Pluripotent stem cell having doubled chromosome

Abstract

Provided is a (N1+N2)-diploid pluripotent stem cell comprising a fused cell of a N1-diploid (wherein N1 represents an integer of 2 to 16) pluripotent stem cell and a N2-diploid (wherein N2 represents an integer of 2 to 16) pluripotent stem cell.

Description

Pluripotent stem cells with doubled chromosomes

[0001] The present invention relates to pluripotent stem cells with doubled chromosomes.

[0002] Human pluripotent stem cells, which can differentiate into any cell type in the body, are not only useful in basic research but also contribute greatly to drug discovery through the creation of disease models and medical applications through cell transplantation therapy. Compared to ES cells, which are established by destroying human fertilized eggs (Non-Patent Document 1) (1), iPS cells, which are established by introducing Yamanaka factors into differentiated cells collected from humans, pose fewer ethical issues (Non-Patent Document 2) (2). Furthermore, because they can be established using the somatic cells of the individual in need of cells, they are expected to be applied to personalized medicine, such as transplants using the patient's own cells. In this way, human pluripotent stem cells, and particularly human iPS cells, are making a significant contribution to the development of regenerative medicine.

[0003] However, pluripotent stem cells also have challenges to overcome. One of the most important challenges is that the maturity of differentiated cells is generally low, regardless of the cell type. For example, it is known that cardiomyocyte differentiation can only achieve fetal cardiomyocyte levels. Therefore, to enhance the maturity of pluripotent stem cell-derived cardiomyocytes, a number of techniques have been used, including extending the culture time, adding low-molecular-weight compounds, adding hormones such as glucocorticoids and T3, adjusting energy sources such as carbohydrates and lipids, adjusting interactions with intercellular and extracellular matrices, physical and electrical stimulation, in vivo transplantation into mice, and three-dimensional culture (Non-Patent Document 3) (3). However, none of these techniques have proven conclusive.

[0004] Some of the differentiated and mature cells that make up our bodies become polyploid. This polyploidization is one indicator of differentiation and maturation. For example, of the cardiomyocytes that make up the adult human heart, only 10% or less remain diploid, while approximately 80% are polyploid (Non-Patent Document 4) (4). Furthermore, approximately half of hepatocytes are polyploid (Non-Patent Document 5) (5). Polyploidization is also observed in other cells, such as skeletal muscle cells, placental trophoblast giant cells, megakaryocytes, and osteoclasts (Non-Patent Document 6) (6). While polyploidization is a process of cell differentiation, it is extremely difficult to reproduce this process by inducing differentiation of normal diploid iPS cells.

[0005] Thomson Aoｩtskovitz−Eldor ,ｳhappioo 33,7aknitz M｡,3wiergiell J,Marsha al.Embryonic stem cell lines deriidemmo human blasstocysstts. 6;2812(5391):1144−7. KOhnuki MNarita MIcchisaka !,oomoo K,et al:Induction of pluuipotent fsem cells from adult human fibroblasttbyy defined factorssCelllll,,007vv 300;131(5):861−72.2. 4,Chanthra N,Uosaki HA Brief Reeviieeo Current Maturation Methods for ｨuammm Induced Pluripotent Stem Cells− Cardiomyocytesssront Cell Dev Biioooopo Mar / y; 8: 1 7 8. eerks W,3ergmman OP / lyploidy in cardiomyocytesssooo to heart regeneration? 14;126(4):552−65.3. ,Reiberger ,Villunger A control in hepatic health and diseef 2011.2021.5:1177−911.0001 Bruin Aruillungger ASchiffelerss ,) Z,3luijterr P,9yllulaar polyploiidyii organ homeostasis and regenerationnProteii

[0006] The 2018-2020 season is the first time I've seen this I'm not sure if I'm going to be able to do that.

[0007] As a result of intensive research to solve the above problems, the present inventors have succeeded in fusing pluripotent stem cells with each other and generating polyploids in an undifferentiated state, thereby completing the present invention. １ ploid (N １ represents an integer from 2 to 16.) and pluripotent stem cells of N ２ ploid (N ２ represents an integer of 2 to 16.) １ +N ２ ) Ploid pluripotent stem cells. [2] N １ and N ２ [3] The pluripotent stem cell according to [1], wherein N is 2 or 4. [4] The pluripotent stem cell according to [1], wherein the pluripotent stem cell is an iPS cell. １ ploid (N １ represents an integer from 2 to 16.) and pluripotent stem cells of N ２ ploid (N ２ represents an integer of 2 to 16.) and a pluripotent stem cell of (N １ +N ２ ) A method for producing diploid pluripotent stem cells. １ and N ２is 2 or 4. [6] The method according to [4], wherein the pluripotent stem cells are iPS cells. [7] The method according to [4], wherein the virus is Sendai virus. [8] A method for producing cardiomyocytes, comprising the step of culturing the pluripotent stem cells according to any one of [1] to [3] in the presence of a GSK-3 inhibitor. [9] A method for producing hepatocytes, comprising the steps of treating the pluripotent stem cells according to any one of [1] to [3] with Activin-A in the presence of a GSK-3 inhibitor to induce them into endoderm cells, treating the induced endoderm cells with fibroblast growth factor and bone morphogenetic factor to induce them into hepatic progenitor cells, and further treating the hepatic progenitor cells with hepatocyte growth factor.

[10] A method for producing cerebral organoids, comprising the steps of culturing the pluripotent stem cells according to any one of [1] to [3] in the presence of a fibroblast growth factor and a ROCK inhibitor to induce embryoid bodies, culturing the embryoid bodies in a medium containing an N2 supplement to induce neuroepithelium, and further culturing them in a medium containing an N2 supplement and a B27 supplement.

[11] A method for producing cardiac organoids, comprising the following steps (a) to (d): (a) culturing the cells according to any one of [1] to [3] on a low-adhesion plate to induce embryoid bodies, (b) treating the embryoid bodies obtained in step (a) with a GSK-3 inhibitor, a bone morphogenetic protein, and Activin A to induce mesoderm, (c) further treating the mesoderm induced in step (b) with Wnt-C59 to induce cardiac mesoderm, and (d) treating the cardiac mesoderm induced in step (c) with a GSK-3 inhibitor.

[12] A method for producing liver organoids, comprising a step of culturing the pluripotent stem cells according to any one of [1] to [3] together with iPS cell-derived endoderm cells, vascular endothelial cells, and mesenchymal stem cells to allow self-aggregation.

[13] A method for producing skeletal muscle cells, comprising a step of culturing the pluripotent stem cells according to any one of [1] to [3] in the presence of a TGF-β receptor inhibitor.

[14] A method for testing the cardiotoxicity of a test substance, comprising the steps of contacting a test substance with the pluripotent stem cells according to any one of [1] to [3], cardiomyocytes produced by the method according to [8], or cardiac organoids produced by the method according to

[11] , and evaluating the test substance as a cardiotoxic substance using cell death, cell membrane potential, calcium transient, or a decrease in muscle contractility as an index.

[15] A method for screening for drugs that improve cardiomyocyte function, comprising the steps of contacting a test substance with the pluripotent stem cells according to any one of [1] to [3], cardiomyocytes produced by the method according to [8], or cardiac organoids produced by the method according to

[11] , and selecting the test substance as a drug for improving cardiomyocyte function using muscle contractility or pulsation rhythm as an index.

[16] A method for testing the hepatotoxicity of a test substance, comprising the steps of contacting the test substance with the pluripotent stem cells described in any one of [1] to [3], hepatocytes prepared by the method described in [9], or liver organoids prepared by the method described in

[12] , and evaluating the test substance as a hepatotoxic substance using cell death or mitochondrial toxicity as an indicator.

[17] A method for screening for drugs that improve hepatocellular function, comprising the steps of contacting the test substance with the pluripotent stem cells described in any one of [1] to [3], hepatocytes prepared by the method described in [9], or liver organoids prepared by the method described in

[12] , and selecting the test substance as a drug for improving hepatocellular function using drug-metabolizing ability as an indicator.

[18] A method for screening for drugs that improve skeletal muscle cell function, comprising the steps of contacting the test substance with the pluripotent stem cells described in any one of [1] to [3], or skeletal muscle cells prepared by the method described in

[13] , and selecting the test substance as a drug for improving skeletal muscle cell function using contractile force as an indicator.

[19] A kit for testing the cardiotoxicity of a test substance or screening for drugs that improve cardiomyocyte function, comprising the pluripotent stem cells described in any one of [1] to [3], cardiomyocytes produced by the method described in [8], or cardiac organoids produced by the method described in

[11] .

[20] A kit for testing the hepatotoxicity of a test substance or screening for drugs that improve hepatocellular function, comprising the pluripotent stem cells described in any one of [1] to [3], hepatocytes produced by the method described in [9], or hepatic organoids produced by the method described in

[12] .

[21] A kit for screening for a drug that improves skeletal muscle cell function, comprising the pluripotent stem cells described in any one of [1] to [3] or skeletal muscle cells produced by the method described in

[13] .

[0008] The present invention makes it possible to obtain polyploid pluripotent stem cells by cell fusion between pluripotent stem cells. Polyploid pluripotent stem cells are useful for basic research using disease models, drug discovery research, and cell transplantation, as they faithfully reflect adult cells and produce cells with a high degree of differentiation and maturity.

