Use of compound in treatment of liver diseases

Abstract

Use of a compound in the treatment of liver diseases. Experimental results show that the compound has a relatively high liver-tissue-targeting property, very low toxicity to liver primary cells and high liver safety, has significant efficacy on liver diseases such as viral hepatitis (e.g., hepatitis B) and liver cancers (including primary liver cancers and metastatic liver cancers), and has relatively good physicochemical properties, metabolic stability, bioavailability and safety, thus having very good drug development prospects.

Description

Application of a compound in treating liver disease Technical Field

[0001] The present invention relates to the technical field of chemical medicine, and in particular to application of a compound in treating liver disease. Background Art

[0002] The liver is an organ primarily responsible for metabolism, performing functions such as deoxidation, glycogen storage, and secretory protein synthesis. It also produces bile, a key component of the digestive system. The liver is the largest organ in the human body, located in the abdomen, below the right diaphragm, in front of the gallbladder, in front of the right kidney, and above the stomach. The liver is the largest digestive gland in the human digestive system, weighing an average of 1.5 kilograms in an adult. It is a reddish-brown, V-shaped organ. The liver is the primary organ for urea synthesis and a vital organ for metabolism.

[0003] Liver disease is a disease with high morbidity and mortality. Liver disease can be divided into viral and non-viral. Hepatitis virus is the main pathogen that causes liver disease. Currently discovered hepatitis viruses include hepatitis A, hepatitis B, hepatitis C, hepatitis D and hepatitis E. Non-viral liver disease is liver damage caused by drugs, narcotics, alcohol, etc. The development process of liver disease generally includes stages such as acute hepatitis, chronic hepatitis, liver fibrosis, cirrhosis (ascites), and liver cancer. In addition, the anatomical characteristics of the liver are dual blood supply from the hepatic artery and portal vein, so malignant tumors are prone to liver metastasis. The primary lesions of liver metastatic cancer can come from multiple organs throughout the body, mainly from digestive tract tumors, accounting for about 35%-50% of liver metastatic cancer.

[0004] Currently, there are few approved treatments for advanced hepatocellular carcinoma, primarily the kinase inhibitor sorafenib and the immune checkpoint blocker PD-1 / PD-L1 monoclonal antibody. Sorafenib is a first-line treatment for liver cancer, but its clinical efficacy has been reported to be limited and it is prone to adverse reactions. According to the results of the Phase III sorafenib clinical trial (SHARP trial), the median survival of patients with advanced unresectable HCC (N=602) was 10.7 months with sorafenib, compared to 7.9 months with placebo, a modest survival improvement. The progression-free survival (PFS) was 167 days with sorafenib, compared to 84 days with placebo. According to the Phase III CheckMate 459 clinical trial, a comparison of nivolumab and sorafenib for the first-line treatment of advanced hepatocellular carcinoma (aHCC), the dosing regimen was nivolumab 240 mg (intravenous drip every 2 weeks) and sorafenib 400 mg (oral, twice daily). Results were announced at the 2019 European Society for Medical Oncology (ESMO) Annual Meeting: The mean overall survival (MSS) for the nivolumab group (371 patients) and the sorafenib group (372 patients), respectively, was 16.4 and 14.7 months (HR = 0.85, 95% CI: 0.72-1.02, P = 0.075 2), which did not reach the predetermined threshold for statistical significance. The ORRs for the two groups were 15% and 7%, respectively. This Phase III clinical trial did not meet the expected primary endpoint (OS), but nivolumab did show improved efficacy compared to sorafenib. Currently, several immune checkpoint blockade antibodies have been approved for the treatment of liver cancer. However, to prolong the survival and biochemical quality of patients with liver cancer, there is an urgent need to develop new targeted immunotherapies for the prevention and treatment of liver disease.

[0005] Summary of the Invention

[0006] To overcome the deficiencies of the prior art, the present invention provides a small molecule compound with immunomodulatory function for use in preventing and / or treating liver disease.

[0007] In a first aspect of the present invention, there is provided a use of a compound or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing and / or treating liver disease, wherein the compound has the following structure:

[0008] Specifically, the liver disease is a disease occurring in the liver, such as infectious diseases, tumor diseases, vascular diseases, metabolic diseases, toxic diseases, autoimmune diseases, hereditary diseases, intrahepatic bile duct stones, etc.

[0009] In one embodiment of the present invention, the liver disease is hepatitis, such as viral hepatitis, alcoholic hepatitis, fatty liver hepatitis, drug-induced hepatitis, autoimmune hepatitis, etc., in particular viral hepatitis.

[0010] Specifically, viral hepatitis includes: hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, hepatitis G, especially hepatitis B.

[0011] In one embodiment of the present invention, the liver disease is a liver tumor, such as hepatic hemangioma, hepatic adenoma, hepatic lipoma, non-parasitic liver cyst, focal nodular hyperplasia of the liver, liver cancer, bile duct cancer, hepatoblastoma, liver sarcoma, etc., especially liver cancer.

[0012] Specifically, the liver cancer is primary liver cancer or metastatic liver cancer.

[0013] Specifically, the primary tumor of metastatic liver cancer can be colorectal cancer, colon cancer, gastric cancer, pancreatic cancer, stomach, intestinal leiomyosarcoma, lung cancer, breast cancer, kidney cancer, cervical cancer, ovarian cancer, prostate cancer and head and neck tumor; in one embodiment of the present invention, the metastatic liver cancer is colon cancer metastatic liver cancer.

[0014] In one embodiment of the present invention, the liver disease is liver damage, such as liver fibrosis and liver cirrhosis.

[0015] In one embodiment of the present invention, the liver disease is fatty liver.

[0016] In one embodiment of the present invention, the liver disease is hepatolithiasis.

[0017] Specifically, in the application, the compound or a pharmaceutically acceptable salt thereof can be used alone or in combination with other types of active ingredients (second active ingredients) (the compound or a pharmaceutically acceptable salt thereof and the second active ingredient can be in the same dosage form or in different dosage forms, and the two can be administered simultaneously, separately or sequentially).

[0018] Specifically, for the embodiment in which the liver disease is a liver tumor, the second active ingredient can be one or more of a radiotherapy agent, a chemotherapeutic agent, an immunotherapy agent, an anti-angiogenic agent, a cytokine, a hormone, a polynucleotide, an antibody, an immunologically active fragment, an immune checkpoint blocker, a cell therapy drug, a small nucleic acid drug, an mRNA vaccine, a tumor vaccine, etc.

[0019] Specifically, the immune checkpoints can be, for example, PD-1, PD-L1, CTLA-4, BTLA, TIM-3, LAG-3, TIGIT, LAIR1, 2B4, CD160, etc., especially PD-1 and PD-L1.

[0020] Specifically, the immune checkpoint inhibitor can be an antibody, a small molecule compound or a combination thereof.

[0021] In one embodiment of the present invention, the second active ingredient is a PD-1 antibody, such as pembrolizumab, nivolumab, cemiplimab, Nofazinlimab (CS1003), Tislelizumab, toripalimab, Sintilimab, Camrelizumab, Penpulimab, Zimberelimab, and serplulimab.

[0022] In one embodiment of the present invention, the second active ingredient is a PD-L1 antibody, such as atezolizumab, duvalumab, durvaluamb, sugemalimab, and envafolimab.

[0023] Other PD-1 / PD-L1 monoclonal antibodies under development include Penpulimab (Kangfang Biopharma), HLX-10 (Fuhong Hanlin), Cemiplimab (Sanofi), SCT-I10A (Sinocell), AMG404 (Amgen), TY101 (Dayou Biopharma), Sasanlimab (Pfizer), Genolizumab (Jinhe Biopharma), LZM009 (Livzon), HX008 (Lepu Medical), LVHN6051 (Lijin Biopharma), F520 (Lunan Pharmaceutical), Spartalizumab (Novartis), QL1604 (Qilu Pharmaceutical), 609A (Sunshine Guojian), SG001 (Shangjian Biopharma), STW204mAb (Sitanwei), Zimberelimab (WuXi Biologics), and Retifanlimab (Zai Lab), etc.

[0024] In one embodiment of the present invention, the second active ingredient is a CTLA-4 antibody, such as Tremelimumab and ipilimumab.

[0025] Specifically, the chemotherapeutic agents include, but are not limited to, chlorambucil, melphalan, cyclophosphamide, ifosfamide, busulfan, carmustine, lomustine, streptozotocin, cisplatin, carboplatin, oxaliplatin, dacarbazine, temozolomide, procarbazine, methotrexate, fluorouracil, cytarabine, gemcitabine, capecitabine, mercaptopurine, fludarabine, vinblastine, vincristine, vinorelbine, paclitaxel, docetaxel, topotecan, irinotecan, etoposide, trabectedin, dactinomycin, doxorubicin, epirubicin, daunorubicin, mitoxantrone, bleomycin ... afatinib, alisertib, amuvatinib, apatinib, axitinib, bortezomib, bosutinib, brivanib, cabozantinib, cediranib, crenolanib, crizotinib, dabrafenib, dacomitinib ib, danusertib, dasatinib, dovitinib, erlotinib, foretinib, ganetespib, gefitinib, ibrutinib, icotinib, imatinib, iniparib, lapatinib, lenvatinib, linifanib, linsitinib, masitinib, momelotinib, motesanib, neratinib, nilotinib, niraparib, oprozomib, olaparib, pazopanib, pictilisib, ponatinib, quizartinib, regorafenib, rigosertib, rucaparib, ruxolitinib, saracatinib, saridegib, sorafenib, sunitinib, tasocitinib, telatinib, tivantinib, tivozanib, tofacitinib, trametinib, vandetanib, veliparib, or a combination thereof.

[0026] In one embodiment of the invention, the chemotherapeutic agent is a multi-target receptor tyrosine kinase (RTK) inhibitor, such as imatinib, sorafenib, sunitinib, dasatinib, lapatinib, pezotinib, crizotinib, vandetinib, regorafenib, cabozantinib, axitinib, ponatinib, radotinib, afatinib, nintedanib, lenvatinib, neratinib, lenvatinib, in particular sorafenib and lenvatinib.

[0027] More specifically, the chemotherapy agent is selected from the group consisting of fluorouracil, doxorubicin, cisplatin, mitomycin, gemcitabine, capecitabine, irinotecan, sorafenib, sunitinib, erlotinib, lenvatinib, in particular sorafenib and lenvatinib.

