Microorganism of genus corynebacterium having enhanced l-arginine productivity, and method for producing l-arginine using same

Abstract

The present invention relates to a microorganism of the genus Corynebacterium having enhanced L-arginine productivity and a method for producing L-arginine using same. The microorganism of the genus Corynebacterium has an improved L-arginine production yield, compared to the parent strain, by having, introduced thereinto, the argO gene encoding an arginine exporter, and thus can effectively produce L-arginine.

Description

Microorganisms of the genus Corynebacterium with enhanced L-arginine production capacity and methods for producing L-arginine using the same

[0001] The present invention relates to a microorganism of the genus Corynebacterium having improved L-arginine production ability and a method for producing L-arginine using the same.

[0002] Arginine is known to be found in free form in plants and other plants. While arginine is a non-essential amino acid, it is a semi-essential amino acid that must be supplied in growing children and under specific conditions such as stress, trauma, and cancer. It is widely used as an ingredient in amino acid fortifiers, pharmaceuticals, and foods. For pharmaceutical purposes, it is used in liver function enhancers, brain function enhancers, male infertility treatments, and comprehensive amino acid preparations. For food applications, it is used as an additive in fish cakes, health drinks, and as a salt substitute for hypertensive patients.

[0003] Arginine can be produced using either wild-type strains obtained from nature or mutant strains modified for enhanced arginine production. Recently, genetic recombination technology has been utilized in microorganisms such as Escherichia coli and Corynebacterium to improve arginine production efficiency. In microorganisms, L-arginine biosynthesis starts from L-glutamate and goes through the following steps: N-acetylglutamate, N-acetylglutamyl-P, N-acetylglutamate 5-semialdehyde, N-acetylornithine, L-ornithine, L-citrulline, and argininosuccinate. Various proteins, such as enzymes, transcription factors, and transport proteins, are involved in this step-by-step synthetic process. Therefore, there have been attempts to increase the production of L-arginine by inducing mutations in various genes involved in the L-arginine biosynthetic pathway or regulatory sequences such as promoters that control their expression through genetic recombination technology.

[0004] According to the literature [Bellmann et al., Microbiology 2001; 147: 1765-74], the lysine exporter is involved in the export of not only lysine but also arginine, citrulline, and ornithine. When the expression of the lysE gene encoding the lysine exporter was enhanced, arginine export ability was enhanced. However, the enhancement of the lysE gene also increased the excretion of by-products other than arginine, and in particular, the increased production of ornithine, which is a by-product, had a negative effect on arginine production.

[0005] Therefore, much research is still needed to develop recombinant strains or mutants with excellent L-arginine production while reducing by-product production.

[0006] [Prior Art Literature]

[0007] [Patent Document]

[0008] Korean Patent No. 10-2269637

[0009] The purpose of the present invention is to provide a microorganism of the genus Corynebacterium having improved L-arginine production ability.

[0010] In addition, the present invention aims to provide a method for producing L-arginine using the above microorganism.

[0011] One aspect of the present invention provides a Corynebacterium microorganism having enhanced L-arginine production capacity by enhancing the activity of an arginine exotransporter.

[0012] The "arginine exporter" used in the present invention plays a role in regulating the intracellular arginine level and maintaining the balance between arginine and lysine. The arginine exporter in the present invention may be a polypeptide encoded by the argO gene and having arginine exporter activity or arginine excretion ability, but is not limited thereto.

[0013] Nucleic acid sequence and protein sequence information for the above arginine transporter can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0014] As used herein, “enhanced activity” means that the expression of a gene encoding a protein such as a desired enzyme, transcription factor, or transport protein is newly introduced or increased, thereby increasing the expression level compared to a wild-type strain or a strain prior to modification. This enhanced activity includes cases where the activity of the protein itself is increased compared to the activity of the protein originally possessed by the microorganism through nucleotide substitution, insertion, deletion, or a combination thereof encoding the gene, and cases where the overall protein activity level within the cell is higher than that of a wild-type strain or a strain prior to modification due to increased expression or increased translation of the gene encoding the same, and combinations thereof.

[0015] According to one specific example of the present invention, the activity enhancement of the arginine exotransporter may be achieved by introduction of a gene encoding the arginine exotransporter.

