representative images (left), the proportion of MAP2-positive neurons to total cells (center), and the proportion of ChAT-positive neurons to neurons (right) are shown. Scale bar, 100 μm.

[0125] Figure 99: Left, hMN culture flow chart. Right, hMN staining for SA-β-Gal, 53BP1, Lamin B2, H3K9me3, and MAP2 / TUJ1 (n=3), showing representative images (top) and quantitative data for SA-β-gal-positive hMNs, 53BP1-positive hMNs, Lamin B2 intensity, and H3K9me3 intensity (bottom). Scale bar, 30 μm.

[0126] FIG100 : Principal component analysis showing transcriptome differences between hMNs collected on D0, D7, D14 and D21.

[0127] Figure 101: Loading scores of the first and second principal components for all genes when comparing hMN.

[0128] Figure 102: Expression values ​​and enriched pathways of upregulated genes during hMN culture. Left: Gray lines represent the proportional expression of upregulated genes, and the red line represents the fitted model for all gray lines. Right: Enriched pathways of upregulated genes.

[0129] Figure 103: Expression values ​​and enriched pathways of downregulated genes during hMN culture. Left: Gray lines represent proportional expression of downregulated genes, and the blue line represents the fitted model for all gray lines. Right: Enriched pathways of downregulated genes.

[0130] Figure 104: Western blot analysis of PSD95 in hMN (n=3). Representative images (top) and quantification (bottom) of PSD95 protein levels are shown. Loading control, GAPDH. Data are presented as mean ± SEM.

[0131] Figure 105: Schematic diagram of the experimental process for the depletion of IgG or anti-CHIT-1 antibodies in the cerebrospinal fluid of young and old monkeys.

[0132] FIG106 : Immunoblotting of CHIT-1 in equal volumes of aged CSF using IgG (IgG-dep) or anti-CHIT-1 antibody (αCHIT-1-dep).

[0133] Figure 107: ELISA analysis of CHIT-1 concentration in each group.

[0134] Figures 108, 109: Co-staining of SA-β-Gal and TUJ1, or P21 / γ-H2A.X and MAP in hMNs cultured in the indicated CSF.

[0135] Figure 110: Experimental workflow for transducing human microglial conditioned medium (CM) with lentivirus to express immune-deficient IgG or anti-CHIT-1 antibody-expressing LUC (LUC-microglia) or CHIT-1 (CHIT-1-microglia), and then using it to culture hMNs.

[0136] Figure 111: Western blot analysis of CHIT-1 in human microglia transduced with lentil-LUC or lentil-CHIT-1. Loading control, GAPDH.

[0137] Figure 112: Detection of CHIT-1 protein secretion in human microglia transduced with lentil-LUC or lentil-CHIT-1.

[0138] FIG. 113 : Immunoblotting of CHIT-1 in culture medium of equal volumes of lentil-CHIT-1 transduced human microglia was performed using IgG (IgG-dep) or anti-CHIT-1 antibody (αCHIT-1-dep).

[0139] Figure 114: ELISA analysis of CHIT-1 concentration among groups.

[0140] Figures 115 and 116: Co-staining of SA-β-Gal and TUJ1, or P21 / γ-H2A.X / Lamin B2 / H3K9me3 and MAP in hMNs cultured in the indicated media.

[0141] Figure 117: Flowchart of CHIT-1 and ascorbic acid or vehicle treatment of human motor neurons (hMN). Distilled water was used as vehicle control.

[0142] Figure 118: Immunofluorescence staining of SA-β-gal, 53BP1, Lamin B2, and H3K9me3 in hMNs labeled with MAP2 or TUJ1 and treated with vehicle, CHIT-1, or CHIT-1 and ascorbic acid, respectively (n=3). Representative images (top) and quantification of the proportion of SA-β-gal-positive MNs, the proportion of 53BP1-positive MNs, Lamin B2 intensity, and H3K9me3 intensity in hMNs are shown (bottom). Scale bar, 30 μm.

[0143] Figure 119: Left, hMN images before and after electrophysiology; center, action potential discharge pattern evoked by a 500ms 300pA current pulse; right, phase diagram of the spike. Scale bar, 100ms, 20mV.

[0144] FIG120 : Action potential firing rate of cultured hMNs treated with vehicle or CHIT-1.

[0145] Figure 121: From left to right, the threshold for action potential generation by hMNs treated with vehicle or CHIT-1, the half-width of the action potential evoked by hMNs treated with vehicle or CHIT-1, the resting membrane potential of the cell body of hMNs treated with vehicle or CHIT-1, and the input resistance of the cell membrane of hMNs treated with vehicle or CHIT-1 are shown.

[0146] Figure 122: Amplitude of outward current evoked by a voltage step from -80 mV to 60 mV (left); and amplitude of outward current in response to a 0 mV voltage stimulus (right, as indicated by the arrow on the left).

[0147] Figure 123: Representative current responses to a series of voltage steps from -80 mV to 60 mV (left, scale bar: 20 ms, 500 pA). The dashed box represents the magnified inward current in the right panel (scale bar, 2 ms, 500 pA).

[0148] Figure 124: Amplitude of inward current evoked by a voltage step from -80 mV to 60 mV. Arrows indicate the voltage used for statistical analysis. Statistics for the inward current response amplitude at -30 mV are shown on the right.

[0149] Figure 125: Western blot analysis of PSD95 protein levels in CHIT-1 and ascorbic acid treated MNs (n=3). Representative images (left) and quantification (right) are shown. Loading control, GAPDH. Data are presented as mean ± SEM.

[0150] Figure 126: Western blot analysis of p-SMAD2 protein levels in hMNs (n=3). Representative images (top) and quantification (bottom) are shown. Loading control, GAPDH.

[0151] Figure 127: Enriched pathways of DEGs in hMNs between vehicle and CHIT-1 treatment. Left, up-regulated; right, down-regulated.

[0152] Figure 128: Violin plots showing the average expression of SMAD2 target genes across all replicates for each hMN group (n=3).

[0153] Figure 129: Principal component analysis showing differences between Control, CHIT-1 and CHIT-1 + ascorbic acid treated hMNs.

[0154] Figure 130: Western blot analysis of p-SMAD2 in vehicle and TGFBR agonist (SRI-011381) treated hMNs (n=3). Loading control, GAPDH. Representative images (left) and quantification of p-SMAD2 levels in hMNs (right) are shown.

[0155] Figure 131: SA-β-Gal and TUJ1 staining of vehicle and TGFBR agonist-treated hMNs (n=3). Representative images (left) and quantitative images of SA-β-gal-positive hMNs (right) are shown. Scale bar, 20 μm.

[0156] Figure 132: Immunofluorescence staining of Lamin B2 or H3K9me3 and MAP2 in vehicle- and TGFBR agonist-treated hMNs (n=3). Representative images (left) and quantification of Lamin B2 and H3K9me3 intensity in hMNs (right) are shown. Scale bar, 20 μm.

[0157] Figure 133: Western blot analysis of p-SMAD2 and SMAD2 / 3 in hMN treated with vehicle, CHIT-1, or CHIT-1 and TGFBR inhibitor (Galunisertib) (n=3). Loading control, GAPDH. Representative images (top) and quantification of p-SMAD2 and SMAD2 / 3 protein levels (bottom) are shown.

[0158] FIG134 : SA-β-Gal staining with TUJ1, Lamin B2, or H3K9me3 and MAP2 in hMNs treated with vehicle, CHIT-1, or CHIT-1 and a TGFBR inhibitor (n=3). Representative images of SA-β-gal-positive hMNs are shown on the left, while quantification of Lamin B2 and H3K9me3 intensity in hMNs is shown on the right. Scale bar, 20 μm. Data are presented as mean ± SEM.

[0159] Figure 135: Western blot analysis of p-SMAD2 and SMAD2 / 3 expression in hMNs transfected with si-NC, si-SMAD2-1#, and si-SMAD2-2# (n=3). Loading control, GAPDH. Representative images (left) and quantification of p-SMAD2 and SMAD2 / 3 protein levels (right) are shown.

[0160] Figure 136: Western blot analysis of p-SMAD2 in hMN treated with si-NC, si-NC and CHIT-1, and CHIT-1 and si-SMAD2-2 (n=3). Loading control, GAPDH. Representative images (left) and quantification of p-SMAD2 (right) are shown.

[0161] Figure 137: Staining of SA-β-gal and TUJ1, Lamin B2, or H3K9me3 and MAP2 in hMNs treated with si-NC, si-NC and CHIT-1, and CHIT and si-SMAD2-2 (n=3). Left: Representative images of SA-β-gal-positive hMNs. Right: Quantification of hMNs, Lamin B2 intensity, and H3K9me3 intensity. Scale bar, 20 μm. Data are presented as mean ± SEM.

[0162] Figure 138: PCA plot showing differentially expressed genes (DEGs) in bulk RNA-seq samples of different groups of hMNs based on long-term culture (LTC).

[0163] Figure 139: Top, Venn diagram showing the overlap of CHIT-1-DEGs and ascorbic acid-DEGs in hMN. Bottom, heat map and bar chart showing the expression of overlapping DEGs and corresponding enriched pathways.

[0164] Figure 140: Working model of ascorbic acid treatment in monkeys. Distilled water was used as a vehicle control.

[0165] Figure 141: SA-β-gal staining of the vGM region of the spinal cord from aged control (Vehicle) and ascorbic acid-treated monkeys (n=5). Representative images (left) and quantification (right) of SA-β-gal-positive areas in the vGM region are shown. Scale bar, 50 μm.

[0166] Figure 142: Lipofuscin accumulation in the spinal cord vGM region of old control monkeys (Vehicle) and ascorbic acid-treated monkeys (n=5). Representative images (left) and quantification (right) are shown. Scale bar, 10 μm.

[0167] Figure 143: Immunofluorescence staining of Lamin B2 and ChAT in the spinal cord vGM region of old control monkeys (Vehicle) and ascorbic acid-treated monkeys (n=5). Representative images (left) and quantification (right) are shown. Scale bar, 10 μm.

[0168] Figure 144: Western blot analysis of CHIT-1 protein levels in lungs of young and old monkeys (n=8). Representative images (left) and quantitative data (right) of CHIT-1 protein levels are shown. Loading control, GAPDH.

[0169] Figure 145: Western blot analysis of CHIT-1 protein levels in livers of young and old monkeys (n=8). Representative images (left) and quantitative data (right) of CHIT-1 protein levels are shown. Loading control, GAPDH.

[0170] Figure 146: Western blot analysis of CHIT-1 protein levels in spleens of young and old monkeys (n=8). Representative images (left) and quantitative data (right) of CHIT-1 protein levels are shown. Loading control, GAPDH.

[0171] Figure 147: Western blot analysis of CHIT-1 protein levels in young and old monkey kidneys (n=8). Representative images (left) and quantitative data (right) of CHIT-1 protein levels are shown. Loading control, GAPDH.

[0172] Figure 148: Western blot analysis of CHIT-1 protein levels in young and old monkey cerebellum (n=8). Representative images (left) and quantitative data (right) of CHIT-1 protein levels are shown. Loading control, GAPDH.

[0173] Figure 149: Western blot analysis of CHIT-1 protein levels in the parietal lobes of young and old monkeys (n=8). Representative images (left) and quantitative data (right) of CHIT-1 protein levels are shown. Loading control, GAPDH.

[0174] Detailed Description of the Invention

[0175] Although the present invention will be described in conjunction with the embodiments listed below, it should be understood that they are not intended to limit the invention to those embodiments. On the contrary, the present invention is intended to cover all alternatives, modifications and equivalents that may be included within the scope of the present invention as defined in the claims. Those skilled in the art will recognize that many methods and materials similar or equivalent to those described herein can be used to practice the present invention. The present invention is not limited to the methods and materials described.

[0176] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although suitable methods and materials are described below, methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention.

