Plasmonic nematic film for detecting genetic hearing loss and biosensor including same

Abstract

The present invention relates to a plasmonic nematic film for detecting genetic hearing loss and a biosensor including same, wherein there is an effect of being able to more easily detect genetic hearing loss through symmetry breaking due to complementary binding between detection DNA bonded to magnetic plasmon nanoparticles aligned on a nanoparticle layer and target DNA exhibiting genetic hearing loss and changes in chiral characteristics according to the symmetry breaking.

Description

Plasmonic nematic film for detecting hereditary hearing loss and biosensor comprising the same

[0001] The present invention relates to a plasmonic nematic film for detecting hereditary hearing loss and a biosensor including the same.

[0002] The ear is classified as the outer ear, which includes the auricle and external auditory canal; the middle ear, which includes the eardrum and ossicles; and the inner ear, which includes the cochlea and auditory nerve. Sound is acoustic energy that is transmitted through the auricle and external auditory canal, causing the eardrum to vibrate.

[0003] The vibration of the eardrum is transmitted as mechanical energy to the ossicles, three small bones attached to the eardrum. The last bone of the ossicles, the stapes, connects to the cochlea and transmits the energy to the lymph fluid within the cochlea. The transmitted energy creates waves in the lymph fluid, and these waves stimulate the hair cells within the cochlea. The movement of the hair cells causes ionic changes, which transmit neurotransmitters to the auditory nerve attached to the hair cells, and the sound energy is transmitted from the auditory nerve to the brain in the form of electrical energy.

[0004] Hearing loss is the most common sensorineural disorder, occurring in approximately 1 in 1,000 newborns. Hearing loss can be broadly categorized as "hereditary" and "non-hereditary," with "hereditary" accounting for over 50% of cases. Hereditary hearing loss can be further categorized as syndromic or non-syndromic. Syndromic hearing loss, which presents with multiple symptoms, accounts for 30%, while the remaining 70% is non-syndromic, with no other symptoms.

[0005] In the case of non-syndromic hearing loss, autosomal recessive inheritance accounts for about 80%, autosomal dominant inheritance accounts for about 15 to 20%, and the remaining less than 2% is hearing loss caused by genes located on the X chromosome and mitochondria.

[0006] Because early diagnosis and ongoing management of hereditary hearing loss are crucial, active research is underway on the genes associated with hereditary hearing loss. Among these, mutations in the GJB2 (OMIM ID: 121011) gene are widely recognized as the cause of hereditary hearing loss.

[0007] In order to prevent and detect such hereditary hearing loss, preventive diagnosis through fetal DNA detection is known to be the most effective, and the single-molecule fluorescence resonance energy transfer (smFRET) method is known as one of the representative DNA mutation detection methods, but it has some disadvantages such as the necessity of using radioactive probe labels, which makes it inconvenient to use.

[0008] Symmetry breaking has been known to be the origin of chirality, which changes circular dichroism due to the asymmetric interaction between circularly polarized light and chiral nanostructures. Meanwhile, the helical structure of nanoscale plasmonic materials can amplify chiral optical signals, and plasmonic nanoparticles with dimensions much smaller than the wavelength of light can focus incident radiation into a highly localized region when excited at their resonant wavelength. For example, plasmonic nanoparticles can be arranged in chiral geometries, such as particle helices or twisted nanorod stacks, to induce plasmonic chiral responses, whereby the nanostructures can absorb circularly polarized light differently, resulting in a strong circular dichroism (CD) spectrum.

[0009] Accordingly, when utilizing plasmonic chirality, effective detection can be achieved without sophisticated equipment due to the strong absorption characteristics and optical rotational dispersion effect of plasmonic particles. Therefore, research is continuously being conducted to detect unique signal changes due to plasmonic symmetry breaking and utilize them in new sensor fields.

[0010] [Prior Art Literature]

[0011] [Patent Document]

[0012] (Patent Document 1) KR 10-2017-0061345 A

[0013] The purpose of the present invention is to provide a plasmonic nematic film for detecting hereditary hearing loss and a biosensor including the same.

[0014] Another object of the present invention is to provide a plasmonic nematic film capable of detecting hereditary hearing loss through symmetry breaking and subsequent change in chiral properties due to complementary binding between a detection DNA bound to magnetic plasmonic nanoparticles aligned on a nanoparticle layer and a target DNA exhibiting hereditary hearing loss.

[0015] In order to achieve the above object, according to one embodiment of the present invention, a plasmonic nematic film for detecting hereditary hearing loss comprises at least two nanoparticle layers and probe DNA, wherein the nanoparticle layers include a plurality of nanoparticle arrays that are spaced apart from each other and have a unidirectional alignment structure, and the at least two nanoparticle layers include a first layer including a plurality of nanoparticle arrays aligned in a first direction; and a second layer adjacent to the first layer including a plurality of nanoparticle arrays aligned in a second direction different from the first direction, wherein the probe DNA is bound to the nanoparticle array, and the nematic film can exhibit chirality.

[0016] The angle (θ) formed by the first direction and the second direction is in the range of 0° to 90°.

[0017] The above plasmonic nematic film detects hereditary hearing loss through complementary binding between the probe DNA and the target DNA.

[0018] The above target DNA is bound to metal nanoparticles.

[0019] The above target DNA can be complementarily bound to a signal DNA bound to a metal nanoparticle.

[0020] It may further include a spacing layer formed between the first layer and the second layer.

[0021] The above nematic film further includes a support layer formed on one surface, and the support layer may include a material selected from the group consisting of glass, indium tin oxide (ITO), fluorine-doped tin oxide (FTO), poly(methyl methacrylate), polycarbonate, poly(dimethylsiloxane), and combinations thereof.

[0022] The above nanoparticle array includes a plurality of magnetic plasmonic nanoparticles.

[0023] The above nanoparticle comprises a core; and a shell comprising a heterogeneous component and surrounding at least a portion of the surface of the core.

[0024] One of the core and shell contains a magnetic component, and the other contains a metallic component.

[0025] A biosensor for detecting hereditary hearing loss according to another embodiment of the present invention may include a plasmonic nematic film.

[0026] The present invention relates to a plasmonic nematic film for detecting hereditary hearing loss and a biosensor including the same, which has the effect of enabling easier detection of hereditary hearing loss through symmetry destruction and subsequent change in chiral characteristics due to complementary binding between detection DNA bound to magnetic plasmonic nanoparticles aligned on a nanoparticle layer and target DNA indicating hereditary hearing loss.

[0027] FIG. 1 is a perspective view schematically illustrating a plasmonic nematic film according to one embodiment of the present invention.

[0028] FIG. 2 schematically illustrates the shape of the nanoparticle layer of the plasmonic nematic film according to one embodiment of the present invention, observed in a direction perpendicular to the ground.

[0029] FIG. 3 illustrates the structure and optical properties of a magnetic plasmonic nanoparticle and a plasmonic nematic film including the same according to one embodiment of the present invention.

[0030] FIG. 4 is a result of confirming the complementary binding structure and characteristics thereof between the detection DNA (pDNA) of the plasmonic nematic film according to one embodiment of the present invention and the target DNA (tDNA) bound to the metal nanoparticle.

[0031] FIG. 5 shows the results of confirming the DNA mutation detection characteristics using the symmetry breaking effect of a plasmonic nematic film according to one embodiment of the present invention and the complementary binding relationship of pDNA and tDNA of an embodiment of the present invention.

[0032] FIG. 6 is a spectral analysis result of magnetic circular dichroism (MCD) of a plasmonic nematic film according to one embodiment of the present invention.

[0033] FIG. 7 shows the DNA electric signal enhancement effect of a plasmonic chiral system due to the interaction of CPLs in a plasmonic nematic film according to one embodiment of the present invention.

[0034] Figure 8 shows the change in electric field distribution according to RCP interaction in a PNF system modified with DNA.

[0035] Figure 9 compares plasmon hotspot dynamics under LCP and RCP conditions without DNA according to one embodiment of the present invention.

[0036] Figure 10 shows the influence of chiroptical characteristics according to the spacing between AuNP and PNF.

[0037] Figure 11 shows the correlation between CD peak wavelength shift and AuNP-PNF distance.

[0038] Figure 12 shows the clinical DNA detection effect of a plasmonic nematic film according to one embodiment of the present invention.

[0039] Figure 13 shows the detection characteristics for point mutations of a plasmonic nematic film according to one embodiment of the present invention.

[0040] The present invention relates to a plasmonic nematic film for detecting hereditary hearing loss, comprising at least two nanoparticle layers and probe DNA, wherein the nanoparticle layers include a plurality of nanoparticle arrays that are spaced apart from each other and have a unidirectional alignment structure, wherein the at least two nanoparticle layers include a first layer including a plurality of nanoparticle arrays aligned in a first direction; and a second layer adjacent to the first layer including a plurality of nanoparticle arrays aligned in a second direction different from the first direction, wherein the probe DNA is bound to the nanoparticle array, and the nematic film exhibits chirality.

[0041] Hereinafter, embodiments of the present invention will be described in detail so that those skilled in the art can easily implement them. However, the present invention may be implemented in various different forms and is not limited to the embodiments described herein.

[0042] In the drawings, the thickness of some components is enlarged to clearly represent layers or regions, as needed. Additionally, in the drawings, the thickness of some layers and regions is exaggerated for convenience of explanation. Throughout the specification, the same reference numerals designate the same components.

[0043] In addition, when a part such as a layer, film, region, or plate is said to be "on," "on," or "above" another part in this specification, this is interpreted to include not only the case where it is "directly above" another part, but also the case where there is another part in between. When a part is said to be "directly above" another part, this is interpreted to mean that there is no other part in between. In addition, when a part such as a layer, film, region, or plate is said to be "below," "under," or "below" another part, this is interpreted to include not only the case where it is "directly below" another part, but also the case where there is another part in between. When a part is said to be "directly below" another part, this is interpreted to mean that there is no other part in between.

[0044] As used herein, when a part is said to "include" a component, this does not mean that it excludes other components, but rather that it may include other components, unless otherwise specifically stated.

[0045] In this specification, the term “PNF” refers to a plasmonic nematic film according to an embodiment of the present invention, “MagPlas NPs” refers to magnetic plasmonic nanoparticles according to an embodiment of the present invention, and “AuNPs” refers to metal nanoparticles according to an embodiment of the present invention. In addition, “tDNA” refers to target DNA, “pDNA” refers to probe DNA and is defined to refer to detection DNA, which may be expressed as “cDNA”. Meanwhile, “sDNA” refers to signal DNA and is defined to refer to signal DNA, which may be expressed as “dDNA”.

[0046] In the present invention, the term “nanoparticle” is defined to include not only a spherical particle shape, but also a nanowire or nanorod shape.

[0047] In the present invention, the term "target DNA" refers to the DNA to be detected, and is defined to include all DNA capable of complementary binding to the detection DNA of the present invention. For example, the target DNA may be a "target DNA that causes hereditary hearing loss" capable of complementary binding to the detection DNA. Furthermore, the target DNA is defined to include "synthetic DNA," "clinical DNA" obtained from a patient, and variants thereof.

[0048] According to one embodiment of the present invention, a plasmonic nematic film for detecting hereditary hearing loss comprises at least two nanoparticle layers and probe DNA, wherein the nanoparticle layers include a plurality of nanoparticle arrays that are spaced apart from each other and have a unidirectional alignment structure, wherein the at least two nanoparticle layers include a first layer including a plurality of nanoparticle arrays aligned in a first direction; and a second layer adjacent to the first layer including a plurality of nanoparticle arrays aligned in a second direction different from the first direction, wherein the probe DNA is bound to the nanoparticle array, and the nematic film can exhibit chirality.