[0009] [Figure 1] Characteristics of fused tetraploid iPS cells. (A) Nuclear staining (blue) of diploid (2N) and tetraploid (4N) iPS cells using Hoescht33342. (B) Expression of Venus and mRFP1 in tetraploid iPS cell colonies. Tetraploid cells express both fluorescent proteins. (C) DNA content measurement by flow cytometry. The fused tetraploid iPS cells (4N) indeed had increased DNA content compared to the diploid iPS cells (2N) before fusion. (D) Karyotype analysis of fused tetraploid iPS cells. Complete chromosome doubling, including sex chromosomes, was observed. (E) Comparative genomic hybridization (CGH) analysis of tetraploid and diploid iPS cells. Complete doubling of genomic DNA was confirmed without any microdeletions or insertions. (F) Cell diameters of diploid and tetraploid iPS cells. Tetraploid iPS cells were found to have a longer diameter. P value calculated using Student's T-Test. N=3. (G) Doubling time of diploid and tetraploid iPS cells. Tetraploid iPS cells were found to have a longer doubling time. P value calculated using Student's T-Test. N=3. [Figure 2] Maintenance of undifferentiated state in fused tetraploid iPS cells. (A) Immunofluorescent staining of undifferentiated marker genes (purple) and nuclear staining with Hoescht33342 (blue) in diploid (2N) and tetraploid (4N) iPS cells. (B) HE staining of teratomas formed by transplanting tetraploid iPS cells into immunodeficient mice. Differentiation into three germ layer cells was observed. (C) Ploidy of teratoma cells formed from diploid and tetraploid iPS cells. (D) Comparison of gene expression between diploid and tetraploid iPS cells by RNA-seq. Many genes were found to have specifically decreased expression only in tetraploid iPS cells. Metallothionein (MT) genes, which respond to oxidative stress and metal attributes, are shown in red. (E) GO enrichment analysis predicted how the gene expression changes shown in Figure (D) affect cellular function. Changes in MT gene expression predicted changes in cellular function, primarily in response to oxidative stress and metal toxicity. [Figure 3] Establishment of tetraploid iPS cells by fusion of diploid iPS cells from different individuals.(A) Venus and mRFP1 expression in tetraploid iPS cell colonies established by fusion of WTC11 and HPS0076 cells. Both fluorescent proteins were expressed. (B) DNA content measurement by flow cytometry. The fused iPS cells (WTC11xHPS0076) indeed had increased DNA content compared to the diploid WTC11 cells before fusion (Control 2N iPSCs). (C) Fluorescent immunostaining of actinin in cardiomyocytes derived from fused iPS cells (WTC11xHPS0076). Expression of the cardiomyocyte marker actinin was confirmed. [Figure 4] Generation of octoploid iPS cells by fusion of tetraploid iPS cells. The figure shows the results of DNA content measurement by flow cytometry. Compared to the control, the number of peaks (P5) increased when tetraploid iPS cells were fused, indicating the generation of octoploid iPS cells. Figure 5 shows the DNA and mitochondrial content, as well as gene expression comparisons, of diploid and tetraploid iPS cell-derived cardiomyocytes. (A) Fluorescent immunostaining of actinin in diploid and tetraploid iPS cell-derived cardiomyocytes. Tetraploid iPS cell-derived cardiomyocytes are larger. (B) DNA content measurement by flow cytometry. (C) Comparison of gene expression profiles in diploid and tetraploid iPS cell-derived cardiomyocytes. (D) Mitochondrial (green) and nuclear (blue) staining using Mitotracker. (E) Quantification of mitochondrial content relative to the nucleus using the FiJi application. Tetraploids had significantly higher mitochondrial content per nucleus (cell). (F) Digital PCR analysis of the nuclear DNA copy number to mitochondrial DNA copy number ratios in undifferentiated diploid and tetraploid iPS cell-derived cardiomyocytes. 15 samples were analyzed, and no significant differences were observed. (G) Digital PCR analysis of the nuclear DNA copy number to mitochondrial DNA copy number ratios in diploid and tetraploid iPS cell-derived cardiomyocytes. Fifteen samples were analyzed, and a significant increase in mitochondrial DNA copy number was observed in tetraploid iPS cell-derived cardiomyocytes. (H) GO enrichment analysis predicts the cellular functions affected by the gene expression changes in Figure 5C. All of the top 10 are related to the cell cycle. [Figure 6] Transmission electron microscopy images of diploid and tetraploid iPS cell-derived cardiomyocytes.[Figure 7] Quantitative PCR results for differentiation marker expression in diploid and tetraploid iPS cell-derived hepatocytes. AFP, HNF4a, and ALB were all highly expressed in tetraploid iPS cell-derived hepatocytes. [Figure 8] Myosin heavy chain (green) and nuclear (blue) staining in diploid and tetraploid iPS cell-derived skeletal muscle cells were shown. Both were positive, and fibrous morphology was observed. [Figure 9] EBs and cerebral organoids formed from diploid and tetraploid iPS cells are shown. (A) EBs formed from diploid and tetraploid iPS cells. (B) Cerebral organoids formed from diploid and tetraploid iPS cells. (C) Flow cytometric DNA content measurement of cerebral organoid cells formed from diploid and tetraploid iPS cells.

[0010] The present invention relates to polyploid pluripotent stem cells produced by cell fusion between diploid pluripotent stem cells, and to a method for producing polyploid pluripotent stem cells, which includes a step of fusing diploid pluripotent stem cells using Sendai virus particles or polyethylene glycol.

[0011] 1. Overview The present inventors have succeeded in differentiating polyploid cell types from conventional diploid iPS cells by fusing iPS cells that already possess pluripotency with each other, establishing polyploidy in an undifferentiated state, and then inducing differentiation into polyploid cell types. Hybridomas, in which B cells are fused with myeloma cells to produce monoclonal antibodies, are the most well-known application of cell fusion, and their usefulness is already well-known (7). In previous examples of fusion using iPS cells, fusion of iPS cells with other cell types to establish tetraploid cells has been reported (8, 9). Fusion of conventional diploid ES cells with haploid ES cells to establish triploid ES cells has also been reported (10). However, triploid cells do not normally exist in the human body. In the present invention, undifferentiated iPS cells were fused with each other to establish tetraploid or octoploid cells, as observed in normal living organisms, and then successfully differentiated into the desired cell types. The fused cells obtained in the present invention are useful for basic research using disease models, drug discovery research, and cell transplantation, as they faithfully reflect adult cells and can produce cells with a high degree of differentiation and maturity, making them useful in regenerative medicine.

[0012] 2. Pluripotent Stem Cells The type of pluripotent stem cells to be fused is not particularly limited, and any pluripotent stem cells from humans or non-human mammals, such as ES cells (embryonic stem cells) or iPS cells (induced pluripotent stem cells), can be used. These pluripotent stem cells can also be introduced with a gene for expressing a fluorescent protein and / or a drug resistance gene to facilitate confirmation of cell fusion and subsequent cell behavior or differentiation. Examples of fluorescent proteins include red fluorescent proteins (mRFP1, Ds-Red, mCherry), green fluorescent proteins (Venus, EGFP, GFP2), and blue fluorescent proteins (Sirius, ECFP, EBFP2).

[0013] Examples of drug resistance genes include puromycin resistance genes, blasticidin resistance genes, neomycin resistance genes, hygromycin resistance genes, etc. However, the fluorescent proteins and drug resistance genes are not limited to those listed here, and can be appropriately selected and used.

[0014] Gene transfer can be performed by known techniques, and an expression vector capable of expressing these proteins can be introduced. The expression vector may be linked to an appropriate promoter (e.g., CMV promoter, EF1-α promoter, etc.) or other RNA elements that enable cap-independent translation initiation (e.g., IRES (internal ribosome entry site), 2A peptide, etc.). The fluorescent protein or drug resistance gene can be transferred into pluripotent stem cells by any method available to those skilled in the art, such as a method using a viral vector, electroporation, or lipofection.

[0015] 3. Cell fusion The present invention relates to N １ ploid (N １ represents an integer from 2 to 16.) and pluripotent stem cells of N ２ ploid (N ２ represents an integer of 2 to 16.) １ +N ２ The (N)ploid pluripotent stem cells of the present invention are １ +N ２ ) Ploid pluripotent stem cells are N １ ploid (N １ represents an integer from 2 to 16.) and pluripotent stem cells of N ２ ploid (N ２ represents an integer of 2 to 16.) pluripotent stem cells are fused by culturing them in the presence of a virus. １ +N ２ The present invention also provides N １ ploid (N １ represents an integer from 2 to 16.) and pluripotent stem cells of N ２ ploid (N ２represents an integer of 2 to 16.) in the presence of a virus. １ +N ２ The present invention relates to a method for producing pluripotent stem cells.

[0016] N １ and N ２ If both are diploid, cell fusion will result in a tetraploid, and N １ is 2, N ２ If N is 3, then pentaploid cells will be produced by cell fusion. Haploid human cells, such as human haploid ES cells, are known (e.g., Ido Sagi et al., Nature volume 532, pages 107-111 (2016)). １ or N ２ Triploid cells can be produced by fusing the above-mentioned haploid ES cells with diploid cells. Alternatively, for example, diploid parent strains may be fused together in advance to produce tetraploids (N １ = 4), and then the diploid parent strain (N ２ = 2) will result in a hexaploid.