[0028] Specifically, the antibodies include, but are not limited to: PRO542, an anti-HIV gp120 antibody fused to CD4 (Progenics / Genzyme Transgenics); MDX-010 (Medarex, New Jersey), a humanized anti-CTLA-4 antibody; SYNAGIS (MedImmune, Maryland), a humanized anti-respiratory syncytial virus (RSV) monoclonal antibody; HERCEPTIN (trastuzumab) (Genentech, California), a humanized anti-HER2 monoclonal antibody; Humanized anti-CD18 F(ab')2 (Genentech); CDP860, which is a humanized anti-CD18 F(ab')2 (Celltech, UK); Ostavir, which is a human anti-hepatitis B virus antibody (Protein Design Lab / Novartis); PROTOVIRTM, which is a humanized anti-CMV IgG1 antibody (Protein Design Lab / Novartis); MAK-195 (SEGARD), which is a murine anti-TNF-α F(ab')2 (Knoll Pharmaceuticals / BASF); llPharma / BASF); IC14, which is an anti-CD14 antibody (ICOS Pharmaceuticals); humanized anti-VEGF IgG1 antibody (Genentech); OVAREX™, which is a murine anti-CA125 antibody (Altarex); PANOREX™, which is a murine anti-17-IA cell surface antigen IgG2a antibody (GlaxoWellcome / Centocor); BEC2, which is a murine anti-idiotypic (GD3 epitope) IgG antibody (ImCloneSystems); IMC-C2 25, a chimeric anti-EGFR IgG antibody (ImmunoClone Systems); VITAXIN™, a humanized anti-αVβ3 integrin antibody (Applied Molecular Evolution / MedImmune); Campath 1H / LDP-03, a humanized anti-CD52 IgG1 antibody (Leukosite); SmartM195, a humanized anti-CD33 IgG antibody (Protein Design Lab / Kanebo);RITUXAN™ (rituximab™), a chimeric anti-CD20 IgG1 antibody (IDEC Pharmaceuticals / Genentech, Roche / Zettyaku); LYMPHOCIDE™, a humanized anti-CD22 IgG antibody (Immunomedics); SmartID10, a humanized anti-HLA antibody (Protein Design Laboratories); ONCOLYM™ (Lym-1), a radiolabeled murine anti-HLADR antibody (Techniclone); ABX-IL8, a human anti-IL8 antibody (Abgenix). x)); anti-CD11a, a humanized IgG1 antibody (Genentech / Xoma); ICM3, a humanized anti-ICAM3 antibody (ICOS Pharmaceuticals); IDEC-114, a primatized anti-CD80 antibody (IDEC Pharmaceuticals / Mitsubishi); ZEVALIN™, a radiolabeled murine anti-CD20 antibody (IDEC / Schering AG); IDEC-131, a humanized anti-CD40L antibody (IDEC / Eisai); IDEC-151, a primatized anti-CD4 antibody (IDEC); IDEC-152, a primatized anti-CD6 antibody (IDEC); The following are the humanized anti-CD23 antibodies (IDEC / SKK Corporation (Seikagaku)); SMART anti-CD3, a humanized anti-CD3 IgG (Protein Design Laboratories); 5G1.1, a humanized anti-complement factor 5 (C5) antibody (Alexion Pharm); D2E7, a humanized anti-TNF-α antibody (CAT / BASF); CDP870, a humanized anti-TNF-α Fab fragment (Celtec); IDEC-151, a primatized anti-CD4 IgG1 antibody (IDEC Pharmaceuticals / SmithKline Beecham); MDX-CD4, a humanized anti- CD4 IgG antibody (Medarex / Eisai / Genmab); CDP571, a humanized anti-TNF-α IgG4 antibody (Celtech); LDP-02, a humanized anti-α4β7 antibody (Luxeter / Genentech); OrthoCloneOKT4A, a humanized anti-CD4 IgG antibody (OrthoBiotech); ANTOVA™, a humanized anti-CD40L IgG antibody (Biogen); ANTEGREN™, a humanized anti-VLA-4 IgG antibody (Elan);MDX-33 is a human anti-CD64 (FcγR) antibody (Medex / Centeon); SCH55700 is a humanized anti-IL-5 IgG4 antibody (Celtec / Schering); SB-240563 and SB-240683 are humanized anti-IL-5 and anti-IL-4 antibodies, respectively (SmithKline Beecham); rhuMab-E25 is a humanized anti-IgE IgG1 antibody (Genentech / Norvartis / Tanox Biosystems); ABX-CBL is a murine anti-CD-147 IgM antibody (Abgenix); BTI-322 is a rat anti-CD2 IgG antibody (Medical Immunology / BioTransplant); Odoclone / OKT3 (Ortho clone / OKT3), a murine anti-CD3 IgG2a antibody (OrthoBiotech); SIMULECT™, a chimeric anti-CD25 IgG1 antibody (Novartis); LDP-01, a humanized anti-β2-integrin IgG antibody (Luxeter); anti-LFA-1, a murine anti-CD18 F(ab′)2 (Pasteur-Merieux / Immunotech); CAT-152, a human anti-TGF-β2 antibody (Cambridge AbTech); CorsevinM, a chimeric anti-Factor VII antibody (Santa Clara); MDX-1106, a PD-1 antibody (Bristol-Myers Squibb); and MDX-1105, a PD-L1 antibody (Roche).

[0029] Specifically, the drug further contains one or more pharmaceutically acceptable excipients, such as one or more of a disintegrant, a binder, a lubricant, a suspending agent, a stabilizer, a filler, an absorption promoter, a surfactant, a flavoring agent, an antioxidant, a preservative, an isotonic sterile saline solution (sodium dihydrogen phosphate, sodium hydrogen phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, etc., or a mixture of the above salts), etc.

[0030] In one embodiment of the present invention, the medicament further comprises one or more pharmaceutically acceptable oral dosage form excipients.

[0031] Specifically, the drug can be administered by any suitable route, such as enteral administration or parenteral administration (eg, intravenous, intramuscular, subcutaneous, intraorgan, intranasal, intradermal, instillation, intracerebral, rectal, etc.).

[0032] Specifically, the drug can be in any suitable dosage form, such as a gastrointestinal dosage form, such as, but not limited to, tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, suspensions, etc.; parenteral dosage forms, such as injectable dosage forms: such as injections (for example, for subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection), respiratory tract dosage forms: such as sprays, aerosols, powder mists, etc., skin dosage forms, such as external solutions, lotions, ointments, plasters, pastes, patches, etc., mucosal dosage forms: such as eye drops, eye ointments, nasal drops, gargles, sublingual tablets, etc., cavity dosage forms: such as suppositories, aerosols, effervescent tablets, drops, pills, etc., for rectum, vagina, urethra, nasal cavity, ear canal, etc.

[0033] In one embodiment of the present invention, the medicament is in oral dosage form.

[0034] In one embodiment of the present invention, the medicament further comprises a second active ingredient, wherein the compound is contained in an oral dosage form and the second active ingredient is contained in an injectable dosage form.

[0035] In a second aspect of the present invention, a pharmaceutical composition is provided, comprising a compound or a pharmaceutically acceptable salt thereof and a second active ingredient (as described in the first aspect of the present invention), and, optionally, one or more pharmaceutically acceptable excipients, wherein the compound has the following structure:

[0036] In one embodiment of the present invention, the second active ingredient is an immune checkpoint inhibitor, such as a PD-1 antibody, for example, pembrolizumab, nivolumab, cemiplimab, Nofazinlimab (CS1003), Tislelizumab, toripalimab, Sintilimab, Camrelizumab, Penpulimab, Zimberelimab, serplulimab; a PD-L1 antibody, for example, atezolizumab, duvalumab, duvaluamb, sugemalimab, Envaf CTLA-4 antibodies, such as tremelimumab and ipilimumab; other PD-1 / PD-L1 monoclonal antibodies under development, such as penpulimab (Kongfang Biopharma), HLX-10 (Henlius Biopharma), cemiplimab (Sanofi), SCT-I10A (Sinocell), AMG404 (Amgen), TY101 (Dayou Biopharma), and sasanlimab (Pfizer) , Genolizumab (Jiahe Biopharma), LZM009 (Livzon), HX008 (Lepu Medical), LVHN6051 (Lijin Biopharma), F520 (Lunan Pharmaceutical), Spartalizumab (Novartis), QL1604 (Qilu Pharmaceutical), 609A (Sunshine Guojian), SG001 (Shangjian Biopharma), STW204mAb (Sitanwei), Zimberelimab (WuXi Biologics), Retifanlimab (Zai Lab), etc.

[0037] In one embodiment of the present invention, the pharmaceutical composition comprises the compound (especially Compound II) or a pharmaceutically acceptable salt thereof and a PD-1 antibody, and, optionally, one or more pharmaceutically acceptable excipients; specifically, the pharmaceutical composition comprises an oral dosage form and an injectable dosage form.

[0038] In one embodiment of the present invention, the pharmaceutical composition comprises Compound I or a pharmaceutically acceptable salt thereof and Nofazinlimab (CS1003) and, optionally, one or more pharmaceutically acceptable excipients; specifically, the pharmaceutical composition comprises an oral dosage form and an injectable dosage form.

[0039] In one embodiment of the present invention, the pharmaceutical composition comprises Compound II or a pharmaceutically acceptable salt thereof and Nofazinlimab (CS1003) and, optionally, one or more pharmaceutically acceptable excipients; specifically, the pharmaceutical composition comprises an oral dosage form and an injectable dosage form.

[0040] In one embodiment of the invention, the second active ingredient is a chemotherapeutic agent, as described in the first aspect of the invention, such as fluorouracil, doxorubicin, cisplatin, mitomycin, gemcitabine, capecitabine, irinotecan, sorafenib, sunitinib, lenvatinib, erlotinib, in particular sorafenib and lenvatinib.

[0041] In one embodiment of the present invention, the pharmaceutical composition comprises the compound (especially Compound II) or a pharmaceutically acceptable salt thereof and sorafenib, and, optionally, one or more pharmaceutically acceptable excipients; specifically, the pharmaceutical composition is an oral dosage form.

[0042] In a third aspect of the present invention, there is provided a use of a combination of a compound or a pharmaceutically acceptable salt thereof and a second active ingredient in the preparation of a medicament for preventing and / or treating liver disease.

[0043] Specifically, the compound and the second active ingredient are as described in the first aspect of the present invention.

[0044] Specifically, the liver disease is as described in the first aspect of the present invention. In one embodiment of the present invention, the liver disease is a liver tumor, such as hepatic hemangioma, hepatic adenoma, hepatic lipoma, non-parasitic liver cyst, focal nodular hyperplasia of the liver, liver cancer, bile duct cancer, hepatoblastoma, liver sarcoma, etc., in particular liver cancer, which can be primary liver cancer or metastatic liver cancer. Specifically, the primary tumor of metastatic liver cancer can be colorectal cancer, colon cancer, gastric cancer, pancreatic cancer, stomach, intestinal leiomyosarcoma, lung cancer, breast cancer, kidney cancer, cervical cancer, ovarian cancer, prostate cancer and head and neck tumors; in one embodiment of the present invention, the metastatic liver cancer is colon cancer metastatic liver cancer.

