Gene therapy vector for treating parkinson's disease and use thereof

Abstract

Provided are a gene therapy vector for treating Parkinson's disease and a use thereof. Specifically, provided is an adeno-associated virus (AAV) vector for treating Parkinson's disease, which can simultaneously express functional tyrosine hydroxylase (TH), GTP-cyclohydrolase 1 (GCH1) and aromatic amino acid decarboxylase (AADC) to promote dopamine synthesis. Also provided are an AAV virus particle containing the AAV vector, a composition containing the AAV vector or the AAV virus particle, and uses of the AAV vector, the AAV virus particle and the composition in the preparation of drugs for preventing or treating Parkinson's disease.

Description

Gene therapy vector for treating Parkinson's disease and its use Technical Field

[0001] The present application relates to the field of gene therapy, and in particular to gene therapy vectors and compositions for treating Parkinson's disease. Background Art

[0002] Parkinson's disease (PD) is a common neurodegenerative disease. PD patients are characterized by the loss of dopaminergic neurons in the substantia nigra. Dopaminergic neurons are mainly a type of neurons that can produce dopamine and transmit nerve impulse signals to the striatum. The striatum mainly controls the movement of skeletal muscles. Therefore, the reduction of dopamine synthesis leads to movement disorders in the body. The main clinical manifestations of patients are: bradykinesia, muscle rigidity, resting tremor, abnormal posture and gait, etc. PD affects about 1% of the world's population over 55 years old. As society enters an aging society, the patient population will continue to expand.

[0003] The common treatment for Parkinson's disease is oral administration of levodopa, a dopamine precursor. While this medication is effective in alleviating symptoms in the early stages of treatment, it can lead to various motor complications as the "honeymoon" phase of treatment wears off. While dopamine agonists can provide some symptom relief, long-term use can lead to adverse reactions such as gastrointestinal and psychiatric symptoms. Surgery, while effective in improving symptoms, cannot cure the disease; postoperative medication is still required and can also lead to complications such as tongue and hand numbness, dysmetria, and confusion, thus presenting certain limitations.

[0004] Gene therapy offers unique advantages for the treatment of Parkinson's disease. First, it involves delivering relevant genes via vectors to the lesion site, repairing, compensating, and correcting cells in the target area to restore normal physiological function. This approach primarily involves the introduction of neurotrophic factors, including glial cell line-derived neurotrophic factor (GDNF), neurturin, and brain-derived neurotrophic factor (BDNF), to promote and protect the survival of relevant neurons. However, most patients with Parkinson's disease experience a significant loss of dopamine neurons at onset. Therefore, enhancing dopamine synthesis in the relevant neuronal nuclei may be key to treating the disease. Dopamine synthesis is primarily mediated by the following enzymes: tyrosine hydroxylase (TH), aromatic amino acid decarboxylase (AADC), and GTP-cyclohydrolase 1 (GCH1). Tyrosine is catalyzed by tyrosine hydroxylase (TH) to produce levodopa, which is then converted to dopamine by aromatic amino acid decarboxylase (AADC). TH requires tetrahydrobiopterin as a coenzyme, and tetrahydrobiopterin is synthesized by GTP-cyclohydrolase 1 (GCH1). Therefore, the expression of TH, AADC, and GCH1 allows for efficient dopamine synthesis.

[0005] Currently under development, gene therapy strategies for Parkinson's disease targeting dopamine synthase use lentiviral vectors carrying expression constructs containing TH, GCH1, and AADC to deliver to the lesion site. The highly expressed TH, GCH1, and AADC increase the effective local dopamine concentration in the midbrain striatum, thereby treating Parkinson's disease. AXO-Lenti-PD (OXB-102), an investigational gene therapy for Parkinson's disease jointly developed by Oxford Biomedica in the UK and Axovant Gene Therapy in the US, employs this strategy. Currently in Phase I / II clinical trials, animal and clinical trial data demonstrate that the drug effectively increases local dopamine levels in the midbrain striatum and improves Parkinson's disease symptoms. Long-term pharmacodynamic studies are ongoing. However, the lentiviral-packaged triple gene vector suffers from low transduction efficiency and dopamine synthesis in neural cells in vivo, resulting in limited efficacy in preclinical models and clinical trials.

[0006] Adeno-associated virus (AAV) vectors belong to the genus Dependivirus in the family Parvoviridae and are small, non-enveloped, linear, single-stranded DNA viruses. Due to their high transfection efficiency and safety, they have become one of the most widely used viral vectors in gene therapy. However, due to the limited packaging capacity of AAV vectors, which can only package DNA fragments of less than 4.7 kb, there are currently no reports of international clinical trials using AAV to express dopamine synthase for the treatment of Parkinson's disease using three genes. Voyager Therapeutics, a US company, uses AAV2-hAADC as a vector and injects it intracranially into the putamen of patients to efficiently express AADC, aiming to treat Parkinson's disease by increasing the efficiency of converting levodopa to dopamine. However, this treatment strategy still requires patients to ingest dopamine prodrugs and does not address their long-term dependence on dopamine prodrugs such as Madopar.

[0007] There is an urgent need for an optimized gene therapy vector for the treatment of Parkinson's disease.

[0008] SUMMARY OF THE INVENTION

[0009] In response to the shortcomings of existing treatment technologies, the present invention provides an AAV vector comprising three key enzymes encoding the synthesis of dopamine - tyrosine hydroxylase (TH), aromatic amino acid decarboxylase (AADC) and GTP-cyclohydrolase 1 (GCH1), wherein any one or more of TH, GCH1 and AADC is a truncated form of the wild type or its functional variant, and the nucleic acid sequences encoding the three enzymes are connected in series in a variety of arrangement orders and connection methods. The present invention breaks through the difficulty of AAV vector packaging three target genes. Through continuous construct optimization, the functional region of the target gene is intercepted, thereby reducing the size of the fragment after the three genes are connected in series, meeting the AAV vector packaging requirements. The AAV vector of the present invention can effectively improve the efficiency of dopamine synthesis after delivery to the nerve cells in the mouse brain, and achieves an excellent therapeutic effect close to functional cure in the Parkinson's disease rat model.

[0010] Accordingly, in a first aspect, the present invention provides an AAV vector comprising nucleic acid sequences encoding tyrosine hydroxylase (TH), GTP-cyclohydrolase 1 (GCH1) and aromatic amino acid dopa decarboxylase (AADC), wherein the nucleic acid sequences encoding TH, GCH1 and / or AADC are linked in frame by a nucleic acid sequence encoding a linker, wherein any one or more of TH, GCH1 and AADC is a truncated form of the wild type or a functional variant thereof and has the catalytic activity required in the dopamine synthesis pathway.

[0011] In some embodiments, the TH encoded by the AAV vector of the present invention is a truncated form of wild-type TH or a functional variant thereof and has the activity of catalyzing the synthesis of levodopa from tyrosine. In some embodiments, TH comprises 330 to 390 amino acid residues. In some embodiments, TH comprises 330 to 380, 330 to 370, 330 to 360, 330 to 350, 330 to 340, 335 to 340, 335 to 380, 340 to 380, 350 to 380, 360 to 380 or 370 to 380 amino acid residues. In some preferred embodiments, TH comprises 330 to 340 amino acid residues. In some more preferred embodiments, TH comprises 335 to 340 amino acid residues, for example, 335, 336, 337, 338, 339 or 340 amino acid residues.

[0012] In some embodiments, TH comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11. In some embodiments, GCH1 comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 9. In some embodiments, AADC comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 7.

[0013] In some embodiments, the linker connecting TH, GCH1 and / or AADC comprises a fusion linker, a 2A peptide linker and / or an internal ribosome entry site (IRES).

[0014] In some embodiments, the fusion linker is a peptide linker. In some embodiments, the peptide linker is selected from (GGS)n, (GGGS)n or (GGGGS)n, wherein n is an integer from 1 to 5. In some preferred embodiments, the fusion linker is (GGGGS)3.

[0015] In some embodiments, the 2A peptide linker comprises a 2A peptide selected from the group consisting of foot-and-mouth disease virus 2A peptide (F2A), porcine teschovirus 2A peptide (P2A), thosea asign virus 2A peptide (T2A), and / or equine rhinitis virus 2A peptide (E2A). In some embodiments, the N-terminus and / or C-terminus of the 2A peptide linker further comprises a GSG amino acid sequence, preferably the N-terminus comprises a GSG amino acid sequence. In some preferred embodiments, the 2A peptide linker comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13 or SEQ ID NO: 15.

[0016] In some embodiments, the nucleic acid sequences encoding TH, GCH1, and AADC in the AAV vector of the present invention are arranged from upstream to downstream in an order selected from any one of the following:

[0017] (1)TH, GCH1, AADC;

[0018] (2) AADC, GCH1, TH;

[0019] (3) AADC, TH, GCH1;

[0020] (4) GCH1, TH, AADC;

[0021] (5) GCH1, AADC, TH; or

[0022] (6)TH, AADC, GCH1.

[0023] In some embodiments, the nucleic acid sequences encoding TH, GCH1, and AADC in the AAV vector of the present invention are linked from upstream to downstream in a manner selected from any one of the following:

[0024] 1) TH-F2A-GCH1-P2A-AADC;

[0025] 2) GCH1-P2A-TH-P2A-AADC;

[0026] 3) GCH1-P2A-AADC-P2A-TH;

[0027] 4) AADC-E2A-GCH1-(G4S)3-TH;

[0028] 5) GCH1-F2A-TH-F2A-AADC;

[0029] 6) AADC-(G4S)3-TH-T2A-GCH1;

[0030] 7) AADC-(G4S)4-TH-T2A-GCH1;

[0031] 8) AADC-P2A-GCH1-P2A-TH;

[0032] 9) AADC-T2A-GCH1-(G4S)3-TH;

[0033] 10) GCH1-F2A-TH-P2A-AADC;

[0034] 11) GCH1-F2A-AADC-F2A-TH;

[0035] 12) AADC-(G4S)3-GCH1-F2A-TH;

[0036] 13) GCH1-E2A-TH-T2A-AADC;

[0037] 14) GCH1-F2A-AADC-P2A-TH;

[0038] 15) AADC-(G4S)3-GCH1-P2A-TH;

[0039] 16) AADC-(G4S)5-GCH1-P2A-TH;

[0040] 17)TH-(G4S)3-GCH1-P2A-AADC;

[0041] 18)GCH1-T2A-AADC-E2A-TH;

[0042] 19)AADC-(G4S)3-GCH1-T2A-TH;

[0043] 20)GCH1-E2A-TH-P2A-AADC;

[0044] 21)AADC-(G4S)3-GCH1-E2A-TH;

[0045] 22)GCH1-E2A-AADC-P2A-TH;

[0046] 23)AADC-(G4S)3-GCH1-(G4S)3-TH;

[0047] 24)GCH1-T2A-TH-E2A-AADC;

[0048] 25)GCH1-(G4S)3-TH-T2A-AADC;

[0049] 26)GCH1-(G4S)2-TH-T2A-AADC;

[0050] 27)GCH1-P2A-AADC-T2A-TH;

[0051] 28)TH-P2A-GCH1-P2A-AADC;

[0052] 29)TH-(G4S)3-GCH1-T2A-AADC;

[0053] 30)GCH1-(G4S)3-TH-E2A-AADC;