[0049] The above plasmonic nematic film can function as a bio-inspired functional nanomaterial in photonic crystal, electrochemical catalyst, and sensor applications by applying the hierarchical structure, shape, and composition of the one-dimensional nanostructure. Conventional methods known in the art for manufacturing nano-laminated structures have had problems of significantly low accuracy and reproducibility. In this regard, the plasmonic nematic film is in the form of an optical laminate, and includes a nanoparticle array derived from nanoparticles of a specific composition, thereby exhibiting improved structural chirality by including a microstructure in which structures similar to plywood are layered and rotated in a Bouligand structure, and at the same time, the spacing and alignment structure of the nanoparticle array are consistent, so that it can exhibit the advantage of significantly improved accuracy and reproducibility compared to the conventional method.

[0050] Specifically, the plasmonic nematic film can exhibit structural chirality by including at least two nanoparticle layers, wherein the plurality of nanoparticle arrays included in the nanoparticle layers are spaced apart from each other and have a unidirectional alignment structure, and at the same time, the alignment direction of each nanoparticle array in two adjacent nanoparticle layers has a predetermined angle. That the plasmonic nematic film exhibits chirality means that it satisfies structural complete asymmetry, meaning that the film does not have a mirror plane within its structure. Based on the chirality generated by the structural feature, the film functions as a chiral nematic surface layer, and can be utilized in various application fields requiring the same, and specifically, can be applied to the purpose of detecting hereditary hearing loss of the present invention.

[0051] More specifically, the plasmonic nematic film includes a probe DNA (pDNA), and the probe DNA is combined with a nanoparticle array.

[0052] The above detection DNA can be complementarily combined with all or part of the base sequence of the target DNA (tDNA) that causes hereditary hearing loss, and when combined, it causes a change in the chiral properties of the plasmonic nematic film of the present invention due to a symmetry breaking effect, and through the change in the chiral properties, a specific hereditary hearing loss gene of interest can be detected.

[0053] FIG. 1 is a perspective view schematically illustrating a plasmonic nematic film (10) according to one embodiment of the present invention. Referring to FIG. 1, the plasmonic nematic film (10) includes at least two layers of nanoparticle layers (20). FIG. 1 illustrates an example in which the nematic film (10) includes four layers of nanoparticle layers (20), and specifically illustrates a structure formed by attaching nematic films (10) including two layers of nanoparticle layers (20) so as to face each other.

[0054] The above nanoparticle layer (20) includes a plurality of nanoparticle arrays (21), and the plurality of nanoparticle arrays (21) are spaced apart from each other within one nanoparticle layer (20) and have a unidirectional alignment structure. Specifically, the at least two-layer nanoparticle layer (20) includes a first layer (11) including a plurality of nanoparticle arrays (21) aligned in a first direction, and a second layer (12) adjacent to the first layer (11) including a plurality of nanoparticle arrays (21) aligned in a second direction different from the first direction. In the present specification, the 'first layer (11)' and the 'second layer (12)' refer to any two layers among the at least two-layer nanoparticle layers (20). As an example, FIG. 1 illustrates the first layer from the ground side as the first layer (11), and the second layer adjacent thereto as the second layer (12). That is, in the nematic film (10), the first layer (11) and the second layer (12) may refer to the second layer and the third layer from the ground side, respectively, and similarly, may refer to the third layer and the fourth layer from the ground side.

[0055] Meanwhile, referring to FIG. 1, the detection DNA (pDNA) (24) of the present invention has a structure that is bound to the nanoparticle array (21), and can induce symmetry destruction and chiral property change of the plasmonic nematic film (10) of the present invention through complementary binding with the target DNA (tDNA) (23) bound to the metal nanoparticles (AuNPs) (25).

[0056] Meanwhile, the angle (θ) formed by the first direction and the second direction is in the range of 0° to 90°.

[0057] Specifically, FIG. 2 schematically illustrates the shape of the nanoparticle layer (20) of the plasmonic nematic film (10) according to one embodiment of the present invention, observed in a direction perpendicular to the ground.

[0058] Specifically, a, b and c of FIG. 2 schematically illustrate cases in which a first layer (11), a second layer (12) and a fourth layer of nanoparticle layers (20) are generated from the ground side, respectively. As an example, when the first layer (11) and the second layer (12) refer to the first layer and the second layer from the ground side, respectively, the first direction (a) which is the alignment direction of the plurality of nanoparticle arrays (21) of the first layer (11) and the second direction (b) which is the alignment direction of the plurality of nanoparticle arrays (21) of the second layer (12) may form a predetermined angle (θ). More specifically, the angle (θ) may be any one angle in the range of 0°<θ<90°. In another aspect, when the first layer (11) and the second layer (12) refer to the second layer and the third layer from the ground side, respectively, the angle (θ) formed by the first direction (b) and the second direction (c) may also be any angle in the range of 0°<θ<90°. When the first direction and the second direction form a predetermined angle range as described above, the plasmonic nematic film (10) can exhibit structural chirality by the stacked structure of the plurality of nanoparticle layers (20).

[0059] The angle (θ) formed by the first direction and the second direction is, for example, about 0°<θ<90°, for example, about 5°≤θ<90°, for example, about 10°≤θ<90°, for example, about 15°≤θ<90°, for example, about 5°≤θ≤85°, for example, about 5°≤θ≤80°, for example, about 5°≤θ≤75°, for example, about 5°≤θ≤70°, for example, about 5°≤θ≤65°, for example, about 5°≤θ≤60°, for example, about 5°≤θ≤55°, for example, about 5°≤θ≤50°, for example, about 10°≤θ≤65°, for example, about 10°≤ θ ≤ 60°, for example, about 10°≤ θ ≤ 55°, for example, about 10°≤ θ ≤ 50°. Here, the angle (θ) formed by the first direction and the second direction is a value based on an acute angle. Since the angle (θ) formed by the first direction and the second direction falls within an appropriate range, the geometric structure formed by the nanoparticle array (21) of the first layer (11) and the nanoparticle array (21) of the second layer (12) according to the coupling effect of the first layer (11) and the second layer (12) can be advantageous in improving the plasmon resonance effect between nanoparticles, and at the same time, can be advantageous in securing the overall structural chirality by implementing effective asymmetry. From another perspective, if the angle (θ) formed by the first direction and the second direction is too small, there is a concern that structural asymmetry may be reduced and chirality may be suppressed, and if the angle (θ) formed by the first direction and the second direction is too large, there is a concern that the coupling effect between the first layer (11) and the second layer (12) may be weakened, which may be detrimental to plasmon resonance.

[0060] FIG. 2 illustrates an example in which the alignment direction of the nanoparticle array (21) of each layer of the plurality of nanoparticle layers (20) is sequentially rotated counterclockwise by a predetermined angle from the first layer to the last layer from the ground side, and is stacked. In another example, the plurality of nanoparticle layers (20) may be stacked such that the alignment direction of the nanoparticle array (21) of each layer is sequentially rotated clockwise by a predetermined angle from the first layer to the last layer from the ground side. In this case, the chirality of the nematic film (10) including the plurality of nanoparticle layers (20) according to the former stacking structure and the chirality of the nematic film (10) including the plurality of nanoparticle layers (20) according to the latter stacking structure may exhibit mutually opposite chiralities. In another aspect, when the nematic film (10) including a plurality of nanoparticle layers (20) according to the former stacking structure exhibits left chirality, the nematic film (10) including a plurality of nanoparticle layers (20) according to the latter stacking structure can exhibit right chirality. In this way, the nematic film (10) can exhibit right or left chirality depending on the rotational direction of the alignment direction of the nanoparticle array (21) of each layer of the plurality of nanoparticle layers (20), and since the predetermined angle satisfies the above-described range, both the plasmon resonance effect and chirality can be excellently implemented.

[0061] In one embodiment, the nematic film (10) may include about 2 to about 10 layers of the nanoparticle layer (20). FIG. 1 illustrates an example in which the nematic film (10) includes 4 layers of the nanoparticle layer (20). Since the nematic film (10) includes an appropriate number of nanoparticle layers (20), the plasmon resonance may be advantageously implemented at a target level due to the coupling effect between the plurality of nanoparticle layers (20), and the geometric structure according to the rotational stacking of the nanoparticle arrays (21) included in the plurality of nanoparticle layers (20) may be more advantageous in implementing chirality at a target level.

[0062] In one embodiment, the thickness of the nanoparticle layer (20) may be, for example, about 100 nm to about 200 nm, for example, about 110 nm to about 200 nm, for example, about 120 nm to about 200 nm, for example, about 130 nm to about 200 nm, for example, about 110 nm to about 180 nm, for example, about 120 nm to about 180 nm, for example, about 130 nm to about 180 nm, for example, about 140 nm to about 180 nm.

[0063] The above plasmonic nematic film detects hereditary hearing loss through complementary binding between the probe DNA and the target DNA.

[0064] Specifically, the present invention relates to a plasmonic nematic film for detecting target DNA targeting point mutations in the GJB2 gene, which is the most frequently mutated gene worldwide, and is capable of detecting hereditary hearing loss by confirming changes in symmetry destruction and chiral properties caused by complementary binding between the detection DNA and the target DNA.

[0065] Specifically, the above detection DNA may include a base sequence capable of complementary binding to 20 sequences in which expression of point mutations is frequently observed in the GJB2 gene, which is the target DNA (tDNA) (23).

[0066] Specifically, the probe DNA may include a base sequence of sequence number 1 or 2, and the target DNA may include a base sequence selected from the group consisting of sequence numbers 3, 4, 5, and 6.

[0067] Meanwhile, FIG. 4d shows a scanning electron microscope (SEM) photograph and an optical microscope (OM) photograph of the nanoparticle layer (20) according to one embodiment of the present invention. The left photograph of FIG. 4d is an OM photograph measured in a direction perpendicular to the ground for any one of the nanoparticle layers (20), and the right photograph is an SEM photograph measured in a direction perpendicular to the ground for any one of the nanoparticle layers (20).

[0068] Referring to the above Fig. 4d, the nanoparticle layer (20) includes a plurality of nanoparticle arrays (21), and the plurality of nanoparticle arrays (21) are arranged spaced apart from each other and have a unidirectional alignment structure. Meanwhile, the distance between two adjacent nanoparticle arrays (21) of the plurality of nanoparticle arrays (21) may be about 500 nm to about 1000 nm. The combination of the feature that the plurality of nanoparticle arrays (21) are spaced apart from each other within this range to form a unidirectional alignment structure and the feature that the alignment directions of the plurality of nanoparticle layers (20) form a predetermined angle may be advantageous in imparting improved chirality to the nematic film (10). From another perspective, if the spacing between the plurality of nanoparticle arrays (21) is too close or too far, the plurality of nanoparticle arrays (21) may be aligned in one direction, and even if the alignment directions of the plurality of nanoparticle layers (20) are stacked to form a predetermined angle, there is a concern that chirality may not be achieved at the desired level.

[0069] Referring to the right-hand side of Fig. 4d, the nanoparticle array (21) may include a plurality of nanoparticles. Specifically, the nanoparticle array (21) may refer to an array (21) in which a plurality of nanoparticles are aligned in a predetermined direction while forming a cluster. The nanoparticles may have a predetermined structure and shape and include a predetermined composition, thereby being more advantageous in implementing the chirality and optical properties of the plasmonic nematic film (10) to a desired level.

[0070] The above nanoparticle array may include a plurality of magnetic plasmonic particles.