[0177] 1. Definition

[0178] As used herein, the term "and / or" encompasses all combinations of items connected by the term, and should be treated as if each combination had been individually listed herein. For example, "A and / or B" encompasses "A," "A and B," and "B." For example, "A, B, and / or C" encompasses "A," "B," "C," "A and B," "A and C," "B and C," and "A and B and C."

[0179] As used herein, the term "subject" refers to a non-human animal subject, such as a non-human mammal, bird, reptile, fish, etc., including livestock, poultry, pets, and sport animals, or a human subject.

[0180] "Aging" generally refers to the phenomenon of an organism's progressive decline in its physiological and / or psychological adaptability to its environment, leading to its gradual death. Aging can be categorized as physiological or pathological. Physiological aging refers to the physiological degeneration that occurs after maturity, while pathological aging is age-related changes caused by various external factors (including various diseases). However, aging is the result of the combined effects of many pathological, physiological, and psychological processes, and in most cases, it is impossible to fully distinguish between physiological and pathological aging.

[0181] The "degree of aging" of an object is usually related to its "physiological age", which refers to the level of physiology and its functions reflected when the object exhibits a certain natural age, that is, the degree of physiology and its functions corresponding to a certain natural age.

[0182] Premature aging of a subject refers to a subject's physiological age being significantly greater than their natural age, usually due to environmental, disease, overwork, and other factors.

[0183] Cellular senescence is considered an important cause of aging in organisms and generally refers to the loss of proliferation capacity despite the maintenance of cell viability and metabolic activity. Distinctive features of senescent cells include (i) growth arrest, (ii) enlarged and flattened cell morphology, (iii) DNA damage foci in the nucleus, (iv) senescence-associated secretory phenotype (SASP), (v) elevated senescence-associated β-galactosidase (SA-β-gal) activity, and (vi) expression of the tumor suppressor p16. INK4a and (vii) an increase in the number and size of PML nuclear bodies.

[0184] The pathways that lead to the aging phenotype of cells generally include replicative senescence (RS), premature senescence, and senescence after differentiation (SAD). "Replicative senescence" is a type of aging that occurs after a large number of cell divisions. For example, when grown in culture, primary cells experience cellular senescence after approximately 50 cell divisions. This obstacle to further proliferation is believed to be due to the shortening of cell telomeres with each successive cell division, causing the cells to reach the point of triggering the DNA damage response (the so-called "Hayflick limit"), ultimately leading to induced proliferation arrest and aging. "Premature senescence" of cells refers to cell aging in the absence of telomere loss or dysfunction. Premature senescence may be caused by a variety of stimuli, including, for example, chemotherapy, radiotherapy, DNA damage, oxidative stress, inflammation, strong mitotic signaling, and ribosomal stress. In addition, genetic defects in cells can also cause premature cellular senescence. SAD refers to the aging-like phenotype (including SASP) displayed by terminally differentiated postmitotic cells, which can be induced by various stressors, including genotoxicity, protein toxicity, oxidation, and ribosomal stressors. Studies have shown that SAD is observed in certain diseases. As used herein, the "senescence degree" of a cell refers to a senescence-associated phenotype that is comparable to that of cells passaged a specific number of times.

[0185] Similarly, the aging of neurons (such as motor neurons) in the central nervous system (such as the spinal cord) is also an important cause of central nervous system aging.

[0186] As used herein, "reference value" refers to an indicator constant representing representative physiological and biochemical characteristics, including morphology, function, and metabolic products, of a normal subject, or its cells, tissues, or organs, or normal isolated cells or cell populations, in a specific state (e.g., age or passage number). Reference values ​​can be predetermined or obtained by testing a reference subject or reference cells.

[0187] As used herein, a "reference subject" or "reference cell" refers to a subject or cell having the aforementioned representative characteristics. For example, a reference subject in the present invention refers to a subject having characteristics representative of a particular degree of aging or physiological age, and a reference cell in the present invention refers to a cell having characteristics representative of cells passaged a specific number of times.

[0188] As used herein, the term "polynucleotide" or "nucleic acid molecule" includes DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA produced using nucleotide analogs. The nucleic acid molecules can be single-stranded or double-stranded, preferably double-stranded DNA. Nucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides) can be used in the synthesis of the nucleic acids. Such nucleotides can be used, for example, to prepare nucleic acids with altered base pairing ability or increased nuclease resistance.

[0189] As used herein, the term "encoding" refers to a polynucleotide that directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon or other start codons such as GTG and TTG and ends with a stop codon such as TAA, TAG and TGA. The coding sequence can be a DNA, cDNA or recombinant nucleotide sequence.

[0190] As used herein, "antisense nucleic acid" refers to a nucleic acid molecule that has a complementary sequence to a target nucleic acid (e.g., mRNA) and participates in gene expression regulation by base pairing with the target nucleic acid. Antisense nucleic acids include RNA or DNA molecules that precisely complement a specific mRNA and specifically block its translation.

[0191] As used herein, "interfering nucleic acid" refers to a nucleic acid molecule encoding an RNA molecule for RNA interference (RNAi), including siRNA, shRNA, miRNA, etc.

[0192] As used herein, the term "protein" refers to a biological macromolecule composed of one or more "polypeptide" chains. A polypeptide is a chain of ten or more amino acid residues linked by peptide bonds. All peptide and polypeptide formulas or sequences herein are written from left to right, indicating the direction from the amino terminus to the carboxyl terminus.

[0193] In the context of peptides, the terms "amino acid," "residue," and "amino acid residue" are used interchangeably to include both naturally occurring amino acids and non-natural amino acids found in proteins. The single-letter and three-letter nomenclature for naturally occurring amino acids in proteins follows the common nomenclature used in the art, as described in Sambrook, et al. (Molecular Cloning: A Laboratory Manual, 2nd, ed. Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).

[0194] As used herein, "percent identity" refers to a comparison of the amino acids of two polypeptides or the nucleotides of two nucleic acid molecules, which, when optimally aligned, have approximately the specified percentage of identical amino acids or nucleotides. For example, "95% amino acid / nucleotide identity" means a comparison of the amino acids of two polypeptides or the nucleotides of two nucleic acid molecules, which, when optimally aligned, have 95% of the identical amino acids / nucleotides.

[0195] As used herein, "isolated" cells refer to cells that are separated from their source organism, typically cells cultured in vitro, including but not limited to cells cultured in adherent culture, cells cultured in suspension, or cells cultured in 3D.

[0196] The CRISPR / Cas system refers to clustered regularly interspaced short palindromic repeats and its related systems, which can cut DNA chains at specific locations under the guidance of guide RNA.

[0197] The CRISPR-dCas system involves modifying Cas to inactivate its nuclease activity, thereby preventing it from cutting DNA chains, while simultaneously connecting it to a transcriptional activation domain to achieve site-specific transcriptional activation.

[0198] Similarly, the CRISPR-dCas system can also be used to regulate the methylation level of the region of interest to regulate transcription. Specifically, dCas can be linked to a sequence that promotes methylation, such as an amino acid sequence with methyltransferase activity (e.g., CRISPR-dCas-SunTag-DNMT3A), to increase the methylation level of the region of interest, thereby reducing the transcription of the region of interest. dCas can also be linked to a sequence that inhibits methylation, such as the Tet (ten-eleven translocation) catalytic domain (CRISPR-dCas-Tet), to reduce the methylation level of the region of interest, thereby increasing the transcription of the region of interest.

[0199] 2. Methods for Identifying the Degree of Aging of the Spinal Cord and Body

[0200] The inventors unexpectedly found that the level of chitinase-1 (CHIT-1) and the presence of CHIT-1-positive microglia were significantly increased in the spinal cord of old subjects compared with the spinal cord of young subjects, indicating that CHIT-1 and CHIT-1-positive microglia are important markers of spinal cord aging.

[0201] Therefore, the present disclosure provides a method for identifying the degree of aging of the spinal cord or body of a subject, comprising:

[0202] a) detecting the level of chitinase-1 (CHIT-1), or the presence of CHIT-1 positive microglia, in a sample from the subject; and

[0203] b) comparing the detection result with a reference value of CHIT-1 level or CHIT-1 positive microglia.

[0204] In addition, the inventors have also noted that CHIT-1 and CHIT-1-positive microglia are markers of spinal cord aging in primates (including non-human primates and humans), while in other animals, such as rodents, their expression and number do not show significant changes with age. Therefore, in some embodiments, the subject is a primate.

[0205] The sample that can be used for the method of the present disclosure is a sample comprising cells or tissue from the subject, such as a biopsy sample of spinal cord tissue. The sample that can be used for the method of the present invention can also be a body fluid sample, such as cerebrospinal fluid or a blood sample, such as whole blood, plasma or serum.

[0206] The inventors also found that the level of CHIT-1 was significantly increased in other tissues of old subjects (e.g., lung, liver, spleen, kidney, cerebellum, and parietal lobe) compared to young subjects.

[0207] a) detecting the level of chitinase-1 (CHIT-1) in a sample from a tissue or organ of the subject; and

[0208] b) comparing the result of said detection with a reference value of CHIT-1 level.

[0209] In some embodiments, the subject is a primate.In some embodiments, the sample is from a tissue or organ selected from the group consisting of lung, liver, spleen, kidney, cerebellum, and parietal lobe.

[0210] In some embodiments, the level of CHIT-1 is selected from the group consisting of CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, CHIT-1 encoding polynucleotide amount or concentration, and any combination thereof. Higher CHIT-1 levels represent a higher degree of aging in tissues or organs, such as the spinal cord. In some embodiments, the presence of CHIT-1 positive microglia includes the number and / or distribution of CHIT-1 positive microglia in the spinal cord. A higher number of CHIT-1 positive microglia and / or a greater number of CHIT-1 positive microglia distributed around the MN represent a higher degree of spinal cord aging.

[0211] In some embodiments, the reference value is obtained by testing a reference subject. In the present invention, the reference subject refers to a subject at a specific physiological age. The desired reference subject can be determined by testing representative characteristics associated with physiological age (e.g., characteristics selected from reflexes and balance). Due to individual differences, preferably, the reference value is obtained by testing a group of reference subjects.

[0212] According to the present invention, a statistically significant number of normal subjects at a specific natural age (e.g., 20, 30, 40, 50, 60, 70, 80, 90 or higher) or a natural age range (e.g., 18-22, 28-32, 38-42, 48-52, 58-62, 68-72, 78-82, 88-92, etc.) can also be selected as reference subjects.

[0213] The reference value may be expressed as "mean ± standard deviation" or as a range. When a population is tested to determine the reference value, the highest and lowest values ​​may be discarded, for example, the highest 2.5% and / or the lowest 2.5%.

[0214] When the test result (such as the CHIT-1 level) is higher than the reference value, the aging degree of the subject's tissue or organ, such as the spinal cord, is identified as higher than the tissue or organ corresponding to the reference value, such as the aging degree of the spinal cord; when the test result (such as the CHIT-1 level) is lower than the reference value, the aging degree of the subject's tissue or organ, such as the spinal cord, is identified as lower than the tissue or organ corresponding to the reference value, such as the aging degree of the spinal cord.

[0215] In some embodiments, the reference value is obtained by testing a reference subject or a reference subject population. When the test result is higher than the reference value, the aging degree of the tissue or organ of the subject, such as the spinal cord, is identified as higher than the (average) aging degree of the tissue or organ, such as the spinal cord, of the reference subject or the reference subject population; when the test result is lower than the reference value, the aging degree of the tissue or organ, such as the spinal cord, of the subject is identified as lower than the (average) aging degree of the tissue or organ, such as the spinal cord, of the reference subject or the reference subject population.

[0216] In some embodiments, the reference value is CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, CHIT-1 encoding polynucleotide amount or concentration, and any combination thereof, representative of a reference subject or a population of reference subjects.