[0054] 31)GCH1-T2A-TH-(G4S)3-AADC;

[0055] 32)TH-P2A-GCH1-F2A-AADC;

[0056] 33)GCH1-F2A-TH-(G4S)3-AADC;

[0057] 34)TH-F2A-GCH1-F2A-AADC;

[0058] 35)TH-(G4S)3-GCH1-E2A-AADC;

[0059] 36)TH-G4S-GCH1-E2A-AADC;

[0060] 37)GCH1-P2A-TH-(G4S)3-AADC;

[0061] 38)AADC-F2A-GCH1-P2A-TH;

[0062] 39)TH-T2A-GCH1-(G4S)3-AADC;

[0063] 40)GCH1-E2A-TH-(G4S)3-AADC;

[0064] 41)TH-E2A-GCH1-(G4S)3-AADC;

[0065] 42)TH-T2A-GCH1-E2A-AADC;

[0066] 43)AADC-F2A-GCH1-F2A-TH;

[0067] 44)TH-F2A-GCH1-(G4S)3-AADC;

[0068] 45)GCH1-(G4S)3-TH-(G4S)3-AADC;

[0069] 46)TH-(G4S)3-GCH1-F2A-AADC;

[0070] 47)TH-E2A-GCH1-T2A-AADC;

[0071] 48)AADC-P2A-TH-(G4S)3-GCH1;

[0072] 49)TH-(G4S)3-GCH1-(G4S)3-AADC;

[0073] 50)AADC-F2A-TH-(G4S)3-GCH1;

[0074] 51)TH-F2A-AADC-F2A-GCH1;

[0075] 52)TH-(G4S)3-AADC-T2A-GCH1;

[0076] 53)TH-(G4S)3-AADC-E2A-GCH1;

[0077] 54)AADC-P2A-GCH1-(G4S)3-TH;

[0078] 55)TH-F2A-AADC-(G4S)3-GCH1;

[0079] 56)AADC-F2A-GCH1-(G4S)3-TH;

[0080] 57)TH-P2A-AADC-F2A-GCH1;

[0081] 58)TH-P2A-AADC-(G4S)3-GCH1;

[0082] 59)GCH1-(G4S)3-TH-P2A-AADC;

[0083] 60)TH-T2A-AADC-(G4S)3-GCH1;

[0084] 61)TH-T2A-AADC-E2A-GCH1;

[0085] 62)GCH1-(G4S)3-TH-F2A-AADC;

[0086] 63)TH-E2A-AADC-(G4S)3-GCH1;

[0087] 64)AADC-E2A-GCH1-T2A-TH;

[0088] 65)GCH1-P2A-TH-F2A-AADC;

[0089] 66)TH-(G4S)3-AADC-(G4S)3-GCH1;

[0090] 67)TH-E2A-AADC-T2A-GCH1;

[0091] 68)GCH1-P2A-AADC-F2A-TH;

[0092] 69)AADC-T2A-TH-(G4S)3-GCH1;

[0093] 70)AADC-T2A-GCH1-E2A-TH;

[0094] 71)TH-F2A-AADC-P2A-GCH1;

[0095] 72)AADC-E2A-TH-(G4S)3-GCH1;

[0096] 73)AADC-P2A-GCH1-F2A-TH;

[0097] 74)TH-(G4S)3-AADC-F2A-GCH1;

[0098] 75)AADC-P2A-TH-F2A-GCH1;

[0099] 76)AADC-(G4S)3-TH-P2A-GCH1;

[0100] 77)AADC-T2A-TH-E2A-GCH1;

[0101] 78)AADC-(G4S)3-TH-E2A-GCH1;

[0102] 79) AADC-E2A-TH-T2A-GCH1; or

[0103] 80)AADC-(G4S)3-TH-F2A-GCH1.

[0104] In some preferred embodiments, the AAV vector of the invention comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of SEQ ID NOs: 19-21.

[0105] In some embodiments, the AAV vector of the present invention further comprises a promoter operably linked to a nucleic acid sequence encoding TH, GCH1, and AADC. In some embodiments, the promoter is selected from the group consisting of a CBH promoter, a chimeric synapsin I promoter, a CMV promoter, a CAG promoter, a CAGG promoter, and a CASI promoter. In some embodiments, the promoter comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1-6. In some preferred embodiments, the promoter comprises the nucleic acid sequence shown in any one of SEQ ID NOs: 1-3. In some more preferred embodiments, the promoter comprises the nucleic acid sequence shown in SEQ ID NO: 1.

[0106] In some embodiments, the AAV vector of the present invention further comprises one or more elements selected from the group consisting of a KOZAK sequence, a polyadenylation signal of SV40 virus (SV40 poly A), and an inverted terminal repeat (ITR).

[0107] In a second aspect, the present invention provides an AAV virus particle comprising an AAV vector according to the first aspect of the present invention, and a capsid protein. In some embodiments, the capsid protein of the AAV virus particle is derived from an AAV selected from the following serotypes: AAV5, AAV9, AAVPHP.eB, AAVPHP.S or AAVPHP.B. In some embodiments, the capsid protein comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NOs: 33-37. In some preferred embodiments, the capsid protein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 34 or 37. In some more preferred embodiments, the capsid protein comprises the amino acid sequence shown in SEQ ID NO: 34.

[0108] In a third aspect, the present invention provides a composition comprising the AAV vector of the first aspect of the present invention and a packaging plasmid encoding a capsid protein, and optionally a helper plasmid.

[0109] In some embodiments, the packaging plasmid further comprises a nucleic acid sequence encoding a Rep protein, wherein the Rep protein is derived from an AAV having an AAV2 or AAVPHP.B serotype. In some embodiments, the Rep protein comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 45 or SEQ ID NO: 46. In some preferred embodiments, the Rep protein comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 46.

[0110] In some embodiments, the packaging plasmid in the composition comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of SEQ ID NOs: 24-28, 48. In some preferred embodiments, the packaging plasmid comprises a nucleic acid sequence selected from SEQ ID NOs: 25 or 28. In some more preferred embodiments, the packaging plasmid comprises the nucleic acid sequence set forth in SEQ ID NO: 25.

[0111] In some embodiments, the helper plasmid comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:29.

[0112] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier, diluent or excipient. In a fourth aspect, the present invention provides a composition comprising the AAV virus particle of the second aspect of the present invention, and optionally a pharmaceutically acceptable carrier, diluent or excipient.

[0113] In the embodiment of the composition of the third aspect and the fourth aspect of the present invention, the pharmaceutically acceptable carrier, diluent or excipient is a buffer. In some embodiments, the buffer comprises phosphate buffer, sodium chloride and F68 surfactant (also known as poloxamer 188, Poloxamer 188).

[0114] In some embodiments, the phosphate buffer is a sodium phosphate buffer or a potassium phosphate buffer. In some preferred embodiments, the phosphate buffer is a sodium phosphate buffer.

[0115] In some embodiments, the pH of the buffer is 6.5-8, for example, pH 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8 or 7.9. In some preferred embodiments, the buffer comprises 5-15 mM phosphate buffer, 130-170 mM sodium chloride and 0.0005%-0.002% F68 surfactant. For example, in the buffer, the concentration of phosphate buffer can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 mM; the concentration of sodium chloride can be 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 , 161, 162, 163, 164, 165, 166, 167, 168, 169 or 170 mM; the content of F68 surfactant can be 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.0011%, 0.0012%, 0.0013%, 0.0014%, 0.0015%, 0.0016%, 0.0017%, 0.0018%, 0.0019%, 0.002%.

[0116] In some embodiments, the buffer comprises 10 mM sodium phosphate buffer, 150 mM sodium chloride, and 0.001% F68 surfactant at a pH of 7.4.

[0117] In a fifth aspect, the present invention provides a cell comprising the AAV vector according to the first aspect, the AAV virus particle according to the second aspect, or the composition according to the third aspect or the fourth aspect.

[0118] In some embodiments, the cells are neural cells, differentiated by function, and the neural cells are selected from: inhibitory neurons (preferably, the cells are medium spiny neurons, interneurons), excitatory neurons (preferably, the cells are dopaminergic neurons), microglia, astrocytes, oligodendrocytes, or Schwann cells. In some preferred embodiments, differentiated by brain region, the cells are midbrain striatal neurons and glial cells.

[0119] In a sixth aspect, the present invention provides use of the AAV vector according to the first aspect, the AAV viral particle according to the second aspect, the composition according to the third aspect or the fourth aspect, and the cell according to the fifth aspect of the present invention in the preparation of a medicament for preventing and / or treating a disease caused by dopamine deficiency in a subject. In some embodiments, the disease is Parkinson's disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0120] FIG1 shows a schematic diagram of the structures of different AAV vectors used in the present invention.

[0121] Figure 2 shows a plasmid map of pAAV-MCS-CBH-SV40. MCS stands for multiple cloning site.

[0122] Figure 3 shows the expression of target proteins in 293T cells after transduction of the AAV9-CBH-TFGPD virus, as detected by Western blot. AADC stands for aromatic amino acid decarboxylase, GCH1 for GTP-cyclohydrolase 1, TH for tyrosine hydroxylase, and GAPDH for glyceraldehyde-3-phosphate dehydrogenase (used as an internal control). The control virus was AAV9-CBH-EGFP.

[0123] Figure 4 shows dopamine concentration in the cell supernatant 72 hours after infection of 293T cells with the AAV-CBH-TFGPD vector in vitro. Error bars represent standard error (SEM). The control virus was AAV9-CBH-EGFP, and DA represents dopamine. Statistical analysis was performed using one-way ANOVA. ***: p < 0.005.

[0124] Figure 5 shows the efficiency of dopamine synthesis mediated by different AAV vectors in mice. Error bars represent standard error (SEM). The control virus was AAV9-CBH-EGFP. DA represents dopamine, and HVA represents the dopamine metabolite homovanillic acid. Statistical analysis was performed using one-way ANOVA. ns represents no significant difference. *: p < 0.05, **: p < 0.01. n = 3.

[0125] Figure 6 shows the efficiency of dopamine synthesis mediated by AAV vectors of different serotypes in mice. Error bars represent standard error (SEM). DA represents dopamine, and HVA represents the dopamine metabolite homovanillic acid. Two-tailed t-test was used for significance analysis. *: p < 0.05, **: p < 0.01, ***: p < 0.001. n = 3.

[0126] Figure 7 shows the efficiency of dopamine synthesis mediated by AAV vectors containing different promoters in mice. Error bars represent standard error (SEM). DA represents dopamine, and HVA represents the dopamine metabolite homovanillic acid. Significance was analyzed using a two-tailed t-test. *: p < 0.05, **: p < 0.01, ***: p < 0.001. n = 3.

[0127] Figure 8 shows the efficiency of dopamine synthesis mediated by AAV vectors containing different linkers in mice. Error bars represent standard error (SEM), and DA stands for dopamine. Statistical analysis was performed using one-way ANOVA. ns means no significant difference, **: p < 0.01, n = 3.

[0128] Figure 9 shows the efficacy of different AAV vectors in a Parkinson's disease rat model. The line graph represents the APO-induced rotational velocity (r / min) in different dosing groups, with error bars representing the standard error (SEM). Each dose group was compared with the placebo group, and statistical analysis was performed using one-way analysis of variance. ***: p < 0.001.