[0017] In this way, in the present invention, pluripotent stem cells of any polyploid (up to 32-ploid) can be produced, but tetraploids obtained by fusing diploids together, or octaploids obtained by fusing tetraploids together are preferred. ５ This can be achieved by fusing approximately 100 pluripotent stem cells together using Sendai virus particle fusion, HVJ-E (Ishihara Sangyo Kaisha). The number of cells to be fused may be the same, or the number of cells may be changed appropriately by changing the mixing ratio. The number of cells can also be adjusted depending on the culture scale after fusion.

[0018] The culture medium may be a medium commonly used for culturing iPS cells, such as mTeSR Plus (STEMCELL TECHNOLOGY) or StemFit (Ajinomoto), etc. However, the fusion itself is carried out in the Cell Fusion Buffer provided with the HVJ-E kit.

[0019] The fused cells can be cultured in a basal medium in the same way as normal diploid iPS cells. To obtain the desired fused cells, it is necessary to select cells that have become drug-resistant due to the fusion of pluripotent stem cells. To achieve this, a gene (drug resistance gene 1) conferring resistance to one drug (drug 1) is introduced into one pluripotent stem cell (pluripotent stem cell 1), and a gene (drug resistance gene 2) conferring resistance to another drug (drug 2) is introduced into the other pluripotent stem cell (pluripotent stem cell 2). By adding drug 1 and drug 2 to the medium, if cells resistant to both drugs are obtained, the fused cells can be selected.

[0020] Furthermore, when pluripotent stem cells 1 are labeled with a red fluorescent protein and pluripotent stem cells 2 are labeled with a green fluorescent protein, the fused cells express both fluorescent proteins and can be separated using a cell sorter, etc. In this way, the fused cells of the present invention can be isolated.

[0021] Among the fused cells obtained by the present invention, polyploid pluripotent stem cells have the following characteristics: - They are larger than normal diploid cells and are mononuclear. - The amount of DNA in pluripotent stem cells is doubled. - They maintain fully doubled chromosomes and are not accompanied by genetic abnormalities. - Their proliferation rate is slightly slower than that of diploid cells. - They maintain the expression of undifferentiated markers. - They have pluripotency, and maintain ploidy (e.g., tetraploidy) even after differentiation. - It is possible to increase ploidy, for example, to octaploid or 16ploid.

[0022] 4. Differentiation of Fused Cells In the present invention, the fused cells obtained as described above can be differentiated into various tissues in vivo or in vitro. As described above, tetraploid fused cells maintain polyploidy, undifferentiated state, and pluripotency. Therefore, by transplanting the fused cells into an animal or culturing them in the presence of differentiation factors (differentiation in two-dimensional culture), it is possible to generate model tissues that resemble actual tissues.

[0023] For example, the fusion cells of the present invention can be cultured in the presence of various drugs or factors to differentiate into cardiomyocytes or cardiac muscle tissue, hepatocytes or liver tissue, cerebral tissue, or skeletal muscle cells or skeletal muscle tissue. In one embodiment of the present invention, model cardiac muscle tissue can be generated in vitro by treating the fusion cells of the present invention with a GSK-3 inhibitor, a potent pharmacological activator of the Wnt / β-catenin signaling pathway. Furthermore, model liver tissue can be generated in vitro by inducing differentiation of the fusion cells of the present invention into endoderm cells through Activin-A treatment, followed by treatment with FGF, BMP, or HGF. Furthermore, in the present invention, skeletal muscle cells can be generated by forcibly expressing the MYOD1 gene or treating the fusion cells of the present invention with a TGF-β receptor inhibitor.

[0024] Alternatively, by transplanting the fused cells into a mammalian animal other than a human, various tissues can be formed at the transplant site, and this animal can be used as a model animal. Examples of animals that can be used include, but are not limited to, mice, rats, rabbits, guinea pigs, and monkeys. Generally, it is desirable to select an animal species in which the fused cells can engraft. When transplanting the fused cells into an animal, the fused cells may be suspended in, for example, phosphate-buffered saline (PBS), or a semi-solid medium such as collagen or Matrigel can be used to improve engraftment and survival rates. The formation of various tissues can be confirmed or evaluated by macroscopic observation of cell morphology, expression of marker genes for each tissue, and the presence or absence of expression or secretion of proteins specific to that tissue.

[0025] 5. Organoid Creation Organoids are small organs created in vitro from stem cells. Organoids are formed as three-dimensional tissue-like structures by self-organization utilizing the self-renewal and differentiation capabilities of stem cells.

[0026] (1) Cardiac organoid Cardiac organoid can be produced, for example, by the following steps. First, the polyploid pluripotent stem cells of the present invention are cultured on a low-adhesion plate to induce embryoid bodies. Next, the obtained embryoid bodies are treated with a GSK-3 inhibitor (e.g., CHIR99021), bone morphogenetic protein (e.g., BMP-4) and Activin-A to induce mesoderm, and the induced mesoderm is further treated with Wnt-C59 to induce cardiac mesoderm. Then, the induced cardiac mesoderm is treated with a GSK-3 inhibitor.

[0027] (2) Liver Organoids Liver organoids can be produced, for example, by the following steps: The polyploid pluripotent stem cells of the present invention are cultured (co-cultured) with iPS cell-derived hepatic endoderm cells, vascular endothelial cells, and mesenchymal stem cells induced in two dimensions to allow self-aggregation, thereby producing three-dimensional liver organoids.

[0028] (3) Cerebral organoids Cerebral organoids can be obtained using, for example, STEM diff. ＴＭ By using Cerebral Organoid Kit (STEMCELL TECHNOLOGIES), cerebral organoids can be produced from the polyploid pluripotent stem cells of the present invention. Specifically, embryoid bodies (EBs) are produced by suspension culture treatment using basic fibroblast growth factor (bFGF) and rho-associated protein kinase (ROCK) inhibitor (Ri). Next, EBs are induced into neuroepithelium using a medium containing N2 supplement, for example, DMEM-F12 medium containing N2 supplement, GlutaMAX, MEM-NEAA and Heparin. The cells are then induced to develop into cerebrums by treatment with a medium containing N2 supplement and B27 supplement, for example, a mixture of DMEM-F12 and Neurobasal medium containing N2 supplement, insulin, Glutamax, MEM-NEAA, 2-mercaptoethanol, and B27 supplement. The cells are then cultured with agitation to mature into three-dimensional tissues.

[0029] (4) Skeletal Muscle Organoids Skeletal muscle organoids can be produced, for example, by the following process: After inducing the polyploid pluripotent stem cells of the present invention into iPS cell-derived skeletal muscle cells in two dimensions, the polyploid pluripotent stem cells are coagulated together with fibroblasts using fibrinogen and thrombin around a pillar device consisting of two plastic and non-plastic structures, thereby producing three-dimensional skeletal muscle organoids.

[0030] 6. Screening Method and Toxicity Test Method The present invention enables testing the toxicity of test substances or screening for drugs that improve the function of cardiomyocytes, hepatocytes, brain functions, or skeletal muscle cells using the pluripotent stem cells, cardiomyocytes, cardiac organoids, hepatocytes, liver organoids, cerebral organoids, skeletal muscle cells, skeletal muscle organoids, etc.

[0031] The method for testing cardiotoxicity includes the steps of contacting a test substance with the pluripotent stem cells, cardiomyocytes, or cardiac organoids and evaluating the test substance as a cardiotoxic substance using cell death, cell membrane potential, calcium transient, or decreased muscle contractility as an index.The method for screening drugs for improving cardiomyocyte function includes the steps of contacting a test substance with the pluripotent stem cells, cardiomyocytes, or cardiac organoids and selecting the test substance as a drug for improving cardiomyocyte function using muscle contractility, calcium transient, or pulsation rhythm as an index.

[0032] The method for testing hepatotoxicity includes contacting a test substance with the pluripotent stem cells, hepatocytes, or liver organoids, and evaluating the test substance as a hepatotoxic substance using cell death or mitochondrial toxicity as an indicator. The method for screening a drug for improving hepatocellular function includes contacting a test substance with the pluripotent stem cells, hepatocytes, or liver organoids, and selecting the test substance as a drug for improving hepatocellular function using drug metabolic ability as an indicator.

[0033] "Contact" means that pluripotent stem cells, cardiomyocytes, hepatocytes, or skeletal muscle cells, or cardiac organoids, liver organoids, cerebral organoids, or skeletal muscle organoids, and a candidate substance (test substance) are present in the same environment, reaction system, or culture system, and includes, for example, adding the candidate substance to a cell culture vessel, mixing the cells or organoids with the candidate substance, and culturing the cells or organoids in the presence of the candidate substance.

[0034] Candidate substances include, for example, peptides, proteins (including antibodies), non-peptide compounds, synthetic compounds (high or low molecular weight compounds), fermentation products, cell extracts, cell culture supernatants, plant extracts, tissue extracts from mammals (e.g., mice, rats, pigs, cattle, sheep, monkeys, humans, etc.), plasma, etc. These compounds may be novel compounds or known compounds. These candidate substances may form salts, and examples of the salts of candidate substances include salts of physiologically acceptable acids (e.g., inorganic acids, organic acids, etc.) and bases (e.g., metallic acids, etc.).