[0071] Plasmon refers to a phenomenon in which free electrons within a metal collectively oscillate. In the case of metal nanoparticles, plasmons can exist locally on the surface, which can be referred to as surface plasmons. When metal nanoparticles encounter an electric field of light in the range from visible light to near-infrared, light absorption occurs due to surface plasmon resonance (SPR), resulting in a vivid color. The magnetic plasmon particles are plasmon particles that are magnetic and can be aligned in a specific array within a magnetic field due to their magnetism, and at the same time, can exhibit color due to the plasmon phenomenon. When the nanoparticles include such magnetic plasmon particles, the nanoparticle array derived therefrom can form a unidirectionally aligned structure, and at the same time, the plasmonic nematic film can exhibit excellent optical properties.

[0072] Meanwhile, the magnetic plasmonic particles may have arrangement variability due to application of a magnetic field. Here, the 'arrangement variability due to application of a magnetic field' refers to a characteristic in which, when a magnetic field is applied to the magnetic plasmonic particles, the magnetic plasmonic particles are aligned in a predetermined arrangement according to the applied magnetic field. Based on this arrangement variability due to application of a magnetic field, the nanoparticles can form a plurality of nanoparticle arrays having a one-way alignment structure by configuring them through a relatively simple means of applying a magnetic field.

[0073] Meanwhile, the detection DNA included in the plasmonic nematic film of the present invention can be bound to the nanoparticle array (21), and more specifically, can be bound to the magnetic plasmonic nanoparticles.

[0074] That is, the detection DNA (pDNA) (24) can be combined with the magnetic plasmonic nanoparticles (MagPlas NPs) to form a complex (MagPlas NPs-pDNA).

[0075] Meanwhile, the target DNA is bound to metal nanoparticles.

[0076] Specifically, the target DNA (tDNA) (23) that complementarily binds to the detection DNA (pDNA) (24) can be directly bound to metal nanoparticles (AuNPs) (25) to form a complex (AuNPs-tDNA).

[0077] That is, through complementary bonding between pDNA (24) and tDNA (23) included in each complex of the above "MagPlas NPs-pDNA" and "AuNPs-tDNA", it is possible to induce symmetry breaking and change in chiral properties of the plasmonic nematic film.

[0078] Specifically, the metal nanoparticles are preferably gold (Au) nanoparticles, but are not limited thereto, and are not particularly limited as long as they are metal nanoparticles that can be applied to analysis of symmetry breaking and chiral property changes.

[0079] Meanwhile, the target DNA can be complementarily bound to the signal DNA bound to the metal nanoparticle.

[0080] Specifically, referring to FIG. 1 and FIG. 12a, the metal nanoparticle (AuNP) (25) can be directly bound to a signal DNA (sDNA) (26), and the signal DNA (sDNA) (26) can complementarily bind to a portion of the base sequence of the target DNA (tDNA) (23). Through this, it is possible to exhibit a sandwich-style binding between the detection DNA (pDNA) (24), the target DNA (tDNA) (23), and the signal DNA (sDNA) (26), and a signal with a change in chiral characteristics accordingly.

[0081] That is, the target DNA (tDNA) may be directly bound to the metal nanoparticle, or may be indirectly bound to the metal nanoparticle through complementary binding with signal DNA (sDNA) directly bound to the metal nanoparticle.

[0082] The above nanoparticle comprises a core; and a shell comprising a heterogeneous component and surrounding at least a portion of the surface of the core.

[0083] Specifically, the shell may be a half-shell structure surrounding a portion of the core surface, or the shell may be a structure that substantially surrounds the entire surface of the core. Meanwhile, the shell containing components different from those of the core should be interpreted to include not only cases where all components are different from each other, but also cases where the overall composition is different even if some of the same components are included.

[0084] One of the core and shell contains a magnetic component, and the other contains a metallic component.

[0085] By combining a core containing a magnetic component and a shell containing a metal component, or a shell containing a magnetic component and a core containing a metal component, the arrangement variability of the magnetic plasmonic particles by application of a magnetic field can be immediately and quickly implemented, and it can be advantageous in securing a technical advantage in terms of expression of a desired color, etc.

[0086] The metal component may include, for example, one selected from the group consisting of silver (Ag), gold (Au), platinum (Pt), copper (Cu), palladium (Pd), iridium, osmium, rhodium, ruthenium, nickel (Ni), cobalt (Co), iron (Fe), manganese (Mn), chromium (Cr), vanadium (V), titanium (Ti), aluminum (Al), zinc (Zn), cadmium (Cd), and combinations thereof.

[0087] The magnetic component may include, for example, one selected from the group consisting of iron oxide (Fe3O4), nickel oxide (NiO), cobalt oxide (Co3O4), iron (Fe), nickel (Ni), cobalt (Co), and combinations thereof.

[0088] In one embodiment, the core may include one selected from the group consisting of silver (Ag), gold (Au), platinum (Pt), copper (Cu), palladium (Pd), iridium, osmium, rhodium, ruthenium, nickel (Ni), cobalt (Co), iron (Fe), manganese (Mn), chromium (Cr), vanadium (V), titanium (Ti), aluminum (Al), zinc (Zn), cadmium (Cd), and combinations thereof, and the shell may include one selected from the group consisting of iron oxide (Fe3O4), nickel oxide (NiO), cobalt oxide (Co3O4), iron (Fe), nickel (Ni), cobalt (Co), and combinations thereof.

[0089] In another embodiment, the core may include one selected from the group consisting of iron oxide (Fe3O4), nickel oxide (NiO), cobalt oxide (Co3O4), iron (Fe), nickel (Ni), cobalt (Co), and combinations thereof, and the shell may include one selected from the group consisting of silver (Ag), gold (Au), platinum (Pt), copper (Cu), palladium (Pd), iridium, osmium, rhodium, ruthenium, nickel (Ni), cobalt (Co), iron (Fe), manganese (Mn), chromium (Cr), vanadium (V), titanium (Ti), aluminum (Al), zinc (Zn), cadmium (Cd), and combinations thereof.

[0090] Meanwhile, the plasmonic nematic film of the present invention may further include a spacing layer formed between the first layer and the second layer.

[0091] The above-mentioned spacing layer (22) can play a role in securing an appropriate layer spacing between the plurality of nanoparticle layers. In addition, the spacing layer (22) can play a role in effectively preventing the process of forming one nanoparticle layer from causing a change in another nanoparticle layer that has already been formed during the process of forming the plurality of nanoparticle layers. In addition, the thickness of the nematic film can be appropriately controlled through the spacing layer (22), and it can be more advantageous in improving the usability of the film.

[0092] In one embodiment, the spacing layer (22) may include one selected from the group consisting of polydiallyldimethylammonium chloride (PDDA), poly(amic acid), poly(allylamine hydrochloride) (PAH), polyethyleneimine (PEI), poly-L-lysine (PLL), poly(acrylic acid) (PAA), polystyrenesulfonate (PSS), polyvinylsulfate (PVS), dextran sulfate (DS), and combinations thereof. By applying this type of component, it may be more advantageous to improve the aforementioned role and function of the spacing layer (22).

[0093] Meanwhile, referring to FIG. 1, the nanoparticle layer (20) may further include a base material. The base material may serve to firmly support the array structure of the nanoparticle array (21) arranged within the nanoparticle layer (20). In addition, the base material may serve to improve the interfacial adhesion between the plurality of nanoparticle layers (20). In addition, the base material may enable the nanoparticle layer (20) to have an appropriate thickness.

[0094] In one embodiment, the substrate may include one selected from the group consisting of polydiallyldimethylammonium chloride (PDDA), poly(amic acid), poly(allylamine hydrochloride) (PAH), polyethyleneimine (PEI), poly-L-lysine (PLL), poly(acrylic acid) (PAA), polystyrenesulfonate (PSS), polyvinylsulfate (PVS), dextran sulfate (DS), and combinations thereof. The substrate may be more advantageous in improving the aforementioned role and function by including such components.

[0095] In an embodiment, the spacing layer (22) and the base material may be derived from components having mutually opposite charges. Specifically, the spacing layer (22) may be derived from a component having a positive (+) charge and the base material may be derived from a component having a negative (-) charge; or the spacing layer (22) may be derived from a component having a negative (-) charge and the base material may be derived from a component having a positive (+) charge. By applying components having mutually opposite charges as raw materials to the spacing layer (22) and the base material, excellent interlayer adhesion can be secured through electrostatic interaction between the spacing layer (22) and the nanoparticle layer (20) during the manufacturing process of the plasmonic nematic film (10), and the aligned structure of the nanoparticle array (21) can be effectively fixed, so that chirality can be precisely implemented according to the rotational stacking of the plurality of nanoparticle layers (20).

[0096] In one embodiment, the spacing layer (22) may be derived from a polymer having a positive (+) charge, and the base material may be derived from a polymer having a negative (-) charge. More specifically, the polymer having a positive (+) charge may include one selected from the group consisting of polydiallyldimethylammonium chloride (PDDA), poly(allylamine hydrochloride) (PAH), polyethyleneimine (PEI), poly-L-lysine (PLL), and combinations thereof, and the polymer having a negative (-) charge may include one selected from the group consisting of polyamic acid, polyacrylic acid (PAA), polystyrene sulfonate (PSS), polyvinyl sulfate (PVS), dextran sulfate (DS), and combinations thereof.

[0097] The above nematic film further includes a support layer formed on one surface, and the support layer may include a material selected from the group consisting of glass, indium tin oxide (ITO), fluorine-doped tin oxide (FTO), poly(methyl methacrylate), polycarbonate, poly(dimethylsiloxane), and combinations thereof.

[0098] The above support layer (40) serves to structurally support the plasmonic nematic film, and since the support layer (40) includes the above-mentioned components, it has the advantage of being able to impart structural rigidity to the film itself without impairing the structural chirality and optical properties of the plasmonic nematic film.

[0099] In one embodiment, the support layer (40) may be derived from a charged glass having a negative (-) charge, and the separation layer (22) may be derived from a polymer having a positive (+) charge. More specifically, the support layer (40) may have a surface formed of silicon oxide (SiO -) can be derived from glass treated to expose ions. In addition, the polymer having a positive (+) charge applied to the spacing layer (22) can include one selected from the group consisting of polydiallyldimethylammonium chloride (PDDA), poly(allylamine hydrochloride) (PAH), polyethyleneimine (PEI), poly-L-lysine (PLL), and combinations thereof.

[0100] A biosensor for detecting hereditary hearing loss according to another embodiment of the present invention may include the plasmonic nematic film.

[0101] Specifically, the plasmonic nematic film can simultaneously secure structural chirality and excellent optical properties by applying a nanoparticle layer including a plurality of nanoparticle arrays that are spaced apart from each other and have a unidirectional alignment structure, and applying a structure in which the alignment direction of the nanoparticle arrays of each layer is rotated and laminated so that the alignment direction of the nanoparticle arrays of each layer forms a predetermined angle when laminating the plurality of nanoparticle layers.

[0102] Furthermore, the nanoparticle array, more specifically, the detection DNA (pDNA) (24) bound to the magnetic plasmonic nanoparticles included in the nanoparticle array, can be used as a biosensor capable of detecting DNA related to hereditary hearing loss through the symmetry breaking and the resulting change in chiral properties induced by complementary binding with the target DNA (tDNA) (23) that causes hereditary hearing loss.

[0103] Experimental preparation

[0104] Citric acid (C6H8O7), sodium acetate (CH3COONa, NaAc), iron nitrate (Fe(NO3)3·9H2O), silver nitrate (AgNO3), ethylene glycol (EG, HOCH2CH2OH), poly(diallyldimethyl ammonium chloride, PDDA), poly(acrylic acid, PAA), 30 nm gold nanoparticle-stabilized suspension in citrate buffer, N-hydroxysuccinimide (NHS), and 1-ethyl-3-(3-dimethyl-aminopropyl)-carbodiimide (EDAC) were purchased from Sigma-Aldrich Co., Ltd.