[0217] In some embodiments, detecting the level of CHIT-1 comprises detecting CHIT-1 enzyme activity in a sample. CHIT-1 enzyme activity in a sample can be detected according to methods known in the art, for example, by detecting the amount of CHIT-1 substrate converted per unit amount (e.g., volume or mass) of the sample per unit time (e.g., 15 min, 30 min, 45 min, 1 h, 2 h, or longer) at a certain temperature (e.g., 37° C.).

[0218] In some embodiments, detecting the level of CHIT-1 comprises detecting the amount or concentration of CHIT-1 protein in a sample. In some embodiments, the amount or concentration of CHIT-1 protein is detected by a protein-binding molecule. Protein-binding molecules include any molecule capable of binding to a CHIT-1 protein, such as, but not limited to, antibodies, antigen-binding fragments of antibodies, and antibody derivatives. In some embodiments, antigen-binding fragments of antibodies include, but are not limited to, Fv fragments (e.g., single-chain Fv and disulfide-bonded Fv) and Fab-like fragments (e.g., Fab fragments, Fab' fragments, and F(ab')2 fragments).

[0219] In some embodiments, detecting the level of CHIT-1 comprises detecting the amount or concentration of a polynucleotide encoding a CHIT-1 protein in a sample. In some embodiments, the polynucleotide is a transcript of a gene encoding CHIT-1 endogenous to the subject. In some embodiments, the level of the transcript is detected using a gene-specific primer pair or probe.

[0220] In some embodiments, the subject is a non-human primate.

[0221] In some embodiments, the subject is a human. In some embodiments, the transcript comprises SEQ ID NO: 2, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO: 2. In some embodiments, the CHIT-1 protein comprises SEQ ID NO: 1, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO: 1.

[0222] In some embodiments, the method comprises using primers or probes directed to a nucleotide sequence encoding TNS1.

[0223] In some embodiments, detecting the presence of CHIT-1-positive microglia includes detecting the number and / or distribution of CHIT-1-positive microglia. The number and / or distribution of CHIT-1-positive microglia in the spinal cord can be detected by known suitable methods, such as single nuclear (sn) RNA-seq and in situ hybridization.

[0224] 3. Methods for treating, preventing or delaying spinal cord aging

[0225] The inventors have discovered that MN and spinal cord aging can be suppressed by inhibiting or removing CHIT-1.

[0226] Therefore, the present disclosure provides a method for treating, preventing or delaying spinal cord aging or motor neuron aging in a subject in need thereof, comprising administering a CHIT-1 inhibitor to the subject. In some embodiments, the CHIT-1 inhibitor is administered intrathecally.

[0227] The present disclosure also provides use of a CHIT-1 inhibitor in the preparation of a medicament for treating, preventing or delaying spinal cord aging or motor neuron aging in a subject in need thereof.

[0228] In some embodiments, the subject is a primate (including non-human primates and humans).

[0229] In some embodiments, the CHIT-1 inhibitor comprises an agent that inhibits transcription and / or translation of a polynucleotide encoding CHIT-1 and / or inhibits CHIT-1 activity.

[0230] In some embodiments, the CHIT-1 inhibitor comprises an agent that inhibits transcription of a polynucleotide encoding CHIT-1, including an inhibitory transcription factor or a gene editing system targeting CHIT-1. In some embodiments, the CHIT-1 inhibitor comprises a CRISPR-dCas system that increases methylation.

[0231] In some embodiments, the CHIT-1 inhibitor comprises a gene editing system for knocking out or knocking down CHIT-1, such as a gene editing system targeting SEQ ID NO: 2, including but not limited to large-range nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and CRISPR / Cas systems.

[0232] In some embodiments, the CHIT-1 inhibitor comprises an antisense nucleic acid or an interfering nucleic acid (including but not limited to siRNA, shRNA, and miRNA) for knocking out or knocking down CHIT-1.

[0233] In some embodiments, the CHIT-1 inhibitor comprises a binding molecule that can bind to a CHIT-1 protein, such as a binding molecule that binds to SEQ ID NO: 1, such as an antibody or an antigen-binding fragment or antibody derivative thereof.

[0234] In some embodiments, the CHIT-1 inhibitor comprises a TGFBR inhibitor. In some embodiments, the TGFBR inhibitor is Galunisertib (LY2157299, Sellect, S2230).

[0235] The present disclosure provides a method for delaying motor neuron aging in a subject, comprising reducing CHIT-1 levels in the cerebrospinal fluid of the subject.

[0236] In some embodiments, the level of CHIT-1 is selected from the group consisting of CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, CHIT-1 polynucleotide amount or concentration, and any combination thereof. In some embodiments, the level of CHIT-1 is selected from the group consisting of CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, and any combination thereof.

[0237] In some embodiments, the method comprises administering to the subject an anti-CHIT-1 antibody, eg, an antibody that binds to SEQ ID NO: 1. In some embodiments, the anti-CHIT-1 antibody is administered intrathecally.

[0238] The inventors also found that administration of ascorbic acid could restore CHIT-1-induced MN and spinal cord senescence.

[0239] Therefore, the present disclosure also provides a method for treating, preventing or delaying spinal cord aging or motor neuron aging in a subject in need thereof, comprising administering ascorbic acid to the subject. In some embodiments, ascorbic acid is administered orally.

[0240] The present disclosure also provides a use of ascorbic acid in the preparation of a medicament for treating spinal cord aging or motor neuron aging in a subject in need thereof. In some embodiments, the medicament is administered orally.

[0241] 4. Test kits for detecting aging

[0242] The present disclosure also provides a kit for identifying the degree of spinal cord aging in a subject, comprising an agent for detecting the level of CHIT-1 or the presence of CHIT-1-positive microglia in a sample from the subject.

[0243] The present disclosure also provides use of an agent for detecting the level of chitinase-1 (CHIT-1) or the level of CHIT-1-positive microglia in a sample from the subject in preparing a kit for identifying spinal cord aging in a subject.

[0244] The present disclosure also provides a kit for identifying senescence of a tissue or organ in a subject, comprising an agent for detecting the level of chitinase-1 (CHIT-1) in a sample from the subject.

[0245] The present disclosure also provides use of an agent for detecting the level of chitinase-1 (CHIT-1) in a sample from the subject in preparing a kit for identifying aging of a tissue or organ in the subject.

[0246] In some embodiments, the subject is a primate (including non-human primates and humans).

[0247] In some embodiments, the level of CHIT-1 is selected from the group consisting of CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, CHIT-1 encoding polynucleotide amount or concentration, and any combination thereof. Higher CHIT-1 levels represent a higher degree of aging in tissues or organs, such as the spinal cord. In some embodiments, the presence of CHIT-1 positive microglia includes the number and / or distribution of CHIT-1 positive microglia in the spinal cord. A higher number of CHIT-1 positive microglia and / or a greater number of CHIT-1 positive microglia distributed around the MN represent a higher degree of spinal cord aging.

[0248] In some embodiments, the kit of the present disclosure is used to implement the method of identifying the degree of spinal cord aging of a subject of the present disclosure, comprising:

[0249] a) detecting the level of chitinase-1 (CHIT-1), or the presence of CHIT-1 positive microglia, in a sample from the subject; and

[0250] b) comparing the result of said detection with a reference value of CHIT-1 level.

[0251] The sample that can be used with the kit of the present disclosure is a sample containing cells or tissues from a subject, such as a biopsy sample of spinal cord tissue. The sample that can be detected with the kit of the present disclosure can also be a body fluid sample, such as cerebrospinal fluid or a blood sample, such as whole blood, plasma or serum.

[0252] In some embodiments, the kit of the present disclosure is used to implement the method of identifying the degree of aging of a tissue or organ of a subject of the present disclosure, comprising:

[0253] a) detecting the level of chitinase-1 (CHIT-1) in a sample from a tissue or organ of the subject; and

[0254] b) comparing the result of said detection with a reference value of CHIT-1 level.

[0255] In some embodiments, the subject is a primate.In some embodiments, the sample is from a tissue or organ selected from the group consisting of lung, liver, spleen, kidney, cerebellum, and parietal lobe.

[0256] Therefore, in some embodiments, the kits of the present disclosure further comprise instructions for carrying out the method.

[0257] In some embodiments, the reference value is obtained by testing a reference subject. In the present invention, the reference subject refers to a subject at a specific physiological age. The desired reference subject can be determined by testing representative characteristics associated with physiological age (e.g., characteristics selected from reflexes and balance). Due to individual differences, preferably, the reference value is obtained by testing a group of reference subjects.

[0258] According to the present invention, a statistically significant number of normal subjects at a specific natural age (e.g., 20, 30, 40, 50, 60, 70, 80, 90 or higher) or a natural age range (e.g., 18-22, 28-32, 38-42, 48-52, 58-62, 68-72, 78-82, 88-92, etc.) can also be selected as reference subjects.

[0259] The reference value may be expressed as "mean ± standard deviation" or as a range. When a population is tested to determine the reference value, the highest and lowest values ​​may be discarded, for example, the highest 2.5% and / or the lowest 2.5%.

[0260] When the test result (such as the CHIT-1 level) is higher than the reference value, the aging degree of the subject's tissue or organ, such as the spinal cord, is identified as higher than the aging degree of the tissue or organ, such as the spinal cord, corresponding to the reference value; when the test result (such as the CHIT-1 level) is lower than the reference value, the aging degree of the subject's tissue or organ, such as the spinal cord, is identified as lower than the aging degree of the tissue or organ, such as the spinal cord, corresponding to the reference value.

[0261] In some embodiments, the reference value is obtained by testing a reference subject or a reference subject population. When the test result is higher than the reference value, the aging degree of the subject's tissue or organ, such as the spinal cord, is identified as higher than the (average) aging degree of the reference subject or the tissue or organ, such as the spinal cord, of the reference subject or the reference subject population; when the test result is lower than the reference value, the aging degree of the subject's spinal cord is identified as lower than the (average) aging degree of the reference subject or the tissue or organ, such as the spinal cord, of the reference subject.

[0262] In some embodiments, the reference value is CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, CHIT-1 encoding polynucleotide amount or concentration, and any combination thereof, representative of a reference subject or a population of reference subjects.

[0263] In some embodiments, detecting the level of CHIT-1 comprises detecting CHIT-1 enzyme activity in a sample. CHIT-1 enzyme activity in a sample can be detected according to methods known in the art, for example, by detecting the amount of CHIT-1 substrate converted per unit amount (e.g., volume or mass) of the sample per unit time (e.g., 15 min, 30 min, 45 min, 1 h, 2 h, or longer) at a certain temperature (e.g., 37° C.). In some embodiments, the agent for detecting the level of CHIT-1 comprises a CHIT-1 substrate.

[0264] In some embodiments, the detection of CHIT-1 levels comprises detecting the amount or concentration of CHIT-1 protein in a sample. In some embodiments, the amount or concentration of CHIT-1 protein is detected by a protein-binding molecule. In some embodiments, the agent for detecting CHIT-1 levels comprises any molecule capable of binding to CHIT-1 protein, such as, but not limited to, antibodies, antigen-binding fragments of antibodies, and antibody derivatives. In some embodiments, antigen-binding fragments of antibodies include, but are not limited to, Fv fragments (e.g., single-chain Fv and disulfide-bonded Fv) and Fab-like fragments (e.g., Fab fragments, Fab' fragments, and F(ab')2 fragments).

[0265] In some embodiments, detecting the level of CHIT-1 comprises detecting the amount or concentration of a polynucleotide encoding a CHIT-1 protein in a sample. In some embodiments, the polynucleotide is a transcript of a gene encoding CHIT-1 endogenous to the subject. In some embodiments, the agent for detecting the level of CHIT-1 comprises a primer pair or probe specific for the CHIT-1 gene.

[0266] In some embodiments, the subject is a non-human primate.