[0045] In one embodiment of the present invention, the combination is a combination of the compound (particularly Compound II) or a pharmaceutically acceptable salt thereof and a PD-1 antibody.

[0046] In one embodiment of the present invention, the combination is a combination of Compound I or a pharmaceutically acceptable salt thereof and Nofazinlimab (CS1003).

[0047] In one embodiment of the present invention, the combination is a combination of Compound II or a pharmaceutically acceptable salt thereof and Nofazinlimab (CS1003).

[0048] In one embodiment of the invention, the second active ingredient is a chemotherapeutic agent, as described in the first aspect of the invention, such as fluorouracil, doxorubicin, cisplatin, mitomycin, gemcitabine, capecitabine, irinotecan, sorafenib, sunitinib, lenvatinib, erlotinib, in particular sorafenib and lenvatinib.

[0049] In one embodiment of the present invention, the combination is a combination of the compound (particularly Compound II) or a pharmaceutically acceptable salt thereof and sorafenib.

[0050] In a fourth aspect of the present invention, there is provided a method for preventing and / or treating liver disease, comprising administering to a subject in need thereof (a therapeutically effective amount) a compound or a pharmaceutically acceptable salt thereof, wherein the compound has the following structure:

[0051] Specifically, the liver disease has the definition described in the first aspect of the present invention.

[0052] Specifically, the subject is a mammal, especially a human.

[0053] In one embodiment of the present invention, the method is a method for preventing and / or treating liver cancer, which comprises the step of administering (a therapeutically effective amount of) a compound or a pharmaceutically acceptable salt thereof to a subject in need thereof, and optionally, it may also include other types of pharmaceutical preparations and / or treatment methods.

[0054] Specifically, the compound or its pharmaceutically acceptable salt is administered by enteral or parenteral administration (e.g., intravenous, intramuscular, subcutaneous, intraorgan, intranasal, intradermal, instillation, intracerebral, intrarectal, etc.); in some embodiments of the present invention, the administration route is oral.

[0055] Specifically, the other types of pharmaceutical preparations may include the second active ingredient as described in the first aspect of the present invention.

[0056] In one embodiment of the present invention, the method further comprises the step of administering an immune checkpoint inhibitor (as described in the first aspect of the present invention); specifically, the method further comprises the step of administering a PD-1 antibody.

[0057] In one embodiment of the present invention, the method further comprises the step of administering a chemotherapeutic agent (as described in the first aspect of the present invention); specifically, the method further comprises administering sorafenib or lenvatinib.

[0058] Specifically, the other types of treatment methods include but are not limited to: hormone therapy, immunotherapy, radiotherapy, surgical treatment, adoptive T cell therapy (such as TCR-T therapy, CAR-T therapy).

[0059] In some embodiments of the present invention, the route of administration of the second active ingredient is injection.

[0060] The present invention provides a compound for use in preventing and / or treating liver diseases. Experimental results show that the compound has high liver tissue targeting, very low toxicity to primary liver cells, high liver safety, and significant therapeutic effects on liver diseases such as viral hepatitis (e.g., hepatitis B) and liver cancer (including primary liver cancer and metastatic liver cancer). Furthermore, the compound has excellent physicochemical properties, metabolic stability, bioavailability, and safety, and has very good prospects for drug development. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] FIG1 shows the drug concentration curves of Compound I, Compound II, and GS-9688 in the liver and plasma of ICR mice after oral administration.

[0062] FIG2 is a schematic diagram showing the plating of compounds for primary liver cell toxicity assays.

[0063] FIG3 shows the results of the primary liver cell toxicity test of the compound.

[0064] Figure 4 shows the ELISA test results for each dose group of Compound I. At each time point, from left to right, the experimental groups are vehicle control (G1), Compound I-3 mpk (G2), Compound I-10 mpk (G3), and Compound I-20 mpk (G4).

[0065] Figure 5 shows the ELISA test results for each dose group of Compound II. For each time point, from left to right, the experimental groups are vehicle control (G1), Compound II-3 mpk (G5), Compound II-10 mpk (G6), and Compound II-20 mpk (G7).

[0066] Figure 6 shows the qPCR results of each dose group of Compound I. At each time point, from left to right, the experimental groups are vehicle control (G1), Compound I-3 mpk (G2), Compound I-10 mpk (G3), and Compound I-20 mpk (G4).

[0067] Figure 7 shows the qPCR results of each dose group of Compound II. For each time point, from left to right, the experimental groups are vehicle control (G1), Compound II-3 mpk (G5), Compound II-10 mpk (G6), and Compound II-20 mpk (G7).

[0068] Figure 8 shows the biochemical test results of each dose group of Compound I. At each time point, from left to right, the experimental groups are vehicle control (G1), Compound I-3 mpk (G2), Compound I-10 mpk (G3), and Compound I-20 mpk (G4).

[0069] Figure 9 shows the biochemical test results of each dose group of Compound II. At each time point, from left to right, the experimental groups are vehicle control (G1), Compound II-3 mpk (G5), Compound II-10 mpk (G6), and Compound II-20 mpk (G7).

[0070] Figure 10 shows the HE staining images of the experimental groups in Example 5. Among them, A and G show the HE staining images of the experimental groups of vehicle control (G1), compound I-3 mpk (G2), compound I-10 mpk (G3), compound I-20 mpk (G4), compound II-3 mpk (G5), compound II-10 mpk (G6), and compound II-20 mpk (G7), respectively.

[0071] FIG11 shows the cytokine secretion of PBMC of donor 1 after stimulation with compound II and GS-9688.

[0072] FIG12 shows the cytokine secretion of PBMCs from donor 2 after stimulation with compound II and GS-9688.

[0073] FIG13 shows the cytokine secretion of PBMC of donor 3 after stimulation with compound II and GS-9688.

[0074] Figure 14 shows the results of the antiviral activity evaluation of PBMC supernatants stimulated with Compound II and GS-9688, interferon α (positive drug), and ETV in PHH. Figure a shows the dosing schedule, and Figures b and c show the experimental results. A and B represent, in order, the results of Compound II (1000 nM), Compound II (333 nM), Compound II (111 nM), Compound II (37 nM), GS-9688 (2500 nM), GS-9688 (833 nM), GS-9688 (278 nM), GS-9688 (92.6 nM), Peg-IFN-α2a (100 IU / ml), ETV (0.5 nM), the PBMC culture supernatant without agonist control, and the culture medium control.

[0075] FIG15 shows the BLI values ​​of mice in each group in the experiment of Example 7 (H22-luc orthotopic model).

[0076] FIG16 shows the imaging images of each group of mice in the experiment of Example 7 (H22-luc orthotopic model).

[0077] FIG17 shows the BLI values ​​of mice in each group in the experiment of Example 8 (Hep3B-luc orthotopic liver tumor model).

[0078] FIG18 shows the imaging images of mice in each group in the experiment of Example 8 (Hep3B-luc orthotopic liver tumor model).

[0079] FIG19 shows the changes in body weight and BLI values ​​of mice in each group in the experiment of Example 9 (MC38-luc liver metastasis model).

[0080] Figure 20 shows the BLI values ​​of individual mice in each group during the dosing period in the experiment (MC38-luc liver metastasis model) in Example 9 (different lines in each figure represent the BLI values ​​of each mouse in the corresponding group). A: Vehicle, QW×3 (n=6); B: Compound II, 3 mpk, QW×3 (n=6); C: PD-1, 10 mpk, BIW×2 (n=6); D: Compound II, 3 mpk, QW×3 + PD-1, 10 mpk, BIW×2 (n=6).

[0081] Figure 21 shows the final tumor and liver weights and tumor volumes of each group of mice in the experiment (MC38-luc liver metastasis model) in Example 9. A: Vehicle, QW × 3 (n = 6); B: Compound II, 3 mpk, QW × 3 (n = 6); C: PD-1, 10 mpk, BIW × 2 (n = 6); D: Compound II, 3 mpk, QW × 3 + PD-1, 10 mpk, BIW × 2 (n = 6).

[0082] FIG22 shows the imaging images of mice in each group in the experiment of Example 9 (MC38-luc liver metastasis model).

[0083] Figure 23 shows the flow cytometry panel and statistical results of lymph node analysis in each group of mice in the experiment (MC38-luc liver metastasis model) of Example 9. A: Vehicle (n=5); B: Compound II, 3 mpk (n=6); C: PD-1, 10 mpk (n=5); D: Compound II, 3 mpk + PD-1, 10 mpk (n=6).

[0084] Figure 24 shows the flow cytometry panel and statistical results of liver and tumors in each group of mice in the experiment (MC38-luc liver metastasis model) in Example 9. A: Vehicle (n=5); B: Compound II, 3 mpk (n=6); C: PD-1, 10 mpk (n=5); D: Compound II, 3 mpk + PD-1, 10 mpk (n=6).

[0085] Figure 25 shows a graph of male animal body weight.

[0086] Figure 26 shows a graph of female animal body weight.

[0087] FIG27 shows a rectal temperature chart of a male animal.

[0088] FIG28 shows a rectal temperature chart of a female animal.

[0089] Figure 29 shows the tissue weights of male animals, wherein 1-9 show the experimental results of experimental groups G1-G9 respectively.

[0090] Figure 30 shows the tissue weights of female animals, wherein 1-9 show the experimental results of experimental groups G1-G9 respectively. DETAILED DESCRIPTION

[0091] Unless otherwise defined, all scientific and technical terms used in the present invention have the same meanings as commonly understood by one of ordinary skill in the art to which the present invention relates.

[0092] In the present invention, "liver disease" and "liver disease" can be used interchangeably. They are a general term for all diseases occurring in the liver, including infectious diseases, tumor diseases, vascular diseases, metabolic diseases, toxic diseases, autoimmune diseases, genetic diseases, intrahepatic bile duct stones, etc.; infectious diseases include viral infections, bacterial infections, parasitic infections, etc., such as viral hepatitis and echinococcosis; tumors are divided into benign tumors and malignant tumors, such as liver cancer, hepatic hemangioma, hepatic lipoma, hepatic sarcoma, etc.

[0093] For the purposes of this invention, the term "hepatitis" is a general term for liver inflammation caused by various factors, including bacteria, viruses, parasites, alcohol, drugs, chemicals, and autoimmune diseases. Based on the cause, hepatitis can be categorized as viral, bacterial, drug-induced, alcoholic, toxic, autoimmune, and non-alcoholic fatty liver disease. Based on the duration of the disease, it can be divided into disease hepatitis and chronic hepatitis. Based on the presence or absence of jaundice, acute hepatitis can be divided into acute icteric hepatitis and acute anicteric hepatitis. Based on the severity of the disease, chronic hepatitis can be divided into mild, moderate, and severe forms.