[0105] Probe DNA (detection DNA), signal DNA, target DNA 1, target DNA 2, DNA 3, DNA 4, and DNA 5 were synthesized and used by Genotech Co., Ltd. in Daejeon.

[0106] The preparation of the magnetic plasmonic nanoparticle (MagPlas NPs) solution was performed using deionized (DI) water (>18 MΩcm -1 ) was used, and a diluted 0.01 M phosphate buffer (PBS) solution at pH 7.4 was used for the complementary binding experiment.

[0107] Meanwhile, clinical tDNA was supplied and used from Seoul National University Bundang Hospital, and SB774-1362, NC62, and SB195-380 were expressed from the GSMDE (gasdermin E) gene. The GSMDE gene, known as DFNA 5, is one of the genes associated with autosomal dominant asymptomatic hearing loss. Meanwhile, the SB 965-1613 gene was expressed from the SLC26A4 gene. The SLC26A4 gene corresponds to a gene associated with Pendred syndrome, the most common form of syndromic hearing loss, an autosomal recessive disease. SB 965-1613 corresponds to a mutation caused by a change in one base in the corresponding exon from A to G.

[0108] Analysis method

[0109] The absorption spectra of the fabricated nanoparticles were analyzed using UV-Vis spectroscopy (Evolution 220, Thermo Scientific, Waltham, MA). Meanwhile, scanning electron microscopy images were acquired using a field emission scanning electron microscope (FESEM S-4700, Hitachi, Tokyo, Japan) at the CNU Chemistry Core Facility (Daejeon, Korea). In addition, the chirality of the samples was analyzed using circular dichroism spectroscopy (CD, J-1500, Jasco Inc. Japan). The CD scale was set to 200 mdeg / 0.1 dOD / 0.1 dOD, the digital integration time (DIT) was set to 32 ms, and the bandwidth was set to 1.0 nm. The data pitch was determined to be 0.5 nm, and the scanning speed was set to 100 nm / min.

[0110] Manufacturing example

[0111] Preparation of magnetic plasmonic nanoparticles (MagPlas Ag@Fe3O4 NPs)

[0112] 44.0 mmol of iron nitrate (Fe(NO3)3·9H2O) was mixed with 40 mL of ethylene glycol (C2H4(OH)2). Then, 35 mmol of anhydrous sodium acetate (CH3COONa) and 0.59 mmol of silver nitrate (AgNO3) were added to the mixed solution, and the mixture was stirred until all the reactants were completely dissolved. Afterwards, the mixture was placed in a Teflon-lined autoclave and maintained at 210°C for 4 hours. After cooling to 25°C, a black powder was obtained, which was washed with deionized water and ethanol, and then dried in a vacuum oven at 60°C for 24 hours.

[0113] To enhance the stability of the colloidal solution, a surface pretreatment step was performed to attach hydrophilic functional groups to the particle surface in order to disperse the powder in a polar solvent such as deionized water. Specifically, 1 mg of powder-type nanoparticles (Ag@Fe3O4) formed in the particle synthesis step and 9 mg / mL of citric acid were used. -1 Ag@Fe3O4 nanoparticles, which are stabilized citrate-coated nanoparticles, were obtained by placing the Ag@Fe3O4 nanoparticles in 1 mL of deionized water and sonicating them for 2 hours with 5-second on / off cycles using an ultrasonic probe (VCX 500, Sonics & Materials Inc., Newtown, CT, USA), and then washing them with deionized water. These are spherical core-shell particles having a core containing silver (Ag) and a shell containing iron oxide (Fe3O4), and magnetic plasmonic particles having a structure in which the shell substantially surrounds the entire surface of the core were manufactured.

[0114] The diameter of the silver (Ag) core and the thickness of the iron oxide (Fe3O4) shell were measured using a high-resolution transmission electron microscope (HR-TEM, JEM-3010, JEOL, Tokyo, Japan) and a TEM (H-7600, Hitachi, Tokyo, Japan). Meanwhile, the chiroptical properties were characterized using a circular dichroism spectrophotometer (J-1500; Jasco, Tokyo, Japan).

[0115] Meanwhile, Figures 3a to 3c show SEM, TEM, and XRD values ​​of magnetic plasmonic nanoparticles manufactured by the above method, respectively, and it can be confirmed that the nanoparticles have a core-shell structure.

[0116] Preparation of magnetic plasmonic nanoparticles (MagPlas NPs) conjugated with detection DNA

[0117] POU3F4 DNA (5'-NH2-C6-GCACCGTAGATGTCAAAGGC-3') was used as probe DNA (detection DNA, pDNA) and was prepared using a carbodiimide reaction.

[0118] To activate the citric acid used as a surfactant for the magnetic plasmonic nanoparticles, 20 μl of a solution containing a cross-linking reagent including 100 mM N-hydroxy succinimide (NHS) and 100 mM 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDAC) was added to 500 μL of the magnetic plasmonic nanoparticle solution and maintained for 30 minutes. Then, 10 pmol of the probe DNA was added to the solution and incubated in a shaking incubator for 5 hours. Thereafter, the magnetic plasmonic nanoparticles bound to the probe DNA were prepared by washing with deionized water and 0.01 M PBS solution.

[0119] Preparation of gold nanoparticles (Au NPs) conjugated with target DNA

[0120] To bind target DNA to gold nanoparticles (Au NPs), a freeze-thaw method was used.

[0121] A 40 μL, 30 nm gold nanoparticle solution was centrifuged, and the citrate buffer was replaced with 0.01 M PBS buffer. 10 pmol of DTT-free target DNA 3'-CGTGGCATCTACAGTTTCCG-(CH2)6-SH-5' or signal DNA (sDNA) (3'-AAAAAAA-SH-5') was added to the washed 40 μL gold nanoparticle solution, and the mixture was incubated at 37°C. After one hour, the mixture was centrifuged, and the supernatant was separated for UV analysis. Meanwhile, to remove unbound DNA from the AuNPs solution, washing with 0.01 M PBS solution and additional centrifugation were performed.

[0122] Meanwhile, to induce complementary binding of probe DNA and tDNA bound to magnetic plasmonic nanoparticles, the above-prepared nematic film was reacted with 100 uL of the above-prepared gold nanoparticle solution at 37°C for 5 hours. After the reaction, the substrate (nematic film) was washed with deionized water and 0.01 M PBS solution and dried with N2 gas.

[0123] Meanwhile, DNAs 3, 4 and 5 are also bound to gold nanoparticles (Au NPs) in the same manner as above.

[0124] Meanwhile, the base sequence of each DNA used in a specific embodiment of the present invention is as shown in Table 1 below.

[0125] DNADNA sequenceSequence number detection DNA5′-NH2-C6-GCACCGTAGATGTCAAAGGC-3′15′-NH2-ACGGTCTATCTATCGCGTCGC-3′2Target DNA 13′-CGT GGC ATC TAC AGT TTC CG-SH-5′3Target DNA 2 (1 change)3′-CGT GCC ATC TAC AGT TTC CG-SH-5′4Target DNA 3 (4 changes)3′-CGT GCA TAC TAC AGT TTC CG-SH-5′5Target DNA 43′-CCTTGATCCTCTAGCCTTCG-SH-5′6Signal DNA(sDNA)3′-AAAAAAA-SH-5'7

[0126] Fabrication of plasmonic nematic films

[0127] To generate a chiral nematic structure and observe optical phenomena, a layer-by-layer method was used. Specifically, two support layers (glass substrates) were used to fabricate a single plasmonic nematic film structure.

[0128] Specifically, two slide glass substrates (20×20×0.7 mm, Duran Inc., United States) were washed with ethanol and deionized water, and dried using N2 gas. After drying the glass substrates, the surfaces of the substrates were treated with O2 plasma to form negatively charged hydroxyl groups on the surfaces. Meanwhile, the negatively charged glass substrates were immersed in a 0.2 wt % polydiallyldimethylammonium chloride (PDDA) aqueous solution for 15 minutes, so that a positively (+) charged polymer layer was deposited as a spacing layer. Thereafter, the substrates were washed with deionized water and dried with N2 gas.

[0129] Afterwards, the dried substrate was mounted on two neodymium magnets (50 Х 10 Х 2 mm) with a strength of 25 mT. 3, 0.2 T) were placed between the substrates, and 300 ug / ml of the nanoparticles (MagPlas NP) manufactured in the above manufacturing example were dropped onto the separation layer of each substrate, and a magnetic field with a strength of 5.5 (±0.5) mT was applied, and then dried overnight under ambient conditions to manufacture a first nanoparticle layer including a plurality of nanoparticle arrays aligned in the first direction.

[0130] After washing the intermediate body on which the first nanoparticle layer was formed with deionized water to remove loosely bound nanoparticles, the intermediate body was immersed in a 0.2 wt% polyacrylic acid (PAA) aqueous solution to fill the space between the plurality of nanoparticle arrays with a negatively charged base material.

[0131] Next, a positively charged polymer layer was deposited as a spacing layer by immersing in a 0.2 wt% polydiallyldimethylammonium chloride (PDDA) aqueous solution for 15 minutes. Thereafter, the nanoparticles of the above-mentioned manufacturing example were dropped on the spacing layer, and a magnetic field was applied. At this time, the magnetic field was applied with the direction adjusted so that the plurality of nanoparticles were aligned in a second direction that formed an angle rotated 20° clockwise from the first direction. Thereafter, the second nanoparticle layer including a plurality of nanoparticle arrays aligned in the second direction that formed an angle rotated 20° clockwise from the first direction was manufactured by drying under atmospheric conditions. Thus, a laminate including a total of two nanoparticle layers was manufactured.

[0132] Meanwhile, in order to implement chiral properties having rotation in the opposite direction to the above rotational direction, it can be manufactured by adjusting the angle so that each is rotated 20° counterclockwise. Through this, a four-layer structure with a skew angle of 20° can be created, and the skew angle can be changed by changing the angle of the substrate placed between the magnets.

[0133] Meanwhile, 300 ug / ml of DNA-conjugated MagPlas NPs were dropped onto a substrate placed between magnets to completely align the particles.

[0134] Finally, the two manufactured laminates (substrates) were washed with a 0.01 M PBS solution, dried using N2 gas, and then, to measure the CD spectrum, the two multilayer substrates were placed face to face and then the two substrates were adsorbed using a 0.01 M PBS solution, thereby manufacturing the nematic film of the present invention.

[0135] Specifically, FIG. 3d schematically illustrates the deposition of at least two nanoparticle layers on a glass substrate with two different support layers (substrates, α and β). It can be confirmed that each of the α support layer and the β support layer rotates in opposite directions to form an angle θ, and each nanoparticle layer is deposited.

[0136] Experimental results

[0137] Confirmation of changes in chiral properties due to complementary binding between detection DNA (pDNA) and target DNA (tDNA)

[0138] The complementary binding between the detection DNA (pDNA) and the target DNA (tDNA) that causes hereditary hearing loss included in the plasmonic nematic film of the present invention causes an additional asymmetric interaction to the chiral properties of the plasmonic nematic film itself, and consequently affects the overall chiroptical properties, and hereditary hearing loss can be detected through this change in chirality.