[0267] In some embodiments, the subject is a human. In some embodiments, the transcript comprises SEQ ID NO: 2, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO: 2. In some embodiments, the CHIT-1 protein comprises SEQ ID NO: 1, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity to SEQ ID NO: 1.

[0268] 5. Pharmaceutical Compositions for Treating, Preventing, or Delaying Aging

[0269] Therefore, the present disclosure provides a pharmaceutical composition for treating, preventing or delaying spinal cord aging or motor neuron aging in a subject in need thereof, comprising a CHIT-1 inhibitor and optionally a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition is formulated for intrathecal administration.

[0270] In some embodiments, the subject is a primate (including non-human primates and humans).

[0271] In some embodiments, the CHIT-1 inhibitor comprises an agent that inhibits transcription and / or translation of a polynucleotide encoding CHIT-1 and / or inhibits CHIT-1 activity.

[0272] In some embodiments, the CHIT-1 inhibitor comprises an agent that inhibits transcription of a polynucleotide encoding CHIT-1, including an inhibitory transcription factor or a gene editing system targeting CHIT-1. In some embodiments, the CHIT-1 inhibitor comprises a CRISPR-dCas system that increases methylation.

[0273] In some embodiments, the CHIT-1 inhibitor comprises a gene editing system for knocking out or knocking down CHIT-1, such as a gene editing system targeting SEQ ID NO: 2, including but not limited to large-range nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and CRISPR / Cas systems.

[0274] In some embodiments, the CHIT-1 inhibitor comprises an antisense nucleic acid or an interfering nucleic acid (including but not limited to siRNA, shRNA, and miRNA) for knocking out or knocking down CHIT-1.

[0275] In some embodiments, the CHIT-1 inhibitor comprises a binding molecule that can bind to a CHIT-1 protein, such as a binding molecule that binds to SEQ ID NO: 1, such as an antibody or an antigen-binding fragment or antibody derivative thereof.

[0276] The present disclosure also provides a pharmaceutical composition for treating, preventing or delaying spinal cord aging or motor neuron aging in a subject in need thereof, comprising ascorbic acid and optionally a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition is formulated for oral administration.

[0277] 6. Animal or cell models of motor neuron aging

[0278] The present disclosure provides an animal model or cell model of motor neuron aging, wherein the animal or cell has increased CHIT-1 levels. In some embodiments, the animal is a non-human mammal. In some embodiments, the cell is a motor neuron. In some embodiments, the neuron is a non-human mammal motor neuron or a human motor neuron.

[0279] The present disclosure also provides a method for constructing an animal model of motor neuron aging, comprising increasing the level of CHIT-1 in the animal. In some embodiments, the animal is a non-human mammal.

[0280] The present disclosure also provides a method for constructing a cell model of motor neuron aging, comprising increasing the level of CHIT-1 in motor neurons or treating motor neurons with CHIT-1 protein or TGFBR agonist. In some embodiments, the neurons are non-human mammalian motor neurons or human motor neurons.

[0281] In some embodiments, the level of CHIT-1 is selected from the group consisting of CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, CHIT-1 polynucleotide amount or concentration, and any combination thereof.

[0282] In some embodiments, increasing the level of CHIT-1 in the animal comprises overexpressing a CHIT-1 protein in the animal. For example, a transgenic animal with increased levels of CHIT-1 can be generated by introducing an overexpression vector encoding the CHIT-1 protein. Overexpression of the CHIT-1 protein can also be promoted by a CRISPR-dCas system (e.g., a CRISPR-dCas system that reduces methylation levels or a CRISPR-dCas system fused to a transcriptional activator).

[0283] In some embodiments, increasing the level of CHIT-1 in the animal comprises administering a CHIT-1 protein or a TGFBR agonist to the animal.

[0284] In some embodiments, the TGFBR agonist is SRI-011381 (Sellect, S6645).

[0285] In some embodiments, the non-human mammal is a mouse or a cynomolgus monkey.

[0286] The animal models of motor neuron aging disclosed herein (such as spinal motor neurons of cynomolgus monkeys and mice) are characterized by the identification of the following phenotypes: increased expression levels of pSMAD2 in motor neurons, decreased number of motor neurons, increased number of SA-β-Gal-positive motor neurons, decreased complexity of motor neuron tree branches, decreased density of motor neuron dendritic spines, decreased axonal area of ​​motor neuron axons extending to the limbs, decreased area of ​​neuromuscular junctions in skeletal muscles of the limbs, decreased ability of motor neurons to conduct electrical signals to axons, and decreased body movement ability controlled by motor neurons.

[0287] The cell models of motor neuron aging disclosed herein, such as human motor neurons (long-term cultured human motor neuron aging model and CHIT-1-induced accelerated human motor neuron aging research model), are characterized by the identification of the following manifestations: motor neuron functional degeneration and increased expression of aging-related markers.

[0288] The inventors discovered that treatment with recombinant human CHIT-1 protein and culture medium containing CHIT-1 protein (e.g., culture medium containing microglia overexpressing CHIT-1) can accelerate the aging of human motor neurons. The inventors also discovered that, compared with culture medium without CHIT-1 protein depletion, the expression of aging markers in human motor neurons treated with culture medium containing CHIT-1 protein depleted of CHIT-1 protein using anti-CHIT-1 antibodies and then treated with culture medium depleted of CHIT-1 protein decreased, indicating that depleting CHIT-1 protein from the environment in which motor neurons reside (e.g., cerebrospinal fluid) can delay motor neuron aging. Example

[0289] Materials and Methods

[0290] Unless otherwise specified, the experimental procedures in the examples of this application were performed according to conventional methods in the art. The following materials and methods are intended to illustrate, but not to limit the present invention.

[0291] Animal use and care

[0292] The cynomolgus macaques used in this study are native to Southeast Asia and were housed at a certified primate research center (Union Bioresources) in Beijing at 25°C under a 12-hour light / 12-hour dark cycle. All animals were confirmed to have no clinical or experimental history prior to the start of the experiment. The Ethics Review Committee of the Institute of Zoology, Chinese Academy of Sciences, approved the use of cynomolgus macaques in this study.

[0293] All mouse experimental procedures were approved by the Institutional Animal Care and Use Committee of the Institute of Zoology (Chinese Academy of Sciences). Mice were anesthetized with isoflurane and then euthanized by CO2 inhalation and cervical dislocation.

[0294] Cynomolgus monkey spinal cord sample collection and preparation

[0295] For the aging study, spinal cord tissue was collected from eight young (4-6 years old) and eight old (18-21 years old) cynomolgus monkeys for sequencing and histological studies. For ascorbic acid treatment, 17-18 year old cynomolgus monkeys (n=10) were randomly divided into two groups. Five monkeys received 30 mg / kg of ascorbic acid orally for 40 months. The ascorbic acid was dissolved in drinking water and taken daily after breakfast. An additional five monkeys served as a control group and received the same amount of drinking water. Spinal cord tissue was then collected for further analysis.

[0296] Spinal cord tissue was harvested from anesthetized monkeys (Zolta 50, 5 mg / kg) perfused with saline. Half of the cervical, thoracic, and lumbar spinal cords were fixed in 4% paraformaldehyde (PFA) at 4°C overnight, dehydrated in RNA-free 25% sucrose for 2 days, and embedded in Tissue Tek OCT Compound (Sakura Finetek). The remaining halves of the cervical, thoracic, and lumbar spinal cords were stored in liquid nitrogen and used for snRNA-seq, RT-qPCR, bulk RNA-seq, or protein extraction.

[0297] Intracerebroventricular injection of CHIT-1 in mice

[0298] To evaluate the role of CHIT-1 in the spinal cord, 2-month-old male nude mice (9 per group) and C57 / BL6 mice (9-11 per group) (purchased from Spef (Beijing) Biotechnology Co., Ltd.) were injected with 5 μL of recombinant human CHIT-1 protein (200 pg / μL) (RD system, 3559-GH-010) or PBS into the lateral ventricle 5 times every other day. The grip strength of all four limbs was then tested on a handgrip dynamometer (Panlab Grid Strength Meter, LE902). Briefly, the mouse was placed on top of the handgrip dynamometer, and the peak pull force was recorded on a digital force sensor. The measurement was repeated seven times. The maximum and minimum values ​​were excluded, and the average was calculated as the grip strength of each mouse. On the day after the last behavioral test, the mice were sacrificed and their spinal cord tissue was collected for subsequent phenotypic analysis.

[0299] Mouse spinal cord sample collection and preparation

[0300] Spinal cords were collected from C57 / BL6 male mice for snRNA-seq (13 months, n = 5; 28 months, n = 5) and immunofluorescence staining (2 months, n = 8; 13 months, n = 10; 28 months, n = 10). Spinal cord tissue was harvested from anesthetized mice perfused with saline (2,2,2-tribromoethanol, intraperitoneal anesthesia, dose: 0.2 ml / 10 g body weight). Half of the cervical, thoracic, and lumbar spinal cords were fixed in 4% PFA at 4°C overnight, dehydrated in RNA-free 25% sucrose for 2 days, and embedded in Tissue Tek OCT Compound (Sakura Finetek). The remaining half of the cervical, thoracic, and lumbar spinal cords were stored in liquid nitrogen and used for snRNA-seq.

[0301] Human spinal cord, cerebrospinal fluid, and plasma sample collection

[0302] Human spinal cord samples were obtained from donors at Beijing Tiantan Hospital, Capital Medical University. Six sets of spinal cord samples were collected from young adult donors (17-25 years old, n=3) and elderly donors (54-75 years old, n=4). All patients provided written informed consent for sample collection and data analysis. This study was approved by the Research and Ethics Committee of Beijing Tiantan Hospital, Capital Medical University.

[0303] Human cerebrospinal fluid (CSF) samples were obtained from donors at Beijing Tiantan Hospital, Capital Medical University. Six sets of CSF samples were collected from young donors (9-21 years old, n=3) and elderly donors (54-60 years old, n=3). All patients provided written informed consent for sample collection and data analysis. This study was approved by the Research and Ethics Committee of Beijing Tiantan Hospital, Capital Medical University.

[0304] Human serum samples were obtained from healthy young male (19-25 years old, n=40) and elderly male (75-92 years old, n=40) donors enrolled in the 1000X Circulating Biobank Key Aging-Related Biomarker Project (1000×CBAB Project) at the China National Center for Geriatrics, Peking University Hospital. All donors provided written informed consent for sample collection and data analysis. The Ethics Review Committee of Peking University Hospital approved the use of human serum in this study.

[0305] SA-β-Gal staining

[0306] SA-β-Gal staining was performed as previously described (Ma, S. et al. Caloric Restriction Reprograms the Single-Cell Transcriptional Landscape of Rattus Norvegicus Aging. Cell 180, 984-1001e1022, (2020)). Briefly, tissue sections with a thickness of 20 μm were washed with PBS, fixed in a solution containing 2% formaldehyde and 0.2% glutaraldehyde for 5 minutes at room temperature (RT), and stained with fresh staining solution containing X-gal at 37 ° C for 6 hours (monkey spinal cord) or 18 hours (mouse spinal cord). Images were taken by Nikon microscope (Olympus, Waltham, USA) using ImageJ software (version: 1.8.0, https: / / imagej.nih.gov / ij / ). Fluorescent detection of SA-β-Gal staining in hMNs was performed according to the CellEvent Senescence Green Flow Cytometry Assay Kit manufacturer's protocol (Thermo Fisher Scirnitic, C10841).

[0307] Hematoxylin staining

[0308] For hematoxylin staining, paraffin-embedded sections with a thickness of 5 μm were dewaxed in xylene, rehydrated in gradient alcohol (100%, 100%, 95%, 80%, 75%), and then briefly rinsed in distilled water. Tissue sections were incubated with hematoxylin solution (Servicebio, China) until the desired degree of staining was achieved and rinsed in running water to remove excess hematoxylin. The sections were then differentiated in 1% acid alcohol for 1 second and rinsed in running water for 1 minute. Finally, the sections were dehydrated in ethanol and xylene in the opposite gradient to the above and fixed with cytoseal-60 (Stephens Scientific).