[0094] The term "viral hepatitis" refers to an infectious disease characterized by liver lesions caused by a variety of hepatitis viruses, mainly including hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, and hepatitis G.

[0095] The terms "liver tumor" and "liver tumor" are used interchangeably. They are a general term for tumor lesions occurring in the liver, which can be divided into benign tumors and malignant tumors. Benign liver tumors mainly include hepatic hemangioma, hepatic adenoma, hepatic lipoma, non-parasitic liver cysts, focal nodular hyperplasia of the liver, etc. Malignant liver tumors mainly include primary liver cancer, secondary liver cancer, bile duct cancer (especially intrahepatic bile duct cancer), and other malignant tumors of the liver (mainly including hepatoblastoma and hepatic sarcoma). Primary liver cancer originates from the epithelial or mesenchymal tissue of the liver, including hepatocellular carcinoma, cholangiocarcinoma, and mixed liver cancer. Secondary or metastatic liver cancer refers to malignant tumors originating from multiple organs throughout the body that invade the liver. It is generally common in liver metastases of malignant tumors of organs such as the stomach, bile duct, pancreas, colorectum, ovary, uterus, lung, and breast.

[0096] The term "pharmaceutically acceptable salts" includes acid addition salts and base addition salts.

[0097] The terms "patient" or "subject" and the like are used interchangeably herein to refer to any animal or cell thereof to be treated according to the methods described herein, whether in vitro or in situ. Specifically, the aforementioned animals include mammals, e.g., rats, mice, guinea pigs, rabbits, dogs, monkeys, humans, and particularly humans.

[0098] The term "treating" refers to preventing, curing, reversing, attenuating, alleviating, minimizing, inhibiting, suppressing and / or halting one or more clinical symptoms of a disease after onset of the disease.

[0099] The term "prevent" or "prevent" refers to treating a disease before it occurs to avoid, minimize, or make the onset or development of the disease more difficult.

[0100] The disclosures of various publications, patents, and published patent specifications cited herein are incorporated by reference in their entirety.

[0101] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0102] Some abbreviations and their corresponding meanings in the embodiments of the present invention are as follows:

[0103] FBS fetal bovine serum

[0104] PBS Phosphate Buffered Saline

[0105] P / S Penicillin-Streptomycin

[0106] QW once a week

[0107] SD standard deviation

[0108] TGI tumor growth inhibition rate

[0109] IG (also described as IG, ig) intragastric administration

[0110] IV tail vein administration

[0111] Example 1: Preparation of Compound I

[0112] 1. Synthesis of intermediate compound 3

[0113] Dissolve clopyralid (50 g, 260.4 mmol) in N,N-dimethylformamide (800 mL), add guanidine hydrochloride (25 g, 263.2 mmol), cuprous oxide (7.4 g, 52.1 mmol), and cesium carbonate (211.6 g, 651.1 mmol), and stir at 120°C for 18 hours. Cool to room temperature and filter. The filter cake is thoroughly dissolved in methanol (1 L), filtered, and the filtrate is concentrated under reduced pressure to obtain the crude title product 3 as a gray-green solid (50 g, crude). This product is carried on to the next step without purification. MS m / z (ESI): 197.0 [M+1].

[0114] 2. Synthesis of intermediate compound 5

[0115] 3 (10 g, 51.0 mmol) was dissolved in N,N-dimethylformamide (80 mL), and N,N-diisopropylethylamine (19.7 g, 153.0 mmol), 1H-benzotriazol-1-yloxytripyrrolidinyl hexafluorophosphate (26.5 g, 51.0 mmol), and 2-methoxyethylamine (3.8 g, 51.0 mmol) were added. The mixture was stirred at room temperature for 18 hours. The reaction solution was diluted with ethyl acetate (500 mL) and washed with saturated brine (500 mL x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (mobile phase: ethyl acetate (0.5% ammonia)-petroleum ether gradient: 0-80%) to yield the title product 5 (1.1 g, 8.5%) as a yellow solid. MS m / z (ESI): 254.1 [M+1].

[0116] 3. Synthesis of intermediate compound 7

[0117] Methyl 4-bromomethylbenzoate (2.7 g, 11.8 mmol) was dissolved in tetrahydrofuran (80 mL). Zinc powder (2.3 g, 35.4 mmol) was added under an ice bath, the atmosphere was replaced with nitrogen three times, and the mixture was stirred at 0°C under nitrogen for 0.5 hours. A solution of bis(triphenylphosphine)nickel chloride (780 mg, 1.2 mmol) and 5 (1.5 g, 5.9 mmol) in tetrahydrofuran (80 mL) was then added under nitrogen at 0°C, and the mixture was stirred at room temperature under nitrogen for 18 hours. The reaction mixture was quenched with water (200 mL) and extracted with ethyl acetate (200 mL x 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (mobile phase: methanol-dichloromethane gradient: 0-3%) to yield the title product 7 (1.1 g, 50.8%) as a yellow solid. MS m / z (ESI): 368.2 [M+1]

[0118] 4. Synthesis of intermediate compound 8

[0119] 7 (1.1 g, 3.0 mmol) was dissolved in tetrahydrofuran (40 mL). A 1 M solution of lithium aluminum tetrahydride in tetrahydrofuran (4.5 mL, 4.5 mmol) was slowly added under nitrogen at 0°C. The mixture was stirred at 0°C for 2 hours. The reaction mixture was quenched by dropwise addition to icy aqueous ammonium chloride (200 mL). The mixture was extracted with ethyl acetate (200 mL x 3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (mobile phase: methanol-dichloromethane gradient: 0-4%) to afford the title product 8 (0.8 g, 78.7%) as a yellow oil. MS m / z (ESI): 340.1 [M+1].

[0120] 5. Synthesis of intermediate compound 9

[0121] Dissolve 8 (0.6 g, 1.8 mmol) in dichloromethane (20 mL) and slowly add thionyl chloride (1.1 g, 9 mmol) at 0°C. Stir at 0°C for 1 hour. The reaction solution was concentrated under reduced pressure to obtain the crude title product 9 (0.6 g, crude) as a brown solid. This product was directly used in the next step without purification. MS m / z (ESI): 358.2 [M+1].

[0122] 6. Synthesis of Compound Ⅰ

[0123] 9 (0.6 g, 1.7 mmol) was dissolved in acetonitrile (10 mL). A 2M solution of dimethylamine in tetrahydrofuran (1 mL, 2.0 mmol), potassium carbonate (704 mg, 5.1 mmol), and sodium iodide (51 mg, 0.34 mmol) were added and stirred at 60°C for 4 hours. After cooling to room temperature, the reaction mixture was quenched with water (100 mL) and extracted with ethyl acetate (100 mL x 3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by C18 silica gel column chromatography (mobile phase: acetonitrile-water (0.05% hydrochloric acid), gradient: 5%-60%) to afford the title product I as a white solid (260 mg, 41.8%). MS m / z (ESI): 367.2 [M+1]. 1 H NMR (400MHz, DMSO) δ12.97(s,1H),11.21(s,1H),9.34(t,J=6.0Hz,1H),8.48(s,1H),7.87(d,J=8.6Hz,1H),7.72(d,J=8.6Hz,1H),7.55(d,J=8.0 Hz,2H),7.43(d,J=8.1Hz,2H),4.84(s,2H),4.41–4.07(m,4H),3.77(q, J=5.8Hz,2H),3.62(t,J=5.8Hz,2H),3.30(s,3H),2.63(d,J=4.8Hz,6H).

[0124] Example 2: Preparation of Compound II

[0125] Compound 9 (430 mg, 1.2 mmol) (prepared in Example 1) was dissolved in acetonitrile (10 mL), and morpholine (170 mg, 2.0 mmol), potassium carbonate (500 mg, 3.6 mmol), and sodium iodide (36 mg, 0.24 mmol) were added. The mixture was stirred at 60°C for 4 hours. After cooling to room temperature, the reaction solution was quenched with water (100 mL) and extracted with ethyl acetate (100 mL x 3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by C18 silica gel column chromatography (mobile phase: acetonitrile-water (0.05% trifluoroacetic acid), gradient: 5%-60%) to afford the title product II as a white solid (200 mg, 40.8%). MS m / z (ESI): 409.2 [M+1]. 1H NMR (400MHz, CD3OD) δ7.73(ddd,J=8.5,3.2,1.5Hz,1H),7.64(dd,J=8.6,2.7Hz,1H),7.45(s,4H),4.30(d,J=3.7Hz,4H), 3.98(d,J=1.2Hz,2H),3.86(t,J=5.5Hz,2H),3.76–3.59(m,4H),3.42–3.35(m,3H),3.36–3.29(m,2H),3.24–3.08(m,2H).

[0126] Example 3: Liver tissue distribution study of the compound

[0127] We selected GS-9688 as the control drug for the liver tissue distribution study. GS-9688 is an oral, selective TLR8 agonist currently in Phase II clinical trials.

[0128] Compound I, Compound II, and GS-9688 (control drug) were administered to ICR mice by single oral gavage (10 mg / kg), and liver and plasma were collected. The specific protocol is as follows:

[0129] Before dosing, check the dosage form and ensure uniformity by vortexing, stirring, or shaking. Calculate the theoretical dosage for each mouse according to the following formula. The actual dosage for each ICR mouse and the collection times of plasma and tissue samples should be recorded in detail on the corresponding spreadsheet.

[0130] Plasma sample collection: At each set time point, approximately 100 μL of blood was collected from the eye socket. The collected whole blood was placed in an EDTA-K2 anticoagulant tube, inverted several times to mix thoroughly, and stored on wet ice. Within 30 minutes, the tube was centrifuged (1500-1600 g) for 10 minutes to separate the plasma. The obtained plasma samples were stored at -40 to -20°C for biological sample analysis.

[0131] Liver tissue collection procedures are as follows: Immediately after whole blood collection, liver tissue should be harvested. The liver tissue should be removed, rinsed with ice-cold saline, and then dehydrated. The tissue should be weighed and homogenized in 20% methanol-water at a ratio of 1:5 (w / v). The collection time and homogenized weight of each tissue should be recorded in detail on the corresponding form.

[0132] Plasma and various tissue homogenates were stored in a freezer at -40 to -20°C until analysis. After the experiment, mice were euthanized by carbon dioxide asphyxiation or cervical dislocation. After analysis, samples were returned to the biological sample room, where they were transferred to a sealed environment at -40 to -20°C according to SOP-SM-001.

[0133] Sample analysis: Tissue samples were analyzed using Agilent high-performance liquid chromatography (HPLC, column: Waters XBridge C18 3.5μm 2.1×50mm; detector: Agilent DAD; mobile phase: phase A: H2O (0.1% Formic Acid), phase B: ACN (0.1% Formic Acid)) to determine the concentrations of compound I, compound II, and GS-9688 (control drug) in the liver and plasma at various time points. The corresponding plasma and liver tissue pharmacokinetic parameters were calculated using a non-compartmental model in Phoenix WinNonlin 8.0 or higher, and the area under the curve (AUC0-t) (AUC0-t, the area under the concentration-time curve 24 hours after administration) was calculated to calculate the drug liver / plasma distribution ratio (R L / P, Ratio of liver / plasma).