[0035] When a candidate substance is contacted with pluripotent stem cells, cardiomyocytes, or cardiac organoids, if results show that cell death, cell membrane potential, calcium transient, or a decrease in muscle contractile force are confirmed, the candidate substance used can be determined or evaluated as a cardiotoxic substance.

[0036] Cell death can be detected by staining dead cells with trypan blue, propidiumidide (PI), or the like; labeling cells in advance with a radioisotope (such as 51Cr) and measuring the radioisotope released upon cell death; adding modified dUTP to DNA that has become highly fragmented due to cell death and detecting it (TUNEL assay); ELISA using antibodies against fragmented DNA and histone proteins bound to DNA; and measuring lactate dehydrogenase released into the culture medium from damaged cells, and these methods serve as an indicator of cardiotoxicity.

[0037] The cell membrane potential is measured using the patch clamp method, a multipoint electrode system, a membrane potential-sensitive dye, or the like, and if the measurement results show a prolongation of FPD (field potential duration), the appearance of TdP (torsade de pointes)-like waveforms, the appearance of EAD (early afterdepolarization) or abnormal waveforms of triggered activity, or the like, compared to the control group, these are indicators of cardiotoxicity.

[0038] Calcium transients are measured by measuring calcium ions flowing into cells using a Ca2+-sensitive fluorescent indicator, and if the change in the calcium transient waveform or the waveform peak is 20% or more higher or lower than that of the control group, this is an indicator of cardiotoxicity.

[0039] In a screening method for drugs that improve cardiomyocyte function, if a candidate substance is brought into contact with pluripotent stem cells, cardiac cells, or cardiac organoids and results in verifiable muscle contraction force or beating rhythm, the candidate substance used can be selected as a drug for improving cardiomyocyte function.

[0040] To measure muscle contraction force, three-dimensional cardiomyocytes are created around a pillar device, and the distance the pillar device moves due to cardiomyocyte contraction is measured. If the distance the pillar device moves is longer compared to a control group, it is an indicator that the drug is a cardiomyocyte function improver. Alternatively, cardiomyocytes are cultured on a plastic extracellular matrix, and the degree of deformation is used as an indicator to measure contraction force. A greater degree of deformation is an indicator of cardiotoxicity. To measure pulsation rhythm, the number of beats of two-dimensional or three-dimensional cardiomyocyte tissue is measured, and a consistent pulsation rhythm compared to a control group is an indicator that the drug is a cardiomyocyte function improver.

[0041] When a candidate substance is contacted with pluripotent stem cells, hepatocytes, or liver organoids, if results are obtained that confirm cell death or mitochondrial toxicity, the candidate substance used can be determined or evaluated as a hepatotoxic substance.

[0042] Cell death can be detected by staining dead cells with trypan blue or propidiumidide (PI), labeling cells with a radioisotope (e.g., 51Cr) and measuring the radioisotope released upon cell death, adding modified dUTP to DNA highly fragmented by cell death and detecting it (TUNEL assay), ELISA using antibodies against fragmented DNA and histone proteins bound to DNA, or measuring lactate dehydrogenase released from damaged cells into the culture medium, and serves as an indicator of hepatotoxicity. Mitochondrial toxicity can be measured by measuring mitochondrial membrane potential, ATP content, glutathione concentration, etc., and if the measurement results are 20% or more lower than those of the control group, it is an indicator of hepatotoxicity.

[0043] In a screening method for drugs that improve hepatocellular function, if a candidate substance is contacted with pluripotent stem cells, hepatocytes, or liver organoids and results confirming drug metabolism ability are obtained, the candidate substance used can be selected as a drug for improving hepatocellular function. Drug metabolism ability is measured by measuring cytochrome P450 (CYP) enzyme activity, CYP gene expression level, and glucuronosyltransferase (UGT) activity, and if an increase in these enzyme activities or gene expression is observed, it is an indicator that the substance is a drug that improves hepatocellular function.

[0044] Examples of drug-metabolizing activities that can be used as indicators include CYP, UGT, esterase, flavin-containing monooxygenase, N-acetyltransferase, and monoamine oxidase.

[0045] In a screening method for drugs that improve skeletal muscle cell function, if a candidate substance is contacted with pluripotent stem cells, skeletal muscle cells, or skeletal muscle organoids and results confirm an improvement in contractile force, the candidate substance can be selected as a drug for improving skeletal muscle cell function. Contractile force can be measured by preparing skeletal muscle organoids, applying an electric pulse, and measuring the distance moved by the pillar device. A longer distance compared to the control is an indicator of a drug that improves skeletal muscle cell function.

[0046] The degree of differentiation and maturation can also be measured by sarcomere structure and gene expression, and the clear observation of light and dark zones and Z membranes when observed under an electron microscope is an indicator of improved skeletal muscle cell function. Regarding gene expression, for example, increased expression of genes such as MHC, SCN4A, and MYH is an indicator of improved skeletal muscle cell function.

[0047] 7. Screening Kit The pluripotent stem cells, cardiac cells, or cardiac organoids of the present invention can be provided in the form of a kit for evaluating cardiotoxicity or a kit for screening drugs that improve cardiomyocyte function.

[0048] Furthermore, the pluripotent stem cells, hepatocytes, or liver organoids of the present invention can be provided in the form of a kit for evaluating hepatotoxicity or a kit for screening drugs that improve hepatocellular function.

[0049] Furthermore, the pluripotent stem cells, skeletal muscle cells, or skeletal muscle organoids of the present invention can be provided in the form of a kit for screening drugs that improve skeletal muscle cell function.

[0050] The kit of the present invention includes the above-mentioned cells or organoids, but can also include a labeling substance, a cell death detection reagent (e.g., LDH, etc.), etc. Labeling substance refers to an enzyme, a radioisotope, a fluorescent compound, a chemiluminescent compound, etc. In addition to the above components, the kit of the present invention can also include other reagents for carrying out the method of the present invention, such as, when the label is an enzyme label, an enzyme substrate (e.g., a chromogenic substrate), an enzyme substrate solution, an enzyme reaction stop solution, etc. Furthermore, the kit of the present invention can also include a diluent for the test compound, various buffers, sterile water, various cell culture vessels, various reaction vessels (e.g., Eppendorf tubes), detergents, an experimental operation manual (instructions), etc.

[0051] EXAMPLES The present invention will be explained in more detail below with reference to examples, although the scope of the present invention is not limited to these examples.

[0052] Methods: Human iPS Cell Culture. Conventional diploid human iPS cells were established episomalally from a healthy Japanese male with informed consent (WTC11 (11)) and HPS0076, iPS cells derived from a Caucasian female obtained from the RIKEN Cell Bank. Culture was performed on plastic dishes coated with GFR Matrigel Phenol Red Free using standard iPS cell medium, mTeSR Plus + 1% penicillin-streptomycin (mTeSR Plus + Pen / Strep). At low cell density, the Rock inhibitor Y-27632 (Ri) was added to the medium at 10 μM. Tetraploid and octoploid iPS cells following fusion were also cultured under similar conditions.

[0053] Introduction of fluorescent protein and drug resistance gene into iPS cells using lentiviruses. Lentiviruses were produced using CSII-CMV-MCS-IRES2-Venus and CSII-CMV-MCS-IRES2-mRFP1 (RIKEN) lentiviral vectors modified with a puromycin resistance gene (PuroR), a blasticidin resistance gene (BsdR), a neomycin resistance gene (NeoR), a hygromycin resistance gene (HygR), and an EF1α promoter (CSII-EF1α-VENUS-IRES2-PuroR, CSII-EF1α-mRFP1-IRES2-BsdR, CSII-EF1α-NeoR, and CSII-EF1α-HygR).

[0054] HEK293 cells were cultured in two 10 cm dishes at 4.0 × 10 ６Cells were seeded at a time. 17 hours later, the medium was replaced with fresh DMEM + 10% FBS. Six hours later, 1,800 μl of Opti-MEM (Thermo Fisher Scientific) was mixed with 5.4 μg of pMDLg / p-RPE (RIKEN) as a lentiviral packaging plasmid, 4.5 μg of pCMV-VSV-G-RSV-Rev (RIKEN) as a lentiviral envelope plasmid, 8.1 μg of the prepared lentiviral vector, and 54 μl of Polyethyleneimine (PEI) Max (Polysciences). The mixture was incubated at room temperature for 25 minutes and then added dropwise to the medium. After 16 hours, the medium was replaced with DMEM + 10% FBS + 10 mM HEPES Buffer (Thermo Fisher Scientific). After 55 hours, the medium was collected and centrifuged at 600 g for 20 minutes at 4°C. The supernatant was filtered using a 0.45 μm filter and a 20 ml syringe, collected in a new tube, and centrifuged at 5,800 g at 4°C overnight. The supernatant was removed, and 100 μl of mTeSR Plus was added to the precipitate and mixed. After shaking at 4°C for 8 hours, the cells were resuspended. The cells were centrifuged at 600 g for 2 minutes at 4°C, dispensed into tubes, and stored at -80°C.