[0129] FIG10 shows Nissl staining images of the striatum of wild-type C57 / B6 mice after injection of a composition of AAV viral particles and a buffer system.

[0130] Detailed Description of the Invention

[0131] The present invention provides AAV vectors, AAV virus particles or compositions, which can be used for efficient gene therapy of diseases characterized by dopamine deficiency, such as Parkinson's disease. Specifically, the present invention provides an AAV vector comprising a series of constructs, in which three proteins, functional tyrosine hydroxylase (TH), GTP-cyclohydrolase 1 (GCH1), and aromatic amino acid dopa decarboxylase (AADC), are connected with a linker and then cloned into an AAV expression vector. Among them, any one or more of TH, GCH1 and AADC is a truncated form of the wild type or its functional variant and has the catalytic activity required in the dopamine synthesis pathway. Preferably, TH is a truncated form of wild-type TH, and it retains the function of wild-type TH.

[0132] Compared with the prior art, the present invention has at least the following advantages:

[0133] 1. The AAV vector of the present invention significantly improves the gene transduction efficiency in 293T cells in vitro, and significantly increases the expression level of the target protein and the levels of dopamine and its metabolites;

[0134] 2. The AAV vectors containing different constructs of the present invention significantly improved the gene transduction efficiency in neural cells in vivo, and significantly increased the levels of dopamine and its metabolites;

[0135] 3. The AAV viral particles of the present invention with different serotypes were able to successfully transduce neurons in the mouse brain, and the levels of dopamine and its metabolites in the cells were significantly increased;

[0136] 4. The AAV vectors containing different promoters of the present invention were able to successfully transduce neurons in the mouse brain, and the levels of dopamine and its metabolites in the cells were significantly increased;

[0137] 5. The AAV vectors containing different linkers of the present invention were able to successfully transduce neurons in the mouse brain, and the levels of dopamine and its metabolites in the cells were significantly increased;

[0138] 6. The AAV vector of the present invention can significantly improve the motor ability of a rat model of Parkinson's disease. Compared with Prosavin, a lentiviral vector drug used to treat Parkinson's disease (Mimoun Azzouz, et al. The Journal of Neuroscience, 2002, 22(23): 10302-10312), the AAV vector of the present invention has significantly improved efficacy in rats, and the AAV vector of the present invention shows a clear dose-effect relationship in the efficacy model.

[0139] 7. The present invention breaks through the technical bottleneck and achieves a significant improvement in gene transduction efficiency while carrying three genes on AAV. The expression level of the target protein and the level of dopamine and its metabolites are significantly increased, and are not restricted by promoters, serotypes, gene sequences, or linkers.

[0140] Some embodiments according to the present invention will be described more fully below. However, various aspects of the present invention may be embodied in different forms and should not be construed as being limited to the embodiments set forth herein. On the contrary, these embodiments are provided to make the present invention thorough and complete and to fully convey the scope of the present invention to those skilled in the art. The terms used in the description herein are only for the purpose of describing specific embodiments and are not intended to be limiting.

[0141] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. It should also be understood that terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of this application and the relevant art, and should not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0142] Unless explicitly stated otherwise, the various features of the invention described herein may be used in any combination. In addition, the present invention also contemplates that in embodiments, any feature or combination of features set forth herein may be excluded or omitted.

[0143] Unless expressly stated otherwise, all references to certain embodiments, features, and terms are intended to include both the recited embodiment, feature, or term and its biological equivalents.

[0144] All references, articles, publications, patent publications and patent applications cited herein are incorporated by reference in their entirety for all purposes. However, the mention of any reference, article, publication, patent publication and patent application cited herein is not and should not be taken as an admission or any form of representation that they constitute available prior art or form part of the common general knowledge in any country in the world.

[0145] definition

[0146] Unless otherwise indicated, the practice of the present invention will employ conventional techniques of organic chemistry, pharmacology, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of the art. See, for example, Sambrook, Fritsch, and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd ed. (1989); Current Protocols In Molecular Biology (FM Ausubel et al., ed., (1987)); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (MJ MacPherson, BD Hames, and GR Taylor, ed. (1995)); Harlow and Lane, ed., (1988); Antibodies, a Laboratory Manual, and Animal Cell Culture (RI. Freshney, ed. (1987)).

[0147] As used herein, the terms "comprising," "including," and "having" are intended to indicate that a vector, composition, or method includes the stated elements, but not excluding other elements.

[0148] As used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items. For example, a composition comprising A and / or B can be interpreted as a composition comprising A, a composition comprising B, or a composition comprising A and B.

[0149] All numerical designations, such as pH, temperature, time, concentration, and molecular weight, including ranges, are approximate and are optionally varied (+) or (-) in increments of 1.0 or 0.1, or by variations of + / - 15%, 10%, 5%, or 2%, as appropriate. It should be understood that all numerical designations are preceded by the term "about." It should also be understood that the agents described herein are exemplary only and that equivalents thereof are known in the art. As used herein, the term "about" when referring to a measurable value such as an amount or concentration, etc., is intended to include variations within 20%, 10%, 5%, 1%, 0.5%, or 0.1% of the specified amount.

[0150] As used herein, the terms "acceptable," "effective," or "sufficient" when used to describe the selection of any component, range, dosage form, etc., mean that the component, range, dosage form, etc. is suitable for the disclosed purpose.

[0151] As used herein, the terms "nucleic acid sequence," "nucleotide sequence," and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Thus, the term includes, but is not limited to, single-stranded, double-stranded, or double-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising, consisting of, or consisting essentially of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases.

[0152] The terms "protein", "peptide", "polypeptide" and "amino acid sequence" are used interchangeably and in their broadest sense refer to a polymeric form of two or more amino acid subunits, amino acid analogs or peptidomimetics. "Protein", "peptide", "polypeptide" and "amino acid sequence" contain at least two amino acids and there is no limitation on the maximum number of amino acids. The term "amino acid" as used herein refers to natural and / or unnatural or synthetic amino acids, including D and L optical isomers and amino acid analogs.

[0153] "Homology" or "identity" refers to the sequence similarity between two polypeptides or between two nucleic acid sequences. The percent identity can be determined by comparing positions in each sequence that can be aligned for the purpose of comparison. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position. The degree of identity between sequences depends on the number of shared matching positions. "Unrelated" or "non-homologous" sequences share less than 40% identity, less than 25% identity with one of the sequences of the present invention. The alignment and percent sequence identity of the nucleic acid or amino acid sequences provided herein can be determined by importing the nucleic acid or amino acid sequence into ClustalW (available at https: / / genome.jp / tools-bin / clustalw / ) and using ClustalW.

[0154] When referring to specific molecules, biological materials or cellular substances, the terms "equivalent" or "bioequivalent" are used interchangeably and refer to those having minimal homology while still retaining the desired structure or function. Non-limiting examples of equivalent polypeptides include polypeptides having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% identity to a reference polypeptide (e.g., a wild-type polypeptide); or polypeptides encoded by polynucleotides having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% identity to a reference polynucleotide (e.g., a wild-type polynucleotide).

[0155] As used herein, amino acid modifications can be amino acid substitutions, amino acid deletions, or amino acid insertions. Amino acid substitutions can be conservative amino acid substitutions or non-conservative amino acid substitutions. Conservative substitutions (also referred to as conservative mutations, conservative substitutions, or conservative variations) are amino acid substitutions in proteins that change a given amino acid into a different amino acid with similar biochemical properties (e.g., charge, hydrophobicity, or size). As used herein, "conservative variation" refers to the replacement of an amino acid residue by another biologically similar residue. Examples of conservative variations include the replacement of one hydrophobic residue such as isoleucine, valine, leucine, or methionine with another; or the replacement of one charged or polar residue with another, such as arginine with lysine, glutamic acid with aspartic acid, glutamine with asparagine, etc. Other illustrative examples of conservative substitutions include the following changes: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine or glutamic acid; phenylalanine to tyrosine, serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and the like.

[0156] As used herein, "expression" refers to the process by which a nucleic acid sequence is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, amino acid sequence, or protein. If the nucleic acid sequence is from genomic DNA, expression may include splicing of mRNA in a eukaryotic cell.

[0157] The term "encoding" when applied to a nucleic acid sequence refers to a nucleic acid sequence that, in its native state or when manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA and / or translated to produce a polypeptide. The antisense strand is the complement of such a nucleic acid, and the coding sequence can be deduced therefrom.

[0158] As used herein, the term "promoter" refers to an expression control sequence that controls the initiation and rate of transcription of a gene or transgene. Promoters can be, for example, constitutive, inducible, repressible, or tissue-specific. Promoters can contain genetic elements to which regulatory proteins and molecules such as RNA polymerase and transcription factors can bind.

[0159] Non-limiting examples of promoters include pol I promoter, pol II promoter, pol III promoter, T7 promoter, U6 promoter, H1 promoter, retroviral Rous sarcoma virus LTR promoter, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, elongation factor 1 alpha short (EFS) promoter, β-glucuronidase (GUSB) promoter, cytomegalovirus (CMV) immediate early (IE) enhancer and / or promoter, chicken β-actin (CBA) promoter or derivatives thereof such as CAG promoter, CB promoter. , (human) elongation factor 1α-subunit (EF1α) promoter, ubiquitin C (UBC) promoter, prion promoter, neuron-specific enolase (NSE), neurofilament light chain (NFL) promoter, neurofilament heavy chain (NFH) promoter, platelet-derived growth factor (PDGF) promoter, platelet-derived growth factor B chain (PDGF-β) promoter, synapsin (Syn) promoter, synapsin 1 (Syn1) promoter, methyl-CpG binding protein 2 (MeCP2) promoter, Ca 2+ / calmodulin-dependent protein kinase II (CaMKII) promoter, metabotropic glutamate receptor 2 (mGluR2) promoter, neurofilament light chain (NFL) promoter, neurofilament heavy chain (NFH) promoter, β-globin minigene nβ2 promoter, preproenkephalin (PPE) promoter, enkephalin (Enk) promoter, excitatory amino acid transporter 2 (EAAT2) promoter, glial fibrillary acidic protein (GFAP) promoter, myelin basic protein (MBP) promoter, or functional fragments thereof.

[0160] As known in the art, the nucleotide sequences of these promoters can be modified to increase or decrease the efficiency of mRNA transcription. Promoters of synthetic origin can be used for ubiquitous or tissue-specific expression. In addition, promoters of viral origin, some of which are described above, can be used in the methods disclosed herein, such as CMV, HIV, adenovirus, and AAV promoters. In an embodiment, a promoter can be used together with an enhancer to increase transcription efficiency. Non-limiting examples of enhancers include interstitial retinoid binding protein (IRBP) enhancer, RSV enhancer, or CMV enhancer.

[0161] As used herein, "poly A" or "poly A" refers to a string of adenine ribonucleotides or adenosine monophosphate (e.g., a string of RNA in which each base is adenine). This poly A sequence is important for nuclear export, translation, and stability of mRNA. The length of the poly A sequence can vary among different mRNA or RNA sequences of the present invention and can be about 250 nucleotides, about 230 nucleotides, about 200 nucleotides, about 180 nucleotides, about 160 nucleotides, about 140 nucleotides, about 120 nucleotides, about 100 nucleotides, or less of poly A.