[0134] The liver / plasma distribution ratios of each compound are shown in Tables 1-3, and the liver and plasma concentrations of each compound at various time points are shown in Figure 1.

[0135] Table 1: Tissue distribution parameters of Compound I (10 mg / kg) in ICR mice

[0136] AUC 0-t , area under the concentration-time curve 24 hours after administration

[0137] Table 2: Tissue distribution parameters of compound II (10 mg / kg) in ICR mice

[0138] AUC 0-t , area under the concentration-time curve 24 hours after administration

[0139] Table 3: Tissue distribution parameters of GS-9688 (10 mg / kg) in ICR mice

[0140] AUC 0-t , area under the concentration-time curve 24 hours after administration; BLOQ, below the minimum detection limit

[0141] Experimental results showed that the liver / plasma drug distribution ratio of Compound I was 46-fold, that of Compound II was 114-fold, and that of GS-9688 was 3.5-fold. The liver / plasma drug distribution ratios of Compound I and Compound II were much higher than those of GS-9688, with Compound II in particular showing a 114-fold liver-to-plasma drug distribution ratio. This result suggests that Compound I and Compound II have high liver tissue targeting and hold great promise for development in the treatment of liver diseases.

[0142] Example 4: Toxicity test of compounds in primary liver cells

[0143] 1. Experimental methods

[0144] 1.1 Cell plating

[0145] (1) Day 1: Resuscitated primary human hepatocytes (PHH) were plated in a collagen-coated 96-well plate at a cell count of 40,000 cells / well and a sample volume of 90 μl / well.

[0146] (2) The cells were cultured in a 37°C, 5% CO2 incubator. After 4 hours, the culture medium was replaced with hepatocyte maintenance medium.

[0147] 1.2 Compound treatment

[0148] (1) On Day 0, the test compounds and STS were diluted to appropriate concentrations and 10 μl was added to each well. The plating method was as shown in Figure 2. The final concentrations of the test compounds were 50 μM, 35 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, 1.56 μM, 0.78 μM, and 0.39 μM, with 2-fold dilutions for 9 doses. The concentrations of the control compound, staurosporine (STS), were 10 μM, 3.3 μM, 1.1 μM, 0.37 μM, 0.123 μM, 0.041 μM, 0.0137 μM, 0.0045 μM, and 0.0015 μM, with 3-fold dilutions for 9 doses. The DMSO concentration was 0.5%.

[0149] (2) Culture in a 37°C, 5% CO2 incubator for 3 days.

[0150] 1.3 Proliferation assay

[0151] 1.3.1 On Day 0-3, Confluence testing:

[0152] (1) The cells in the 96-well plate were imaged daily using the IncuCyte instrument, and the images were analyzed using the instrument's built-in software to obtain the Confluence data of the cells in each well.

[0153] (2) GraphPad Prism 8 software was used to draw graphs.

[0154] 1.3.2 On Day 3, perform CTG testing:

[0155] (1) Add 100 μl of CTG detection reagent to each well and mix thoroughly (protect from light).

[0156] (2) Incubate at room temperature for 30 minutes (protect from light).

[0157] (3) Read the chemiluminescence value using Envision.

[0158] (4) GraphPad Prism 8 software was used to draw graphs.

[0159] 1.4 Data Analysis

[0160] IC50 (half maximal inhibitory concentration) of the compound was calculated using GraphPad Prism 8 software using the following nonlinear fitting formula:

[0161] Y = Bottom + (Top-Bottom) / (1 + 10^((LogIC50-X)*HillSlope)), Y: inhibition rate, X: log value of compound concentration;

[0162] Inhibition rate (%) = 100 - (reading value of compound well - reading value of low reading control well) / (reading value of high reading control well - reading value of low reading control well) * 100;

[0163] High-reading control wells: cells plus DMSO, low-reading control wells: no cell culture medium.

[0164] 2. Experimental results

[0165] The experimental results are shown in Figure 3. The positive control compound has a killing activity of 464.5 nanomolar on human primary liver cells, and the test compound has a killing activity of 26.5 micromolar on human primary liver cells. The test compound has weak direct killing activity on primary liver cells and has no obvious cytotoxicity.

[0166] Example 5: Liver safety evaluation of compounds

[0167] C57BL / 6J wild-type female mice (6 weeks old) were randomly divided into groups. Whole blood and liver tissue were collected 1, 2, and 4 hours after administration of different doses for multiple parameters to assess the drug's effect on the liver.

[0168] 1. Experimental methods

[0169] 1.1 Administration

[0170] C57BL / 6J wild-type female mice (6 weeks old) were randomly divided into groups and administered;

[0171] Liver tissue and blood were collected 1 hour, 2 hours, and 4 hours after the single administration.

[0172] The experimental animals and groups are shown in the following table.

[0173] Table 4 Experimental animals

[0174] Table 5 Experimental groups

[0175] Preparation of compound stock solution: solvent: 2% (v / v) DMCO + 5% PEG400 + 93% 0.01N HCl

[0176] Sample collection and processing are as follows:

[0177] (A) 1 / 4 liver tissue—quick freezing in liquid nitrogen—total RNA extraction—reverse transcription—qPCR.

[0178] The mRNA levels of ISG15, ISG56, Mx1, and Oas1b in the liver tissue of the qPCR detection group were detected using the following primers:

[0179] Internal reference: mouse Gapdh

[0180] mISG15-qF:GGTGTCCGTGACTAACTCCAT

[0181] mISG15-qR:TGGAAAGGGTAAGACCGTCCT

[0182] mISG56-qF:CTGAGATGTCACTTCACATGGAA

[0183] mISG56-qR:GTGCATCCCCAATGGGTTCT

[0184] mMx1-qF:GACCATAGGGGTCTTGACCAA

[0185] mMx1-qR:AGACTTGCTCTTTCTGAAAAGCC

[0186] mOas1b-qF:GGGCCTCTAAAGGGGTCAAG

[0187] mOas1b-qR:TCAAACTTCACTCCACAACGTC.

[0188] (B) 1 / 4 liver tissue—ground and homogenized—for ELISA testing;

[0189] (1) Weigh the liver tissue, wash it with ice-cold saline and remove the connective tissue;

[0190] (2) Add 5-8 volumes of PBS (with protease inhibitors), homogenize the tissue thoroughly, centrifuge at 2000 rpm for 15 min, and keep the supernatant (-20°C);

[0191] (3) Use ELISA kit to detect IFN-α, IP-10, IL-6, and TNF-α.

[0192] (C) Remaining liver tissue—HE staining and pathological evaluation.

[0193] (D) 1 / 2 blood (whole blood) - liver function test: AST (aspartate aminotransferase), ALT (alanine aminotransferase / alanine aminotransferase), ALP (alkaline phosphatase), ALB (albumin), GGT (gamma-glutamyl transferase).

[0194] (E) 1 / 2 blood - prepare serum - save for ELISA.

[0195] 1.2 Data Analysis

[0196] Graphpad Prism 8 was used to analyze the experimental data.

[0197] The data were tested using 2-way ANOVA.

[0198] 2. Experimental results

[0199] 2.1 Cytokine detection results

[0200] The ELISA test results of each dose group of compound I and II are shown in Figures 4 and 5, respectively. The results show that the expression of cytokines in different dose groups of the same drug has different trends over time, as follows:

[0201] In the compound I-3mpk group, the expression levels of IL-6, TNF-α, and IFN-α decreased from high to low from 1 h to 4 h, and the expression level of IP-10 increased, then decreased, and then increased again from 1 h to 4 h;

[0202] In the compound I-10mpk group, the expression levels of IL-6, TNF-α, and IFN-α increased from low to high from 1 h to 4 h, and the expression level of IP-10 was the highest at 2 h and decreased at 4 h;

[0203] The change trends of IL-6, TNF-α, IFN-α, and IP-10 in the compound Ⅰ-20mpk group were similar, with the expression levels being close to those in the control group at 1 h, reaching the highest level at 2 h, and decreasing at 4 h;

[0204] The expression trends of IL-6, TNF-α, IFN-α, and IP-10 in the Compound II-3 / 10 / 20 mpk / group were similar, reaching their highest levels at 2 hours and decreasing at 4 hours. The kinetics of cytokine secretion were distinct, consistent with drug absorption and metabolism. Compound II significantly induced the secretion of IP-10 (CXCL-10). In clinical studies of TLR agonists, IP-10 is often used as a biomarker for evaluating drug efficacy.

[0205] 2.2 Results of real-time fluorescence quantitative PCR detection of interferon-related genes

[0206] The qPCR results for each dose group of Compound I and II are shown in Figures 6 and 7, respectively. The results showed that the relative expression levels of ISG15, 1SG56, Mx1, and oas1b increased over time in the Compound I group, reaching a peak at 4 hours. In the Compound II group, the relative expression levels of ISG15, 1SG56, Mx1, and oas1b increased over time, reaching a peak at 4 hours, and all were statistically significant. At a dose of 3 mpk (the effective dose), both Compound I and Compound II significantly induced an increase in the expression of interferon-related gene mRNA levels.

[0207] 2.3 Real-time fluorescence quantitative PCR detection results

[0208] The biochemical test results of each dose group of Compound I and II are shown in Figures 8 and 9, respectively. The results showed that ALT increased in all groups of Compound I. At 4 hours, the differences between the groups were significant and statistically significant (p<0.001), and all exceeded the normal reference range. However, according to the clinical adverse reaction grading standard, ALT exceeding 3 times the normal value is a grade 1 AE. The increase in ALT caused by a single dose of Compound I did not reach a grade 1 AE; AST exceeded the normal reference range in all dosing groups, and the differences were not statistically significant; ALP and GGT were within the normal reference range in all dose groups; ALB levels in the Compound I-10mpk group were significantly lower than those in the control group at 2 hours;

[0209] ALT levels increased in all groups treated with Compound II. At 2 hours, the differences among the dosing groups were significant and statistically significant (p<0.001), exceeding the normal reference value range. However, according to the clinical adverse reaction grading standard, ALT exceeding 3 times the normal value is a grade 1 AE. The increase in ALT caused by a single dose of Compound II did not reach a grade 1 AE. AST exceeded the normal reference range in all dosing groups, and the differences were not statistically significant. ALP was within the normal reference range in all dose groups. ALB levels in the Compound II group were significantly lower than those in the control group at 2 hours and 4 hours. GGT levels in the Compound II group were significantly lower than those in the control group at 3 hours, and showed a dose-dependent relationship. If γ-glutamyl transferase is greater than 2.0 to 2.5 times the baseline value, it is a grade 1 AE. Low γ-glutamyl transferase is generally a normal phenomenon clinically.