[0016] According to one specific example of the present invention, the arginine transporter or the gene encoding it may be derived from a microorganism of the genus Escherichia.

[0017] The above Escherichia genus microorganisms may include, but are not limited to, Escherichia coli, Escherichia albertii, Escherichia blattae, Escherichia fergusonii, Escherichia hermannii, or Escherichia vulneris.

[0018] For example, the arginine transporter or the gene encoding it may be derived from Escherichia coli.

[0019] According to one specific example of the present invention, the arginine transporter may comprise the amino acid sequence of sequence number 1.

[0020] According to one specific example of the present invention, the gene encoding the arginine transporter may include the base sequence of SEQ ID NO: 2.

[0021] The amino acid sequence or base sequence of the arginine exocytopenia transporter according to the present invention may be composed of or essentially include a sequence having 70% or more, 80% or more, 90% or more, 98% or more, 99% or more, or 99.9% or more homology with the amino acid sequence of SEQ ID NO: 1 or the base sequence of SEQ ID NO: 2, and must be able to maintain its original function.

[0022] As used herein, “improved productivity” means increased productivity of L-arginine compared to the parent strain. The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a strain that is directly the target of mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a wild type Corynebacterium microorganism or a Corynebacterium microorganism or strain that has been mutated from the wild type.

[0023] The above-mentioned Corynebacterium genus microorganism may be known in the art, and examples thereof include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli,It may be, but is not limited to, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi or Corynebacterium flavescens.

[0024] According to one specific example of the present invention, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0025] The Corynebacterium microorganism with improved L-arginine production ability according to the present invention can increase intracellular arginine excretion by strengthening the activity of the arginine exotransporter, thereby improving L-arginine production ability. Specifically, the Corynebacterium genus microorganism having improved L-arginine production ability exhibits increased L-arginine production ability compared to the parent strain, and in particular, the L-arginine production amount is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, It may be increased by, but is not limited to, 8.5x, 9x, 9.5x or 10x.

[0026]

[0027] A Corynebacterium genus microorganism according to one specific example of the present invention can be implemented through a recombinant vector containing a gene encoding an arginine exotransporter targeting a parent strain.

[0028] The term "vector" as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene into a host cell. Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory sequences operably linked to allow the gene insert to be expressed, and "operably linked" means that the target gene and its regulatory sequence are functionally linked to each other in a manner that enables gene expression, and a "regulatory sequence" includes a promoter sequence for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating the termination of transcription and translation.

[0029] The vector used in the present invention is not particularly limited as long as it is capable of replicating in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0030] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0031] The "recombinant vector" used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell's genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0032] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.

[0033] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0034] When transforming prokaryotic cells to produce recombinant microorganisms, the host cells may include, but are not limited to, various strains of Escherichia coli such as E. coliDH5α, E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, and E. coliXL1-Blue, strains of Corynebacterium, strains of Bacillus such as Bacillus subtilis and Bacillus thuringiensis, and various enterobacteria and strains such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas species.

[0035] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0036] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0037] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0038] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0039] Genes inserted into the recombinant vector for transformation of the present invention can be substituted into a host cell such as a microorganism of the genus Corynebacterium through homologous recombination crossing over.

[0040] According to one specific example of the present invention, the host cell may be a microorganism of the genus Corynebacterium, and for example, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0041]

[0042] In addition, another aspect of the present invention provides a method for producing L-arginine, comprising the steps of culturing the above-described Corynebacterium microorganism in a medium; and recovering L-arginine from the microorganism or the medium in which the microorganism is cultured.

[0043] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0044] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for microorganisms of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0045] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0046] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0047] According to one specific example of the present invention, the step of recovering L-arginine from the cultured Corynebacterium microorganism and the medium in which the microorganism is cultured may collect or recover the L-arginine produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but is not limited thereto.

[0048] According to one specific example of the present invention, the step of recovering the L-arginine may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0049] According to one specific example of the present invention, the step of recovering L-arginine may include a process of purifying L-arginine.

[0050] The Corynebacterium microorganism according to the present invention can effectively produce L-arginine by improving the yield of L-arginine production compared to the parent strain by introducing a gene encoding an arginine transporter.