[0162] As used herein, "poly A signal sequence," "polyadenylation signal sequence," or "poly A signal sequence" refers to an RNA sequence (e.g., AAUAAA) located downstream of the most 3' coding region and recognized by an RNA cleavage complex that cleaves the 3' terminal sequence of the newly transcribed RNA by an RNA polymerase (e.g., Pol II) so that polyadenylation can occur. Poly A polymerase then adds and extends the poly A tail by adding adenosine monophosphate units from ATP to the newly cleaved 3' end of the RNA. The poly A signal sequences recognized by the RNA cleavage complex vary among different groups of eukaryotes, with most human polyadenylation sites containing the AAUAAA sequence, although this sequence is less common in plant and fungal mRNAs. All of these sequence motifs that are recognized by the RNA cleavage complex for RNA cleavage and subsequent polyadenylation are within the scope of the poly A signal sequence.

[0163] Exemplary poly A signal sequences include bovine growth hormone polyadenylation signal (bGH poly A), small poly A signal (SPA), human growth hormone polyadenylation signal (hGH poly A), the polyadenylation signal of SV40 virus (SV40 poly A), rabbit beta globin poly A sequence (rBG poly A), or variants thereof.

[0164] As used herein, the term "vector" refers to a nucleic acid that can carry a nucleic acid sequence encoding a protein of interest and, when, for example, the vector is placed in a cell by a transfection, infection, or transformation process, can promote the expression of the protein of interest. It is understood in the art that once entering the cell, the vector can be replicated as an extrachromosomal (episomal) element or can be integrated into the host cell chromosome. Vectors include plasmids, cosmids, phagemids, or artificial chromosomes. Vectors can include nucleic acids derived from retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, baculoviruses, or other naturally occurring or modified viruses.

[0165] As used herein, "viral vector" refers to a vector that can be packaged and recombinantly produced into viral particles, which contain a polynucleotide to be delivered into a host cell in vivo, ex vivo, or in vitro. Examples of viral vectors include retroviral vectors, AAV vectors, lentiviral vectors, adenoviral vectors, alphaviral vectors, and the like.

[0166] A "gene therapy vector" is defined as any molecule that can carry an inserted polynucleotide into a host cell. Examples of gene therapy vectors are liposomes, micelles, biocompatible polymers, including natural and synthetic polymers, lipoproteins, polypeptides, polysaccharides, lipopolysaccharides, artificial viral envelopes, metal particles, bacteria, viruses (such as baculoviruses, adenoviruses, and retroviruses), bacteriophages, cosmids, plasmids, fungal vectors, and other recombinant vectors commonly used in the art, which have been described for expression in a variety of eukaryotic and prokaryotic hosts and can be used for gene therapy as well as for protein expression.

[0167] "Plasmid" is a DNA molecule that is usually separated from chromosomal DNA and can replicate independently of chromosomal DNA. In many cases, it is circular and double-stranded. Plasmids provide a mechanism for horizontal gene transfer within a microbial population and generally provide a selective advantage under given environmental conditions. Plasmids can carry genes that provide resistance to naturally occurring antibiotics in competitive environmental niches, or alternatively, the proteins produced can act as toxins under similar environments. It is known in the art that although plasmid vectors typically exist as extrachromosomal circular DNA molecules, plasmid vectors can also be designed to stably integrate into the host chromosome in a random or targeted manner, and this integration can be accomplished using circular plasmids or plasmids that have been linearized before being introduced into the host cell.

[0168] The "plasmids" used in genetic engineering are called "plasmid vectors." Many plasmids are commercially available for such uses. The gene to be replicated is inserted into a copy of the plasmid, which contains a gene that makes the cell resistant to a specific antibiotic and a multiple cloning site (MCS or polylinker), which is a short region containing several common restriction sites that allow DNA fragments to be easily inserted at this location. Another major use of plasmids is to produce large amounts of proteins. In this case, researchers culture bacteria or eukaryotic cells containing a plasmid carrying the gene of interest, which can be induced to produce large amounts of protein from the inserted gene.

[0169] Term used herein " tissue " refers to the tissue of living or dead organism or any tissue derived from or designed to imitate living or dead organism.Described tissue can be healthy, sick and / or have genetic mutation.Biological tissue can comprise any single organization (for example, the collection of cells that can be interconnected), or constitute the tissue of the part or region of the body of an organ or organism.This tissue can comprise, be basically made up of or be made up of homogenous cellular material, or it can be composite structure, for example, the structure found in the body region including thoracic cavity, for example, can comprise lung tissue, skeletal tissue and / or muscle tissue.Exemplary tissue includes but is not limited to being derived from those of liver, lung, thyroid, skin, pancreas, blood vessel, bladder, kidney, brain, bile duct, duodenum, abdominal aorta, iliac vein, heart and intestine, comprises its any combination.

[0170] The term "subject" is not limited to a particular species. In some embodiments, subjects include non-human animals undergoing diagnosis or treatment and those animals undergoing infection or animal models, including but not limited to simian, mouse, rat, dog or lagomorph species, as well as other livestock, sports animals or pets. In some embodiments, the subject is a human.

[0171] As used herein, "treatment" of a disease in a subject refers to (1) preventing the symptoms or disease from occurring in a subject who is susceptible to or does not yet exhibit symptoms of the disease; (2) inhibiting the disease or preventing its development; or (3) ameliorating the symptoms of the disease or causing regression of the symptoms. As understood in the art, "treatment" is an approach for obtaining beneficial or desired results, including clinical results. For purposes of the present invention, beneficial or desired results can include reducing the extent of one or more diseases or conditions, delaying or slowing the progression of a disease or condition, improving or alleviating the state of a disease or condition (whether partially or completely).

[0172] The term "effective amount" as used herein means an amount sufficient to achieve the desired effect. In the case of therapeutic or preventive applications, the effective amount will depend on the type and severity of the condition in question and the characteristics of the individual subject, such as general health, age, sex, weight, and tolerance to drugs. In the context of gene therapy, an effective amount is an amount sufficient to cause the restoration of partial or full function of a gene that is defective in a subject. In some embodiments, the effective amount of an AAV vector is an amount sufficient to cause the expression of a gene in a subject. In some embodiments, the effective amount is the amount required to increase dopamine expression in a subject in need thereof.

[0173] The effective amount will depend on the nature of the application in question, the individual characteristics and sensitivity of the target subject, and the method used. Those skilled in the art will be able to determine the effective amount based on these factors. In some embodiments, the effective amount can include one or more administrations of the AAV vector, AAV viral particle, or composition.

[0174] As used herein, the term "administering" is intended to mean delivering a substance to a subject, such as an animal or a human. Administration can be performed in a single dose, continuously, or intermittently throughout the course of treatment. Methods for determining the most effective mode of administration and dosage are known to those skilled in the art and will vary with factors such as the composition used for treatment, the purpose of treatment, and the age, health, or sex of the subject being treated. In some embodiments, single or multiple administrations may be performed, with the dosage level and pattern being selected by a physician, or in the case of pets and other animals, by a veterinarian.

[0175] AAV vectors

[0176] “Adeno-associated virus” or “AAV” belongs to the genus Dependoparvovirus, family Parvoviridae. AAV is a single-stranded DNA virus consisting of a viral genome and a capsid. The AAV genome consists of the rep gene and the cap gene, flanked by two inverted terminal repeats (ITRs). The rep gene encodes the Rep protein, which is involved in viral replication and packaging, while the cap gene encodes the capsid protein of the virus. The “ITRs” or “inverted terminal repeats” can form a T-shaped palindrome that participates in the replication and packaging process of AAV, which is usually required to complete the lytic and latent life cycle of AAV.

[0177] The term "viral capsid" or "capsid" refers to the protein coat of the viral particle. The capsid's function is to encapsidate, protect, transport, and release the viral genome into the host cell. The capsid is typically composed of oligomeric structural protein subunits (capsid proteins). The AAV capsid is composed of a mixture of three viral capsid proteins: VP1, VP2, and VP3.

[0178] AAV itself is replication-defective and can only remain latent in host cells without the presence of a helper virus. Therefore, the production of AAV vectors usually requires a helper plasmid to provide key genes involved in AAV replication.

[0179] As used herein, "AAV vector" and "recombinant AAV (rAAV) vector" are used interchangeably to refer to a vector comprising one or more heterologous nucleic acid sequences and one or more ITRs. When an AAV vector is present in a host cell that provides functional rep and cap gene products, the AAV vector can be replicated and packaged into infectious viral particles with the help of a helper virus or helper plasmid.

[0180] In some embodiments, the AAV vector of the present invention comprises nucleic acid sequences encoding tyrosine hydroxylase (TH), GTP-cyclohydrolase 1 (GCH1), and aromatic amino acid dopa decarboxylase (AADC), wherein the nucleic acid sequences encoding TH, GCH1, and AADC are linked in frame by a nucleic acid sequence encoding a linker, wherein any one or more of TH, GCH1, and AADC is a truncated form of the wild type or a functional variant thereof and has the catalytic activity required in the dopamine synthesis pathway.

[0181] In some embodiments, the TH encoded by the AAV vector of the present invention is a truncated form of wild-type TH or a functional fragment thereof, and the truncated form of TH has the activity of catalyzing the synthesis of levodopa from tyrosine. In some embodiments, TH comprises 330 to 390 amino acid residues. In some embodiments, TH comprises 330 to 380, 330 to 370, 330 to 360, 330 to 350, 330 to 340, 335 to 340, 335 to 380, 340 to 380, 350 to 380, 360 to 380, or 370 to 380 amino acid residues. In some preferred embodiments, TH comprises 330 to 340 amino acid residues. In some more preferred embodiments, TH comprises 335 to 340 amino acid residues, for example, 335, 336, 337, 338, 339, or 340 amino acid residues.

[0182] In some embodiments, TH comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11. In some embodiments, GCH1 comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 9. In some embodiments, AADC comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 7.

[0183] In some embodiments, the linker connecting TH, GCH1 and / or AADC comprises a fusion linker, a 2A peptide linker and / or an internal ribosome entry site (IRES).

[0184] In some embodiments, the fusion linker is a peptide linker. In some embodiments, the peptide linker is selected from (GGS)n, (GGGS)n or (GGGGS)n, wherein n is an integer from 1 to 5. In some preferred embodiments, the fusion linker is (G4S)3 (SEQ ID NO: 17, GGGGSGGGGSGGGGS).

[0185] In some embodiments, the 2A peptide linker comprises a 2A peptide selected from the group consisting of foot-and-mouth disease virus 2A peptide (F2A), porcine teschovirus 2A peptide (P2A), Thosea asign virus 2A peptide (T2A), and / or equine rhinitis virus 2A peptide (E2A).

[0186] 2A peptides are short viral peptides (approximately 18-25 amino acids, e.g., ATNFSLLKQAGDVEENPGP) that enable the translation of multiple polypeptide chains from a single transcript. 2A peptides work by causing the ribosome to skip the synthesis of the glycine and proline peptide bonds at the C-terminus of the 2A element, ultimately leading to the separation of the end of the 2A sequence from the downstream polypeptide chain. After translation of two proteins linked by the nucleotide sequence encoding the 2A peptide, the upstream protein will have additional 2A residues at its C-terminus, while the downstream protein will have an additional proline at its N-terminus.

[0187] In some embodiments, the N-terminus and / or C-terminus of the 2A peptide linker further comprises a GSG amino acid sequence, preferably the N-terminus comprises a GSG amino acid sequence. In some preferred embodiments, the 2A peptide linker comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 13 or SEQ ID NO: 15.