[0210] 2.4 Liver HE Results

[0211] The livers of mice in each dose group of Compound I and Compound II were fixed and stained with HE after 1, 2, and 4 hours after administration. The results showed that there was no significant difference between each dose group and the blank group. The HE images are shown in Figure 10. The administration of Compound I and Compound II did not cause obvious pathological damage to the liver tissue.

[0212] Example 6: Anti-HBV Activity Detection of Compounds

[0213] We used primary human hepatocytes (PHH), a classic in vitro infection model for studying HBV infection, to evaluate the anti-HBV activity of Compound II and GS-9688 (control drug).

[0214] First, compound II and GS-9688 were used to stimulate peripheral blood mononuclear cells (hPBMCs) from three donors at four concentration points. After 24 hours of stimulation, the culture supernatant was collected and the cytokine concentrations of IFN-α, IFN-γ and IL-1240 were detected.

[0215] Figures 11-13 show cytokine secretion after compound stimulation of PBMCs from different donors. Across different donors, Compound II exhibited significantly greater potency and intensity in inducing IFN-α, IFN-γ, and IL-1240 secretion than GS-9688. In particular, Compound II exhibited strong IFN-α stimulating activity, while GS-9688 showed minimal IFN-α activation, suggesting, to some extent, that IFN-α production is primarily driven by TLR7 activation.

[0216] The culture supernatant from one of the donors (donor 1) was used to stimulate HBV-infected primary hepatocytes (PHHs). Interferon α and the nucleoside analog entecavir (ETV) were used as positive controls. The experimental procedure is shown below (Figure 14a). The specific steps are as follows:

[0217] On day -1, thaw the frozen PHH and adjust the density to 6×10 5 cells / ml, PHH were plated into 48-well plates, 0.22 ml per well.

[0218] On day 0, PHH were infected with HBV type B, 600 GE / cells.

[0219] On day 1, fresh culture medium was replaced and the reference compounds ETV and Peg-IFN-α2a (Pegasys-Roche) were added to the cells for treatment. The PHH reference compounds ETV and Peg-IFN-α2a were each treated at one concentration in triplicate.

[0220] On day 3, the cell culture medium was supplemented with the test compound, Compound II, and GS-9688-treated PBMC supernatant (donor 1), along with the reference compounds ETV and Peg-IFN-α2a. Four test concentrations of PBMC supernatant were diluted 1:4 and added to the cells, with all assays performed in triplicate. Fresh culture medium containing PBMC supernatant and the reference compounds was replaced on days 5, 7, 9, and 11. On day 13, the cell supernatant was harvested, and cell viability was assessed using CCK-8.

[0221] According to the kit instructions, qPCR was used to detect the HBV DNA content in the supernatant, and ELISA was used to detect HBsAg and HBeAg in the supernatant.

[0222] The experimental results are shown in Figure 14. Compound II significantly reduced the levels of surface antigens HBeAg (Figure 14b) and HBsAg (Figure 14c), comparable to its cytokine-inducing activity. It also significantly decreased HBV DNA (Figure 14d). Furthermore, Compound II exhibited significantly stronger anti-HBV activity than the positive control drug GS-9688. Compound II's HBsAg-reducing activity was slightly stronger than that of PEG-interferon α (Peg-IFN-α2a) (100 IU / mL), and its HBV DNA-inhibiting activity was comparable to that of PEG-interferon α (Peg-IFN-α2a) (100 IU / mL). As a control, the nucleoside analog ETV did not reduce HBsAg levels but significantly inhibited HBV DNA, demonstrating activity comparable to that of Compound II and GS-9688.

[0223] In summary, compound II has significant anti-hepatitis B virus activity and is superior to the positive control drug GS-9688.

[0224] Example 7: Study on the efficacy of the compound in the H22-luc homologous mouse liver cancer model

[0225] 1. Experimental methods

[0226] 1.1 Cell culture

[0227] H22-luc cells were rapidly thawed in a 37°C water bath and supplemented with complete medium containing 90% 1640, 10% FBS, and 1% P / S. The cells were placed in a 37°C, 5% CO2 incubator and passaged every 1-2 days depending on the cell density.

[0228] Adjust the cell concentration (H22-luc, 2.0E8 / mL) and mix it with Matrigel at a ratio of 1:1. Place it on ice and wait for subsequent injection experiments. Vortex and mix thoroughly before use.

[0229] 1.2 Tumor cell inoculation

[0230] (1) The mice were weighed before surgery and injected intraperitoneally with the anesthetic drug Avertin at a rate of 0.15 mL / 10 g body weight. After anesthesia, the hair at the abdominal surgical site was shaved with a pet razor and the mice were fixed on an operating table made of foam board.

[0231] (2) Shave the hair and disinfect the abdominal skin preparation area with iodine and 75% ethanol in sequence. Use ophthalmic scissors to make a longitudinal incision of about 1.5 to 2.0 cm in the center of the largest lobe of the liver.

[0232] (3) Use your fingers to gently press the costal arches on both sides to squeeze out the largest lobe of the liver.

[0233] (4) After vortexing the cells, use a BD brand 1 ml syringe to aspirate the cells. Insert the needle at a 30-degree angle to the liver surface, keeping the needle parallel to the tabletop. Advance the needle approximately 3 mm and slowly inject 10 μL of H22-luc cell suspension. Observe that the color of most liver lobes in the injection area quickly becomes lighter (white spots) or turbid translucent vacuoles appear.

[0234] (5) After the injection, use a cotton swab to clean the injection site and slowly remove the needle until there is no bleeding, then remove the cotton swab.

[0235] (6) Gently push the liver back into the abdominal cavity and suture the muscle layer and cortex. After suturing, use 75% ethanol to wipe the sutured incision and surrounding skin.

[0236] (6) After surgery, each mouse was subcutaneously injected with 5 mg / mL of levofloxacin hydrochloride.

[0237] The experimental animals and cell line information are shown in the following table

[0238] Table 6 Experimental animals and cell lines

[0239] 1.3 Drug treatment

[0240] The mice were randomly divided into groups and the dosing information was as follows.

[0241] Table 7 Experimental groups

[0242] Preparation of compound stock solution: solvent: 2% (v / v) DMSO + 5% PEG400 + 93% 0.01N HCl

[0243] 1.4 Data Analysis

[0244] The experimental data were analyzed by Graphpad Prism 8. The experimental data are expressed as mean ± SD.

[0245] The data were tested using 2-way ANOVA.

[0246] 2. Experimental results

[0247] The results of the tumor inhibition effects of Compound I and Compound II in the H22-luc orthotopic model are shown in Figures 15 and 16. The average BLI of the tumor in the vehicle group reached 7.00×10 10 Compound I and Compound II significantly inhibited tumor growth, with TGIs of 87.0% and 83.4%, respectively, P < 0.0001. One mouse in the Compound I group died of ascites on day 20 after grouping. Body weights did not change significantly in any of the groups during the dosing period.

[0248] 3. Experimental Conclusion

[0249] Compounds I and II showed significant tumor-inhibiting effects in the H22-luc liver orthotopic tumor model.

[0250] Example 8: Pharmacological efficacy study of the compound in a Hep3B-luc human hepatocyte orthotopic xenograft mouse model

[0251] 1. Experimental methods

[0252] 1.1 Cell culture

[0253] Hep3B-luc cells were rapidly thawed in a 37°C water bath and supplemented with complete medium containing 90% MEM + 10% FBS + 1% P / S. The cells were placed in a 37°C 5% CO2 incubator and passaged every 1-2 days depending on the cell density.

[0254] Adjust the cell concentration (Hep3B-luc, 1.0E8 / mL), mix with Matrigel at a ratio of 1:1, place on ice and wait for subsequent injection experiments, and mix thoroughly with Vortex before use.

[0255] 1.2 Tumor cell inoculation

[0256] (1) The mice were weighed before surgery and injected intraperitoneally with the anesthetic drug Avertin at a rate of 0.15 mL / 10 g body weight. After anesthesia, the hair at the abdominal surgical site was shaved with a pet razor and the mice were fixed on an operating table made of foam board.

[0257] (2) Shave the hair and disinfect the abdominal skin preparation area with iodine and 75% ethanol in sequence. Use ophthalmic scissors to make a longitudinal incision of about 1.5 to 2.0 cm in the center of the largest lobe of the liver.

[0258] (3) Use your fingers to gently press the costal arches on both sides to squeeze out the largest lobe of the liver.

[0259] (4) After vortexing the cells, use a BD brand 1 ml syringe to aspirate the cells. Insert the needle at a 30-degree angle to the liver surface, keeping the needle parallel to the tabletop. Advance the needle approximately 3 mm and slowly inject 10 μL of Hep3B-luc cell suspension. Observe that the color of most liver lobes in the injection area quickly becomes lighter (white spots) or turbid translucent vacuoles appear.

[0260] (5) After the injection, use a cotton swab to clean the injection site and slowly remove the needle until there is no bleeding, then remove the cotton swab.

[0261] (6) Gently push the liver back into the abdominal cavity and suture the muscle layer and cortex. After suturing, use 75% ethanol to wipe the sutured incision and surrounding skin.

[0262] (7) After surgery, each mouse was subcutaneously injected with 5 mg / mL of levofloxacin hydrochloride.

[0263] The experimental animals and cell line information are shown in the following table

[0264] Table 8 Experimental animals and cell lines

[0265] 1.3 Drug treatment

[0266] The mice were randomly divided into groups and the dosing information was as follows.

[0267] Table 9 Experimental groups

[0268] Preparation of compound stock solution: solvent: 2% (v / v) DMSO + 5% PEG400 + 93% 0.01N HCl

[0269] 1.4 Data Analysis

[0270] The experimental data were analyzed by Graphpad Prism 8. The experimental data are expressed as mean ± SD.

[0271] The data were tested using 2-way ANOVA.

[0272] 2. Experimental results

[0273] The tumor inhibition results of Compound II in the Hep3B-luc orthotopic liver tumor model are shown in Figures 17 and 18. Compound II at a dose of 3 mg / kg significantly inhibited tumor growth (p<0.05), with a TGI value of 61.6%. There were no deaths or obvious clinical symptoms in any of the treatment groups. The maximum body weight loss after administration of 3 mg / kg of Compound I was 8.0%, while the maximum body weight loss after administration of 3 mg / kg of Compound II was 5.4%.

[0274] 3. Experimental Conclusion

[0275] Compound II-3mpk has a significant tumor inhibitory effect in the Hep3B-luc liver orthotopic tumor model.