[0055] 1.25 × 10 iPS cells were plated onto a 12-well plate coated with Matrigel. ５ Cells were seeded in 1000 cells / well. After 24 hours, the medium was replaced with mTeSR Plus + Pen / Strep w / o Ri containing 25 μl of virus solution. When the cells became confluent, the wells were washed three times with PBS. Expression of the fluorescent protein was confirmed under a fluorescence microscope, and the medium was replaced with mTeSR Plus + Pen / Strep + Ri containing 0.5 μg / mL of puromycin or 10 μg / mL of blastcidin to select the target cells.

[0056] WTC11 cells transfected with mRFP1-IRES2-BsdR or VENUS-IRES2-PuroR using a lentivirus are referred to as "WTC11 + mRFP1-IRES2-BsdR" and "WTC11 + VENUS-IRES2-PuroR," respectively. Furthermore, HPS0076 cells transfected with mRFP1-IRES2-BsdR or VENUS-IRES2-PuroR using a lentivirus are referred to as "HPS0076 + mRFP1-IRES2-BsdR" and "HPS0076 + VENUS-IRES2-PuroR," respectively. Furthermore, cells in which NeoR or HygR was introduced into tetraploid WTC11 cells are referred to as "4N-WTC11+NeoR" and "4N-WTC11+HygR," respectively.

[0057] Fusion of iPS cells and drug selection To generate tetraploid iPS cells, either WTC11 + mRFP1-IRES2-BsdR or HPS0076 + mRFP1-IRES2-BsdR cells and either WTC11 + VENUS-IRES2-PuroR or HPS0076 + VENUS-IRES2-PuroR cells were detached from the culture dish and fused at 2.0 × 10 ５ The cells were suspended in PBS, combined into one tube, and thoroughly mixed. The cells were centrifuged at 120 g at 4°C for 3 minutes, the supernatant was removed, and 50 μl of Cell Fusion Buffer (Ishihara Sangyo Kaisha) was added to the pellet and thoroughly suspended. 1 μl of ice-cold HVJ-E (Ishihara Sangyo Kaisha) was added as Sendai virus for cell fusion, and the cells were thoroughly suspended and incubated on ice for 5 minutes. After centrifugation at 780 g at 4°C for 5 minutes, the cells were incubated at 37°C for 15 minutes. 10 ml of mTeSR Plus + Pen / Strep + Ri was added and suspended. The cell suspension was then seeded at 100 μl / well into a 96-well plate and cultured. When sufficient proliferation of fused cells was confirmed by observation under a fluorescence microscope, two drugs were added and the fused cells were selected. Using the same procedure, 4N-WTC11-NeoR and 4N-WTC11+HygR were fused to generate octaploid iPS cells.

[0058] To generate tetraploid iPS cells using polyethylene glycol, either WTC11 / HPS0076+mRFP1-IRES2-BsdR cells or WTC11 / HPS0076+VENUS-IRES2-PuroR cells were detached from the culture dish and cultured at 2.0 × 10 ５ The cells were suspended in PBS, combined into one tube, and mixed thoroughly. The cells were centrifuged at 120 g for 3 minutes at 4°C, the supernatant was removed, and PEG 1500 (Roche) was added to the pellet, suspended, and incubated at 37°C for 5 minutes. After centrifugation at 780 g for 5 minutes, the supernatant was removed. After adding 10 ml of mTeSR Plus + Pen / Strep + Ri and suspending the cells, the cell suspension was seeded at 100 μl / well into a 96-well plate and cultured. Under a fluorescent microscope, when the fused cells had sufficiently proliferated, two drugs were added and the fused cells were selected.

[0059] Immunofluorescence staining The expression of undifferentiated marker genes was confirmed by immunofluorescence staining. Tetraploid iPS cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes. After washing the cells with PBS, blocking solution (3% goat serum (Jackson ImmunoResearch), 2% Triton-X (Wako) in PBS) was added and incubated at room temperature for 30 minutes. The blocking solution was removed, and the cells were incubated overnight at 4°C in the dark with primary antibodies (SOX2: Abcam #ab97959 (1 / 500 dilution), OCT4: Abcam #ab19857 (1 / 500 dilution), SSEA4: Abcam #ab16287 (1 / 500 dilution), TRA-1-81: Abcam #ab16289 (1 / 500 dilution) diluted with blocking solution). After washing with PBS, the cells were incubated with secondary antibodies (Alexa Fluor 647: #A-21235, #A-21244 (1 / 2000 dilution)) at room temperature in the dark for 1 hour. After washing the cells with PBS, a nuclear staining solution (Hoescht 33342 (Cell Signaling Technology), diluted 1000 times) was added and incubated at room temperature in the dark for 10 minutes. After washing the cells with PBS, they were observed under a fluorescence microscope.

[0060] Karyotype analysis and comparative genome hybridization (CGH) analysis Karyotype analysis was performed using G-band analysis. Genomic DNA extracted from iPS cells using the DNeasy Blood & Tissue Kit (QIAGEN, 69504) was used for CGH analysis. CGH analysis was performed using a SurePrint G3 Human CGH Microarray 4x180K (Agilent).

[0061] Measurement of DNA content in cells by flow cytometry iPS cells (5.0 x 10 ５ The cells (800 cells) were suspended in PBS and placed in a 1.5 ml tube. The cells were centrifuged at 300 g for 5 minutes, and the supernatant was removed. The cells were washed with 1 ml of PBS, centrifuged again, and the supernatant was removed. 4% paraformaldehyde was added and the cells were fixed at room temperature for 20 minutes. The cells were washed with PBS, centrifuged, and the supernatant was removed. 500 μl of PBS was added and the cells were suspended, and then 5 μl of cell cycle assay solution (Dojindo Laboratories) was added and the cells were incubated at 37°C for 15 minutes. The entire volume was transferred to a 35 μm cell strainer, and fluorescence was measured using a flow cytometer.

[0062] Teratoma formation and histological analysis Cells on a 6-well plate were prepared for transplantation as follows: The medium was removed, 500 μl of 0.5 mM EDTA (Nacalai Tesque) was added, and the plate was incubated at 37°C for 10 minutes. 1.5 ml of mTeSR Plus was then added. The cells were gently detached from the plate using a Cell Lifter. 1.0 × 10 ６ The cells were transferred to a 1.5 ml tube and centrifuged at 200 g for 3 minutes at room temperature. The supernatant was removed. The pellet was broken up by tapping, and then 500 μl of 50% Matrigel-50% mTeSR Plus+Ri was added and gently suspended. The cell suspension was aspirated using a 20-gauge needle and a 1 ml syringe and transplanted into the testes of 8-week-old immunodeficient mice.

[0063] Eight weeks after transplantation, the animals were dissected and teratomas were collected. The tissues were washed with PBS and then fixed in 4% paraformaldehyde overnight at 4°C. The tissues were washed with running water for 10 minutes and then replaced with 20% sucrose in PBS overnight at 4°C. The solution was then replaced with 30% sucrose in PBS and replaced overnight at 4°C. The tissues were frozen and 6 μl thick frozen sections were prepared using a cryostat. The tissues were stained with hematoxylin and eosin to observe the three germ layers.

[0064] Cell proliferation rate measurement 1.0 x 10 ５ Cells were suspended in 2 ml of mTeSR Plus + Pen / Strep + Ri and seeded onto a 6-well plate. The medium was replaced with mTeSR Plus + Pen / Strep every two days. When the cells reached 90-100% confluence, the number of cells was counted. The seeding, culturing, and counting process was continued for 60 days, and the proliferation rate was calculated. Measurement of cell diameter

[0065] Diploid WTC11 or tetraploid WTC11 iPS cells were detached from the culture dish, suspended in PBS, and dead cells were stained with 0.4% Trypan blue. ＴＭ The diameter of viable cells was measured using a II Automated Cell Counter (Invitrogen).

[0066] RNA was extracted from undifferentiated iPS cells or iPS cell-derived cardiomyocytes using the RNAeasy Micro Kit (QIAGEN, 74004). The extracted RNA was sequenced using strand-specific RNA sequencing. Using a 150 bp paired-end DNBseq-400 (MGI Tech), 4,000-50,000,000 reads were obtained. Gene expression analysis, including heat map and GO enrichment analysis, was then performed using CLC workbench (QIAGEN).

[0067] Cardiomyocyte differentiation and purification of iPS cells. Essentially, we used a technique that modulates Wnt signaling with small molecules (11). CHIR99021 (R&D System) was used at concentrations of 6 μM and 12 μM for differentiation induction. Diploid iPS cells were successfully induced to differentiate at both concentrations, but tetraploid iPS cells were only successfully induced to differentiate into cardiomyocytes at 6 μM CHIR99021.

[0068] On day 15 after the start of differentiation induction, a lactate-based method was used to purify cardiomyocytes (12). Diploid iPS cell-derived cardiomyocytes were successfully purified after three 4 mM lactate-containing medium changes, but tetraploid iPS cell-derived cardiomyocytes died after the third medium change. Therefore, only two 4 mM lactate-containing medium changes were performed. This purification process and other procedures were performed on iPS cell-derived cardiomyocytes on day 28 after the start of differentiation induction, including freezing, RNA extraction, and immunostaining with ACTININ antibody (Merck #A7732, 1 / 1000 dilution) under the same conditions as for the undifferentiated marker genes described above.