[0188] In some embodiments, the nucleic acid sequences encoding TH, GCH1, and AADC in the AAV vector of the present invention are arranged from upstream to downstream in an order selected from any one of the following:

[0189] (1)TH, GCH1, AADC;

[0190] (2) AADC, GCH1, TH;

[0191] (3) AADC, TH, GCH1;

[0192] (4) GCH1, TH, AADC;

[0193] (5) GCH1, AADC, TH; or

[0194] (6)TH, AADC, GCH1.

[0195] In some embodiments, the nucleic acid sequences encoding TH, GCH1, and AADC in the AAV vector of the present invention are linked from upstream to downstream in a manner selected from any one of the following:

[0196] 1) TH-F2A-GCH1-P2A-AADC;

[0197] 2) GCH1-P2A-TH-P2A-AADC;

[0198] 3) GCH1-P2A-AADC-P2A-TH;

[0199] 4) AADC-E2A-GCH1-(G4S)3-TH;

[0200] 5) GCH1-F2A-TH-F2A-AADC;

[0201] 6) AADC-(G4S)3-TH-T2A-GCH1;

[0202] 7) AADC-(G4S)4-TH-T2A-GCH1;

[0203] 8) AADC-P2A-GCH1-P2A-TH;

[0204] 9) AADC-T2A-GCH1-(G4S)3-TH;

[0205] 10) GCH1-F2A-TH-P2A-AADC;

[0206] 11) GCH1-F2A-AADC-F2A-TH;

[0207] 12)AADC-(G4S)3-GCH1-F2A-TH;

[0208] 13)GCH1-E2A-TH-T2A-AADC;

[0209] 14)GCH1-F2A-AADC-P2A-TH;

[0210] 15)AADC-(G4S)3-GCH1-P2A-TH;

[0211] 16)AADC-(G4S)5-GCH1-P2A-TH;

[0212] 17)TH-(G4S)3-GCH1-P2A-AADC;

[0213] 18)GCH1-T2A-AADC-E2A-TH;

[0214] 19)AADC-(G4S)3-GCH1-T2A-TH;

[0215] 20)GCH1-E2A-TH-P2A-AADC;

[0216] 21)AADC-(G4S)3-GCH1-E2A-TH;

[0217] 22)GCH1-E2A-AADC-P2A-TH;

[0218] 23)AADC-(G4S)3-GCH1-(G4S)3-TH;

[0219] 24)GCH1-T2A-TH-E2A-AADC;

[0220] 25)GCH1-(G4S)3-TH-T2A-AADC;

[0221] 26)GCH1-(G4S)2-TH-T2A-AADC;

[0222] 27)GCH1-P2A-AADC-T2A-TH;

[0223] 28)TH-P2A-GCH1-P2A-AADC;

[0224] 29)TH-(G4S)3-GCH1-T2A-AADC;

[0225] 30)GCH1-(G4S)3-TH-E2A-AADC;

[0226] 31)GCH1-T2A-TH-(G4S)3-AADC;

[0227] 32)TH-P2A-GCH1-F2A-AADC;

[0228] 33)GCH1-F2A-TH-(G4S)3-AADC;

[0229] 34)TH-F2A-GCH1-F2A-AADC;

[0230] 35)TH-(G4S)3-GCH1-E2A-AADC;

[0231] 36)TH-G4S-GCH1-E2A-AADC;

[0232] 37)GCH1-P2A-TH-(G4S)3-AADC;

[0233] 38)AADC-F2A-GCH1-P2A-TH;

[0234] 39)TH-T2A-GCH1-(G4S)3-AADC;

[0235] 40)GCH1-E2A-TH-(G4S)3-AADC;

[0236] 41)TH-E2A-GCH1-(G4S)3-AADC;

[0237] 42)TH-T2A-GCH1-E2A-AADC;

[0238] 43)AADC-F2A-GCH1-F2A-TH;

[0239] 44)TH-F2A-GCH1-(G4S)3-AADC;

[0240] 45)GCH1-(G4S)3-TH-(G4S)3-AADC;

[0241] 46)TH-(G4S)3-GCH1-F2A-AADC;

[0242] 47)TH-E2A-GCH1-T2A-AADC;

[0243] 48)AADC-P2A-TH-(G4S)3-GCH1;

[0244] 49)TH-(G4S)3-GCH1-(G4S)3-AADC;

[0245] 50)AADC-F2A-TH-(G4S)3-GCH1;

[0246] 51)TH-F2A-AADC-F2A-GCH1;

[0247] 52)TH-(G4S)3-AADC-T2A-GCH1;

[0248] 53)TH-(G4S)3-AADC-E2A-GCH1;

[0249] 54)AADC-P2A-GCH1-(G4S)3-TH;

[0250] 55)TH-F2A-AADC-(G4S)3-GCH1;

[0251] 56)AADC-F2A-GCH1-(G4S)3-TH;

[0252] 57)TH-P2A-AADC-F2A-GCH1;

[0253] 58)TH-P2A-AADC-(G4S)3-GCH1;

[0254] 59)GCH1-(G4S)3-TH-P2A-AADC;

[0255] 60)TH-T2A-AADC-(G4S)3-GCH1;

[0256] 61)TH-T2A-AADC-E2A-GCH1;

[0257] 62)GCH1-(G4S)3-TH-F2A-AADC;

[0258] 63)TH-E2A-AADC-(G4S)3-GCH1;

[0259] 64)AADC-E2A-GCH1-T2A-TH;

[0260] 65)GCH1-P2A-TH-F2A-AADC;

[0261] 66)TH-(G4S)3-AADC-(G4S)3-GCH1;

[0262] 67)TH-E2A-AADC-T2A-GCH1;

[0263] 68)GCH1-P2A-AADC-F2A-TH;

[0264] 69)AADC-T2A-TH-(G4S)3-GCH1;

[0265] 70)AADC-T2A-GCH1-E2A-TH;

[0266] 71)TH-F2A-AADC-P2A-GCH1;

[0267] 72)AADC-E2A-TH-(G4S)3-GCH1;

[0268] 73)AADC-P2A-GCH1-F2A-TH;

[0269] 74)TH-(G4S)3-AADC-F2A-GCH1;

[0270] 75)AADC-P2A-TH-F2A-GCH1;

[0271] 76)AADC-(G4S)3-TH-P2A-GCH1;

[0272] 77)AADC-T2A-TH-E2A-GCH1;

[0273] 78)AADC-(G4S)3-TH-E2A-GCH1;

[0274] 79) AADC-E2A-TH-T2A-GCH1; or

[0275] 80)AADC-(G4S)3-TH-F2A-GCH1.

[0276] In some preferred embodiments, the AAV vector of the present invention comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of SEQ ID NOs: 19-21.

[0277] In some embodiments, the AAV vector of the present invention further comprises a promoter operably linked to a nucleic acid sequence encoding TH, GCH1, and AADC. Promoters suitable for use in the present invention include, but are not limited to, pol I promoter, pol II promoter, pol III promoter, T7 promoter, U6 promoter, H1 promoter, retroviral Rous sarcoma virus LTR promoter, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, elongation factor 1α short (EFS) promoter, β-glucuronidase (GUSB) promoter, cytomegalovirus (CMV) immediate early (IE) enhancer and / or promoter, chicken β-actin (CBA) promoter, or derivatives thereof. Biological promoters such as CAG promoter, CB promoter, (human) elongation factor 1α-subunit (EF1α) promoter, ubiquitin C (UBC) promoter, prion promoter, neuron-specific enolase (NSE), neurofilament light chain (NFL) promoter, neurofilament heavy chain (NFH) promoter, platelet-derived growth factor (PDGF) promoter, platelet-derived growth factor B chain (PDGF-β) promoter, synapsin (Syn) promoter, synapsin I (Syn I) promoter, methyl-CpG binding protein 2 (MeCP2) promoter, Ca 2+ / calmodulin-dependent protein kinase II (CaMKII) promoter, metabotropic glutamate receptor 2 (mGluR2) promoter, neurofilament light chain (NFL) promoter, neurofilament heavy chain (NFH) promoter, β-globin minigene nβ2 promoter, preproenkephalin (PPE) promoter, enkephalin (Enk) promoter, excitatory amino acid transporter 2 (EAAT2) promoter, glial fibrillary acidic protein (GFAP) promoter, myelin basic protein (MBP) promoter, or functional fragments thereof.

[0278] In some embodiments, the promoter is selected from the group consisting of: a CBH promoter, a chimeric synapsin I promoter, a CMV promoter, a CAG promoter, a CAGG promoter, or a CASI promoter. In some embodiments, the promoter comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NOs: 1-6. In some preferred embodiments, the promoter comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NOs: 1-3. In some more preferred embodiments, the promoter comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 1. In some most preferred embodiments, the promoter comprises the nucleic acid sequence shown in SEQ ID NO:1.

[0279] In some embodiments, the AAV vector of the present invention further comprises a poly A signal sequence located downstream of the nucleic acid sequence encoding TH, GCH1, and AADC. Exemplary poly A signal sequences include bovine growth hormone polyadenylation signal (bGH poly A), small poly A signal (SPA), human growth hormone polyadenylation signal (hGH poly A), SV40 virus polyadenylation signal (SV40 poly A), rabbit beta globin poly A sequence (rBG poly A), or variants thereof.

[0280] In some embodiments, the AAV vector of the present invention includes, from 5' to 3', the following: AAV 5' ITR, a promoter, a KOZAK sequence, nucleic acid sequences encoding TH, GCH1, and AADC proteins (arranged in different orders and connection methods), a poly A signal sequence, and AAV 3' ITR.

[0281] In some specific embodiments, the AAV vector of the present invention comprises, from 5' to 3':

[0282] (1) 5'ITR-CBH promoter-KOZAK-TH-F2A-GCH1-P2A-AADC-SV40 polyA-3'ITR;

[0283] (2) 5'ITR-CBH promoter-KOZAK-AADC-P2A-GCH1-P2A-TH-SV40 polyA-3'ITR;

[0284] (3) 5'ITR-CBH promoter-KOZAK-TH-GS15-GCH1-P2A-AADC-SV40polyA-3'ITR;

[0285] (4) 5'ITR-chimeric Synapsin I promoter-KOZAK-TH-GS15-GCH1-P2A-AADC-SV40 polyA-3'ITR; or

[0286] (5) 5'ITR-CMV promoter-KOZAK-TH-GS15-GCH1-P2A-AADC-SV40polyA-3'ITR;

[0287] Among them, GS15 is a (G4S)3 linker, which comprises the amino acid sequence shown in SEQ ID NO: 17 (GGGGSGGGGSGGGGS).

[0288] In some embodiments, the KOZAK sequence comprises a GCCACC nucleic acid sequence. In some embodiments, the SV40 polyA comprises a nucleic acid sequence as shown in SEQ ID NO:47.

[0289] AAV viral particles

[0290] The present invention provides an AAV virus particle comprising the AAV vector of the present invention and a capsid protein.

[0291] Currently, there are more than a dozen common AAV serotypes and hundreds of variants, which differ primarily in the cap gene encoding the capsid protein. AAV serotypes are primarily determined by the structure of the capsid protein and include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAV-DJ, AAV-DJ / B, AAV PHP.B, AAV PHP.eB, AAV PHP.S, and AAVrh74.