[0309] Oil Red O staining

[0310] Frozen tissue sections with a thickness of 20 μm were rinsed three times in PBS and fixed in a solution containing 4% PFA for 10 minutes at room temperature. The sections were then rinsed three times in PBS and immersed in 60% isopropanol for 2 seconds at room temperature, then incubated for 15 minutes at room temperature with Oil Red O working solution (30 mL of Oil Red O stock solution was diluted with 20 mL of distilled water and filtered through a 0.22 μm filter (PolylSelect Life Science)). The sections were rinsed in 60% isopropanol for 30 seconds at room temperature and rinsed three times in PBS. The sections were then counterstained with hematoxylin for 1 minute 30 seconds at room temperature, then rinsed three times in PBS and immersed in 1% ammonia until the sections turned blue. Finally, the sections were further analyzed with glycerol (Sigma).

[0311] Immunohistochemical staining

[0312] Paraffin-embedded sections with a thickness of 5 μm were dewaxed and rehydrated, and then antigen retrieval was performed by microwave in 10 mM sodium citrate buffer (pH 6.0) for 3 times, 2 minutes each time. After cooling to RT, the sections were rinsed three times in PBS and incubated with 3% H2O2 for 20 minutes to inactivate endogenous peroxidase. After washing three times with PBS, the sections were permeabilized with 0.1% Triton X-100 in PBS for 10-30 minutes at room temperature, and then blocked with 10% donkey serum (Jackson) in PBS for 1 hour at room temperature and incubated with primary antibodies overnight at 4°C. The next day, the sections were incubated with HRP-conjugated secondary antibodies for 1 hour at RT, followed by colorimetric detection using DAB (ZSGB-BIO) and counterstained with hematoxylin. Finally, sections were dehydrated in graded alcohols (50%, 70%, 80%, 90%, 100%, and 100%) and xylene before being mounted in neutral resin mounting medium. Primary antibodies were as follows: anti-γH2A.X (Millipore, 05-636, 1:500), anti-CHIT-1 (Novus Biologicals, NBP1-84490, 1:1000), anti-p-SMAD2 (Cell Signaling Technology, 18338, 1:10,000), anti-NeuN (Abcam, ab177487, 1:1000), and anti-ChAT (Millipore, AB144P, 1:2000). The following secondary antibodies were used: goat anti-mouse secondary antibody kit and goat anti-rabbit secondary antibody (ZSGB-BIO), donkey anti-goat IgG (H+L) cross-adsorbed secondary antibody, HRP (Thermo Fisher scientific, A16005, 1:200).

[0313] Immunofluorescence staining

[0314] Frozen tissue sections with a thickness of 14 μm were rinsed 3 times for 5 minutes in PBS, permeabilized with 0.2% Triton X-100 in PBS solution for 10 minutes, and then rinsed 3 times with PBS. The sections were then incubated with blocking buffer (10% donkey serum in PBS) for 1 hour at RT, then incubated with the primary antibody overnight at 4 ° C, and incubated with the fluorescently labeled secondary antibody for 1 hour at RT. The nuclei were counterstained with Hoechst 33342 (Thermo Fisher Scientific) and then mounted in VECTERSHIELD anti-fading mounting medium (Vector Laboratories, h-1000). Images were acquired using a confocal laser scanning microscope (Leica TCS SP8 or Zeiss LSM 900). The primary antibodies are as follows: anti-NeuN (Abcam, ab177487, 1:1000), anti-NeuN, ab104224, 1:500), anti-ChAT (Millipore, AB144P, 1:100-1:200), anti-IBA1 (Abcam, ab5076, 1:300), anti-IBA1 (Wako, 019-19741, 1:400), anti-Lamin B2 (Abcam, ab151735, 1:200-1:600), anti-H3K9me3 (Abcam; ab8898, 1:200-1:2000), anti-4-HNE (Abcam, ab48506, 1:200), anti-CHIT-1 (Novus biological, NBP1-84490, 1:200), anti-CHIT2 (Santa Clara, CA, USA). Cruz, sc-271460, 1:100), anti-P2RY12 (Atlas Antibodies, HPA014518, 1:400), anti-P2RY2 (BioLegend, 848002, 1:50), anti-GFP (Abcam, ab4674, 1:2000), anti-TUJ1 (Abcam, ab78078, 1:1000), anti-VAChT (Sigma Aldrich, SAB4200559, 1:200).Secondary antibodies were as follows: Alexa Fluor 568 donkey anti-rabbit IgG (H+L) (Invitrogen, A10042, 1:500), Alexa Fluor 568 goat anti-goat IgG (H+L) (Invitrogen, A11057, 1:5000), Alexa Fluor 568-donkey anti-mouse IgG (H+L) highly cross-adsorbed secondary antibody (Invitrigen, A11037, 1:500, Alexa Fluor 488 donkey anti-rat IgG (H+L) highly cross-adsorbed secondary antibody (Invitrogen, A21208, 1:500), Alexa Fluor 488 donkey anti-goat IgG (H+L) (Invitrigen, A11055, 1:5000), Alexa Fluor 486 donkey anti-rabbit IgG (H+AL) (Thermo Fisher Scientific, A21206, 1:500), and Alexa Fluor 568-donkey anti-mouse IgG (H+L) highly cross-adsorbed secondary antibody (Invitrogen, A11037, 1:500). 488 donkey anti-mouse IgG (H+1) (Therm, A21202, 1:500).

[0315] Nissl staining

[0316] For Nissl staining, paraffin-embedded sections with a thickness of 20 μm were dewaxed, stained with Nissl reagent (Beytotimm, China), dehydrated in graded alcohols, cleared in xylene, and mounted with neutral balsam (ZSGB-BIO). The number of cells in the spinal cord was counted and analyzed using ImageJ software (version: 1.8.0, https: / / imagej.nih.gov / ij / ).

[0317] Golgi staining

[0318] Golgi staining was performed using the FD Fast Golgi Staining Kit (FD NeuroTechnologies, USA) according to the manufacturer's protocol. Briefly, monkey spinal cord tissue with a thickness of 150 μm was immersed in solutions A and B at room temperature for 2 weeks and then transferred to solution C at 4°C for 72 hours. Monkey spinal cord tissue was sectioned with a thickness of 150 μm using a cryostat system (CM3050S; Leica Microsystems, Bannockburn, III, Germany). Subsequent staining steps were performed according to the manufacturer's protocol. Bright field images were obtained using a Nikon microscope and a confocal laser scanning microscope (Leica TCS SP8). Microscopic images were analyzed using ImageJ software (version: 1.8.0, https: / / imagej.nih.gov / ij / ).

[0319] RNA in situ hybridization (RNA-ISH)

[0320] The thoracic spinal cord was fixed with 4% PFA (containing DEPC) at 4°C overnight, perfused in 25% sucrose solution (containing DEPC) for 2-3 days until the tissue settled to the bottom and embedded in Tissue Tek OCT Compound (Sakura Finetek) for cryoprotection. The OCT-embedded spinal cord was cut into 18 μm thick sections for RNA-ISH. The primers for TNS1 were designed based on the homologous sequence of mice (Allen Brain Map) and used to clone the TNS1 fragment from cynomolgus macaque cDNA and subsequent RNA probe labeling. DIG-labeled RNA probes were transcribed by T7 polymerase using DIG RNA labeling mixture (Roche Diagnostics). The blue-purple signal was considered to be a TNS1-positive cell. The primer sequences used were:

[0321] TNS1-ISH1-Forward CTCTGCCCGACTTCTCCAA(SEQ ID NO:3)

[0322] TNS1-ISH1-Reverse CATGTCCACAGAGTTGACGAA(SEQ ID NO:4)

[0323] Western blotting

[0324] For Western blotting, tissues were lysed on ice for 1 hour in RIPA buffer (25 mM Tris-HCl (pH 7.6), 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, and 0.1% SDS) containing a protease inhibitor cocktail (Roche) and centrifuged at 13,000 rpm for 30 minutes at 4°C. Supernatants were collected and quantified using a BCA kit (Thermo Fisher Scientific). Protein (50 μg) was then transferred to a PVDF membrane (Millipore). Western blots were observed after incubation with the primary antibody overnight at 4°C and with an HRP-conjugated secondary antibody for 1 hour at RT. The primary antibodies were as follows: anti-CHIT-1 (Novus biological, NBP1-84490, 1:1000), anti-GAPDH (Santa Cruz, sc-365062, 1:3000), anti-PSD95 (Abcam, ab18258, 1:10000), and anti-p-SMAD2 (Cell Signaling Technology, 18338S, 1:1000).

[0325] ELISA

[0326] CHIT-1 levels were measured using a commercial ELISA kit (Abcam, ab246541) according to the manufacturer's instructions. Plates were scanned at 450 nm using a Synergy H1 (BioTek).

[0327] Human motor neuron (hMN) differentiation

[0328] At the initial stage of hMN differentiation, hESCs were passaged onto MMC-inactivated MEF feeder cells. For the first three days, cells were cultured in Medium 1 (containing 50% Advanced DMEM / F12 (Invitrogen), 50% neurobasal (Invitrigen), 1×N2 (Invitroden), 1×B27 (Invitroben), 1% GlutaMAX (Invitropen), 1% NEAA (Invitrogen), 1% penicillin / streptomycin (Invitragen), 4 μM CHIR99021 (Cellagentech), 3 μM SB431542 (Cellagenttech), 1 μM dorsomorphin (Sigma), 0.1 μM compound E (EMD Chemicals), and 0.2% heparin (Sigma). Over the next three days, 100 nM retinoic acid (RA) was added to Medium 1 (referred to as Medium 2). On day 6, dorsomorphin was removed and 500 nM SAG (Medium 3) was added. On day 8, cells were dissociated into single cells using Accumax (Millipore) and re-seeded on Matrigel-coated plates in Medium 1. On day 9, 10 μM DAPT and laminin were added to promote MN differentiation.

[0329] Drug treatment of hMNs

[0330] hESC-derived hMNs were cultured in medium 1 containing 10 μM DAPT for 18 days. Almost 95% of the MNs expressed classical markers. The cells were then incubated with (1) 200 ng / mL recombinant human CHIT-1 protein (RD System, 3559-GH-010) (with or without 280 μM ascorbic acid), (2) 10 μM SRI-011381 (TGFBR agonist, Sellect, S6645), (3) 10 μM Galunisertib (TGFBR-inhibitor, Sellect, S2230) (with or without 200 ng / mL CHIT-1), and the medium was changed every other day. After 7 days of treatment, three independent hMN cultures were collected from each group for immunofluorescence analysis, Western blotting, or bulk RNA-seq.

[0331] Knockdown of SMAD2 in hMNs

[0332] hESC-derived hMNs were cultured in Medium 1 containing 10 μM DAPT for 18 days. hMNs were transfected with a negative control duplex or siRNA targeting SMAD2 (RIBOBIO) using Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. For long-term cultured neurons, siRNA duplexes were transfected every 3.5 days. During the transfection period, hMNs were incubated with or without 200 ng / mL CHIT-1. After 7 days of treatment, three independent hMN cultures per group were harvested for immunofluorescence analysis, Western blotting, or bulk RNA-seq.

[0333] si-SMAD2-1# GGAGTGCGCTTATACTACA(SEQ ID NO:5)

[0334] si-SMAD2-2# GAAGCCGTCTATCAGCTAA(SEQ ID NO:6)

[0335] si-SMAD2-3#GGTTTACTCTCCAATGTTA(SEQ ID NO:7)

[0336] Human microglial cell culture

[0337] Human microglial cells (HMC3, human microglial clone 3; Procell, CL-0620) were cultured in HMC3 medium at 37°C in 5% CO2 in 6-well plates (Corning Incorporated, 3516). When 80% confluence was reached, cells were harvested with 0.25% trypsin and then passaged. All cell culture media tested negative for mycoplasma contamination.