[0069] iPS cells were differentiated into hepatocytes by treatment with Activin-A in the presence of a GSK-3 inhibitor, followed by hepatic progenitor cells with the addition of fibroblast growth factor (FGF) and bone morphogenetic protein (BMP), and maturation with hepatocyte growth factor (HGF), as in previous studies (13). Differentiation was assessed by immunostaining (described above) using antibodies against albumin (R&D #MAB1455, 1 / 200 dilution), HNF4α (CST #3113S, 1 / 200 dilution), and AFP (Sigma #A8452, 1 / 500 dilution), as well as quantitative PCR (described below).

[0070] Skeletal muscle differentiation of iPS cells was performed using a method similar to that used in a previous study (15). To improve differentiation efficiency, starting from day 7 after differentiation induction, a medium containing 10 μM SB431542 (Fujifilm Wako), a TGF-β receptor inhibitor, was used. Differentiation was evaluated by morphological observation and immunostaining (as described above) using a Myosin Heavy Chain antibody (R&D #MAB4470, diluted 1 / 400).

[0071] Mitochondrial staining and image analysis. Diploid and tetraploid iPS cell-derived cardiomyocytes were cultured in a 12-well plate in RPMI 1640 medium with B27 serum-free supplement. 500 ng / ml Hoechst 33342 (Merck) and 50 nM MitoTracker Green FM (M7514) were added and incubated at 37°C for 10 minutes. After removing the medium and washing with PBS, the cells were observed under a fluorescence microscope and images were taken. Subsequently, the number of mitochondrial-positive pixels and the number of nuclei were automatically counted using image analysis with the FiJi application, and the amount of mitochondria per nucleus was measured.

[0072] Mitochondrial DNA copy number analysis by digital PCR Genomic DNA and mitochondrial DNA were extracted from diploid and tetraploid iPS cell-derived cardiomyocytes, and the genomic DNA copy number was determined as the copy number of the RPP30 gene sequence, and the mitochondrial DNA copy number was determined as the copy number of the MT-ND4 gene sequence. The copy number variation measurement function of Droplet digital PCR (ddPCR, Bio-Rad) was used to quantify the copy number ratio of the MT-ND4 gene sequence to the RPP30 gene. For RPP30, RPP30 FW primer: GATTTGGACCTGCGAGCG (SEQ ID NO: 4), RPP30 RV primer: GCGGCTGTCTCCACAAGT (SEQ ID NO: 5), RPP30 HEX probe: CTGACCTGAAGGCTCT (SEQ ID NO: 6), for MT-ND4, MT-ND4 FW primer: CCCTCATGTTCATACACCTATCC (SEQ ID NO: 1), MT-ND4 RV primer: AGCCTCTGTTGTCAGATTCAC (SEQ ID NO: 2), MT-ND4 FAM probe: CCCATTCTCCTCCTATCCCTCAACCC (SEQ ID NO: 3).

[0073] Transmission Electron Microscopy Observation Transmission electron microscopy observation of diploid and tetraploid iPS cell-derived cardiomyocytes was performed by the Molecular Pathology and Histology Analysis Laboratory at the Tokyo Metropolitan Institute of Medical Science using a JEOL JEM1400 transmission electron microscope.

[0074] Quantitative PCR: Total RNA was extracted from iPS cells using Sepasol-RNAI Super G (Nacalai Tesque). Residual DNA was then digested with DNase I (RNase-Free) (NEB). cDNA was synthesized from the total RNA using the ReverTra Ace® qPCR RT Kit (TOYOBO).

[0075] Droplet digital PCR (ddPCR) was performed using the synthesized cDNA as follows, essentially following the same procedure as in a previous study (14). The primer / probe set used was TaqMan® Gene Expression Assays (GAPDH: Hs99999905_m1 (VIC), AFP: Hs01040598_m1 (FAM), HNF4α: Hs00230853_m1 (FAM), ALB: Hs00609411_m1 (FAM)).

[0076] The thermal cycle conditions were as follows: 1. 95°C, 10 minutes; 2. 94°C, 30 seconds; 3. 59°C, 1 minute; 2 and 3 were repeated 39 times; 4. 98°C, 10 minutes. The fluorescent signal of each droplet was analyzed using the QX100 droplet reader (Bio-Rad) with the CNV2 setting and Quantasoft (Bio-Rad).

[0077] Embryoid body (EB) and cerebral organoid formation: For both diploid and tetraploid iPS cells, STEMdiff Cerebral Organoid Kit (#08570, STEMCELL) was used. ＴＭ The procedure was carried out according to the recommended protocol using the TECHNOLOGIES.

[0078] Results: Establishment of diploid iPS cells expressing fluorescent proteins and drug resistance genes. To select fused cells with drugs, the puromycin resistance gene and the blasticidin resistance gene were introduced into the diploid iPS cells to be fused using lentivirus. To visualize fused cells by fluorescence, the Venus gene and the mRFP1 gene were introduced into WTC11 and HPS0076, respectively, and these cells were established by selection with each drug alone.

[0079] Fusion of iPS cells and drug selection First, we attempted to fuse WTC11 cells. Cells were fused using HVJ-E, and fused cells were selected as cells resistant to both puromycin and blasticidin. We examined the efficiency of cell fusion by varying the amount of HVJ-E from 1 to 10 μl. We were able to establish fused cell clones most efficiently with 1 μl, with 2.0 × 10 ５ By fusing two diploid cells from each group, approximately 20 tetraploid iPS cells were established. A similar process for establishing fused cells was also performed using polyethylene glycol, a method used in hybridoma establishment, but no fused cell clones were obtained.

[0080] Characteristics of the Established Tetraploid iPS Cells Microscopic observation of the morphology of the established tetraploid iPS cells revealed that they were larger than normal diploid iPS cells and had a single nucleus (Figure 1A). Co-expression of Venus and mRFP1 was also confirmed (Figure 1B). Flow cytometry analysis of the cellular DNA content confirmed that the DNA content of the tetraploid iPS cells was indeed doubled compared to the diploid iPS cells (Figure 1C). Karyotype analysis confirmed that the tetraploid iPS cells retained fully doubled chromosomes (Figure 1D). Furthermore, CGH analysis demonstrated that chromosome doubling occurred without any small insertions or deletions (Figure 1E). Thus, chromosome doubling by iPS cell fusion was complete and without any genetic abnormalities.

[0081] Comparison of size and division cycle of tetraploid and diploid iPS cells and investigation of maintenance of pluripotency. Furthermore, cell diameter measurements revealed that tetraploid cells were approximately 18.7 μm, approximately 1.1 times larger than diploid cells (approximately 16.9 μm) (Fig. 1F). Cell proliferation rates were also measured, revealing that the doubling time of diploid cells was approximately 21.7 hours, while that of tetraploid cells was approximately 26.6 hours, approximately 1.2 times slower (Fig. 1G).

[0082] To examine whether tetraploid iPS cells maintained their undifferentiated state, we first confirmed the expression of the undifferentiated markers SOX2, OCT4, and SSEA4 using immunofluorescence staining. We found that expression was maintained similarly to diploid iPS cells (Figure 2A). Furthermore, when transplanted into the testes of NOD-SCID mice, tetraploid iPS cells formed teratomas, similar to diploid iPS cells, and tissue characteristics of the three germ layers were observed (Figure 2B). Furthermore, the cells in the formed teratomas maintained their tetraploid ploidy (Figure 2C). Thus, tetraploid iPS cells maintained their undifferentiated state and pluripotency despite DNA doubling.

[0083] Comparison of Transcript Profiles of Tetraploid and Diploid iPS Cells RNA was extracted from undifferentiated tetraploid and diploid iPS cells, and gene expression was compared using RNA-seq. The results showed that the number of genes with decreased expression in tetraploid iPS cells was greater than the number of genes with increased expression in tetraploid iPS cells compared to diploid iPS cells. Genes with increased expression in tetraploids included FAM187A, RN7SK, and RNU1-1. Meanwhile, genes with decreased expression in tetraploids included TRIM4, ZNF558, UNC5D, and many other genes, including metallothionein (MT), which plays a role in oxidative stress and metal toxicity responses (Figure 2D). GO enrichment analysis predicted the impact of these genes, whose expression varies depending on ploidy, on cellular functions. Oxidative stress and metal toxicity responses accounted for 9 of the top 10 (Figure 2E).

[0084] Fusion of diploid iPS cells derived from different individuals Using the conditions that successfully fused WTC11 cells, we also attempted to fuse WTC11 expressing a puromycin resistance gene and Venus gene with HPS0076 expressing a blasticidin resistance gene and mRFP1 gene. Using 1 μl of HVJ-E, we obtained 2.0 × 10 ５ By fusing each of these cells, six tetraploid iPS cells were established. Thus, fusion of iPS cells was possible, whether between the same cells or between cells derived from different individuals. Similar fusion experiments of iPS cells derived from different individuals were performed using polyethylene glycol, but unlike the experiment using HVJ-E, no fused iPS cell lines were obtained. The established cells expressed both Venus and mRFP1 (Figure 3A), and flow cytometry confirmed their tetraploidy (Figure 3B).