[0276] Example 9: Pharmacological efficacy study of the compound and its combination with PD-1 in the MC38-luc syngeneic mouse liver cancer metastasis model

[0277] 1. Experimental methods

[0278] 1.1 Cell culture

[0279] MC38-luc cells were rapidly thawed in a 37°C water bath and supplemented with complete medium containing 90% DMEM + 10% FBS + 1% P / S + Puro. The cells were placed in a 37°C 5% CO2 incubator and passaged every 1-2 days depending on the cell density.

[0280] Adjust the cell concentration (MC38-luc, 2.0E7 / mL), place on ice until subsequent injection experiments, and mix thoroughly using a Vortex shaker before use.

[0281] 1.2 Tumor cell inoculation

[0282] (1) Shave the abdomen and left side (spleen side) of the mouse, anesthetize it, and expose the skin on the spleen side.

[0283] a. Place the mouse head under anesthesia to prevent awakening during surgery;

[0284] b. Place paper or gauze on the mouse to elevate it and expose the spleen.

[0285] c. After positioning, you can shave again and wipe with alcohol;

[0286] (2) Cut the skin and underlying mucosa at the spleen position with an incision of about 1 cm. Use scissors to clamp the pancreas and pull out the spleen. Place the spleen / pancreas on moist gauze and moisten it with PBS.

[0287] a. Gently pull out the pancreas, and do not pull directly on the spleen, as the spleen is too fragile;

[0288] b. Keep moist with PBS;

[0289] (3) Gently lift the spleen with forceps, insert the syringe horizontally from one end of the spleen, about 1 cm into the needle, and gently inject MC38 cells into the spleen;

[0290] a.1x 10 6 MC38-luc, 50uL;

[0291] b. Before sucking up cells, pump the syringe repeatedly to lubricate it;

[0292] c. Inject in the center of the spleen and do not puncture the spleen. If fluid flows out or there is heavy bleeding during the injection, the test will fail.

[0293] (4) After the injection is completed, press the needle end of the spleen with a cotton swab, then slowly withdraw the needle for 5 minutes to allow the cells to fully enter the blood;

[0294] a. Keep the spleen moist

[0295] (5) During the 5-minute waiting period, ligature the blood vessels at both ends of the spleen with sutures;

[0296] a. There is a large blood vessel at the base of the spleen, at both the front and back ends. This can be found by gently opening the pancreas.

[0297] b. The suture is inserted between the spleen and pancreas and tied at the front and back ends respectively;

[0298] c. This step can prevent heavy bleeding and significantly improve the success rate;

[0299] (6) After 5 minutes (vascular ligation), gently grasp the spleen with forceps, remove the spleen (burn it) along the spleen-pancreas junction with an electric soldering iron, and insert the pancreas back into the mouse;

[0300] a. Do not overheat the soldering iron and try to burn (touch) the spleen;

[0301] b. Burn the blood vessels from one end to the other to completely remove the spleen.

[0302] (7) Suture: Use suture needle and thread to suture the internal mucosa first (3-4 stitches), and then suture the external skin (3-4 stitches);

[0303] a. Suture two layers;

[0304] b. After suturing, analgesics can be injected subcutaneously immediately.

[0305] The experimental animals and cell lines information are shown in the following table.

[0306] Table 10 Experimental animals and cell lines

[0307] 1.3 Drug treatment

[0308] The mice were randomly divided into groups and the dosing information was as follows.

[0309] Table 11 Experimental groups

[0310] Preparation of compound stock solution: solvent: 2% (v / v) DMSO + 5% PEG400 + 93% 0.01N HCl

[0311] Preparation of PD-1 antibody stock solution: Solvent: PBS, PD-1 antibody is CS1003 antibody developed by CStone Pharmaceuticals (sometimes referred to as "PD-1" in this example).

[0312] 1.4 Data Analysis

[0313] The experimental data were analyzed by Graphpad Prism 8. The experimental data are expressed as mean ± SD.

[0314] The data were tested using 2-way ANOVA.

[0315] 2. Experimental results

[0316] The weight changes and BLI values ​​of mice in each group during the efficacy period of Compound II and PD-1 in the MC38-luc liver metastasis model are shown in Figure 19. The BLI values ​​of individual mice in each group during the dosing period are shown in Figure 20. The average tumor BLI in the vehicle group reached 6.24×10 9. The combined administration of Compound II and PD-1 significantly inhibited the growth of MC38-luc tumors (p<0.001), and the TGI value was 83.4%. The administration of Compound II alone had an inhibitory effect on the growth of MC38-luc tumors (p<0.05), and the TGI value was 63.3%. The maximum body weight reduction rate after administration of the Compound II group was 3.9%. The maximum body weight reduction rate after administration of the combined administration group of Compound II and PD-1 was 3.8%. The Synergy ratio of the combined administration group was 2.698, and the combination of the two had a synergistic anti-tumor effect. The final tumor and liver weights and tumor volumes are shown in Figure 21. The imaging images of each group of mice are shown in Figure 22

[0317] The flow cytometry panel and statistical results for lymph nodes are shown in Figure 23. The flow cytometry panel and statistical results for liver and tumors are shown in Figure 24. Compound II (alone or in combination with PD-1 antibody) significantly induced an increase in kuffer cells in liver tissue, surpassing the vehicle and PD-1 antibody groups. CD8+ T cell detection in peripheral lymph nodes showed no significant difference between the Compound II, PD-1, and vehicle groups, but a decrease in memory T cells was observed.

[0318] 3. Experimental Conclusion

[0319] Compound II can inhibit the growth of tumors in the MC38-luc homologous mouse liver metastasis model. The combined administration of Compound II and PD-1 can further significantly inhibit the growth of tumors in the MC38-luc homologous mouse liver metastasis model.

[0320] Example 10: Investigation of the physicochemical properties of the compound

[0321] Test compounds: Compound I and Compound II, and control compound N01 (for its preparation, see Chinese patent CN108069963B).

[0322] The clogP (lipid-water partition coefficient) values ​​predicted by chemdraw software were 4.7 for N01, 3.0 for compound I and compound II, and the logP values ​​dropped significantly to more than 1.5, indicating that compound I and compound II have better hydrophilicity.

[0323] The solubility of the compounds in phosphate buffer at pH = 7.4 was further tested, and the results showed that the solubility of compounds I and II was about 10 times higher than that of N01 (D18).

[0324] The above results indicate that the compounds of the present invention have better physicochemical properties and drugability.

[0325] Table 12 Lipid-water partition coefficient and solubility of compounds

[0326] a Prediction by ChemDraw software

[0327] Example 11: In vitro metabolic stability study of compounds

[0328] Evaluate the metabolic stability of the compound in in vitro liver microsomes. The experimental procedures and steps are as follows:

[0329] Compounds were incubated at 1 μM in 1 mg / mL liver microsomes at 37°C. The reaction system consisted of 0.1 M potassium phosphate buffer (pH 7.4) containing 3 mmol / L MgCl2 and 1 mmol / L NADPH. The reaction was initiated by preincubating the small molecule and liver microsomes at 37°C for 10 minutes. The metabolic reaction was then initiated by the addition of the cofactor NADPH. The reaction was terminated at 0, 5, 10, 20, 30, and 60 minutes with three volumes of ice-cold methanol containing an internal standard (200 nM labetalol). After incubation at room temperature for 10 minutes, the sample was centrifuged at 4000 rpm at 4°C for 20 minutes, and the supernatant was diluted 1:1 with chromatographically pure water for quantitative analysis. Compound quantification was performed by LC-MS / MS on an Agilent quadrupole time-of-flight instrument (Agilent 6510). After 6 minutes of separation on a C18 column (50 × 2.1 mm; 2.6 μm) using a mobile phase gradient containing 0.1% formic acid in water, the peaks of the designated ion signals were detected. For metabolite identification, a 1:1 mobile phase gradient was used, and the retention time was extended to 20 minutes. MS / MS analysis of the metabolites was performed, focusing on the distinct molecular ion peaks. The detailed procedure is as follows:

[0330] 1) Add 10 μL / well of compound working solution to all wells of a 96-well reaction plate (T0, T5, T10, T20, T30, T60) except the blank.

[0331] 2) Add 80 μL / well of the microsome solution to all reaction wells (T0, T5, T10, T20, T30, T60, and blank).

[0332] 3) Pre-incubate at 37°C for 10 minutes.

[0333] 4) After pre-incubation, add 10 μL / well of NADPH to each reaction plate to start the reaction.

[0334] 5) At the set end time point, 300 μL / well of 4° C. methanol solution (containing internal standard: 200 nM labetalol) was added to each reaction plate to terminate the reaction.

[0335] 6) Seal each plate and shake for 10 minutes.

[0336] 7) After shaking, centrifuge at 4000 rpm and 4°C for 20 minutes.

[0337] 8) Remove 300 μL of supernatant, add 300 μL / well of HPLC-grade water, mix well, and then detect by LC-MS.

[0338] Data Analysis:

[0339] The first-order kinetic equation was used to calculate the metabolic half-life (T1 / 2) and metabolic clearance (CLint(mic)) (μL / min / mg).

[0340] First-order kinetic formula:

[0341] C t =C0 exp(-k e t), k e is a constant

[0342] When C t =1 / 2C0, T 1 / 2 =Ln2 / k e =0.693 / k e ;

[0343] C Lint (mic)=0.693 / T 1 / 2 ×1 / (Microsome concentration:mg / mL)

[0344] The results are shown in the following table.

[0345] Table 13 Evaluation of liver microsomal stability of compounds

[0346] The results showed that compound I had an extremely short half-life in mouse liver microsomes but a significantly prolonged half-life in human liver microsomes. Compound II also exhibited significantly prolonged half-life in both human and mouse liver microsomes. This suggests that oxygen substitution of the butyl chain moderates metabolic rate, suggesting that oxidation of the β-position of the N01 alkyl chain is a potential metabolic pathway. These results suggest that compounds I and II may have improved oral bioavailability and metabolic stability, particularly in humans.

[0347] Example 12: Investigation of cardiac potassium channel (hERG) inhibitory activity of compounds

[0348] The rapidly activating potassium channel encoded by the human ether-a-go-go-related gene (hERG) is a key ion channel involved in phase 3 repolarization of the cardiac action potential. Drug blockade of hERG channels can lead to prolonged cardiac repolarization, manifested on the electrocardiogram as a prolonged QT interval, a condition known as long QT syndrome. Drug-induced delayed ventricular repolarization can, in some cases, trigger the fatal arrhythmia torsades de pointes. This study used the whole-cell patch-clamp technique, a standard method for hERG safety evaluation, to investigate the effects of small molecules on hERG potassium channels and assess their risk of ventricular repolarization toxicity.