[0051] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0052]

[0053] Example 1. Production of strains with the argO gene introduced

[0054] To introduce the argO gene encoding an arginine exporter derived from a microorganism of the genus Escherichia into an arginine-producing strain of Corynebacterium glutamicum, L-arginine-producing strains Corynebacterium glutamicum 14GR (KCCM13219P) and E. coliDH5a (HIT Competent cells™, Cat No. RH618) were used.

[0055] The above Corynebacterium glutamicum 14GR was cultured at 30°C in ARG-broth medium (pH 7.2) containing 10.5 g of 98% Glucose, 1 g of Beef extract, 4 g of Yeast extract, 2 g of Polypeptone, 2 g of NaCl, and 40 g of (NH4)2SO4 in 1 L of distilled water.

[0056] The above E. coliDH5a was cultured at 37°C on LB medium containing 10.0 g of tryptone, 10.0 g of NaCl, and 5.0 g of yeast extract in 1 L of distilled water.

[0057] The antibiotic kanamycin was a product from Sigma.

[0058] DNA sequencing analysis and gene synthesis were performed by Macrogen, Inc.

[0059]

[0060] 1-1. Recombinant vector

[0061] A recombinant vector was constructed to disrupt the lysE gene involved in lysine and arginine export in Corynebacterium glutamicum 14GR and introduce the argO gene encoding an arginine exotransporter derived from the genus Escherichia in its place. The codon-optimized argO sequence (SEQ ID NO: 2) and the right-arm sequence used for cloning were obtained through gene synthesis. The 655 bp portion of the left arm, the 636 bp portion of the right arm, and the argO gene linked to the promoter were amplified by PCR from the Corynebacterium glutamicum genome, and then linked by overlap PCR and cloned into the pk19mobsacB (ATCC, 87098) vector. To construct the plasmid, the primers in Table 1 below were used to amplify each gene fragment.

[0062] Primer name Primer sequence (5'-3') Sequence number lysE left homology arm amplification primer LF1tgattacgcccggatccagatactcctttgga3LF2cggatccagatactcctttgga4LR1ttttggaatcggtggccttc5LR2ttttcgcgggttttggaatc6 Promoter amplification primer P-F1cccgcgaaaatggcgggtattttcatcc7P-F2tggcgggtattttcatccaaa8P-R1tcctccaaaattgtggtggc9P-R2gttcttgtaatcctccaaaattgtgg10argO and lysE right homology arm amplification PrimerF1ttacaagaacatgttctcctactacttccaaggc11F2atgttctcctactacttccaaggc12R1attacccttccatcaccatcg13R2gtcaccaacgattacccttcc14

[0063]

[0064] PCR was performed using the above primers under the following conditions. Using a thermocycler (TP600, TAKARA BIO Inc., Japan), 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP) was added to the reaction solution. 1 pM of oligonucleotides and 10 ng of chromosomal DNA of Corynebacterium glutamicum ATCC 13032 were used as templates, and 25 to 30 cycles were performed in the presence of 1 unit of pfu-X DNA polymerase mixture (Solgent). PCR was performed under the following conditions: (i) denaturation step: 94°C for 30 seconds, (ii) annealing step: 58°C for 30 seconds, and (iii) extension step: 72°C for 1 to 2 minutes (providing a polymerization time of 2 minutes per 1 kb).

[0065] The gene fragment thus produced was cloned into the pk19mobsacB vector using self-assembly cloning. The vector was transformed into E. coliDH5a, plated on LB agar plates containing 50 μg / ml kanamycin, and cultured at 37°C for 24 hours. The resulting colonies were isolated to confirm that the insert was accurately present in the vector. The vector was then isolated and used for recombination in a Corynebacterium glutamicum strain.

[0066] As a common process in the above method, the amplification of the corresponding genes was performed by PCR from the genomic DNA of Corynebacterium glutamicum ATCC 13032, and then inserted into the pk19mobsacB vector by self-assembled cloning according to the strategy, and then selected in E. coliDH5a. Chromosomal base substitution was performed by individually amplifying each fragment of the gene and producing the target DNA fragment by overlap PCR. For the genetic manipulation, Ex Taq polymerase (Takara) and Pfu polymerase (Solgent) were used as PCR amplification enzymes, and various restriction enzymes and DNA modifying enzymes were used from NEB products, and were used according to the supplied buffer and protocol.