[0085] Furthermore, SNP-CGH analysis revealed that single nucleotide polymorphisms (SNPs) that were homozygous between WTC11 and HPS0076 cells were detected as heterozygous in the established tetraploid cells. This indicates that the established tetraploid cells were indeed generated by the fusion of two different types of cells. Representative SNPs are shown as examples (Table 1). Table 1 shows examples of SNPs detected as heterozygous in the fused cells, but not as homozygous, between WTC11 and HPS0076 iPS cells. Tetraploid iPS cells established by fusing iPS cells from different individuals could also be induced to differentiate into cardiomyocytes using the differentiation protocol described below (Figure 3C).

[0086]

[0087] Generation of Octoploid iPS Cells Using lentivirus, a neomycin resistance gene or a hygromycin resistance gene was introduced into tetraploid WTC11 iPS cells in a similar manner to the introduction of a puromycin resistance gene and a blasticidin resistance gene into diploid WTC11 iPS cells, and the cells were selected by drug selection. Octoploid iPS cells were then generated by fusing the resulting tetraploid WTC11 cells carrying the neomycin resistance gene with tetraploid WTC11 cells carrying the hygromycin resistance gene. 2.0 x 10 ５ Each cell was fused with 1 μl of HVJ-E and then selected with neomycin and hygromycin, and the presence of octaploid iPS cells was observed by DNA quantification ( FIG. 4 ).

[0088] Phenotype of Cardiomyocytes Derived from Tetraploid iPSCs. Tetraploid iPSCs were differentiated into cardiomyocytes and their phenotypes were compared with those of diploid iPSC-derived cardiomyocytes. Similar to diploid cells, tetraploid cells could be differentiated into cardiomyocytes by regulating Wnt signaling with small molecules (11). Furthermore, a metabolic selection method (12) was also applicable, in which lactate was added to the culture medium instead of glucose to metabolically select only cardiomyocytes. However, while diploid iPSCs were successfully differentiated at either 6 μM or 12 μM concentrations of CHIR99021, which activates Wnt signaling and is added at the beginning of the differentiation protocol, tetraploid iPSCs were only differentiated at 6 μM, but not at 12 μM.

[0089] Furthermore, during metabolic selection of cardiomyocytes using lactate-containing medium, diploid iPS cell-derived cardiomyocytes could be selected by changing the lactate-containing medium three times every two days. However, tetraploid iPS cell-derived cardiomyocytes could only be changed twice because three changes of the medium would result in the death of the cardiomyocytes. Thus, adjustments to the protocol were necessary for differentiation induction and cardiomyocyte selection. The resulting tetraploid iPS cell-derived cardiomyocytes were confirmed by immunohistochemistry to be positive for actinin, which forms the sarcomere, just like diploid iPS cell-derived cardiomyocytes. Furthermore, cardiomyocytes derived from tetraploid iPS cells were found to be as large as mature cardiomyocytes (Figure 5A).

[0090] Flow cytometry quantification of DNA content in the resulting cardiomyocytes revealed that 80% of the diploid iPSC-derived cardiomyocytes were diploid and only 12% were tetraploid, completely failing to reflect the adult state (Figure 5B). However, 83% of the tetraploid iPSC-derived cardiomyocytes were tetraploid, more faithfully reproducing the adult state. No octoploid cardiomyocytes were observed (Figure 5B).

[0091] To compare gene expression patterns, RNA sequencing was performed on diploid and tetraploid iPS cell-derived cardiomyocytes. Gene expression was compared for triplicate samples, revealing clustering of genes with ploidy-specific expression (Figure 5C). It is known that genes involved in cellular function switch isoforms from MYH6 to MYH7 during cardiomyocyte maturation. RNA sequencing revealed that this isoform switching occurred in tetraploid iPS cell-derived cardiomyocytes compared to diploid iPS cell-derived cardiomyocytes (Table 2). Table 2 shows a comparison of gene expression patterns that undergo isoform switching between tetraploid and diploid iPS cell-derived cardiomyocytes.

[0092]

[0093] Furthermore, we found that KCNJ2, a ventricular myocyte-type ion channel whose expression increases with maturation, was upregulated in tetraploid iPS cell-derived cardiomyocytes. Conversely, the expression of HCN4, an automatic ion channel whose expression decreases with maturation, was downregulated. Furthermore, we found that the expression of all genes encoded by mitochondrial DNA was elevated without exception (Table 3).

[0094]

[0095] On the other hand, when the expression of these mitochondrial genes was analyzed by RNA-seq in undifferentiated iPS cells, it was found that between diploid and tetraploid cells, some mitochondrial genes showed increased expression in the undifferentiated state, while others showed decreased expression (Table 4).

[0096]

[0097] These results suggest that tetraploid iPSC-derived cardiomyocytes have increased mitochondrial mass and a higher mitochondrial DNA to nuclear DNA ratio, suggesting that this increase in mitochondrial mass is specific to cardiomyocyte differentiation. Therefore, we visualized mitochondria and observed an increase in mitochondria in tetraploid iPSC-derived cardiomyocytes (Figures 5D and 5E). Furthermore, when we quantified the copy number ratio of mitochondrial DNA to nuclear DNA using digital PCR, we found no significant difference in the mitochondrial mass of undifferentiated iPSCs between diploid and tetraploid cells (Figure 5F). However, we observed an increase in mitochondria in tetraploid iPSC-derived cardiomyocytes compared to diploid iPSC-derived cardiomyocytes (Figure 5G). Therefore, this increase in mitochondrial mass is cardiomyocyte-specific.

[0098] Mitochondria play a crucial role in the contractile function of cardiomyocytes, and mitochondrial development is one indicator of cardiomyocyte maturity. Therefore, it can be said that tetraploid iPS cell-derived cardiomyocytes more faithfully reproduce the state of the adult heart than conventional diploid iPS cell-derived cardiomyocytes.

[0099] Furthermore, when the cellular functions associated with genes whose expression varies specifically with ploidy were analyzed based on the GO term, all of the top ranking genes were involved in the cell cycle (Figure 5H). This indicates that cell cycle activity is significantly reduced in tetraploid iPS cell-derived cardiomyocytes compared to diploid iPS cell-derived cardiomyocytes. Fetal cardiomyocytes in vivo also possess proliferative capacity, but this capacity is lost with maturation. Therefore, tetraploid iPS cell-derived cardiomyocytes possess characteristics more similar to those of mature cardiomyocytes. Furthermore, the intracellular structure of diploid and tetraploid iPS cell-derived cardiomyocytes was observed using a transmission electron microscope. Sarcomere and mitochondria were observed in both diploid and tetraploid iPS cell-derived cardiomyocytes (Figure 6).

[0100] Phenotype of Tetraploid iPSC-Derived Hepatocytes Tetraploid iPSCs were induced to differentiate into hepatocytes. Unlike cardiomyocytes, hepatocyte differentiation was successful using the same protocol as for diploid iPSCs. mRNA was extracted from the resulting hepatocytes, and the expression levels of the hepatocyte differentiation markers ALB, HNF4α, and AFP were quantified. The expression levels were higher in tetraploid iPSC-derived hepatocytes than in diploid iPSC-derived hepatocytes (Figure 7). As with cardiomyocytes, the use of polyploid iPSCs enabled enhanced differentiation maturity.

[0101] Induction of tetraploid iPS cells into skeletal muscle cells. Tetraploid iPS cells were induced to differentiate into skeletal muscle cells. As with hepatocyte differentiation, this was successful using the same protocol as for diploid iPS cells. Immunostaining of the induced skeletal muscle cells with the marker myosin heavy chain confirmed expression in both diploid and tetraploid cells (Figure 8).

[0102] Induction of Embryoid Bodies (EBs) and Organoid Formation from Tetraploid iPS Cells Organoids formed from iPS cells are expected to be more faithful models of living tissues, as they can reproduce them in three dimensions. Therefore, we attempted to form EBs from tetraploid iPS cells, as with diploid iPS cells, and then differentiate these EBs to form cerebral organoids. As a result, tetraploid iPS cells were able to form EBs, as with diploid iPS cells, and further form cerebral organoids (Figure 9A, B). We also confirmed that the cells in the formed organoids maintained their ploidy (Figure 9C).

[0103] Discussion: Previous studies have reported the fusion of pluripotent stem cells with other cell types. For example, when human fibroblasts and ES cells were fused using polyethylene glycol, the established cells maintained the expression of undifferentiated markers, indicating that the fibroblasts were reprogrammed by fusion. Because the original purpose of this study was to examine whether fusion reprograms the fibroblast nuclei, the differentiation potential of the fusion-established cells and the characteristics of the differentiated cells were not analyzed (8). Other studies have shown that the fusion of iPS or ES cells with hematopoietic stem cells facilitates differentiation into mesendodermal cells. This report demonstrated that the established fused iPS cells maintained the expression of undifferentiated marker genes and could differentiate into neural cells, cardiomyocytes, and hepatocytes, as well as form teratomas containing cells from all three germ layers. Among these, differentiation into mesendodermal cells was particularly promoted (9). This is thought to be due to the influence of the fusion of undifferentiated iPS cells with hematopoietic stem cells, which are mesodermal cells.

[0104] Meanwhile, this invention is the first example of fusing undifferentiated iPS cells together, and we have found that this method can promote differentiation of cardiomyocytes and hepatocytes, which are normally polyploid in vivo. Promoting cell differentiation faithfully reproduces in vivo cells, enabling better analysis of disease models and use in drug discovery research. It is also important for cell transplantation therapy.