[0349] The test results are shown in the table below. Compound N01 showed strong inhibitory activity against hERG, IC 50< 3μM), which is at the edge of clinical drug safety requirements. Compared with N01, the overall lipophilicity of compound I and compound II is significantly reduced, and the inhibitory activity against hERG is also significantly reduced. Compound II has moderate hERG inhibitory activity (IC 50 =4.3 μM), compound II is a weak inhibitor according to general standards (IC 50 >10μM). The test results showed that compounds I and II, especially compound I, significantly improved cardiac safety. Considering that the dosage of compounds I and II was very low, according to the ICH cardiac safety evaluation index (C max / hERG IC 50 >30 is low risk), C of compound I and compound II max / hERG IC 50 >30, low risk of cardiotoxicity.

[0350] Table 14 Evaluation results of hERG inhibitory activity of compounds

[0351] Example 13: Single-dose toxicity evaluation of compounds

[0352] The purpose of this study was to evaluate the tolerance of C57BL / 6 mice to different doses of the test compounds, Compound I and Compound II, after being orally administered for 7 days, to observe the clinical symptoms (toxic reactions) of the mice and to evaluate the maximum tolerated dose (MTD) of the mice.

[0353] 1. Experimental methods

[0354] 1.1 Experimental animals

[0355] C57BL / 6 mice, 8 weeks old, male / female, 27 mice, provided by: Sibeifu (Beijing) Biotechnology Co., Ltd.

[0356] Experimental animals were housed in individual cages in an SPF-grade laminar flow clean room with a constant temperature and humidity of 22±3°C, 40-70% humidity, and 12-hour light-dark cycle.

[0357] 1.2 Animal grouping and treatment

[0358] The animals were randomly divided into 8 groups according to their body weight. The specific groups are shown below.

[0359] Table 15 Animal grouping

[0360] The preparation method of compound stock solutions is shown in the table below.

[0361] Table 16 Preparation of compound stock solutions

[0362] 1.3 Detection indicators and methods

[0363] 1.3.1 Weight

[0364] The body weight of the animals was measured and recorded daily.

[0365] 1.3.2 Clinical Observation

[0366] All groups underwent clinical observation before dosing and 1-2 hours after dosing, with additional observations required. Death and mortality rates were observed twice daily. Observations should include, but are not limited to, the following: animal hair coat, activity, mental state, vomiting, diarrhea, and abnormal periocular discharge. All animals were observed on the day of necropsy, and any abnormal findings were recorded.

[0367] Animals will be euthanized if:

[0368] The animals have lost a significant amount of body weight (emaciation). The cumulative body weight loss compared to day 1 is equal to or greater than 20%.

[0369] Animals cannot get enough food or water.

[0370] Weakness, difficulty in movement, and low body temperature.

[0371] 1.3.3 Rectal temperature detection

[0372] The rectal temperature of all animals was measured and recorded at 0 hour before administration and 2, 4, 8, and 24 hours after administration.

[0373] 1.3.4 Gross anatomy and tissue weighing

[0374] The experiment was terminated on the 7th day after administration, and gross dissection was performed to observe whether there were any lesions in the abdominal and thoracic organs. The spleen and liver tissues were collected and weighed.

[0375] 1.4 Statistics

[0376] The experimental results are expressed as "mean ± standard deviation". The data of each group were statistically analyzed using SPSS17.0 software package, and the one-way ANOVA test was used to compare whether there was any statistical difference between the two groups. P < 0.05 was considered statistically significant.

[0377] 2. Experimental results

[0378] 2.1 Weight

[0379] The body weight results of the experimental animals are shown in Figures 25 and 26. In male animals, the body weight of animals treated with Compound I and Compound II decreased after a single dose, and the body weight began to recover from Days 3 to 7. The body weight of animals in Groups 1, 2, 3, 4, 6, 7, and 8 was significantly reduced on Day 2 compared with the vehicle group. In female animals, the body weight of animals treated with Compound I and Compound II decreased after a single dose, and the body weight began to recover from Days 3 to 7. The body weight of animals in Groups 1, 2, 3, 4, 6, 7, and 8 was significantly reduced on Day 3 compared with the vehicle group, and the body weight of animals in Groups 2, 3, 4, and 8 was significantly reduced on Day 4 compared with the vehicle group.

[0380] 2.2 Rectal temperature

[0381] The rectal temperature results of the experimental animals are shown in Figures 27 and 28. After 2 hours of treatment with Compound I and Compound II, the rectal temperature of the animals decreased, which was significantly different from that of the vehicle group. After 4 hours, 8 hours, and 24 hours of treatment, the rectal temperature of the animals gradually returned to normal.

[0382] 2.3 Cage-side observation

[0383] During the experiment, male animal No. 46 in Group 1, treated with Compound I at 10 mg / kg, was found to have a mild hunched back on day 2, and male animal No. 35 in Group 6, treated with Compound II at 20 mg / kg, was found to have white discharge around the eyes on day 2. No abnormalities were observed in the other animals' cages.

[0384] 2.4 Gross anatomy

[0385] During dissection, enlarged spleens were observed in male animal No. 46 treated with Compound I, 10 mg / kg, from Group 1, and in female animal No. 2 treated with Compound I, 40 mg / kg, from Group 4. No gross anatomic abnormalities were observed in the other animals.

[0386] 2.5 Tissue weight

[0387] The results of spleen and liver weights of animal tissues are shown in Figures 29 and 30. In female animals, spleen weights of animals treated with 30 mg / kg Compound I were significantly increased compared to those in the vehicle group.

[0388] 3. Experimental Conclusion

[0389] In summary, under the current experimental conditions, the maximum tolerated dose of Compound I and Compound II for both female and male animals was 40 mg / kg.

[0390] Under the same experimental conditions, the maximum tolerated dose of compound N01 was 20 mg / kg. Compounds I and II also had lower rates of side effects and less weight loss. These results indicate that compounds I and II have better safety.

[0391] Table 17 Single-dose toxicity evaluation results of compounds

[0392] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

[0393] The aforementioned embodiments and methods described in the present invention may be varied based on the ability, experience, and preference of those skilled in the art.

[0394] In the present invention, merely listing the steps of the method in a certain order does not constitute any limitation on the order of the method steps.

Claims

1. Use of a compound or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing and / or treating liver disease, wherein the compound has the following structure:

2. The use according to claim 1, characterized in that The liver disease is hepatitis, preferably selected from the group consisting of viral hepatitis, alcoholic hepatitis, fatty hepatitis, drug-induced hepatitis, and autoimmune hepatitis, and more preferably viral hepatitis.

3. The use according to claim 2, characterized in that The viral hepatitis is selected from the group consisting of hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, and hepatitis G, preferably hepatitis B.

4. The use according to claim 1, characterized in that The liver disease is a liver tumor, preferably selected from: hepatic hemangioma, hepatic adenoma, hepatic lipoma, non-parasitic liver cyst, focal nodular hyperplasia of the liver, liver cancer, cholangiocarcinoma, hepatoblastoma, liver sarcoma, preferably liver cancer.

5. The use according to claim 4, characterized in that The liver cancer is primary liver cancer or metastatic liver cancer; Preferably, the primary tumor of the metastatic liver cancer is selected from the group consisting of colorectal cancer, colon cancer, gastric cancer, pancreatic cancer, stomach, intestinal leiomyosarcoma, lung cancer, breast cancer, kidney cancer, cervical cancer, ovarian cancer, prostate cancer and head and neck tumors.

6. The use according to claim 1, characterized in that The liver disease is liver damage, preferably liver fibrosis or liver cirrhosis; or, the liver disease is fatty liver or intrahepatic bile duct stones.

7. The use according to claim 1, characterized in that The drug further comprises a second active ingredient, which is selected from: one or more of a radiotherapy agent, a chemotherapeutic agent, an immunotherapy agent, an anti-angiogenic agent, a cytokine, a hormone, a polynucleotide, an antibody, an immunologically active fragment, an immune checkpoint blocker, a cell therapy drug, a small nucleic acid drug, an mRNA vaccine, and a tumor vaccine; Preferably, the immune checkpoint is selected from: PD-1, PD-L1, CTLA-4, BTLA, TIM-3, LAG-3, TIGIT, LAIR1, 2B4, CD160, preferably PD-1 or PD-L1; Preferably, the chemotherapeutic agent is selected from the group consisting of fluorouracil, doxorubicin, cisplatin, mitomycin, gemcitabine, capecitabine, irinotecan, sorafenib, sunitinib, erlotinib, and lenvatinib.

8. The use according to claim 7, characterized in that The second active ingredient is a PD-1 antibody, such as pembrolizumab, nivolumab, cemiplimab, Nofazinlimab (CS1003), Tislelizumab, toripalimab, Sintilimab, Camrelizumab, Penpulimab, Zimberelimab, serplulimab; or, The second active ingredient is a PD-L1 antibody, such as atezolizumab, duvalumab, durvaluamb, sugemalimab, envofilimab; or, The second active ingredient is a CTLA-4 antibody, such as Tremelimumab and ipilimumab; or The second active ingredient is a multi-target receptor tyrosine kinase (RTK) inhibitor, such as sorafenib and lenvatinib.

9. The use according to any one of claims 1 to 8, characterized in that: The medicament further comprises one or more pharmaceutically acceptable excipients.

10. The use according to claim 9, characterized in that The dosage form of the drug is tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, suspensions, injections, sprays, aerosols, and powder sprays; Preferably, the drug is in oral dosage form.

11. The use according to any one of claims 1 to 8, characterized in that: The compound or its pharmaceutically acceptable salt is administered orally.

12. Use of a compound or a pharmaceutically acceptable salt thereof in combination with a second active ingredient in the preparation of a medicament for preventing and / or treating liver disease, wherein the compound has the following structure: The second active ingredient is selected from: one or more of a radiotherapeutic agent, a chemotherapeutic agent, an immunotherapeutic agent, an anti-angiogenic agent, a cytokine, a hormone, a polynucleotide, an antibody, an immunologically active fragment, an immune checkpoint blocker, a cell therapy drug, a small nucleic acid drug, an mRNA vaccine, and a tumor vaccine; Preferably, the immune checkpoint is selected from: PD-1, PD-L1, CTLA-4, BTLA, TIM-3, LAG-3, TIGIT, LAIR1, 2B4, CD160, preferably PD-1 or PD-L1; Preferably, the chemotherapeutic agent is selected from the group consisting of fluorouracil, doxorubicin, cisplatin, mitomycin, gemcitabine, capecitabine, irinotecan, sorafenib, sunitinib, erlotinib, and lenvatinib.

13. The use according to claim 12, characterized in that The liver disease is a liver tumor, preferably liver cancer.

14. The use according to claim 12 or 13, characterized in that The combination is a combination of the compound or a pharmaceutically acceptable salt thereof and a PD-1 antibody; Preferably, the compound is compound II.

15. The use according to any one of claims 12 to 14, characterized in that: The compound or its pharmaceutically acceptable salt is administered orally; and / or the second active ingredient is administered by injection.

Images