Montbretin a biosynthesis methods, constructs, and recombinant organisms

Abstract

Provided are transgenic organisms, such as plants and plant parts, cells, and related compositions and methods for producing and monitoring the genotype for enhanced production of montbretin A (MbA) and / or its precursors. For example, provided is a transgenic organism comprising at least one heterologous nucleic acid operatively linked to a promoter, wherein the heterologous nucleic acid encodes at least one enzyme in a montbretin A (MbA) metabolic pathway or other gene that is operable to increase MbA production. The organisms can be a plant, plant part, or plant cell, or a microorganism such as a yeast. Also provided are methods for producing at least one MbA precursor and / or MbA, comprising permitting the expression of the at least one heterologous nucleic acid in the transgenic organism and isolated nucleic acid molecules that comprise sequence encoding at least one enzyme in a MbA metabolic pathway and vectors comprising the nucleic acids.

Description

[0001] MONTBRETIN A BIOSYNTHESIS METHODS, CONSTRUCTS, AND RECOMBINANT ORGANISMS CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. US 63 / 538,386, filed 14 September 2023. TECHNICAL FIELD The present disclosure relates to the rare specialized metabolite montbretin A (MbA), produced by montbretia (Crocosmia) plants, which may be useful in type-2 diabetes (T2D) and obesity. In particular, the present disclosure identifies and characterizes genes and enzymes of the montbretia phenylpropanoid pathway and other coding regions for use in a bioengineering approach to improve heterologous MbA production. BACKGROUND Type-2 diabetes (T2D) is a growing epidemic and one of the leading causes of death and disability worldwide (The Lancet, 2023). The disease affects over half a billion people globally, with healthcare expenditures exceeding $US 900 billion in 2021. The number of people affected by T2D is expected to rise to 1.3 billion by 2050, making it “a defining disease of the 21st century” (Ong et al., 2023). T2D is often linked to obesity or being overweight, unhealthy lifestyle conditions, and food insecurity across low-, middle- and high income societies (Diabetes Canada, 2020; FAO et al., 2021). The growing numbers of T2D patients, as well as side effects caused by current T2D medications, require new or improved treatment options, including easily accessible pharmaceuticals and nutraceuticals, to control blood glucose levels in T2D patients and prediabetics. The plant specialized metabolite montbretin A (MbA) has been approved for Phase-1 clinical trials as a T2D treatment, after having previously passed efficacy and toxicity studies in animals (Yuen et al., 2016). MbA lowers the glycemic index of starch- containing food by highly efficient (Ki of 8 nM) and specific inhibition of the human pancreatic α-amylase (HPA), an enzyme in starch digestion (Asada et al., 1988; Tarling et al., 2008; Andersen et al., 2009; Williams et al., 2015). MbA is a complex acylated flavonoid glycoside (FIGURE 1(a) and (b)), which according to current phytochemical and taxonomic knowledge is unique to plants of the genus montbretia (Crocosmia; family Iridaceae) that have eight different species native to Southern and Eastern Africa (Royal Botanical Garden, Kew, 2023). However, the ornamental montbretia hybrid C. x crocosmiiflora is widely grown around the world as a perennial garden plant. C. x crocosmiiflora produces MbA in small amounts in bulb-like below-ground organs, called corms, during a short time of the growing season (Irmisch et al., 2018). The limited taxonomic occurrence of MbA, its low abundance in montbretia corms, and lack of scalable horticultural production make it uneconomical to obtain sufficient amounts of the metabolite from its natural source. Furthermore, due to its complex chemical structure (FIGURE 1(b)), an adequate supply is unlikely to be achieved by chemical or