[0105] To fuse diploid cells, drug selection was performed using two drug resistance genes, Puromycin and Blasticidin, and by repeating the same procedure, octaploid cells were also established. Further manipulations can produce 16-ploid and higher cells. It is known that the ploidy of some liver cells, skeletal muscle cells, placenta, and megakaryocytes in vivo can reach extremely high levels of octaploid or higher, so changing the ploidy of iPS cells depending on the target cell type is an effective method.

[0106] References 1. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, et al. Embryonic stem cell lines derived from human blastocysts. Science. 1998 Nov 6;282(5391):1145-7. 2. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 2007 Nov 30;131(5):861-72. 3. Ahmed RE, Anzai T, Chanthra N, Uosaki H. A Brief Review of Current Maturation Methods for Human Induced Pluripotent Stem Cells-Derived Cardiomyocytes. Front Cell Dev Biol. 2020 Mar 19;8:178. 4. Derts W, Bergmann O. Polyploidy in cardiomyocytes: roadblock to heart regeneration? Circ Res. 2020 Feb 14;126(4):552-65. 5. Sladky VC, Eichin F, Reiberger T, Villunger A. Polyploidy control in hepatic health and disease. J Hepatol. 2021 Nov;75(5):1177-91. 6. Fang J, de Bruin A, Villunger A, Schiffers R, Lei Z, Slujter JPG. Cellular polyploidy in organ homeostasis and regeneration. Protein Cell. 2022 Dec 31; 7. Mitra S, Tomar PC. Hybridoma technology;advancements,clinical significance,and future aspects.J Genet Eng Biotechnol.2021 Oct 18;19(1):159. 8.Cowan CA,Atienza J,Melton DA,Eggan K.Nuclear reprogramming of somatic cells after fusion with human embryonic stem cells.Science.2005 Aug 26;309(5739):1369−73. 9.Qin J,Sontag S,Lin Q,Mitzka S,Leisten I,Schneider RK,et al.Cell fusion enhances mesendodermal differentiation of human induced pluripotent stem cells.Stem Cells Dev.2014 Dec 1;23(23):2875−82. 10.Haim−Abadi G,Golan−Lev T,Koren A,Benvenisty N.Generation,genomic characterization,and differentiation of triploid human embryonic stem cells.Stem Cell Rep.2023 Apr 17; 11.Miyaoka Y,Chan AH,Judge LM,Yoo J,Huang M,Nguyen TD,et al.Isolation of single−base genome−edited human iPS cells without antibiotic selection.Nat Methods.2014 Mar;11(3):291−3. 12.Lian X,Hsiao C,Wilson G,Zhu K,Hazeltine LB,Azarin SM,et al.Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling.Proc Natl Acad Sci USA.2012 Jul 3;109(27):E1848−57. 13.Tohyama S,Hattori F,Sano M,Hishiki T,Nagahata Y,Matsuura T,et al.Distinct metabolic flow enables large−scale purification of mouse and human pluripotent stem cell−derived cardiomyocytes.Cell Stem Cell.2013 Jan 3;12(1):127−37. 14.Si−Tayeb K,Noto FK,Nagaoka M,Li J,Battle MA,Duris C,et al.Highly efficient generation of human hepatocyte−like cells from induced pluripotent stem cells.Hepatology.2010 Jan;51(1):297−305. 15.Tanaka A,Woltjen K,Miyake K,Hotta A,Ikeya M,Yamamoto T,et al.Efficient and Reproducible Myogenic Differentiation from Human iPS Cells: Prospects for Modeling Miyoshi Myopathy In Vitro.PLOS ONE.2013 Apr;8(4):e61540. 16.Breckwoldt K,Letuffe−Breniere D,Mannhardt I,Schulze T,Ulmer B,et al.Differentiation of cardiomyocytes and generation of human engineered heart tissue.Nat Protoc.2017 Jun;12(6):1177−1197. 17.Mandegar MA,Huebsch N,Frolov EB,Shin E,Truong A,Olvera MP,et al.CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs.Cell Stem Cell.2016 Apr 7;18(4):541−53.;

Claims

1. N １ ploid (N １ represents an integer from 2 to 16.) Pluripotent stem cells and N ２ ploid (N ２ represents an integer from 2 to 16.) １ +N ２ ) Ploid pluripotent stem cells.

2. N １ and N ２ The pluripotent stem cell according to claim 1, wherein is 2 or 4.

3. The pluripotent stem cell according to claim 1, which is an iPS cell.

4. N １ ploid (N １ represents an integer from 2 to 16.) Pluripotent stem cells and N ２ ploid (N ２ represents an integer of 2 to 16.) in the presence of a virus to fuse the pluripotent stem cell of (N １ +N ２ ) A method for producing multiplicative pluripotent stem cells.

5. N １ and N ２ The method according to claim 4, wherein is 2 or 4.

6. The method according to claim 4, wherein the pluripotent stem cells are iPS cells.

7. The method according to claim 4, wherein the virus is Sendai virus.

8. A method for producing cardiomyocytes, comprising the step of culturing the pluripotent stem cells according to any one of claims 1 to 3 in the presence of a GSK-3 inhibitor.

9. A method for producing hepatocytes, comprising the steps of treating the pluripotent stem cells described in any one of claims 1 to 3 with Activin-A in the presence of a GSK-3 inhibitor to induce them into endoderm cells, treating the induced endoderm cells with fibroblast growth factor and bone morphogenetic factor to induce them into hepatic progenitor cells, and further treating the hepatic progenitor cells with hepatocyte growth factor.

10. A method for producing cerebral organoids, comprising the steps of culturing the pluripotent stem cells described in any one of claims 1 to 3 in the presence of a fibroblast growth factor and a ROCK inhibitor to induce them into embryoid bodies, culturing the embryoid bodies in a medium containing an N2 supplement to induce them into neuroepithelium, and further culturing them in a medium containing an N2 supplement and a B27 supplement.

11. A method for producing cardiac organoids, comprising the following steps (a) to (d): (a) culturing the cells according to any one of claims 1 to 3 on a low-adhesion plate to induce them into embryoid bodies; (b) treating the embryoid bodies obtained in step (a) with a GSK-3 inhibitor, bone morphogenetic protein and Activin A to induce them into mesoderm; (c) treating the mesoderm induced in step (b) with Wnt-C59 to induce them into cardiac mesoderm; and (d) treating the cardiac mesoderm induced in step (c) with a GSK-3 inhibitor.

12. A method for producing liver organoids, comprising a step of culturing the pluripotent stem cells described in any one of claims 1 to 3 together with iPS cell-derived endoderm cells, vascular endothelial cells and mesenchymal stem cells to cause self-aggregation.

13. A method for producing skeletal muscle cells, comprising the step of culturing the pluripotent stem cells according to any one of claims 1 to 3 in the presence of a TGF-β receptor inhibitor.

14. A method for testing the cardiotoxicity of a test substance, comprising the steps of contacting a test substance with the pluripotent stem cells described in any one of claims 1 to 3, cardiomyocytes produced by the method described in claim 8, or cardiac organoids produced by the method described in claim 11, and evaluating the test substance as a cardiotoxic substance using cell death, cell membrane potential, calcium transient, or a decrease in muscle contractility as an indicator.

15. A method for screening for a drug that improves cardiomyocyte function, comprising the steps of contacting a test substance with the pluripotent stem cells described in any one of claims 1 to 3, cardiomyocytes produced by the method described in claim 8, or cardiac organoids produced by the method described in claim 11, and selecting the test substance as a drug for improving cardiomyocyte function using muscle contraction force or pulsation rhythm as an index.

16. A method for testing the hepatotoxicity of a test substance, comprising the steps of contacting the test substance with the pluripotent stem cells described in any one of claims 1 to 3, hepatocytes produced by the method described in claim 9, or hepatic organoids produced by the method described in claim 12, and evaluating the test substance as a hepatotoxic substance using cell death or mitochondrial toxicity as an indicator.

17. A method for screening for drugs that improve hepatocyte function, comprising the steps of contacting a test substance with the pluripotent stem cells described in any one of claims 1 to 3, hepatocytes produced by the method described in claim 9, or liver organoids produced by the method described in claim 12, and selecting the test substance as a drug for improving hepatocyte function using drug metabolic ability as an indicator.

18. A method for screening for a drug that improves skeletal muscle cell function, comprising the steps of contacting a test substance with the pluripotent stem cells described in any one of claims 1 to 3, or skeletal muscle cells produced by the method described in claim 13, and selecting the test substance as a drug for improving skeletal muscle cell function using contractile force as an index.

19. A kit for testing the cardiotoxicity of a test substance or for screening a drug for improving cardiomyocyte function, comprising the pluripotent stem cells described in any one of claims 1 to 3, cardiomyocytes produced by the method described in claim 8, or cardiac organoids produced by the method described in claim 11.

20. A kit for testing the hepatotoxicity of a test substance or for screening drugs that improve hepatocellular function, comprising the pluripotent stem cells described in any one of claims 1 to 3, hepatocytes produced by the method described in claim 9, or hepatic organoids produced by the method described in claim 12.

21. A kit for screening for a drug that improves skeletal muscle cell function, comprising the pluripotent stem cells described in any one of claims 1 to 3, or skeletal muscle cells produced by the method described in claim 13.

Images