[0139] Magnetic plasmonic nanoparticles were synthesized via a hydrothermal method, and the average diameter of the Ag core was confirmed to be 60 nm, and the shell thickness of Fe3O4 was 50 nm (Figs. 3a and 3b). Meanwhile, the X-ray diffraction (XRD) spectrum shows the composition of Ag and Fe3O4, where the ICDD numbers of Ag and Fe3O4 are 04-0783 and 01-088-0315, respectively (Fig. 3c).

[0140] The plasmonic cores were assembled using magnetic plasmonic nanoparticles (MagPlas NPs) under a linear magnetic field to form two sets of PNFs (a, β), where the two layers of substrate a were aligned at a −θ angle, and the layers of substrate β were aligned at a +θ angle (Fig. 3d). Then, the two prepared substrates were attached facing each other at a designated PNF angle (θ). Meanwhile, the assembled PNF structure was expected to resemble a chiral nematic formulation of liquid crystals with a specific directionality that can induce asymmetric light-matter interactions (Fig. 3e, left).

[0141] Meanwhile, the adsorption of AuNPs on PNFs may affect the overall chiral properties from additional asymmetric interactions.

[0142] Specifically, the right drawing of Fig. 3e shows the optical asymmetry (I) of the plasmonic nematic film and circular polarization (CPL). asy ) and additional asymmetry (I' asy ) interaction, in CD spectroscopy, the overall asymmetric interaction (I) for the circular dichroism change (ΔCD) total asy ) is I asy and I' asy is equal to the sum of

[0143] Meanwhile, the gray array represents a plasmonic nematic film bound to pDNA, and the yellow particles represent metal nanoparticles bound to target DNA.

[0144] In addition, the adsorption or binding of AuNPs in the plasmonic nematic film is induced by complementary binding between target DNA and detection DNA (pDNA), specifically, the one-sided chiral signal of the DNA double helix structure can be enhanced at the hotspot between the magnetic plasmonic nanoparticles of the nematic film and the gold nanoparticles (Au NPs), and the complementary binding can effectively distinguish the presence of DNA mutations and the related chiral signal at the hotspot between the PNFs and AuNPs under circularly polarized light (CPL).

[0145] Furthermore, due to changes in electron transport in double-stranded tDNA with point mutations depending on the type of circularly polarized light (CPL), I asy was investigated. Considering that DNA mutations can change the chiral DNA structure in terms of electric field distribution, this leads to an increase in overall optical chirality (I total_asy ) can affect.

[0146] Here, the overall optical chirality (I total_asy ) is I asy and I' asy As a sum of , the optical asymmetry (top, I) of PNF and circular polarization (CPL) respectively asy ) and additional asymmetry (bottom, I' asy ) is shown as an interaction (Fig. 3e).

[0147] To explain this effect, I' asy Expressions for I'asy_normal and I' asy_mut was further classified as , where I' asy_mut It involves loop formation and alteration of DNA structure by considering changes in electron transfer between chiral plasmonic nanostructures and DNA due to DNA mutations.

[0148] Meanwhile, Ψ PNFrepresents the wavefunction describing the PNF, and Operator_PNF(Ω) corresponds to the quantum mechanical operator that characterizes the chiral response of the PNF (Fig. 3f). The asymmetric signal due to the interaction between AuNP and PNF (when tDNA exists without mutation) can be expressed as follows:

[0149] [Formula 1]

[0150] I asy = ∫Ψ PNF *(Ω)Ψ PNF dV

[0151] Here, the number of PNF layers (N layers ) and the change in the angle (θ) between layers is I asy It represents the influence on the value. Therefore, it can be defined as follows:

[0152] [Formula 2]

[0153] Ω =f(N layers ,θ)

[0154] Consequently, the asymmetric signal considering both the interaction between AuNP and PNF and the DNA mutation (if there is a mutation in tDNA) can be expressed as Equations 3 and 4 below:

[0155] [Formula 3]

[0156] I'asy_normal= ∫Ψ_ PNF *(Ω _ AuNP_normal )Ψ_ AuNP dV

[0157] [Formula 4]

[0158] I' asy_mut = ∫Ψ _PNF *(Ω _AuNP_mut )Ψ _AuNP dV

[0159] Here, Ω _AuNP_normal is a quantum mechanical operator that characterizes the specific interactions between the electronic states of normal DNA, PNF, and AuNP, and Ω _AuNP_mutcorresponds to a mutation of a DNA-dependent quantum mechanical operator that describes the specific interaction between the electronic states of the PNF and the DNA-bound AuNP and the altered electron motion between them (Fig. 3g).

[0160] Furthermore, wavelength (λ) can be described as a specific length of light or radiation that plays a crucial role in the interaction and hybridization between DNA mutations, plasmonic nanostructures such as PNFs, and AuNPs. The occurrence of DNA mutations can induce structural changes in the electronic behavior of DNA, magnetoplasmonic nanoparticles (Ag@Fe3O4), and AuNPs, which can affect the optical interaction at a specific wavelength:

[0161] [Formula 5]

[0162] Ω _ AuNP_ mut =Ω _AuNP_normal + f(C,Φ,λ)

[0163] Here, f(C,Φ,λ) is a function dependent on C,Φ,λ, where C is the concentration of target mutant DNA, Φ is the mutation rate of unit target DNA, and λ is the associated wavelength, which is related to the optical phenomenon occurring between the interaction and hybridization of DNA mutants and PNF and AuNP.

[0164] Characterization of complementary binding between detection DNA (pDNA) and hereditary hearing loss target DNA (tDNA)

[0165] Figure 4a schematically illustrates the binding between target DNA (tDNA) and metal (Au) nanoparticles and the binding between detection DNA (pDNA) and magnetic plasmonic nanoparticles, respectively.

[0166] Specifically, referring to Fig. 4a, the binding between the magnetic plasmonic nanoparticles and the detection DNA (MagPlas NPs-pDNA, i) was via N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC) / N-hydroxysulfosuccinimide (NHS). Meanwhile, the binding between the metal nanoparticles and the target DNA (Au NPs-tDNA, ii) was via sulfur binding.

[0167] Meanwhile, Figure 4b shows 10 metal (Au) nanoparticles bound to target DNA (tDNA). -4 The absorption spectrum of 10 pmol is shown, and referring to Fig. 4b, 3.32ⅹ10 at the ratio of Au:tDNA=1:3 used as a reference. -10 It was confirmed that the absorbance of M Au-tDNA showed linearity depending on the concentration.

[0168] Meanwhile, Fig. 4c shows the extinction spectrum during the bonding process, and referring to this, characteristic peaks can be confirmed in the regions of 403 nm, 527 nm, and 649 nm. Specifically, the peak at 403 nm is due to Mie scattering of Fe3O4, and the peak at 649 nm is related to the localized surface plasmon resonance of the Ag core. Meanwhile, the strong absorption peak at 527 nm can be inferred to be derived from the localized surface plasmon resonance.

[0169] Specifically, it can be confirmed that each characteristic absorption peak slightly shifts (AuNP: 531 to AuNP-tDNA: 528 nm; Ag@Fe3O4: 649 to Ag@Fe3O4-tDNA: 657 nm) due to the effect of binding of each nanoparticle and tDNA or pDNA and complementary binding of tDNA and pDNA. That is, the change in the extinction spectra values ​​is a result of the interaction of the optical properties of each pDNA and tDNA with the plasmon bands of Ag and AuNP in the complementary DNA binding between pDNA and tDNA.

[0170] Meanwhile, the chiral optical detection (chiroptical sensing) effect of the plasmonic nematic film of the present invention on hereditary hearing loss was confirmed.

[0171] Figures 4d and 4e are scanning electron microscope (SEM) and optical microscope (OM) images of the nanoparticle layer of the present invention, which confirm the formation of a single layer and a double layer, respectively.

[0172] Specifically, the first nanoparticle layer means that the angle (θ) of the nanoparticle array is in the range of 0° to 90°, and the angle of the nanoparticle array of the second nanoparticle layer formed on the upper surface of the first nanoparticle layer may be an opposite angle (-θ), that is, in the range of 0° to -90°.

[0173] Meanwhile, Fig. 4f shows the normalized UV-vis absorption spectra of a single nanoparticle layer in non-polarized, transversal, and longitudinal modes, respectively, with two characteristic peaks, λ S and λ D can be confirmed. λ of longitudinal mode DThe peak exhibited a noticeable redshift from the unpolarized mode, specifically from 636 nm to 650 nm.

[0174] In addition, the two support layers manufactured above were attached to face each other so as to exhibit an angle (θ) ranging from 0° to 90°. At this time, the support layer includes at least one nanoparticle layer. Specifically, Fig. 4g shows the extinction (quenching) spectra of a film (1 layer) including a single-layer nanoparticle layer, a film (2 layers) including a double-layer nanoparticle layer by attaching films including a single-layer nanoparticle layer to face each other, and a plasmonic nematic film (2+2 layers) including a double-layer nanoparticle layer by attaching plasmonic films to face each other.

[0175] According to the above Fig. 4g, it can be confirmed that the intensity of the two peaks increases proportionally as the number of layers of the nanoparticle layer increases.

[0176] Meanwhile, FIG. 4h shows the CD spectra according to the number of nanoparticle layers included in the plasmonic nematic film of the present invention, and FIG. 4i shows the CD spectra values ​​according to the angle (θ) between the directions of each nanoparticle array included in two or more nanoparticle layers included in the plasmonic nematic film.

[0177] According to the above FIGS. 4h and 4i, it can be confirmed that the chiral strength increases as the number of nanoparticle layers included in the plasmonic nematic film of the present invention increases. In addition, it was confirmed that the plasmonic nematic film exhibits right-handed (RH) chirality in the range of 0° to 30°, and left-handed (LH) chirality in the range of -30° to 0°. More specifically, it was confirmed that the highest CD spectrum intensity was exhibited at an angle of 20°. That is, when the film of the present invention is manufactured to form an angle of 20°, it can exhibit the best chirality, and through this, the effect of detecting DNA for hereditary hearing loss can also be sensitively observed.

[0178] Meanwhile, for additional chiral detection, additional variables, i.e., NP concentration and strength of external magnetic field, were adjusted to maximize chiroptical properties above θ, respectively, to 300 μg mL -1 and optimized to 22mT, it was confirmed that the nano-arrays could be aligned in a way that maximizes the chiroptical response in the above optimal configuration, and through this, it was confirmed that the detection sensitivity and specificity could be improved.

[0179] Confirmation of DNA mutation detection characteristics by symmetry breaking effect of plasmonic nematic films

[0180] Figure 5a is a schematic diagram of a detection DNA (pDNA) (i) bound to a magnetic plasmonic nanoparticle and a tDNA (ii) bound to a metal nanoparticle, and Figures 5b and c show SEM photographic images before and after complementary binding of the detection DNA and target DNA, respectively.

[0181] Meanwhile, Fig. 5d shows an absorption spectrum of a plasmonic nematic film according to an embodiment and when 10 pmol of AuNPs-tDNA(ii) is bound to the film. Meanwhile, Fig. 5e shows an absorption spectrum of the plasmonic nematic film and when simple metal nanoparticles (AuNPs) are bound to the film.

[0182] Meanwhile, Fig. 5j shows the complementary binding relationship between the pDNA and tDNA of the present invention. It can be confirmed that pDNA and tDNA 1 are completely complementarily bound, and pDNA and tDNA 2 showed a single base pair mismatch of 5%. Meanwhile, it was confirmed that pDNA and tDNA 3 showed a 4 base pair mismatch (20%), and pDNA and tDNA 4 showed a 12 base pair mismatch (60%).

[0183] Referring to the above Figure 5a, the complementary DNA bond between (i) and (ii) causes additional symmetry breaking (I') of the plasmonic nematic film of the present invention. asy ) and by confirming the change in chiral properties through this, the hereditary hearing loss DNA targeted by the present invention can be detected.