[0292] In some embodiments, the capsid protein is derived from an AAV selected from the group consisting of AAV1, AAV2, AAV5, AAV6, AAV8, AAV9, AAVrh10, AAV-DJ, AAVPHP.B, AAVPHP.eB, or AAVPHP.S. In some embodiments, the capsid protein is derived from an AAV selected from the group consisting of AAV5, AAV9, AAVPHP.eB, AAVPHP.S, or AAVPHP.B.

[0293] In some embodiments, the capsid protein of the AAV virus particle of the invention comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of SEQ ID NOs: 33-37. In some preferred embodiments, the capsid protein of the AAV virus particle of the invention comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 34 or 37. In some more preferred embodiments, the capsid protein of the AAV virus particle of the invention comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 34. In some most preferred embodiments, the capsid protein of the AAV virus particle of the invention comprises the amino acid sequence set forth in SEQ ID NO: 34.

[0294] In some preferred embodiments, the AAV virus particle of the present invention comprises an AAV vector and a capsid protein, wherein the AAV vector comprises, from 5' to 3', the following sequence: 5'ITR-CBH promoter-KOZAK-TH-F2A-GCH1-P2A-AADC-SV40 polyA-3'ITR; wherein the capsid protein comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 34.

[0295] In some preferred embodiments, the AAV virus particle of the present invention comprises an AAV vector and a capsid protein, wherein the AAV vector comprises, from 5' to 3', the following sequence: 5'ITR-CBH promoter-KOZAK-AADC-P2A-GCH1-P2A-TH-SV40 polyA-3'ITR; wherein the capsid protein comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 34.

[0296] In some preferred embodiments, the AAV virus particle of the present invention comprises an AAV vector and a capsid protein, wherein the AAV vector comprises, from 5' to 3', the following sequence: 5'ITR-CBH promoter-KOZAK-TH-GS15-GCH1-P2A-AADC-SV40 polyA-3'ITR; wherein the capsid protein comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 34.

[0297] In some preferred embodiments, the AAV virus particle of the present invention comprises an AAV vector and a capsid protein, wherein the AAV vector comprises, from 5' to 3', the following sequence: 5'ITR-chimeric synapsin I promoter-KOZAK-TH-GS15-GCH1-P2A-AADC-SV40 polyA-3'ITR; wherein the capsid protein comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 34.

[0298] In some preferred embodiments, the AAV virus particle of the present invention comprises an AAV vector and a capsid protein, wherein the AAV vector comprises, from 5' to 3', the following sequence: 5'ITR-CMV promoter-KOZAK-TH-GS15-GCH1-P2A-AADC-SV40 polyA-3'ITR; wherein the capsid protein comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 34.

[0299] In some preferred embodiments, the AAV virus particle of the present invention comprises an AAV vector and a capsid protein, wherein the AAV vector comprises the nucleotide sequence shown in any one of SEQ ID NOs: 19-21, and the capsid protein comprises the amino acid sequence shown in SEQ ID NO: 34.

[0300] Composition

[0301] In one aspect, the present invention provides a composition comprising an AAV vector of the present invention and a packaging plasmid encoding a capsid protein, and optionally a helper plasmid.

[0302] In some embodiments, the packaging plasmid further comprises a nucleic acid sequence encoding a Rep protein, wherein the Rep protein is derived from an AAV having an AAV2 or AAVPHP.B serotype. In some embodiments, the Rep protein comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 45 or SEQ ID NO: 46.

[0303] In some embodiments, the packaging plasmid in the composition comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 24-28 and 48. In some preferred embodiments, the packaging plasmid comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NOs: 25 or 28. In some more preferred embodiments, the packaging plasmid comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 25. In some most preferred embodiments, the packaging plasmid comprises the nucleic acid sequence set forth in SEQ ID NO: 25.

[0304] In some embodiments, the helper plasmid in the composition comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 29. In some embodiments, the helper plasmid in the composition comprises the nucleic acid sequence set forth in SEQ ID NO: 29.

[0305] In another aspect, the present invention provides a composition comprising an AAV viral particle of the present invention, wherein the AAV viral particle comprises an AAV vector of the present invention and a capsid protein.

[0306] In some embodiments, the compositions of the present invention further comprise a pharmaceutically acceptable carrier, diluent, or excipient.

[0307] As used herein, the term "pharmaceutically acceptable" refers to a carrier, excipient or diluent that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0308] The exemplary carriers used in the compositions of the present invention include saline, buffered saline, glucose and water. The exemplary excipients used in the compositions of the present invention include fillers, adhesives, disintegrants, coatings, adsorbents, antiadherents, glidants, preservatives, antioxidants, flavorings, coloring agents, sweeteners, solvents, cosolvents, buffers, chelating agents, viscosity imparting agents, surfactants, diluents, wetting agents, carriers, diluents, preservatives, emulsifiers, stabilizers and tension regulators. Suitable excipients are known to those skilled in the art to prepare compositions of the present invention. Usually, the selection of suitable excipients especially depends on the desired dosage form of employed activating agent, disease to be treated and compositions.

[0309] In some embodiments of the composition, the pharmaceutically acceptable carrier, diluent or excipient is a buffer. In some embodiments, the buffer comprises phosphate buffer, sodium chloride and a surfactant.

[0310] In some embodiments, the surfactant is selected from one or more of polyoxyethylene polyoxypropylene ether block copolymers (Poloxamer 188, F68), polysorbate (Tween), polyethylene glycol (PEG), polyethylene glycol p-isooctylphenyl ether (Triton), fatty acid sorbitan (Span), sucrose fatty acid ester (SE), polyoxyethylene fatty alcohol ether (Brij) and polyoxyethylene fatty acid ester (Myeij).

[0311] In some embodiments, the surfactant is selected from the group consisting of F68, Tween, or a combination thereof.

[0312] In some embodiments, the Tween comprises Tween20.

[0313] In some embodiments, the phosphate buffer is a sodium phosphate buffer or a potassium phosphate buffer. In some preferred embodiments, the phosphate buffer is a sodium phosphate buffer.

[0314] In some embodiments, the pH of the buffer is 6.5-8, for example, pH 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8 or 7.9. In some preferred embodiments, the buffer comprises 5-15 mM phosphate buffer, 130-170 mM sodium chloride and 0.0005%-0.002% F68. For example, in the buffer, the concentration of phosphate buffer can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 mM; the concentration of sodium chloride can be 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175 60, 161, 162, 163, 164, 165, 166, 167, 168, 169 or 170 mM; the content of F68 can be 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.0011%, 0.0012%, 0.0013%, 0.0014%, 0.0015%, 0.0016%, 0.0017%, 0.0018%, 0.0019%, 0.002%.

[0315] In some embodiments, the buffer comprises 10 mM sodium phosphate buffer, 150 mM sodium chloride, and 0.001% F68 at a pH of 7.4. Example

[0316] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described below in conjunction with specific examples and accompanying drawings, and the advantages and features of the present invention will become clearer as the description progresses. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are carried out according to conventional conditions in the art, for example, the conditions described in Sambrook and Russeii et al., Molecular Cloning: A Laboratory Manual (3rd Edition) (2001), CSHL Press, or according to the conditions recommended by the manufacturer. Unless otherwise stated, the experimental materials and reagents used in the following examples are all commercially available.

[0317] Example 1. Design and Construction of AAV Vectors

[0318] The core sequences used to construct the AAV vector of the present invention are shown in Table 1 below.

[0319] Table 1. Promoter, protein, and partial linker sequences used in the present invention.

[0320] The nucleotide sequences of AADC-P2A-GCH1-P2A-TH (SEQ ID NO: 19), TH-GS15-GCH1-P2A-AADC (SEQ ID NO: 20), and TH-F2A-GCH1-P2A-AADC (SEQ ID NO: 21) were artificially synthesized (wherein TH is a truncated form of TH); the synapsin I promoter (SEQ ID NO: 2) and the CMV promoter (SEQ ID NO: 3) were also synthesized. The synthesized genes were cloned into the applicant's self-developed adeno-associated virus backbone pAAV-MCS-CBH-SV40 (whose nucleotide sequence is shown in SEQ ID NO: 22, and the plasmid map is shown in Figure 2) by recombination ligation to prepare recombinant adeno-associated virus vectors (rAAV), resulting in the following vectors, the schematic diagram of which is shown in Figure 1.

[0321] CBH-DGT vector:

[0322] AADC-P2A-GCH1-P2A-TH was digested with AgeI and SalI / ligated and cloned into the adeno-associated virus backbone vector pAAV-MCS-CBH-SV40 between CBH and SV40, and the vector was named CBH-DGT vector.

[0323] CBH-TFGPD vector:

[0324] TH-F2A-GCH1-P2A-AADC was digested with AgeI and SalI / ligated and cloned into the adeno-associated virus backbone vector pAAV-MCS-CBH-SV40 between CBH and SV40, and the vector was named CBH-TFGPD vector.

[0325] CBH-TGPD vector:

[0326] TH-GS15-GCH1-P2A-AADC was digested with AgeI and SalI / ligated and cloned into the adeno-associated virus backbone vector pAAV-MCS-CBH-SV40 between CBH and SV40, and the vector was named CBH-TGPD vector.

[0327] CMV-TGPD vector:

[0328] The CBH promoter in the CBH-TGPD vector was replaced by the CMV promoter, and the vector was named CMV-TGPD vector.

[0329] Synapsin-TGPD vector:

[0330] The CBH promoter in the CBH-TGPD vector was replaced by the Synapsin I promoter, and the vector was named synapsin-TGPD vector.

[0331] CBH-EGFP vector:

[0332] The EGFP sequence was cloned and used to replace the AADC-P2A-GCH1-P2A-TH sequence in the CBH-DGT vector. The vector was named CBH-EGFP vector.

[0333] Example 2. AAV virus particle packaging and determination

[0334] The vectors containing the target genes obtained in Example 1 (CBH-DGT, CBH-TGPD, CBH-TFGPD, CMV-TGPD, synapsin-TGPD, CBH-EGFP) were co-transfected with different serotype packaging plasmids (KL-pAAV5 (SEQ ID NO: 24), KL-pAAV9 (SEQ ID NO: 25), KL-pAAVPHP.eB (SEQ ID NO: 26), KL-pAAVPHP.S (SEQ ID NO: 27), KL-pAAVPHP.B (SEQ ID NO: 28)) and a helper plasmid (KL-pAAV-Helper, nucleotide sequence SEQ ID NO: 29) into 293T cells (purchased from the American Type Culture Collection (ATCC), with a deposit number of CRL-3216), and AAV was packaged using the 293T system. Transfection was performed using PEI cationic polymer (PEI-Max transfection reagent, purchased from Polysciences, catalog number: 24765-1)-mediated transient transfection of eukaryotic cells. The transfection procedure was performed according to the manufacturer's recommended standardized procedure. The transfection scale was 15 cm 2 Cell culture dish.