chemo-enzymatic synthesis. However, synthetic biology and bioengineering of a heterologous host has the potential for development of a scalable production system for MbA. To this end, the montbretia MbA biosynthetic genes and enzymes, as well as several precursor pathway genes, have been cloned and characterized, and proof of concept of metabolically engineered MbA production in Nicotiana benthamiana (Nb) has been established (Irmisch et al., 2018, 2019b, 2019a, 2020). MbA is assembled from seven building blocks: the flavonoid myricetin, two units of UDP- glucose (UDP-Glc), two units of UDP-rhamnose (UDP-Rha), one UDP-xylose (UDP-Xyl), and the CoA-activated hydroxycinnamic acid caffeoyl-CoA (Irmisch et al., 2020). The assembly utilizes the activity of five UDP-dependent glycosyltransferases (CcUGT1-5) and a BAHD-acyltransferase (CcAT1 or CcAT2) (FIGURE 1(a)). Nb is widely used as a heterologous transient expression system for the production of a variety of different proteins and discovery of biosynthetic pathways, due to the ease of Agrobacterium mediated expression of single or multiple genes (Bally et al., 2018). In the plant biotechnology industry, Nb is used for production of therapeutic and diagnostic proteins, enzymes, vaccines and antibodies (Tschofen et al., 2016; Schillberg and Finnern, 2021). Biosynthetic systems of several plant specialized metabolites, including terpenoids, alkaloids, and flavonoids from a diverse range of plant species, have been elucidated and reconstructed using heterologous transient gene expression in Nb; and this system is also being explored for scalable of production of high-value plant metabolites (Lau and Sattely, 2015; Reed and Osbourn, 2018; Schultz et al., 2019; Calgaro-Kozina et al., 2020; Irmisch et al., 2020; Nett and Sattely, 2021; Dudley et al., 2022; Kim et al., 2022; De La Peña et al., 2023). However, one major challenge inherent to the bioengineering and heterologous production of specific specialized metabolites in Nb is the occurrence of unwanted side-products due to endogenous Nb enzyme activities (Irmisch et al., 2020; Dudley et al., 2022). Another common problem is the lack, or low abundance, of specific metabolic precursors in Nb, which may result in low yields of the target product or biosynthesis of non-target metabolites (Reed and Osbourn, 2018; Irmisch et al., 2019b; De La Peña and Sattely, 2021; Kim et al., 2022). In previous work, we successfully reconstructed MbA biosynthesis in Nb by transiently expressing the six montbretia MbA assembly genes (CcUGT1-5 and CcAT1), as well as three additional montbretia genes to enhance myricetin biosynthesis, specifically a MYB transcription factor (CcMYB4), flavonol synthase (CcFLS), and flavonol 3′5’-hydroxylase (CcCYP2) (Irmisch et al., 2019b, 2020). However, levels of MbA were low, and two related compounds, montbretin B (MbB) and montbretin C (MbC), were produced in higher concentrations than MbA (Irmisch et al., 2020). MbA, MbB, and MbC are nearly identical, but they differ in their acyl moieties, which are derived from caffeoyl- CoA, coumaroyl-CoA and feruloyl-CoA, respectively (FIGURE 1(b)). In contrast to MbA, MbB and MbC are not effective as HPA inhibitors (Ki of 3600 nM and 6100 nM, respectively), highlighting the importance of the caffeoyl meta-hydroxy group (Tarling et al., 2008; Williams et al., 2015). Formation of MbA, MbB and MbC by the same set of montbretin pathway assembly enzymes is likely due to lack of substrate specificity of CcAT1 and CcAT2, which accept caffeoyl-CoA, coumaroyl-CoA and feruloyl-CoA (Irmisch et al., 2018). It is not known what mechanisms regulate the preferential accumulation of MbA, relative to MbB and MbC, in montbretia corms, and how the same might be accomplished in Nb. We hypothesize that differences in availability of caffeoyl-CoA in montbretia corms and Nb leaves may be a factor influencing the different montbretin profiles in the native and heterologous