[0184] Meanwhile, the tDNA(ii) solution bound to the metal nanoparticles was loaded onto the two support layers (substrate α and β) of the above-described manufacturing example to hybridize with the pDNA(i) bound to the magnetic plasmonic nanoparticles at 37°C for 5 hours. As a result, referring to Figs. 5b and c, it can be confirmed that the tDNA(ii) bound to the metal nanoparticles was hybridized with the pDNA(i) bound to the plasmonic nanoparticles (5c), and a clear difference from the original PNF (5b) can be confirmed. It was confirmed that the absorbance spectrum of the hybridized complex increased linearly with the concentration of (ii).

[0185] Specifically, referring to FIGS. 5d and e, it can be confirmed that the plasmonic nematic film combined with the tDNA still exhibits a high absorption spectrum even after the washing step, confirming successful bonding, whereas in the case of the nematic film hybridized with metal nanoparticles (Au NPs) without tDNA, the absorbance slightly increased with hybridization, but the effect disappeared again after washing.

[0186] That is, through this, a complementary bond is formed between the detection DNA (pDNA) and the target DNA (tDNA) included in the nematic film of the present invention, and thus additional symmetry breaking (I') of the plasmonic nematic film is performed. asy ) and it can be confirmed that it exhibits changes in chiral properties.

[0187] Meanwhile, Fig. 5f shows the CD spectrum of the plasmonic nematic film of the present invention combined with tDNA (Au NPs-tDNA) bound to 10 pmol of metal nanoparticles, where a typical notch around 600 nm corresponds to λ dip Meanwhile, Fig. 5g shows the CD spectrum of the nematic film of the present invention combined with a single tDNA that is not combined with metal nanoparticles.

[0188] Figure 5h shows the λ according to the concentration of tDNA-AuNP in LH PNF. dip It shows the linear correlation of wavelength changes.

[0189] Specifically, referring to Fig. 5f, additional asymmetric light-matter interaction (I) by tDNA bound to metal nanoparticles (Au NPs-tDNA) asy ') to confirm that the chiral optical properties of the plasmonic nematic film were controlled, more specifically, at 607 nm (λ dip ) and 702 nm (λ peak) A unique change in CD spectrum can be observed due to blue shift in wavelength.

[0190] This is consistent with the concept expressed by Equation 5 above, and is a result that particularly emphasizes the asymmetric influence around the wavelengths of 600 nm and 700 nm, which may be related to the additional asymmetric light-matter interaction resulting from the reformation of the plasmonic nematic film and the selective binding of pDNA-AuNP.

[0191] On the other hand, referring to Fig. 5g, it can be confirmed that the complementary binding of pDNA and tDNA in the absence of metal nanoparticles (AuNP) does not show wavelength shift.

[0192] That is, the above results imply that the signal of double-stranded DNA can be amplified when it exists in a hotspot between magnetoplasmonic nanoparticles (MagPlas NPs) and metal nanoparticles (AuNPs).

[0193] This interaction results in a linear deep wavelength shift (λ) that depends on the concentration of tDNA. dip ) and it was confirmed that tDNA 1 detection was characterized by a wavelength shift in the range of 600 nm (n=5 for LH and RH, respectively). The linearity curve was obtained at a concentration of tDNA 1 (10 -4 , 10 -3 , 10 -2 , 10 -1 , 100 pmol) was confirmed to have a correlation coefficient R2 ~ 0.9922 in the LH structure (Fig. 5h). Fig. 5i shows the λ dip It corresponds to a bar graph that relatively compares the wavelength shifts of . Referring to Fig. 5i, in the case of the binding of the plasmonic nematic film and tDNA1, λ of 13 nm is observed in both the LH and RH structures. dip It can be confirmed that the movement is shown. Compared to tDNA 2 to 4, Δλ dipIt was confirmed to be 5 to 8 nm depending on the sequence matching ratio, and most of them are λ of tDNA 1. dip It was less than the moving value.

[0194] More specifically, when compared to tDNA 3 and tDNA 4, which have sequence identity rates of 80% and 45%, respectively, tDNA 2, which has a sequence identity rate of 95%, shows a larger wavelength shift, and tDNA4, which has the lowest sequence identity rate, shows the lowest wavelength shift, showing a value very similar to that of AuNPs in which tDNA does not exist.

[0195] In summary, it can be confirmed that the additional asymmetric interaction (I'asy) between pDNA and tDNA in the hotspot between the magnetic plasmonic nanoparticles (MagPlas NPs) and metal nanoparticles (AuNPs) of the plasmonic nematic film system is different depending on the DNA sequence matching ratio between the pDNA and four different tDNAs. This means that the plasmonic nematic film of the present example can sensitively distinguish each different tDNA.

[0196] Furthermore, these results indicate that the parameter Φ (mutation percentage) in Equation 5 above corresponds to the mismatch ratio of double-stranded DNA. As Φ increases, Ω _AuNP_mut represents a proportional decrease.

[0197] Spectral analysis of magnetic circular dichroism (MCD) of plasmonic nematic films

[0198] Additional asymmetric light-matter interaction (I asy +I' asy ) was also confirmed through analysis of magnetic circular dichroism (MCD).

[0199] Specifically, Fig. 6a illustrates the origin of optical activity in a plasmonic nematic film due to the asymmetric light-matter interaction between circularly polarized light (CPL) and an external magnetic field of the MCD.

[0200] Meanwhile, Fig. 6b shows 300 μg ml on an optical glass substrate under conditions of no magnetic field. -1 As a result of comparing the magneto-optical activity of a film (non-PNF) on which μg / ml of magnetic plasmonic nanoparticles (MagPlas NPs) are deposited, (ii) in the drawing represents a non-PNF structure in which magnetic plasmonic nanoparticles bound to detection DNA (pDNA) are arranged, and (iv) represents a state in which the detection DNA (pDNA) included in the film is complementarily bound to AuNPs-tDNA.

[0201] Referring to the above Fig. 6b, it can be confirmed that, regardless of the direction of the external magnetic field (B), most of the spectrum exhibits a symmetrical spectrum in the range of 300 to 800 nm. In addition, it can be confirmed that non-PNF complementarily bound to AuNPs-tDNA also exhibits a symmetrical spectrum in the same wavelength range.

[0202] This is because non-PNFs, which are neither symmetric nor asymmetric structures, cannot induce magneto-optical activity as the magnetic plasmonic nanoparticles are irregularly deposited without any specific directionality, which is related to symmetry breaking or additional asymmetric light-matter interactions.

[0203] That is, it can be inferred that the PNF manufactured under magnetic field conditions according to the embodiment of the present invention can exhibit an asymmetric structure and can exhibit the desired DNA detection effect through symmetry breaking or additional asymmetric light-matter interaction.

[0204] Specifically, FIGS. 6c and 6d are the measurement results for the MCD spectrum according to the external magnetic field direction of the plasmonic nematic film of the present invention having LH and RH structures, respectively, at 300 μg ml -1 For plasmonic nematic films (PNFs) composed of magnetic plasmonic nanoparticles (MagPlas NPs), asymmetric interactions (I) in the range of 600 to 800 nm are observed due to the asymmetric electronic transition effect depending on the magnetic field position. asy ) was confirmed to represent.

[0205] Additionally, it can be seen that the sharp peak at 461 nm, which indicates symmetry regardless of the chiral structure, is due to the symmetric Faraday effect.

[0206] FIGS. 6e and 6f show MCD spectra before / after the plasmonic nematic film (PNF) of one embodiment of the present invention is complementarily bound to 10 pmol of AuNPs-tDNA complex, and FIGS. 6g and 6h show MCD spectra before / after the PNF is complementarily bound to fetal clinical DNA.

[0207] According to the above Figures 6e and 6f, when the pDNA included in the PNF of the present invention is complementarily bound to AuNPs-tDNA (iv), it can be confirmed that an asymmetric sharp peak appears at 727 nm, and the intensity of the peak is confirmed to have increased by about 3 times compared to before complementary binding.

[0208] Similarly, according to the above drawings 6g and 6h, it can be confirmed that additional asymmetric interactions are observed in PNFs containing fetal clinical DNA.

[0209] In particular, after binding to tDNA, both PNFs of LH and RH structures were confirmed to exhibit a stronger asymmetric interaction peak at 720 nm compared to before binding.

[0210] Confirmation of the DNA electrical signal enhancement effect of a plasmonic chiral system due to the interaction of circular polarization (CPL).

[0211] The chiral properties and chiral plasmon enhancement of the PNF were confirmed using computational simulations utilizing COMSOL Multiphysics. The simulations of the proposed structure were analyzed using the basic 3D electromagnetic wave, frequency-domain (EWFD) simulation method of the COMSOL Wave Optics module.

[0212] First, three magnetic plasmonic nanoparticles (MagPlas NPs) were aligned to form a single nanochain, and then several nanochain layers were positioned at a 20° angle to the PNF to explain the chirality of the PNF in the simulation (Fig. 7a). The chiral signal was not distinct in the first layer, but a clear signal was observed in the second layer stacked at a 20° angle (Fig. 7b). This can be expected because the chiral optical rotational properties of the nanochain layer are derived from the configuration of the skew line. Meanwhile, the chiral strength was confirmed to increase with the number of layers through the simulation, so I asy A correlation between the number of layers and the chiral optical asymmetry signal was established. As the number of layers increases, the chiral optical asymmetry signal also increases, I asy We verified the expression defined for , where Ω is a function of N_layers, which can be expressed as Equation 6 below:

[0213] [Formula 6]

[0214] I asy =∫Ψ PNF *(Ω)Ψ PNF dV

[0215] Additionally, PNF produced right-hand (RH) chirality in the range of θ from 0° to 30° and left-hand (LH) chirality in the range of -30° to 0°, as in the experiment (Fig. 7c).

[0216] In particular, a distinct change in the CD signal was observed in the 550 nm, 650 nm, and 750 nm regions as the angle increased. This result suggests that Ω is a function of θ in Equation 6 defined above. The strongest optical asymmetric interaction can be induced at a PNF angle of 20° when the CPL penetrates the nematically aligned nanoarray. DNA mutations can affect the asymmetric interaction within the PNF in various ways, including structural aspects, length, and electron distribution (Fig. 5j).

[0217] DNA molecules are composed of four types of bases—adenine, thymine, guanine, and cytosine—each with a specific number of electrons. DNA mutations involving changes in these bases can theoretically alter the number of electrons in the affected region. For example, because the bases have different electron counts, substituting guanine for thymine can result in a subtle change in the total number of electrons in a DNA molecule. Deletions in DNA base sequences can also affect the total number of electrons. The primary goal of these simulations is to identify distinct asymmetric signals resulting from DNA mutations within the PNF and establish a direct correlation with the chiral electronic field.

[0218] The simulations aimed to highlight the link between DNA mutations and the emergence of a distinct asymmetric signal, while omitting stoichiometric calculations and intermolecular interactions for simplicity. This link is asy =∫Ψ PNF *(Ω_ PNF ) Ψ PNF It is based on the optical asymmetric interaction, denoted by dV, where Ω_ PNF plays a pivotal role in inducing these unique chiral reactions.

[0219] To investigate the influence of DNA conformation (Φ), I' asy_mut =∫Ψ _PNF *(Ω_AuNP_mut )Ψ _AuNP dV is considered, where dV corresponds to d(C, Φ, λ).

[0220] Normal DNA conditions were set as shown in Figure 7d, and the mutant conditions consisted of shorter lengths than the wild-type. All DNA-related characteristics were entered using features registered in COMSOL. In addition, the experiment assumed an average length per DNA sequence of 0.34 nm.