[0067]

[0068] 1-2. Corynebacterium glutamicum mutant DS1

[0069] A mutant strain, DS1, was constructed using a cloning vector. The cloning vector was prepared at a final concentration of 1 μg / μl or higher, and the first recombination was induced in Corynebacterium glutamicum 14GR using electroporation (see literature [Tauch et al., FEMS Microbiology letters 123 (1994) 343-347]). The electroporated strain was spread on an agar medium containing 50 μg / μl of kanamycin, and colonies were isolated. Proper insertion into the induced site in the genome was confirmed through PCR and base sequence analysis. The isolated strain was inoculated into a liquid medium to induce a second recombination, cultured for more than one night, and spread on an agar medium containing 10% sucrose to isolate colonies. Among the finally isolated colonies, resistance to kanamycin was confirmed, and among the strains without antibiotic resistance, whether the argO gene had been introduced was confirmed through base sequence analysis (see literature [Schafer et al., Gene 145 (1994) 69-73]). Finally, a Corynebacterium glutamicum mutant strain DS1 capable of producing L-arginine with the argO gene introduced was constructed.

[0070]

[0071] Experimental Example 1. Evaluation of L-arginine production capacity of strains into which the argO gene has been introduced.

[0072] The L-arginine production ability of the parent strain, Corynebacterium glutamicum 14GR, and Corynebacterium glutamicum DA1 into which the argO gene produced in Example 1 was introduced was compared.

[0073] Each strain was patched onto a flask-derived solid medium and cultured at 30°C for 24 hours. The cultured colonies were inoculated into 10 ml of a flask-derived medium and cultured at 32°C, 200 rpm, for 30 hours. The composition of the medium used here is shown in Table 2 below. After the culture was completed, the culture solution was diluted 50-fold with distilled water, filtered through a 0.45 μm filter, and then the L-arginine production was analyzed using high-performance liquid chromatography (HPLC) (Agilent technologies 1260 infinity, Agilent technologies) equipped with a column (DionexIonPacTM CS12A) and a UV detector (195 mm), and the results are shown in Table 3 below.

[0074] Flask starter medium solid medium ( / L) 98% Glucose 10.5 g, Beef extract 1 g, Yeast extract 4 g, Polypeptone 2 g, NaCl 2 g, (NH4)2SO4 40 g, Agar 20 gFlask titer medium ( / L) 98% Glucose 120 g, MgSO4 1 g, KH2PO4 2 g, (NH4)2SO4 45 g, FeSO4 20 mg, MnSO4 20 mg, Biotin 100 μg, Thiamine 100 μg, YSP 4 g and Urea 2 g

[0075] strain OD 610 L-Arginine (%) Residual Sugar (%) L-Citrulline (%) L-Lysine (%) 14GR 3 2.02.37 1.43 0.026 0.023 DA 140.02.62 0.75 0.012 0.008

[0076] As shown in Table 3 above, Corynebacterium glutamicum DA1, into which the argO gene was introduced, showed enhanced arginine excretion compared to the parent strain, Corynebacterium glutamicum 14GR, with an increase in L-arginine production of approximately 10%, and was confirmed to have excellent bacterial growth and sugar consumption, and a decrease in the production of by-products such as L-citrulline and L-lysine.

[0077]

[0078] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0079] [Accession number]

[0080] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0081] Accession number: KCCM13219P

[0082] Date of acceptance: 20220629

[0083]

Claims

1. A microorganism of the genus Corynebacterium with enhanced L-arginine production due to enhanced activity of the arginine exocytote.

2. In claim 1, A microorganism of the genus Corynebacterium in which the activity of the above arginine exotransporter is enhanced by the introduction of a gene encoding the arginine exotransporter.

3. In claim 1, The above arginine transporter is a microorganism of the genus Corynebacterium, which is derived from a microorganism of the genus Escherichia.

4. In claim 1, A microorganism of the genus Corynebacterium, wherein the above arginine transporter comprises an amino acid sequence of sequence number 1.

5. In claim 1, The above Corynebacterium genus microorganism is Corynebacterium glutamicum.

6. A step of culturing the Corynebacterium genus microorganism of claim 1 in a medium; and A method for producing L-arginine, comprising a step of recovering L-arginine from the microorganism or a medium in which the microorganism is cultured.

Images