[0335] 72 hours after transfection, the cell supernatant and cells were collected together into a 50 mL centrifuge tube. Use a desktop centrifuge to centrifuge at 4200 rpm for 10 minutes at room temperature to separate the cells and supernatant. Transfer the supernatant to a new 50 mL centrifuge tube, add MgCl2 and ribozyme, and mix well for use. Add ribozyme and cell lysate to the remaining cells, let stand at room temperature for 1 hour, and then centrifuge at 10000g for 10 minutes at room temperature. Transfer the supernatant to the cell supernatant obtained in the previous step, mix well, and finally perform affinity purification and concentration to obtain AAV virus particles of different serotypes (AAV9-CBH-DGT, AAV9-CBH-TGPD, AAV9-CBH-TFGPD, AAV9-CMV-TGPD, AAV9-synapsin-TGPD, AAV5-CBH-TGPD, AAVPHP.eB-CBH-TGPD, AAVPHP.S-CBH-TGPD, AAVPHP.B-CBH-TGPD and AAV9-CBH-EGFP).

[0336] The physical titer of AAV was calculated using methods well known in the art based on the quantitative PCR results and AAV standards as a reference (see Table 2). The primer and probe sequences used in quantitative PCR were:

[0337] CMV-Forward Primer:

[0338] ACTTCCATTGACGTCAATGGGTGG(SEQ ID NO:30)

[0339] CMV probe:

[0340] 5'-CAAGTGTATCATATGCCAAGTACGCCCCC-3'(SEQ ID NO:31)

[0341] CMV-Reverse Primer:

[0342] AGGTCATGTACTGGGCATAATGC(SEQ ID NO:32)

[0343] The CMV probe has a FAM fluorescent group at the 5' end and a BHQ1 fluorescent group at the 3' end.

[0344] Table 2. Physical titers of different AAV viral particles

[0345] As shown in Table 2, for the different AAV vectors in Example 1, capsid proteins with different AAV serotypes can effectively package them, thereby obtaining AAV virus particles with high physical titers.

[0346] Example 3. Detection of intracellular target protein expression after AAV virus particles infected 293T cells

[0347] The packaged AAV viral particles AAV9-CBH-TFGPD were infected with 293T cells at the same multiplicity of infection (MOI). After infection, the cells were lysed to produce a cell lysate, which was used for Western blot analysis. After SDS-PAGE electrophoresis, the target proteins were transferred to a PVDF membrane. Anti-GCH1, anti-TH, and anti-AADC antibodies were used as primary antibodies to detect the expression of the target proteins, and anti-GAPDH antibody was used as an internal reference antibody to detect the expression of the internal reference protein. The experimental results (see Figure 3) show that AAV viral particles AAV9-CBH-TFGPD can efficiently express the target proteins GCH1, TH1, and AADC after in vitro transduction of cells.

[0348] Example 4. Detection of dopamine synthesis levels in vitro mediated by AAV vector

[0349] Packaged AAV viral particles were infected with 293T cells at the same MOI. After 72 hours, the cell supernatant was collected and the concentrations of dopamine and its metabolites in the cell supernatant were measured by high-performance liquid chromatography. The experimental results (see Table 3 and Figure 4) showed that after AAV9-CBH-TFGPD was transduced into cells in vitro, intracellular dopamine synthesis was significantly increased, and the dopamine metabolites 3,4-dihydroxyphenylacetic acid and homovanillic acid were also significantly increased, demonstrating that AAV9-CBH-TFGPD can mediate efficient dopamine synthesis in cells under in vitro conditions.

[0350] Table 3. AAV vector-mediated in vitro dopamine synthesis and metabolite detection

[0351] Example 5. Detection of dopamine synthesis efficiency in vivo mediated by different AAV vectors

[0352] AAV viral particles packaged with different AAV vectors were delivered to the brains of wild-type C57 / B6 mice at the same dose via stereotaxic injection to infect the brain neurons of the mice. Two weeks after the injection, samples were collected, and 200 μL of a solution containing 0.2 mM HClO4 and 1 mM cysteine ​​was added to every 30 mg of brain tissue. The homogenate was broken into a cell lysate. The supernatant was centrifuged at 4°C and 12,000 rpm for 5 minutes, and the concentrations of dopamine and its metabolites in the cell lysate were detected by high-performance liquid chromatography. The experimental results (see Table 4 and Figure 5) showed that although AAV9-CBH-DGT did not show significant differences in the level of dopamine synthesis, the dopamine metabolites 3,4-dihydroxyphenylacetic acid and homovanillic acid were significantly increased compared with the control group, indicating that dopamine is rapidly metabolized after synthesis. These results show that compared with the control group, different AAV vectors can efficiently mediate dopamine synthesis after infecting neurons in vivo.

[0353] Table 4. In vivo dopamine synthesis and its metabolite content mediated by different AAV vectors

[0354] Example 6. Detection of dopamine synthesis efficiency in vivo mediated by AAV vectors of different serotypes

[0355] AAV vectors of different serotypes were delivered to the brains of wild-type C57 / B6 mice at the same dose by stereotaxic injection to infect the neurons in the mouse brain. Two weeks after the injection, samples were collected, and 200 μL of a solution containing 0.2 mM HClO4 and 1 mM cysteine ​​was added to every 30 mg of brain tissue, and the homogenate was broken into a cell lysate. The supernatant was taken by centrifugation at 4°C and 12000 rpm for 5 minutes, and the concentration of dopamine and its metabolites in the cell lysate was detected by high-performance liquid chromatography. The experimental results (see Table 5 and Figure 6) show that AAV vectors of serotypes AAV9, AAV5, AAVPHP.eB, AAVPHP.S and AAVPHP.B all significantly increased the level of dopamine synthesis, and the increase in the dopamine metabolites 3,4-dihydroxyphenylacetic acid and homovanillic acid was more obvious than that of the control group, indicating that dopamine is rapidly metabolized after synthesis. Therefore, the experimental results show that compared with the control group, AAV vectors of different serotypes can efficiently synthesize dopamine after infecting nerve cells in vivo.

[0356] Table 5. In vivo dopamine synthesis and its metabolite content mediated by different serotypes of AAV vectors

[0357] Example 7. Detection of in vivo dopamine synthesis efficiency mediated by AAV vectors using different promoters

[0358] Viral particles packaged with AAV vectors using different promoters were delivered to the brains of wild-type C57 / B6 mice at the same dose by stereotaxic injection to infect the neurons in the mouse brain. Two weeks after the injection, samples were collected, and 200 μL of a solution containing 0.2 mM HClO4 and 1 mM cysteine ​​was added to every 30 mg of brain tissue, and the homogenate was broken into a cell lysate. The supernatant was taken by centrifugation at 4°C and 12000 rpm for 5 minutes, and the dopamine concentration in the cell lysate was detected by high-performance liquid chromatography. The experimental results (see Table 6 and Figure 7) show that compared with the control group, AAV vectors using different promoters can efficiently synthesize dopamine after infecting neurons in vivo.

[0359] Table 6. In vivo dopamine synthesis levels mediated by AAV vectors using different promoters

[0360] Example 8. Detection of in vivo dopamine synthesis efficiency mediated by AAV vectors using different linkers

[0361] AAV virus particles packaged with AAV vectors using different connectors were delivered to the brains of wild-type C57 / B6 mice at the same dose by stereotaxic injection to infect the brain neurons of the mice. Two weeks after the injection, samples were collected, and 200 μL of a solution containing 0.2 mM HClO4 and 1 mM cysteine ​​was added to every 30 mg of brain tissue, and the slurry was broken into a cell lysate. The supernatant was taken by centrifugation at 4°C and 12000 rpm for 5 minutes, and the dopamine concentration in the cell lysate was detected by high-performance liquid chromatography. The experimental results (see Table 7 and Figure 8) show that compared with the control group, AAV vectors using different connectors can efficiently synthesize dopamine after infecting neurons in vivo.

[0362] Table 7. In vivo dopamine synthesis levels mediated by AAV vectors using different linkers

[0363] Example 9. Evaluation of the efficacy of AAV9-CBH-TGPD in a Parkinson's disease rat model

[0364] A unilateral Parkinson's disease model was established in SD rats by stereotaxic injection of 6-hydroxydopamine (6-OHDA) into the medial forebrain bundle (MFB) unilaterally. Four weeks after 6-OHDA injection, the rats were intraperitoneally injected with apomorphine hydrochloride (APO) (1 mg / kg) to induce rotation toward the healthy side. The quality of the model was assessed by the rotation speed.

[0365] After selecting a suitable Parkinson's disease rat model, the animals were divided into groups according to the results of APO induction. AAV9-CBH-EGFP viral particles and different doses of AAV9-CBH-TGPD viral particles (see Table 8) were administered to the striatum on the injured side via stereotaxic injection. Apomorphine hydrochloride (1 mg / kg) was injected intraperitoneally at weeks 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 17, 19, 21, and 23 after administration. The number of rotations of the animals was counted 5-10 minutes, 15-20 minutes, and 25-30 minutes after administration of the induction drug. Compared with the control group, the number of circles after APO induction decreased significantly in each AAV9-CBH-TGPD administration group, and the AAV9-CBH-TGPD administration dose was negatively correlated with the number of circles after induction (see Figure 9), that is, the higher the administration dose, the lower the number of circles after APO induction, which proves that AAV9-CBH-TGPD has a good therapeutic effect in the Parkinson's disease rat model.

[0366] Table 8. Animal grouping and dosing

[0367] The best therapeutic effect of Prosavin, a lentiviral vector drug used to treat Parkinson's disease (Mimoun Azzouz, et al. The Journal of Neuroscience, 2002, 22(23):10302-10312), was a reduction in apomorphine-induced rotational behavior from 8 rpm in the control group to 5 rpm in the treatment group (similar to clinical trial data). The AAV-CBH-TGPD of the present invention has achieved a near-functional cure, reducing apomorphine-induced rotational behavior from 10 rpm in the control group to nearly 1 rpm in the treatment group.

[0368] Example 10. Safety Testing of AAV Virus Particles and Buffer Systems

[0369] Using the method of Example 2, the vector CBH-TGPD obtained in Example 1 was packaged with AAV9, AAV2, and AAV5 serotype packaging plasmids, respectively, to obtain AAV virus particles of different serotypes. The AAV9 and AAV5 packaging plasmids were the same as those in Example 2, and the AAV2 packaging plasmid sequence is shown in SEQ ID NO: 48.

[0370] Compositions were prepared by mixing AAV viral particles at a total dose of 8.0E+9 vg with a buffer system. The buffer system consisted of 10 mM sodium phosphate buffer (NaH2PO4 & Na2HPO4), 150 mM sodium chloride, and 0.001% F68, pH 7.4, in a total volume of 10 μl. The buffer system, or a combination of AAV viral particles and the buffer system, was delivered to the brains of wild-type C57 / B6 mice via stereotaxic injection. The neurotoxicity of the buffer system and the combination of different AAV serotypes was evaluated.

[0371] Two weeks after the injection, the mice were stained with Nissl to determine neurotoxicity. The brain of the mouse was sampled, paraffin sections were made in the striatum area, and after staining according to the instructions of the Nissl staining kit (Shanghai Sangon Biotech Co., Ltd., E607316-0100), optical microscope photos were taken. As shown in Figure 10, compared with the buffer system group, the number, shape and distribution of neurons in the mice injected with the buffer system + AAV9 composition, the buffer system + AAV2 composition, and the buffer system + AAV5 composition were normal, indicating that the AAV virus particles of the present application have no neurotoxicity, and the composition with the buffer system also meets the safety requirements.