[0221] To demonstrate a clear correlation between DNA sequence changes and chiral systems, conditions were set such that this length decreased by 1 nm after interaction with LCP (Figure 7e) for conditions i, ii, and iii. This aspect is important because it highlights how the electronic field distribution within a plasmonic chiral system can change significantly based on DNA sequence and wavelength. All simulations confirmed the electronic distribution upon interaction with CPL at wavelengths of 500, 550, and 600 nm for each DNA sequence condition. For example, in condition i, where the DNA located between the PNF and AuNP is assumed to be in its longest unmutated state, a clear change in the electric field distribution was observed when moving from condition i to condition iii, particularly at wavelengths of 500 and 550 nm under LCP illumination. Shorter wavelengths (e.g., 500 nm, 550 nm) are more sensitive to subtle changes in the electronic environment of the nanostructure due to their higher energy and thus may be more affected by local electronic changes due to DNA deformation. In contrast, longer wavelengths (e.g., 600 nm) may interact more with the overall shape and structure of the PNF and thus be less sensitive to minor electronic changes due to DNA mutations.

[0222] This would indicate that the DNA within the PNF responds distinctly to specific wavelengths when interacting with the CPL.

[0223] We further investigated the changes in the electric field distribution when interacting with RCP light under the same conditions (Fig. 8). Similar to the interaction with LCP light, we observed an increase in the interaction strength from condition i to condition iii. This suggests that the interaction with plasmonic nanostructures gradually changes with DNA sequence differences. Since plasmonic nanostructures such as PNF are designed to interact with light in a manner sensitive to the chirality of the structure, chirality can be interpreted as the structure's ability to distinguish the CPL of LH and RH.

[0224] Modifications to DNA, whether through base-pairing mutations or changes in DNA length, can affect the electron distribution within a PNF. This is because the electronic structure of DNA contributes to the overall chiroptical response of the nanostructure.

[0225] In the absence of DNA, the evolution of the plasmonic hotspot was investigated across different wavelengths (500, 550, and 600 nm) under both LCP and RCP conditions (Fig. 9). Note that no significant difference was observed between the two types of CPL interactions in the absence of DNA, implying a crucial role of DNA in influencing the chiroptical properties of PNFs when interacting with CPLs. The presence of electron-rich DNA is a key factor in modulating the chiroptical response of the PNF system during interaction with CPLs, suggesting that DNA not only contributes to the physical structure of PNFs but also plays a crucial role in their optical behavior, particularly in terms of interactions with CPLs.

[0226] This will be crucial for understanding how DNA mutations can generate distinct asymmetric signals in chiral plasmonic systems, and can provide a direct correlation between DNA mutations and the resulting optical effects. This experiment also demonstrates the I' asy_mut =∫Ψ _PNF *(Ω _AuNP_mut )Ψ _AuNP Ω in dV representation _AuNP_mut Establishing a fundamental understanding of how the DNA conformation, represented by Ω, influences the chiral optical properties in driving these unique chiral reactions. _PNF It can be said that it emphasizes the role of .

[0227] Meanwhile, we confirmed the change in spacing between Au NPs and PNFs induced by DNA mutations (Fig. 10). Analysis of the calculated CD spectra revealed a shift in the CD peak wavelength of approximately 600 nm, corresponding to a change in the position of the Au NPs relative to the magnetic plasmonic nanoparticles. Figure 11 illustrates the correlation between the CD peak wavelength and the spatial separation between the PNFs and Au NPs, confirming the interaction between DNA mutations and chiral electronics within the PNFs.

[0228] Based on the above experiments, we clearly demonstrate that DNA mutations play a pivotal role in generating distinct asymmetric signals within a chiral plasmonic system. Furthermore, we confirm the importance of the function f(ψ, λ) in inducing the unique chiral response.

[0229] The above function is I' asy_mut =∫Ψ _PNF *(Ω _AuNP_mut )Ψ _AuNPThis relates to how the conformation of encapsulated DNA in the dV formula affects the chiral optical properties of the system. Experimental data confirm that the unique electron transfer associated with the mutant DNA at the PNF and AuNP interfaces leads to a notable change in the optically asymmetric interactions. This change is fundamental to explaining the observed changes in signal output.

[0230] Importantly, when comparing the electronic dynamics between mutant and normal DNA, there are clear differences in optical asymmetry, as evidenced by the different responses in the CD spectra. This discrepancy in signals can be attributed to the altered electronic behavior of the mutant DNA within the experimental framework. This complex understanding of these optical asymmetric interactions will allow us to identify the specific optical changes observed and reveal the significant impact that the mutant DNA may have on the overall optical response of the system.

[0231] Confirmation of the clinical DNA detection effect of plasmonic nematic films

[0232] Additional asymmetry (I') of the plasmonic nematic film (PNF) of the present invention was investigated using patient serum obtained from Seoul National University Bundang Hospital (Table 2). asy ) was conducted in a clinical trial for hearing loss due to the effect (Fig. 12). Specifically, to evaluate the clinical sample detection capability, four individual samples, each associated with a clinical gene associated with hearing loss, were selected.

[0233] Sample IDMutationGeneZygosityClinical featureSB774-1362DupATAGGSDME [NM_004403.3] c.1193_1196dup:p.Ser399Argfs*2 (het)HomozygoteHearing lossNC62Wild typeWild typeHomozygoteNormal hearingSB195-380DelTTCGSDME [NM_004403.3] c.991-15_991-13delTTC (het)HomozygoteHearing lossSB 965-1613A>GSLC26A4 [NM_000441.2] c.919-2A>G (het), c.2168A>G:p.His723Arg (het)HomozygoteHearing loss

[0234] Specifically, SB774-1362 corresponds to a mutation that occurs when a specific sequence of four ATAGs is duplicated in an exon, and NC62 corresponds to a normal control tDNA that is not associated with hearing loss. Meanwhile, SB195-380 corresponds to a mutation that deletes three base pairs in an intron, and SB965-1613 corresponds to a mutation that occurs when a single A is converted to a G in an exon of the SLC26A4 gene.

[0235] Meanwhile, SB774-1362 and detection DNA (pDNA, 5'-NH2- AGCTGCTGCGCTATCTGGCA -3') that can complementarily bind to signal DNA (signal DNA, 3'-AAAAAA-SH-5') were synthesized and used by Genotech Co. Ltd. in Daejeon. Specifically, each of the above tDNAs can complementarily bind to signal DNA (sDNA) conjugated to metal nanoparticles (AuNPs), thereby exhibiting sensing effects for different clinical samples.

[0236] Specifically, to detect the repeat site of tDNA, pDNA was conjugated to magnetic plasmonic nanoparticles, and signal DNA (sDNA) was conjugated to metal nanoparticles (AuNPs) to serve as a signal probe for direct binding to tDNA.

[0237] According to Figure 12a, additional asymmetric interactions (I') are generated through sandwich binding between pDNA, tDNA, and sDNA bound to metal nanoparticles contained in the plasmonic nematic film containing pDNA. asy ) can be derived, through which the overall asymmetric interaction for the circular dichroism change (ΔCD) in the CD spectrum is I asy +I' asy It can be confirmed that it originated from .

[0238] The CD spectrum of SB965 clinical DNA within the plasmonic nematic film can induce a mismatch between the detection DNA (pDNA) and tDNA, and no significant wavelength shift can be observed in the spectral characteristics between the two (Fig. 12b). However, within the sandwich PNF system, which can induce 100% matching, the CD spectrum of SB774 shows a wavelength shift (λ) as can be seen in Fig. 12c. dip ) could cause.

[0239] It is hypothesized that binding between clinical DNA, detection DNA (pDNA), and signal DNA (sDNA or dDNA) occurs within the plasmonic system through interactions with CPLs at enhanced hotspots generated within the system.

[0240] These interactions facilitate the sensitive detection and analysis of DNA structure and interactions by leveraging the unique properties of magnetic circular dichroism (MCD) within plasmonic nanoparticles (PNFs). As highlighted in the previous discussion, the observed absorption spectral differences between NC62 DNA and SB774 DNA within PNFs highlight the efficacy of MCD in distinguishing DNA samples. The strong magnetic field used in MCD significantly amplifies the CD signal, which is crucial for the accurate detection of DNA within the PNF environment. This amplification process utilizes changes in molecular electronic structure and transition energies, particularly evident in chiral molecules containing transition metal ions. These changes enhance the differences in electronic transitions between NC62 DNA and SB774 DNA, thereby enhancing the CD signal, allowing for more accurate detection and analysis of DNA structure and its interactions within PNFs. In the context of detector DNA (pDNA), signal DNA (dDNA or sDNA), and clinical DNA, the enhanced hotspots generated by CPL interactions within the plasmonic system play a pivotal role. These hotspots are said to facilitate binding of different DNA types by providing platforms for enhanced interactions.

[0241] This hypothesis is consistent with the observed MCD data, where modification of electronic transitions under strong magnetic fields allows for the distinct detection and analysis of DNA samples, which is further confirmed by absorption spectra and MCD signals.

[0242] Specifically, according to FIG. 12c, in the case of the PNF system according to one embodiment of the present invention, the wavelength shift (λ) of the CD spectrum when bound to tDNA dip ) was induced, and it was confirmed that SB774 tDNA, a DNA found in hearing-impaired patients, could be clearly detected even at very low concentrations (1,534 nm / μl).

[0243] Meanwhile, in the PNF system, a prominent optical asymmetric signal was detected in the 600 nm and 700 nm range, which corresponds to the presence of tDNA. The significant signal change confirmed at a specific wavelength was within the Ω set for clinical sample detection using PNF. _AuNP_mut This suggests that the value may play an important role as a mediating factor influencing f(λ).

[0244] In particular, a significant wavelength shift from 623 nm to 607 nm can be observed, which is related to the increased electron transfer and symmetry breaking effect between the plasmonic nematic film (PNF) and Au particles in the complementary bond with SB774. This is observed at five concentrations (1,534 Х 10 -4 The results of quantitative experiments with n=4 for the LH structure (Fig. 12d) and the RH structure at 1,534 pg / μl are shown, and the linear calibration curves for each structure were obtained, and the R2 values ​​were 0.9915 and 0.9918, respectively. The linear relationship between wavelength shift and concentration means that additional electron transfer occurs as the number of clinical tDNA located as a bridge between PNF and AuNP increases. From the electron distribution point of view, the presence of tDNA in PNF interacting with CPL means that f(C) is Ω_ AuNP_mut This suggests that it is an important parameter in the value.

[0245] Meanwhile, Fig. 12e shows the results of a selectivity experiment using four types of clinical DNA samples (1,534 pg / μl). The detection DNA used in this experiment is complementary to SB774-1362, and in particular, SB774 tDNA, which shows perfect complementary binding with the pDNA of PNF, showed a wavelength shift of about 17 nm, whereas the other three types of tDNA showing loops or mismatches showed wavelength shifts of 2 to 5 nm.

[0246] This can be inferred that the loop structure affected the incomplete binding between pDNA and tDNA after the washing step in the manufacturing example.

[0247] As a result, the PNF designed for SB-774-1362 was confirmed to be capable of specifically detecting the presence of SB-774-1362, while distinguishing between samples with four or more mutations. These results suggest that the PNF exhibits high selectivity for SB774-1362 and can accurately distinguish it from other samples with multiple mutations.

[0248] Confirmation of point mutation detection characteristics of plasmonic nematic films

[0249] The ability of plasmonic nematic films to detect point mutations in DNA derived from patients with and without actual hearing loss was demonstrated.