[0338] Construction of CHIT-1 gene expression vector

[0339] The PLE4-CHIT-1 overexpression vector was constructed by replacing the green fluorescent protein (GFP) encoding sequence of the source vector (PLE4-GFP, a gift from T. Hishida) with the CHIT-1 encoding cDNA sequence (SEQ ID NO: 2). The primers used to clone the CHIT-1 cDNA sequence are SEQ ID NO: 8 and 9.

[0340] CHIT1-Forward CTAGTCTAGAGCCACCATGGTGCGGTCT(SEQ ID NO:8)

[0341] CHIT1-Reverse CGACGCGTTCACTTGTCATCGTCGTCCTT(SEQ ID NO:9)

[0342] Lentivirus production and cell transduction

[0343] HEK293T cells (sourced from ATCC) were transfected with lentiviral vectors (lenti-Luc or lenti-CHIT-1) for protein overexpression, along with the packaging plasmids psPAX2 and pMD2.G. Lentiviral particles were collected from the supernatant of HEK293T cells by ultracentrifugation at 64,300 g for 135 minutes at 4°C and used to transduce HMC3. Twenty-four hours after lentiviral transduction, the culture medium was changed to Medium 1 with 10 μM DAPT for two days. Conditioned medium from HMC3 transduced with lenti-Luc or lenti-CHIT-1 was then collected, diluted 1:5 with fresh Medium 1 with 10 μM DAPT (final CHIT-1 concentration of approximately 250 μg / mL), and added to cultured hMNs (day 18), with the medium changed every other day. After 7 days of treatment, three independent hMN cultures were harvested from each group for immunofluorescence analysis or Western blotting.

[0344] Nucleic acid isolation and snRNA-seq on the 10X Genomics Chromium platform

[0345] Frozen monkey or mouse spinal cord tissue was ground and dissolved in a solution containing 250 mM sucrose, 25 mM KCl, 5 mM MgCl2, 10 mM Tris buffer, 1 μM DTT, 1 U / μL protease inhibitor, 0.4 U / μL RNaseIn (Promega), 0.2 U / μL Superasin (Thermo Fisher Scientific), 0.1% Triton X-100, 1 μM propidium iodide (PI) (Thermo Fisher Scientific) and 10 ng / mL Hoechst 33342 (Thermo Fisher Scientific) in nuclease-free water (Ambion). The sample was then filtered through a 40 μm cell strainer (BD Falcon), centrifuged at 500 g for 8 minutes at 4°C, and resuspended in PBS supplemented with 0.3% BSA (Gemini), 0.4 U / μL RNaseIn (Promega) and 0.2 U / μL Superasin (Thermo Fisher Scientific). Hoechst 33342 and PI double-positive nuclei were sorted using FACS (BD Influx) and counted using a dual fluorescence cell counter (Luna FLTM, Logos Biosystems). For mouse nucleus isolation, nuclei from the same group (n=5 mice) were pooled and diluted to 450-500 nuclei / μL to allow single-nucleus capture. Following the manufacturer's standard protocol (10x Genomics), a single-nucleus library of approximately 5000 nuclei per sample was constructed using the 10x Genomics Chromium Single Cell 3'Gene Expression Solution. The library was then sequenced with a 150bp paired-end read length on the NovaSeq 6000S4 sequencing system (Illumina, 20012866).

[0346] Bulk RNA-seq library construction and sequencing

[0347] For batch RNA-seq, total RNA was extracted using TRIzol (Thermo Fisher Scientific), and RNA quality was checked using a nano Photometer (IMPLEN, CA, USA) and an Agilent 2100RNA nano 6000 analysis kit (Agilent Technologies, CA, USA.). Unstranded bulk RNA-seq sequencing libraries were then generated from 1–3 μg of RNA per sample using the Illumina Universal V6 RNA seq Library Preparation Kit (Vazyme, NR604-02) according to the manufacturer's standard protocol. Finally, cluster generation and sequencing were performed on a Novasek 6000S4, generating 150 bp paired-end reads with a sequencing depth of 20 M reads per sample (performed by Beijing Annolu Genomics).

[0348] Single-cell labeled reverse transcription sequencing (STRT-Seq) library construction and sequencing

[0349] The STRT-seq library was constructed as described by Wang et al. (Wang, S. et al. Single-Cell Transcriptomic Atlas of Primate Ovarian Aging. Cell 180, 585-600e519, 2020). In short, a single nucleus was taken from MN and transferred to a lysis buffer. Then, the mRNA in the lysate was reverse transcribed with SuperScript II reverse transcriptase (Thermo Fisher Scientific, 18064-071), and 8 nucleotides (nt) nuclear specific column codes were added to the cDNA from each nucleus. Absolute counting of molecules was performed using 8nt unique molecular identifiers (UMIs). Synthetic cDNA from nuclei with different column codes was pre-amplified for 20 cycles, pooled together and amplified for 6 additional cycles, then fragmented with Covaris S2 (Thermo Fisher Scientific), and enriched for the fragments of interest by Dynabeads MyOne Streptavidin C1 beads (Thermo Fisher Scientific, 65001). The enriched fragments were constructed into libraries using the KAPA HyperPrep kit (KAPA, KK8504) and sequenced on an Illumina HiSeq 4000 platform with a 150 bp end read length from Novogene.

[0350] Batch RNA-seq data analysis

[0351] Raw reads were first trimmed using TrimGalore (version 0.4.5). Clean reads were mapped to the Macaca_fascularis_5.0 or hg19 genome using HISAT2 (version 2.0.4). Gene expression quantification was performed using HTSeq (version 0.11.0) to count only high-quality mapping reads (mapping quality score >20). Differential expression analysis was performed using DESeq2 (version 1.22.2). Differentially expressed genes (DEGs) in monkey spinal cord were identified as having a Benjamini-Hochberg (BH)-adjusted P value <0.05 cutoff, while DEGs in hMNs treated with different methods were identified as genes with a BH-adjusted P value <0.05 and |log2FC| >1. Long-term culture (LTC)-DEGs in hMNs were identified by principal component analysis (PCA). Genes with |PC1 load score| > 0.02 and |PC2 load score| < 0.05 were defined as LTC DEGs, which gradually moved away from the D0 transcriptome along the PC1 dimension with prolonged culture time. GSEA was performed on all pathways using clusterProfiler (version 4.4.4) under the Biological Process category of Gene Ontology (GO) annotation. SMAD2 target genes of upregulated DEGs between CHIT-1-treated and control hMNs were identified using RcisTarget (version 1.6.0). These target genes were further used to compare the extent of SMAD2 activation in control, CHIT-1, and CHIT-1 plus ascorbic acid hMNs.

[0352] snRNA-seq data processing

[0353] Raw sequencing files for cynomolgus macaques and mice generated using the 10x Genamics Chromium platform were processed with Cell Ranger (version 3.0.0, 10x Genomics) and mapped to pre-mRNA references generated using the Macaca_fascularis_5.0 or mm10 genomes and their corresponding annotation files, respectively. For STRT-seq data, template switch oligonucleotide (TSO) and polyA tail sequences were first trimmed. After removing adapters and low-quality bases, clean reads were also mapped to the Macaca_fascularis_5.0 genome with Tophat (version 2.1.1). Mapped reads were further counted using HTSeq (version 0.11.0).

[0354] Filtering of low-quality cells and dataset integration

[0355] The raw count matrix generated from Cell Ranger was first processed with CellBender (version 0.2.0) using default parameters to remove possible background noise. For the cynomolgus macaque dataset generated by the 10x Genomics Chromium system, the filtered matrix was then analyzed using Seurat (version 3.2.3) to exclude cells with a mitochondrial gene ratio >5% and a gene count <200. DoubletFinder (version 2.0.2) was applied to the dataset of each sample to remove possible doublets. For the STRT-seq data, cells with a localization ratio >10% and a gene count >500 per cell remained. Each filtered dataset was normalized using the “SCTransform” function of Seurat. A total of 2000 highly variable genes were selected for integration using the “SelectIntegrationFeatures” function, based on which each sample was subjected to principal component analysis using the “RunPCA” function. Datasets from different samples and platforms were integrated with the RPCA integration pipeline of Seurat. Mouse spinal cord snRNA-seq data were also analyzed using the same procedure described above.

[0356] Clustering of integrated snRNA-seq data

[0357] Principal component analysis was first performed on the integrated dataset with the “RunPCA” function. Then, clustering was performed based on the top 30 components (monkey dataset and mouse dataset) using the “FindNeighbors” and “FindClusters” functions. Dimensionality reduction analysis was performed using the “RunTSNE” function. Cell types were assigned to the corresponding clusters based on the expression of cell type-specific marker genes 94-97 and the pathway enrichment analysis results of marker genes calculated with the “FindAllMarkers” function (BH-adjusted P < 0.05, |logFoldChange| > 0.5). HOXD4 was used as a marker for MNs because it was previously reported to be highly expressed in spinal MNs. After integration and clustering, cells clustered into MNs, but cells with low HOXD4 expression were further excluded.

[0358] Differential gene expression and pathway enrichment analysis of snRNA-seq data

[0359] The Wilcoxon test was used to calculate the differentially expressed genes (DEGs) in different cell types between the elderly and young groups using the "FindMarkers" function in Seurat, with BH-adjusted P values ​​< 0.05 and |logFoldChange| > 0.25. Because meningeal cells are not a major component of the spinal cord parenchyma, meningeal cells and LGR5+IN cells were not included in downstream analyses, and LGR5+IN was predominantly detected in both samples. All pathway enrichment analyses involved in this study were performed using Metascape (http: / / metascape.org / gp / index.html). The differential expression (DE) scores of DEG-enriched pathways were calculated as follows:

[0360] N up is the number of upregulated DEGs, N down is the number of downregulated DEGs.

[0361] Transcription factor analysis of snRNA-seq data

[0362] Transcription factor analysis was performed using the SCENIC pipeline (version 1.1.2.2). The human TF database (hg19) was obtained using RcisTarget (version 1.6.0). Transcriptional regulatory networks were inferred based on the input DEGs of the corresponding cell types using GENIE3 (version 1.8.0). Network diagrams were generated using Cytoscape (3.8.2).

[0363] Gene set scoring analysis

[0364] Gene sets were downloaded from GSEA (https: / / www.gsea-msigdb.org / gsea). Gene set scores were calculated using the Seurat "AddModuleScore" function. Statistical analysis of gene set scores for old and young cells was performed using the ggpubr package (version 0.2.4) using the Wilcoxon test.

[0365] Microglial subcluster analysis

[0366] Monkey microglia transcriptome data extracted from the entire dataset were normalized using the "SCTransform" function and analyzed using "RunPCA" based on 1000 highly variable genes. Dimensionality reduction and clustering were performed based on the top 12 PCs as described above. For mouse microglia, after normalization and dimensionality reduction, Seurat objects were used to perform "FindTransferAnchors" and "TransferData" on the monkey microglia data to classify mouse microglia. Marker genes for clusters and subtypes were identified using Seurat's "FindAllMarkers" function.

[0367] Quantification of immunofluorescence staining and immunohistochemistry staining

[0368] To measure and normalize the intensity of the fluorescence signal, we used the standard function modules of ImageJ software (version: 1.8.0, https: / / imagej.nih.gov / ij / ). Specifically, we used the built-in measurement tool of ImageJ software to read the mean pixel intensity of the selected region of interest (ROI). To measure the mean fluorescence intensity of the spinal cord WM, vGM, and dGM regions of young and old monkeys, the entire cross-sectional area of ​​each monkey (rather than a few randomly selected areas) was used for quantification. To measure the mean fluorescence intensity of MNs, more than 40 MNs in the spinal vGM sections of each monkey were randomly selected for quantification.