[0372] Although the present invention has been described with reference to specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition, method, or process step to the object, spirit, and scope of the present invention. All such modifications are intended to be within the scope of the present invention.

Claims

1. An adeno-associated virus (AAV) vector comprising nucleic acid sequences encoding tyrosine hydroxylase (TH), GTP-cyclohydrolase 1 (GCH1) and aromatic amino acid dopa decarboxylase (AADC), wherein the nucleic acid sequences encoding the TH, GCH1 and / or AADC are linked in frame via a nucleic acid sequence encoding a linker, wherein: Any one or more of the TH, GCH1 and AADC is a truncated form of a wild type or a functional variant thereof and has the catalytic activity required in the dopamine synthesis pathway.

2. The AAV vector of claim 1, wherein the TH is a truncated form of wild-type TH or a functional variant thereof and has the activity of catalyzing the synthesis of levodopa from tyrosine; preferably, the TH comprises 330 to 390 amino acid residues.

3. The AAV vector of claim 1 or 2, wherein the TH comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:

11.

4. The AAV vector of any one of claims 1-3, wherein the GCH1 comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:

9.

5. The AAV vector of any one of claims 1-4, wherein the AADC comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:

7.

6. The AAV vector of any one of claims 1-5, wherein the linker comprises a fusion linker, a 2A peptide linker and / or an internal ribosome entry site (IRES).

7. The AAV vector of any one of claim 6, wherein the fusion linker is a peptide linker; preferably, the peptide linker is selected from (GGS)n, (GGGS)n or (GGGGS)n, wherein n is an integer from 1 to 5.

8. The AAV vector of claim 7, wherein the fusion junction is (G4S)3.

9. The AAV vector of claim 6, wherein the 2A peptide linker comprises a 2A peptide selected from the group consisting of foot-and-mouth disease virus 2A peptide (F2A), porcine teschovirus 2A peptide (P2A), Thosea asign virus 2A peptide (T2A) and / or equine rhinitis virus 2A peptide (E2A).

10. The AAV vector of claim 9, wherein the N-terminus and / or C-terminus of the 2A peptide linker further comprises a GSG amino acid sequence, preferably the N-terminus comprises a GSG amino acid sequence.

11. The AAV vector of claim 10, wherein the 2A peptide linker comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13 or SEQ ID NO:

15.

12. The AAV vector of any one of claims 1 to 11, wherein the nucleic acid sequences encoding the TH, GCH1 and AADC are arranged from upstream to downstream in an order selected from any one of the following: (1) TH, GCH1, AADC; (2) AADC, GCH1, TH; (3) AADC, TH, GCH1; (4) GCH1, TH, AADC; (5) GCH1, AADC, TH; or (6)TH, AADC, GCH1.

13. The AAV vector of claim 12, wherein the nucleic acid sequences encoding the TH, GCH1 and AADC are linked from upstream to downstream in a manner selected from any one of the following: 1) TH-F2A-GCH1-P2A-AADC; 2) GCH1-P2A-TH-P2A-AADC; 3) GCH1-P2A-AADC-P2A-TH; 4) AADC-E2A-GCH1-(G4S)3-TH; 5) GCH1-F2A-TH-F2A-AADC; 6) AADC-(G4S)3-TH-T2A-GCH1; 7) AADC-(G4S)4-TH-T2A-GCH1; 8) AADC-P2A-GCH1-P2A-TH; 9) AADC-T2A-GCH1-(G4S)3-TH; 10) GCH1-F2A-TH-P2A-AADC; 11) GCH1-F2A-AADC-F2A-TH; 12) AADC-(G4S)3-GCH1-F2A-TH; 13) GCH1-E2A-TH-T2A-AADC; 14) GCH1-F2A-AADC-P2A-TH; 15) AADC-(G4S)3-GCH1-P2A-TH; 16) AADC-(G4S)5-GCH1-P2A-TH; 17) TH-(G4S)3-GCH1-P2A-AADC; 18) GCH1-T2A-AADC-E2A-TH; 19) AADC-(G4S)3-GCH1-T2A-TH; 20) GCH1-E2A-TH-P2A-AADC; 21) AADC-(G4S)3-GCH1-E2A-TH; 22) GCH1-E2A-AADC-P2A-TH; 23)AADC-(G4S)3-GCH1-(G4S)3-TH; 24) GCH1-T2A-TH-E2A-AADC; 25) GCH1-(G4S)3-TH-T2A-AADC; 26) GCH1-(G4S)2-TH-T2A-AADC; 27) GCH1-P2A-AADC-T2A-TH; 28)TH-P2A-GCH1-P2A-AADC; 29)TH-(G4S)3-GCH1-T2A-AADC; 30) GCH1-(G4S)3-TH-E2A-AADC; 31) GCH1-T2A-TH-(G4S)3-AADC; 32)TH-P2A-GCH1-F2A-AADC; 33) GCH1-F2A-TH-(G4S)3-AADC; 34) TH-F2A-GCH1-F2A-AADC; 35) TH-(G4S)3-GCH1-E2A-AADC; 36)TH-G4S-GCH1-E2A-AADC; 37)GCH1-P2A-TH-(G4S)3-AADC; 38)AADC-F2A-GCH1-P2A-TH; 39)TH-T2A-GCH1-(G4S)3-AADC; 40)GCH1-E2A-TH-(G4S)3-AADC; 41)TH-E2A-GCH1-(G4S)3-AADC; 42)TH-T2A-GCH1-E2A-AADC; 43)AADC-F2A-GCH1-F2A-TH; 44)TH-F2A-GCH1-(G4S)3-AADC; 45)GCH1-(G4S)3-TH-(G4S)3-AADC; 46)TH-(G4S)3-GCH1-F2A-AADC; 47)TH-E2A-GCH1-T2A-AADC; 48)AADC-P2A-TH-(G4S)3-GCH1; 49)TH-(G4S)3-GCH1-(G4S)3-AADC; 50)AADC-F2A-TH-(G4S)3-GCH1; 51)TH-F2A-AADC-F2A-GCH1; 52)TH-(G4S)3-AADC-T2A-GCH1; 53)TH-(G4S)3-AADC-E2A-GCH1; 54)AADC-P2A-GCH1-(G4S)3-TH; 55)TH-F2A-AADC-(G4S)3-GCH1; 56)AADC-F2A-GCH1-(G4S)3-TH; 57)TH-P2A-AADC-F2A-GCH1; 58)TH-P2A-AADC-(G4S)3-GCH1; 59)GCH1-(G4S)3-TH-P2A-AADC; 60)TH-T2A-AADC-(G4S)3-GCH1; 61)TH-T2A-AADC-E2A-GCH1; 62)GCH1-(G4S)3-TH-F2A-AADC; 63)TH-E2A-AADC-(G4S)3-GCH1; 64)AADC-E2A-GCH1-T2A-TH; 65)GCH1-P2A-TH-F2A-AADC; 66)TH-(G4S)3-AADC-(G4S)3-GCH1; 67)TH-E2A-AADC-T2A-GCH1; 68)GCH1-P2A-AADC-F2A-TH; 69)AADC-T2A-TH-(G4S)3-GCH1; 70)AADC-T2A-GCH1-E2A-TH; 71)TH-F2A-AADC-P2A-GCH1; 72)AADC-E2A-TH-(G4S)3-GCH1; 73)AADC-P2A-GCH1-F2A-TH; 74)TH-(G4S)3-AADC-F2A-GCH1; 75)AADC-P2A-TH-F2A-GCH1; 76) AADC-(G4S)3-TH-P2A-GCH1; 77)AADC-T2A-TH-E2A-GCH1; 78) AADC-(G4S)3-TH-E2A-GCH1; 79) AADC-E2A-TH-T2A-GCH1; or 80)AADC-(G4S)3-TH-F2A-GCH1.

14. The AAV vector of claim 13, wherein the AAV vector comprises the nucleic acid sequence shown in any one of SEQ ID NOs: 19-21.

15. The AAV vector of any one of claims 1-14, further comprising a promoter operably linked to the nucleic acid sequences encoding TH, GCH1 and AADC; preferably, wherein the promoter is selected from: CBH promoter, chimeric synapsin I promoter, CMV promoter, CAG promoter, CAGG promoter or CASI promoter.

16. The AAV vector of claim 15, wherein the promoter comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:1-6; preferably, the promoter comprises the nucleic acid sequence shown in any one of SEQ ID NO:1-3; more preferably, the promoter comprises the nucleic acid sequence shown in SEQ ID NO:

1.

17. The AAV vector of any one of claims 1-16, wherein the AAV vector further comprises one or more elements selected from the group consisting of a KOZAK sequence, a polyadenylation signal of SV40 virus (SV40 poly A), and an inverted terminal repeat (ITR).

18. An AAV virus particle comprising the AAV vector according to any one of claims 1 to 17, and a capsid protein.

19. The AAV virus particle of claim 18, wherein the capsid protein is derived from an AAV serotype selected from the group consisting of AAV5, AAV9, AAVPHP.eB, AAVPHP.S or AAVPHP.B.

20. The AAV virus particle of claim 19, wherein the capsid protein comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of SEQ ID NOs:33-37; preferably, the capsid protein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:34 or 37; more preferably, the capsid protein comprises the amino acid sequence shown in SEQ ID NO:

34.

21. A composition comprising the AAV vector of any one of claims 1-17 and a packaging plasmid encoding a capsid protein, and optionally a helper plasmid.

22. The composition of claim 21, wherein the packaging plasmid further comprises a nucleic acid sequence encoding a Rep protein, wherein the Rep protein is derived from an AAV having an AAV2 or AAVPHP.B serotype.

23. The composition of claim 22, wherein the Rep protein comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:45 or SEQ ID NO:

46.

24. The composition of any one of claims 21-23, wherein the packaging plasmid comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of SEQ ID NOs: 24-28 and 48; preferably, the packaging plasmid comprises a nucleic acid sequence selected from SEQ ID NOs: 25 or 28; more preferably, the packaging plasmid comprises a nucleic acid sequence as shown in SEQ ID NO:

25.

25. The composition of any one of claims 21-24, wherein the helper plasmid comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:

29.

26. The composition of any one of claims 21-25, further comprising a pharmaceutically acceptable carrier, diluent or excipient.

27. A composition comprising the AAV virus particle of any one of claims 18-20; optionally, the composition further comprises a pharmaceutically acceptable carrier, diluent or excipient.

28. The composition of claim 26 or 27, comprising phosphate buffer, sodium chloride and a surfactant, preferably poloxamer 188.

29. A cell comprising the AAV vector of any one of claims 1-17, the AAV viral particle of any one of claims 18-20, or the composition of any one of claims 21-28.

30. The cell of claim 29, wherein the cell is a nerve cell, and according to function, the nerve cell is selected from: inhibitory neurons (preferably, the cell is a medium spiny neuron, an interneuron), excitatory neurons (preferably, the cell is a dopaminergic neuron), microglia, astrocytes, oligodendrocytes or Schwann cells; according to brain region, the cell is midbrain striatum neurons and glial cells.

31. Use of the AAV vector of any one of claims 1-17, the AAV virus particle of any one of claims 18-20, the composition of any one of claims 21-28, or the cell of claim 29 or 30 in the preparation of a medicament for preventing and / or treating a disease caused by dopamine deficiency in a subject.

32. The use according to claim 31, wherein the disease is Parkinson's disease.

Images