[0250] Of the 12 patients studied, 7 exhibited significant hearing loss due to various genetic mutations. These mutations included deletion, translocation, and transition mutations (Table 3).

[0251] Sample IDMutationGeneZygosityClinical featureSB1058-1732GJB2 [NM_004004.5] c.235delC: p.Leu79Cysfs *3GJB2HomozygoteHearing lossSB1079-1753SLC26A4 [NM_000441.2] c.2168A>G:p.His723ArgSLC26A4HomozygoteHearing loss, EVASSB520-986GJB2 [NM_004004.5] c.109G>A: p.Val37IleGJB2HomozygoteHearing lossSB872-1491MPZL2 [NM_005797.4] c.220C>T: p.Gln74TerMPZL2HomozygoteHearing lossSB13-29POU3F4 [NM_000307.5]: c.623T>A:p.Leu208TerPOU3F4HomozygoteHearing loss, IP type IIISH308-694OTOF [NM_001287489.2] c.3192C>G: p.Tyr1064TerOTOFHomozygoteHearing loss, ANSD

[0252] SB1058-1732, characterized by a cytosine deletion, is associated with autosomal recessive nonsyndromic hearing loss and auditory neuropathy spectrum disorder. Similarly, SB1079-1753, which contains an adenine to guanine substitution in the SLC26A4 gene, has been associated with infantile sensorineural hearing loss and Pendred syndrome in a Korean patient. SB520-986, on the other hand, has been identified as a pathogenic contributor to autosomal recessive nonsyndromic hearing loss in GJB2, exhibiting variable expressivity and incomplete penetrance. SB872-1491, which contains a cytosine to thymine substitution, is strongly associated with autosomal recessive nonsyndromic moderate hearing loss. SB13-29 is characterized by a T>A substitution at amino acid position 208 of POU3F4, which results in premature protein termination and is predicted to result in the synthesis of a truncated protein. This premature truncation can cause functional impairment of proteins involved in the auditory mechanism, potentially leading to the development of hearing loss.

[0253] In the case of SH308-694, a C>G substitution in Homo sapiens otoferrin (OTOF) induces a premature termination codon at tyrosine at amino acid position 1064. The resulting premature protein termination may interfere with the normal function of a protein involved in auditory processing. This defect may play a significant role in the development of hearing-related disorders.

[0254] Sequencing PCR testing was performed to confirm the disease status. To enhance understanding of the optical properties of the mutant DNA, two different sets of 20 probe DNA (pDNA) strands were used. One set was complementary to the mutated DNA sequence, while the other matched the wild-type sequence, facilitating comparative analysis, as shown in Table 4 below.

[0255] Specifically, Table 4 below shows the sequence of synthetic detection DNA (pDNA) for binding to magnetic plasmonic nanoparticles.

[0256] tDNApDNA sequence for mutantpDNA sequence for wild typeSB1058-17325'-NH2-C6-CAG CTG CAGGGC CCA TAG CC-3'5'-NH2-C6-CAG CTG CAG GCC CAT AGC CG-3'SB1079-17535'-NH2-C6-GAC ATC ACG GAC CGT CAA AA -3'5'-NH2-C6-GAC ATC ATG GAC CGT CAA AA-3'SB520-9865'-NH2-C6-CAG CCA CAATGA GGA TCA TA-3'5'-NH2-C6-CAG CCA CAACGA GGA TCA TA-3'SB872-14915'-NH2-C6-TAC AAA CTACTC AGG TCC CC-3'5'-NH2-C6-TAC AAA CTGTTC AGG TCC CC-3'SB13-295'-NH2-C6-GTG AAG CCCTAC TTG ATT CT-3'5'-NH2-C6-GTG AAG CCCAAC TTG ATT CT-3'SH308-6945'-NH2-C6-GGG TGG GCACTA CGC CTC GT-3'5'-NH2-C6-GGG TGG GCAGTA CGC CTC GT-3'

[0257] The distinct difference in observed signal intensity is due to the unique optical asymmetric interaction induced by the altered electron transport of the mutant DNA. This occurs when the mutant DNA is positioned between the PNF and the AuNP, in contrast to the interaction with the wild-type detector DNA (pDNA). As shown in Figure 13a, this significant change in response can be detected even for mutations containing only a single nucleotide sequence. However, as shown in Figure 13b, no significant spectral changes were observed using CD spectroscopy when observing the two types of clinical DNA samples. This suggests that CD spectroscopy may not be sensitive enough to effectively detect or distinguish single-point mutations in DNA.

[0258] Based on the hypothesis that DNA mutations cause chiroptical changes in sandwich PNF, quantitative experiments were performed to verify this hypothesis. The experiments were performed at five different concentrations (1.534 x 10 -1 10 inland 3 The LH (Fig. 13c) and RH structures were compared and analyzed in SB1058-1732 (pg / μl range).

[0259] Linear calibration curves were obtained for each structure, yielding R2 values ​​of 0.9991 and 0.9987, respectively. Meanwhile, the potential of the PNF sandwich system to detect deletion and transition mutations was investigated (Fig. 13d). All statistical analyses were performed using t-tests to assess the significance of the differences observed between mutant and wild-type DNA.

[0260] As a result, p<0.001( *** ) and 0.001≤p<0.01( **) showed a wide range of differences. More specifically, when specific detection DNA (pDNA) strands showing 100% complementarity to various mutant sequences were introduced into PNF together with wild-type DNA and target DNA containing specific mutations, a distinct difference in CD wavelength shift was observed. For example, when complementary detection DNA (pDNA) was introduced to SB1058-1732, the wavelength shift (ΔCD) of wild-type detection DNA (pDNA) was up to 5 nm, whereas a wavelength shift (ΔCD) of up to 15 nm was observed for SB1058-1732. Similarly, when SB1079-1753 was targeted with complementary detection DNA (pDNA), a wavelength shift of up to 13 nm was observed for SB1079-1753 and up to 10 nm for wild-type detection DNA (pDNA). In the case of SB520-986, a maximum movement of 20 nm was observed, while in the case of wild-type detection DNA (pDNA), a movement of 5 nm was observed, confirming a more pronounced effect.

[0261] In contrast, introduction of pDNA fully complementary to SB872-1491 resulted in a substantial shift of 13 nm for SB872-1491, whereas the wild-type detector DNA (pDNA) showed a shift of 5 nm. This pattern was also consistently observed in ongoing experiments with transition mutants such as SB13-29 and SH308-694 (Fig. 13e), where SB13-29 showed a 10 nm shift compared to a 6 nm shift for the wild-type detector DNA (pDNA), and SH308-694 showed a 10 nm shift compared to a 5 nm shift for the wild-type detector DNA (pDNA). These experimental results demonstrate the superior effectiveness of plasmonic nematic films (PNFs) in detecting various types of point mutations, including deletions, transitions, and transition mutations, in clinical samples.

[0262] In this invention, we have demonstrated that plasmonic nematic films (PNFs), which utilize the power of plasmonic chiral interactions, can offer the potential to improve genetic diagnostic accuracy. In this invention, we have demonstrated that DNA mutations induce unique asymmetric signals, which are characterized by a Ω _AuNP_mut = Ω _AuNP_normal + f(C,ψ,λ) is a phenomenon due to the precise electronic dynamics at the interface between DNA and PNF. This interaction significantly changes the CD spectrum and the optical behavior of the system, indicating that DNA structure and mutations play an important role in the chiroptical response. Interestingly, ΔCD changed depending on the complementary binding ratio (100%, 95%, 80%, and 40%) between the detector DNA (pDNA) and four synthetic tDNAs after adding the asymmetric light-matter interaction of PNF. As a result, the simulation demonstrated that DNA mutations have a critical effect on the generation of distinct asymmetric signals in the chiral plasmonic system by changing the electronic dynamics at the DNA-plasmon interface, which significantly affects the optical asymmetry and chiral response of the system. In addition, the performance of PNF was evaluated using patient samples containing deletions, transversions, and transitions, especially the 1ntt mutation. As a result, the R-squared values ​​for all samples (λ according to concentration) dip The linear correlation of wavelength shift was found to be greater than 0.9922, and this result was 10 -18 By generating a unique chiral signal detectable at low concentrations of mol, it may provide a promising avenue for chiral detection of DNA point mutations, which could lead to significant advances in the precise monitoring and diagnosis of genetic diseases such as HNSHI.

[0263] Although the preferred embodiments of the present invention have been described in detail above, the scope of the present invention is not limited thereto, and various modifications and improvements made by those skilled in the art using the basic concept of the present invention defined in the following claims also fall within the scope of the present invention.

[0264] [Explanation of symbols]

[0265] 10: Plasmonic nematic film

[0266] 20: Nanoparticle layer

[0267] 11: 1st floor

[0268] 12: Second floor

[0269] 21: Nanoparticle array

[0270] 22: Separation layer

[0271] 23: Target DNA (tDNA)

[0272] 24: Detection DNA (pDNA or cDNA)

[0273] 25: Metal nanoparticles

[0274] 26: Signal DNA (sDNA or dDNA)

[0275] 40: Supporters

[0276] The present invention relates to a plasmonic nematic film for detecting hereditary hearing loss and a biosensor including the same.

Claims

1. A plasmonic nematic film for detecting hereditary hearing loss comprising at least two layers of nanoparticles and probe DNA, The above nanoparticle layer includes a plurality of nanoparticle arrays spaced apart from each other and having a unidirectional alignment structure, The above at least two layers of nanoparticle layers include a first layer including a plurality of nanoparticle arrays aligned in a first direction; and a second layer adjacent to the first layer including a plurality of nanoparticle arrays aligned in a second direction different from the first direction. The above detection DNA is bound to the nanoparticle array, The above nematic film exhibits chirality. Plasmonic nematic film for detection of hereditary hearing loss.

2. In paragraph 1, The angle (θ) formed by the first direction and the second direction is in the range of 0° to 90°. Plasmonic nematic film for detection of hereditary hearing loss.

3. In paragraph 1, The above plasmonic nematic film detects hereditary hearing loss through complementary binding between the probe DNA and the target DNA. Plasmonic nematic film for detection of hereditary hearing loss.

4. In paragraph 3, The above target DNA is bound to metal nanoparticles. Plasmonic nematic film for detection of hereditary hearing loss.

5. In paragraph 3, The above target DNA complementarily binds to the signal DNA bound to the metal nanoparticle. Plasmonic nematic film for detection of hereditary hearing loss.

6. In paragraph 1, Further comprising a spacing layer formed between the first layer and the second layer. Plasmonic nematic film for detection of hereditary hearing loss.

7. In paragraph 1, The above nematic film further includes a support layer formed on one side, The support layer comprises a material selected from the group consisting of glass, indium tin oxide (ITO), fluorine-doped tin oxide (FTO), poly(methyl methacrylate), polycarbonate, poly(dimethylsiloxane), and combinations thereof. Plasmonic nematic film for detection of hereditary hearing loss.

8. In paragraph 1, The above nanoparticle array comprises a plurality of magnetic plasmonic nanoparticles. Plasmonic nematic film for detection of hereditary hearing loss.

9. In paragraph 8, The above nanoparticle comprises a core; and A shell comprising a core and a heterogeneous component and surrounding at least a portion of the surface of the core. Plasmonic nematic film for detection of hereditary hearing loss.

10. In paragraph 9, One of the above cores and shells contains a magnetic component, and the other contains a metal component. Plasmonic nematic film for detection of hereditary hearing loss.

11. A plasmonic nematic film comprising a plasmonic nematic film according to any one of claims 1 to 10. Biosensor for detection of hereditary hearing loss.

Images