[0369] Statistical analysis

[0370] All data were statistically analyzed using a two-tailed t-test to compare differences between groups, assuming equal variance using PRISM software (GraphPad 8), except for Figures 3e, 4k, and 5e, and Extended Data Figure 3a, which were analyzed by the Wilcoxon test using the ggpubr R package (version 0.4.0). A P value < 0.05 was considered statistically significant. P values ​​are shown in the figures where appropriate. A P value of "NA" (not applicable) indicates a comparison between two groups with a zero value.

[0371] Example 1. Identification of MN as a Distinct Neurodegenerative Phenotype in the Spinal Cord of Aged Primates

[0372] Thoracic spinal cord tissue was collected from eight young (four males and four females, 4-6 years old) and eight old (four males and four females, 18-21 years old) cynomolgus monkeys, which are equivalent to approximately 20 and 70 years old in human age, respectively. Comparison revealed no significant differences in the general morphology and organizational patterning of the spinal cord (including the dorsal gray matter (dGM), ventral gray matter (vGM), and white matter (WM)) between the old and young monkeys (Figure 1).

[0373] However, unlike the young group, we found a series of region-specific neurodegeneration indicators, including the accumulation of senescence-associated β-galactosidase (SA-β-gal as a marker)-positive cells, increased DNA damage (marked by γ-H2A.X), elevated levels of oxidative damage (marked by 4-HNE), and accumulation of lipid droplets (marked by Oil Red O) in the aged spinal cord (Figures 2-6). MNs were identified as large cells expressing choline acetyltransferase (ChAT) or tensin 1 (TNS1) and residing in the vGM (Figures 7 and 8).

[0374] Notably, we found that over 90% of SA-β-gal-positive cells were MNs, and approximately 70% of MNs stained SA-β-gal positive in the vGM of aged spinal cords (Figures 9-11). Furthermore, other markers of aging, such as lipofuscin accumulation (an aging pigment in aged tissues), oxidative damage, impaired neuronal nuclear lamina integrity (manifested by decreased lamin B2), and heterochromatin decondensation (manifested by decreased H3K9me3 levels), were also enhanced in aged MNs (Figures 12-18). The significant decrease in MN number in the spinal cords of aged NHPs further underscores the functional degeneration of motor neurons during aging (Figures 7, 8, and 19). Functionally, we found that motor neuron axonal area and neuromuscular junction area decreased with aging in skeletal muscle of cynomolgus monkey limbs (Figure 20), suggesting a weakening of motor neuron innervation of skeletal muscle. Subsequently, we used artificial intelligence methods (see Sun et al., CHIT1-positive microglia drive motor neuron aging in the primate spinal cord. Nature 2023; 624(7992)611-620) to test and analyze the motor abilities of young and old NHPs. We found that old NHPs showed a decline in motor ability, as reflected in a decrease in movement distance, a decrease in climbing time, and a decrease in the number of times they used their upper limbs to grab food (Figures 21-23).

[0375] Therefore, the number of MNs in the spinal cord and the levels of senescence markers therein are correlated with spinal cord aging.

[0376] Example 2: Relationship between elevated spinal cord neuroinflammation and molecular changes in elderly primates

[0377] To explore the underlying molecular mechanisms of spinal cord aging in primates, we first used tissue RNA sequencing (bulk RNA-seq) to analyze transcriptome changes in young and aged thoracic spinal cord (Figure 24). Consistent with the aging phenotype, downregulated genes were primarily enriched in pathways involved in maintaining neuronal function, such as isoprenoid metabolism, which is associated with the production of metabolic myelin precursors and neurotransmitter transport (Figure 25). In contrast, upregulated genes were highly enriched in proinflammatory pathways (Figure 25). The most highly upregulated differentially expressed genes (DEGs) were CHIT-1 (FoldChange = 8.5, Benjamini-Hochberg (BH) corrected p-value = 1.3E-10), SERPINA5 (FoldChange = 4.9, BH corrected p-value = 0.0097), and GPNMB (FoldChange = 3.1, BH corrected p-value = 0.024) (Figures 26 and 27).

[0378] Furthermore, we found that significantly enhanced inflammation is a hallmark of spinal cord aging, and that the number of microglia (marked by P2RY12) increased in the parenchyma of the aging spinal cord ( FIG. 28 ).

[0379] Taken together, these data reveal that significant levels of neuroinflammation are a hallmark of spinal cord aging in aged primates.

[0380] Example 3: Changes in cell type-specific gene expression in the spinal cord after aging

[0381] To uncover cell-type-specific mechanisms of spinal cord aging in NHPs, we constructed a single-cell nuclear transcriptome atlas using microfluidics-based technology. We also utilized single-cell labeled reverse transcription sequencing (STRT-seq) as a complementary strategy to capture MNs (see Methods). In total, we obtained 101,237 high-quality single nuclei for downstream analysis.

[0382] After integrating the two datasets based on principal component analysis (PCA), we annotated each cell cluster using classic cell type-specific markers and functional annotations. We identified 14 cell types in the spinal cord (Figures 29 and 30), including neurons such as MNs, CNTN4+ interneurons (CNTN4.INS), RBFOX1+ interneurons (RBFOX1.INS), and LGR5+ interneurons (LGR5.INS); glial cells and glial precursor cells: oligodendrocytes (OLs), oligodendrocyte precursor cells (OPCs), Schwann cells, fibrillar astrocytes (Fib.Ast), protoplasmic astrocytes (Pro.Ast), ependymal cells; and supporting cells, including endothelial cells (EC), pericytes, and meningeal cells (Figures 29 and 30).

[0383] In addition, we also identified different types of immune cells in the spinal cord, such as microglia, macrophages, and T cells (Figures 31 and 32). Pathway enrichment analysis of the top 30 marker genes for each cell type revealed corresponding functional characteristics, such as "motor behavior" for MNs, "positive regulation of immune responses" for immune cells, "oligodendrocyte differentiation" for OPCs, and "vascular transport" for ECs (Figure 33).

[0384] To dissect cell type-specific and age-related changes in the spinal cord, we next analyzed transcriptional changes in each cell type. While most aging-associated DEGs were cell type-specific, with their expression altered in only one or two cell types, a few DEGs were shared by multiple cell types (Figure 33), including the gene encoding ferritin heavy peptide (FTH1), which is associated with iron homeostasis, oxidative stress, and proinflammatory pathways, which were increased in almost all cell types in the aged spinal cord (Figure 34). In addition, pathways related to inflammatory activation, such as "cytokine signaling in the immune system," "activation of the immune response," and "antigen presentation via MHC class II," were enriched in multiple cell types, including microglia, macrophages, and endothelial cells (Figure 35).

[0385] To fully understand the cell-type-specific impact of spinal cord aging, we mapped the top five most significantly upregulated DEGs from bulk RNA-seq to individual cell types. Through combined bulk and single-cell RNA-seq analysis, we found that the most significantly upregulated DEGs were concentrated in microglia (Figure 36). For example, CHIT-1 and GPNMB were specifically highly expressed in aging microglia, suggesting that their significant upregulation, along with their microglia-specific expression, may contribute to overall spinal cord aging (Figure 36).

[0386] Example 4: CHIT-1 positive microglia were found to be positively correlated with aging in the spinal cord

[0387] To further analyze the response of microglia to aging, we divided microglia into three states based on specific gene expression (Figures 37 and 38). Among them, microglia in state 1 accounted for approximately 80% of the microglia population in the young and old spinal cord and may represent the "initial" state of microglia (Figures 37-40). Microglial state 2 highly expressed SPP1, CD83, and RGS1, which are reported to be involved in immune regulation (Figures 37-41). Microglial state 3 showed high expression of CHIT-1, GPNMB, and LGALS3, and was mainly defined by a group of genes related to inflammation, secretion, and DNA damage (Figures 37-39, 41, and 42).

[0388] Notably, while both state 2 and state 3 microglia showed higher proportions in the aged spinal cord, state 3 microglia were almost exclusively present in aged tissue (Figure 43), indicating that state 3 microglia are uniquely enriched in the aged primate spinal cord.

[0389] Next, we co-stained CHIT-1 with the microglial marker P2RY12 to confirm the existence of a new aging-specific microglial state. In the aged spinal cord, cells in this state accounted for approximately 7% of the total P2RY12-positive microglia (Figure 44). In addition, CHIT-1, a marker gene for microglial state 3, was also the most highly upregulated aging DEG (Figure 26), and its significantly increased expression in aged tissues was confirmed at both the global RNA and protein levels (Figures 26 and 45). These results indicate that CHIT-1-positive microglia 3 preferentially accumulate in the aged spinal cord.

[0390] Next, we further explored the distribution of the newly discovered microglia 3 in the spinal cord. We selected different spinal cord segments and found that microglia 3 were present in the vGM and WM throughout the rostrocaudal axis of the aged spinal cord (Figure 47). In addition, we also performed CHIT-1 immunofluorescence staining on the spinal cords of humans and mice and the brains of monkeys. Similar to monkeys, the number of CHIT-1-positive microglia increased significantly in spinal cord samples from elderly people (Figure 46). However, CHIT-1-positive cells were not detected in the frontal lobes of elderly monkeys and the spinal cords of mice of various ages (Figures 48 and 49). We further performed snRNA-seq on the spinal cords of young and elderly mice (Figures 50 and 51). Consistent with the above histological findings, we still could not identify CHIT-1-positive microglia in the spinal cords of aged mice (Figures 52-55). In addition, we also detected elevated levels of CHIT-1 in the cerebrospinal fluid (CSF) and serum of aged monkeys and humans ( Figures 56 and 57 ), suggesting that CHIT-1 may be an indicator associated with spinal cord aging in primates.

[0391] Example 5: CHIT-1-positive microglia in the elderly spinal cord have a neurotoxic effect on MN

[0392] To investigate whether the age-related accumulation of CHIT-1-positive microglia reshapes microglia-neuron communication and leads to MN functional degeneration, we first analyzed the spatial relationship between CHIT-1-positive microglia and aged MNs.

[0393] In the vGM region of the aged spinal cord, CHIT-1-positive microglia were primarily located near MN cell bodies (pattern 1, 77.2%, within 20 μm; pattern 2, 7.2%, within 20-100 μm; pattern 3, 5.1% clustered within 50 μm of the MN), rather than away from the MN (pattern 4, 10.5%, greater than 100 μm) (Figure 58). Overall, CHIT-1-positive microglia close to the MN (patterns 1, 2, and 3) accounted for approximately 90% of the total CHIT-1-positive microglia in the vGM region of the aged spinal cord (Figure 58). Notably, we found that nearly 100% of CHIT-1-positive microglia in patterns 1, 2, and 3 were located near SA-β-gal-positive MNs, rather than in the vGM region near SA-β-gal-negative MNs (Figure 59). Coincidentally, a considerable portion of SA-β-gal-positive MNs in the vGM region were surrounded by CHIT-1-positive microglia (within 100 μm) ( Figures 58 and 59 ), indicating that there is a close association between MN cells and CHIT-1-positive microglia at the onset of MN senescence.

[0394] In the white matter, we detected over 75% of CHIT-1-positive microglia located near axons labeled with UCHL1 and ChAT (Figure 60), both of which are predominantly expressed in MNs. Furthermore, in the vGM, the complexity and density of dendritic branches of aged MNs decreased (Figures 61-64). Compared to young MNs, aged MNs also had fewer Vacht-labeled puncta and cholinergic synapses, which provide neuromodulatory effects on MN signaling (Figure 65). These data suggest that the concentration of CHIT-1-positive microglia around MNs, from the cell body to the axon, may adversely affect their structure and function (Figure 66).

[0395] To investigate how CHIT-1 in the microenvironment mediates neurotoxicity in MNs, we focused on the SMAD signaling pathway, as CHIT-1 has been reported to activate the SMAD signaling pathway through the TGF-β receptor (Figure 67). Consistent with this, we observed accumulation of p-SMAD2 and increased TGF-β signaling activity (Figures 68 and 69). Consistent with these data, we observed an increase in molecular damage regulated by TGF-β receptor signaling, such as enhanced oxidative damage and apoptotic signaling, in aged MNs (Figures 13 and 69). To test whether CHIT-1 could induce motor neuron senescence, we injected CHIT-1 recombinant protein directly into the cerebrospinal fluid of mice and cynomolgus monkeys, mimicking the microenvironment in which CHIT-1 increases with aging. After CHIT-1 was injected into the cerebrospinal fluid (CSF) of nude mice and C57 / BL6 mice (Figures 70, 76), spinal cord MNs underwent accelerated senescence, as evidenced by a decrease in the number of MNs in the vGM region, increased p-SMAD2-mediated signaling activity, increased SA-β-gal accumulation in motor neurons, a decrease in the number of motor neurons, DNA damage (marked by γ-H2A.X), and decreased expression of the nuclear lamin Lamin B2, similar to those observed in aged primate MNs (Figures 71-74, 77-82). Functionally, CHIT-1 treatment reduced the axonal conduction capacity of motor neurons, and significantly reduced the area of ​​motor neuron axons and neuromuscular junctions in skeletal muscle (Figures 83 and 84). In the vGM, the complexity and density of dendritic branches of aged MNs were reduced (Figures 85-87). Finally, CHIT-1 treatment resulted in impaired spinal cord function, as demonstrated by decreased grip strength, decreased net hanging time, and reduced movement distance, leading to impaired physical activity (Figures 75, 88-90). Following injection of CHIT-1 into the cerebrospinal fluid (CSF) of cynomolgus monkeys (Figure 91), CHIT-1 levels in the CSF increased significantly, reaching levels similar to those of aging cynomolgus monkeys (Figure 92). CHIT-1 treatment of cynomolgus monkeys resulted in accelerated aging of spinal cord MNs, as evidenced by a decrease in the number of MNs in the vGM region and increased SA-β-gal accumulation in motor neurons (Figures 94, 95). These MNs also exhibited a decline in motor ability similar to that of aging individuals, as evidenced by a decrease in movement distance, a decrease in climbing time, and a decrease in the number of upper limb attempts to grasp food (Figures 95-97).

[0396] These data suggest that CHIT-1-positive microglia may transmit their pro-senescent effects to neighboring MNs, leading to their degeneration and senescence.

[0397] Example 6: CHIT-1 is a driver of primate motor neuron aging

[0398] To validate our NHP-based findings in humans, namely whether exogenous CHIT-1 accumulation promotes motor neuron aging, we used motor neurons (hMNs) differentiated from human embryonic stem cells as a model (Figure 98). We cultured hMNs for extended periods in vitro, and found that hMNs displayed a range of aging-related phenotypes similar to those observed in aged primate spinal cord MNs, including an increase in the percentage of SA-β-gal-positive cells, an enhanced DNA damage response, and loss of Lamin B2 and heterochromatin markers after CHIT-1 treatment (Figure 99). We also observed that long-term cultured hMNs exhibited functional degeneration and decreased expression of the major postsynaptic protein PSD95 in the synaptic cleft (Figures 100-104), consistent with the impaired dendritic structure we detected in aged monkey MNs (Figures 61-65).

[0399] Building on this, we utilized an established human motor neuron cell model and cultured human motor neurons using cerebrospinal fluid from elderly individuals. We found that we could induce motor neuron senescence, and that immune clearance of CHIT-1 alleviated the senescent phenotype (Figures 105-109). Furthermore, using an in vitro motor neuron senescence cell model, we found that conditioned medium containing microglial-secreted CHIT-1 accelerated the induction of hMN senescence, and immune clearance of CHIT-1 alleviated the senescent phenotype (Figures 110-116). These results suggest that CHIT-1 is an important factor in motor neuron senescence.

[0400] Based on this, we treated motor neurons with recombinant human CHIT-1 and found that compared with the control group, CHIT-1 treatment increased SMAD2 phosphorylation, accelerated motor neuron aging, and decreased neuronal electrical signaling capacity (Figures 117-129). This suggests that CHIT-1 treatment of cultured hMNs can mimic the phenotype of motor neuron aging in vivo.

[0401] Next, we examined whether secreted CHIT-1 induces hMN senescence through the conserved TGF-β receptor and SMAD signaling pathways. We treated hMNs with a TGFBR agonist to mimic exogenous activation of secreted CHIT-1 and found that subsequent SMAD signaling activation mimicked CHIT-1 treatment to induce hMN senescence, characterized by increased SA-β-gal expression and decreased levels of Lamin B2 and H3K9me3 (Figures 130-132), suggesting that CHIT-1 may regulate the TGFBR-SMAD signaling pathway. Furthermore, blocking the TGFBR-SMAD signaling pathway with a TGFBR inhibitor alleviated the pro-senescence effects of CHIT-1 treatment (Figures 133 and 134). Furthermore, combined siRNA-mediated knockdown of SMAD2 and CHIT-1 treatment yielded similar effects as TGFBR inhibition and also alleviated the pro-senescence effects of CHIT-1 treatment (Figures 135-137). Together, these results support a promoting role for CHIT-1 in driving hMN senescence, at least in part, by activating the TGFBR-SMAD signaling pathway.

[0402] Because the hMN model mimics the neuronal aging process, we next investigated whether specific senolytic compounds could delay hMN aging. Ascorbic acid treatment, a compound we recently identified with senolytic activity, effectively attenuated senescence in CHIT-1-treated hMNs ( Figures 118-118 , 125-129 , 138 , and 139 ). Combined treatment with ascorbic acid and CHIT-1 resulted in reduced SMAD phosphorylation and restoration of a normal gene expression profile ( Figures 98 , 118 , 125-128 , 138 , and 139 ).

[0403] To further determine the physiological relevance of this result, we orally administered ascorbic acid at a dose of 30 mg per kg body weight daily to aged cynomolgus monkeys for up to 40 months (Figure 140). In these ascorbic acid-treated cynomolgus monkeys, MN senescence was attenuated compared to untreated cynomolgus monkeys of the same age, as evidenced by reduced lipofuscin accumulation in SA-β-gal-positive cells and vGM regions, as well as restored levels of neuronal lamin B2 (Figures 141-143).

[0404] In conclusion, we demonstrate that CHIT-1 is a driver of MN senescence and, importantly, that this pro-senescence effect can be alleviated by geroprotective compounds, providing new insights into the development of new therapeutic strategies for aged spinal cord and age-related motor neuron diseases.

[0405] Example 7: CHIT-1 is a biological marker of aging

[0406] The lung, liver, spleen, kidney, cerebellum and parietal lobe tissues of young and old monkeys (4 males and 4 females) were collected for protein extraction, and the expression of CHIT-1 in each tissue was analyzed by Western blotting.

[0407] As shown in Figures 144-149, the expression levels of CHIT-1 in various tissues of aging monkeys were significantly higher than those of young monkeys. These results indicate that CHIT-1 is a biological marker of aging.

[0408] Sequence information

Claims

1. A method for identifying the degree of spinal cord aging in a subject, comprising: a) detecting the level of chitinase-1 (CHIT-1), or the presence of CHIT-1 positive microglia in a sample from the subject; and b) comparing the result of the detection with a reference value of CHIT-1 level, wherein the subject is a primate.

2. The method of claim 1, wherein the reference value is obtained by detecting a reference object.

3. The method of claim 1 or 2, wherein the reference value is obtained by testing a reference subject population.

4. The method of any one of claims 1 to 3, wherein the level of CHIT-1 is selected from the group consisting of CHIT-1 enzymatic activity, CHIT-1 protein amount or concentration, CHIT-1 encoding polynucleotide amount or concentration, and any combination thereof.

5. The method of any one of claims 1 to 4, wherein the sample is cerebrospinal fluid or a blood sample, such as whole blood, plasma or serum.

6. A method for treating or preventing spinal cord aging or motor neuron aging in a subject in need thereof, comprising administering a CHIT-1 inhibitor to the subject, such as intrathecally.

7. The method of claim 6, wherein the CHIT-1 inhibitor comprises an agent that inhibits transcription and / or translation of a polynucleotide encoding CHIT-1 and / or inhibits CHIT-1 activity.

8. The method of claim 6 or 7, wherein the CHIT-1 inhibitor is an inhibitory transcription factor, an antisense polynucleotide, an interfering RNA, or an agent that binds to CHIT-1.

9. The method of claim 8, wherein the agent that binds to CHIT-1 is an anti-CHIT-1 antibody.

10. A method of treating or preventing spinal cord aging or motor neuron aging in a subject in need thereof, comprising administering ascorbic acid to the subject.

11. A kit for identifying spinal cord aging in a subject, comprising an agent for detecting the level of chitinase-1 (CHIT-1) or the presence of CHIT-1-positive microglia in a sample from the subject, wherein the subject is a primate.

12. The kit of claim 11, wherein the level of CHIT-1 is selected from the group consisting of CHIT-1 enzyme activity, CHIT-1 protein amount or concentration, CHIT-1 encoding polynucleotide amount or concentration, and any combination thereof.

13. The kit of claim 11 or 12, wherein the agent is selected from a CHIT-1 substrate, an anti-CHIT-1 antibody, a primer or a probe specific for a polynucleotide encoding CHIT-1, and any combination thereof.

14. The kit according to any one of claims 11 to 13, wherein the sample is cerebrospinal fluid or a blood sample, such as whole blood, plasma or serum.

15. Use of an agent for detecting the level of chitinase-1 (CHIT-1) in a sample from the subject, or the presence of CHIT-1 positive microglia, in the preparation of a kit for identifying spinal cord aging in a subject, wherein the subject is a primate.

16. The use according to claim 15, wherein the level of CHIT-1 is selected from the group consisting of CHIT-1 enzyme activity, CHIT-1 protein amount or concentration, CHIT-1 encoding polynucleotide amount or concentration, and any combination thereof.

17. The use according to claim 15 or 16, wherein the agent is selected from a CHIT-1 substrate, an anti-CHIT-1 antibody, a primer or a probe specific for a polynucleotide encoding CHIT-1, and any combination thereof.

18. The use according to any one of claims 15 to 17, wherein the sample is cerebrospinal fluid or a blood sample, such as whole blood, plasma or serum.

19. Use of a CHIT-1 inhibitor in the preparation of a medicament for treating or preventing spinal cord aging or motor neuron aging in a subject in need thereof.

20. The use of claim 19, wherein the CHIT-1 inhibitor comprises an agent that inhibits transcription and / or translation of a polynucleotide encoding CHIT-1 and / or inhibits CHIT-1 activity.

21. The use according to claim 19 or 20, wherein the CHIT-1 inhibitor is an inhibitory transcription factor, an antisense polynucleotide, an interfering RNA, or an agent that binds to CHIT-1.

22. The use of claim 21, wherein the agent that binds to CHIT-1 is an anti-CHIT-1 antibody.

23. Use of ascorbic acid in the preparation of a medicament for treating spinal cord aging or motor neuron aging in a subject in need thereof.

24. A method for identifying the degree of aging of a tissue or organ of a subject, comprising: a) detecting the level of chitinase-1 (CHIT-1) in a sample from a tissue or organ of the subject; and b) comparing the result of the detection with a reference value of CHIT-1 level, wherein the subject is a primate.

25. The method of claim 24, wherein the sample is from a tissue or organ selected from the group consisting of lung, liver, spleen, kidney, cerebellum, and parietal lobe.

Images