system. Caffeoyl-CoA, coumaroyl-CoA, and feruloyl-CoA are all derived from the general phenylpropanoid pathway (FIGURE 1(c)), which plays a central role in plant growth and development and is tightly regulated by a complex network of transcription factors and signaling pathways (Douglas et al., 1992; Zhong and Ye, 2009; Weng and Chapple, 2010; Chezem and Clay, 2016; Xie et al., 2018; Renault et al., 2019; de Vries et al., 2021b). The phenylpropanoid pathway begins with phenylalanine ammonia-lyase (PAL) converting phenylalanine to cinnamic acid, followed by cinnamic acid, which is converted by 4- hydroxylase (C4H) to yield coumaric acid (Fraser and Chapple, 2011; Kriegshauser et al., 2021). Activation of coumaric acid to coumaroyl-CoA is catalyzed by 4-coumaroyl ligase (4CL) (Costa et al., 2005). It is important to note that coumaroyl-CoA provides the acyl moiety in MbB, and is also the precursor for the biosynthesis of myricetin, the central flavonol building block in MbA, MbB and MbC (Irmisch et al., 2019b). Caffeoyl-CoA and feruloyl- CoA are produced from coumaroyl-CoA via the formation of shikimate esters, known as the shikimate shunt (Hoffmann et al., 2003, 2005; Moghe et al., 2023). Esterification of coumaroyl-CoA with shikimate by hydroxycinnamoyl-CoA: shikimate hydroxycinnamoyl transferases (HCT), gives rise to coumaroylshikimate (Hoffmann et al., 2003). Coumaroylshikimate can be hydroxylated by p-coumarate 3′-hydroxylase (C3’H) to produce caffeoylshikimate (Schoch et al., 2001; Alber et al., 2019). In some plant species, HCT may catalyze the reaction of caffeoylshikimate to caffeoyl-CoA and free shikimate (Hoffmann et al., 2005; Vanholme et al., 2013). Alternatively, caffeoylshikimate esterase (CSE) catalyzes the hydrolysis of caffeoylshikimate into shikimate and caffeic acid, the latter can then be activated by 4CL to caffeoyl-CoA (Vanholme et al., 2013). Caffeoyl-CoA can be methylated by caffeoyl-CoA O- methyltransferase to produce feruloyl-CoA (CCoA-OMT) (Zhong et al., 1998). Routes that bypass the shikimate shunt involve direct conversion of coumaric acid into caffeic acid. For example, in Brachypodium distachyon and Arabidopsis thaliana a bifunctional ascorbate peroxidase, C3H / APX, can hydroxylate coumaric acid (Barros et al., 2019). In poplar (Populus trichocarpa), a C4H / C3H complex has been reported for this function (Chen et al., 2011), but has recently been put in question (Gou et al., 2018). Additionally, older literature suggested that phenolases may oxidize coumaric acid to caffeic acid (Stafford and Dresler, 1972; Duke and Vaughn, 1982; Kojima and Takeuchi, 1989). Since 4CL enzymes are involved in the formation of caffeoyl-CoA, coumaroyl-CoA and feruloyl- CoA (FIGURE 1(b)), we recently cloned and characterized montbretia 4CLs. We tested the two identified Cc4CLs for a possible preference for caffeic acid, relative to coumaric acid, as a possible mechanism for higher levels of MbA production in montbretia. However, both Cc4CLs preferred coumaric acid as their substrate and did not enhance MbA levels when co-expressed with the MbA assembly pathway in Nb (Sunstrum et al., 2021). Accordingly, a lack of a scalable production systems limit the development and use of MbA for human health. SUMMARY The present application is based in part on the fortuitous discovery that particular genes encoding enzymes of the Montbretia shikimate pathway, which is part of the phenylpropanoid pathway, may be utilized in a bioengineering process to improve heterologous montbretin A (MbA) production. The MbA production may be in any of bacteria, archaea, fungi (including yeast), algae, plants, plant parts, or plant cells, or any cell that may be transiently transfected or stably transfected with the gene expression constructs described herein to express one or more of the polypeptides encoded described herein and capable of producing MbA.. In particular, the heterologous MbA production may be in transiently transformed Nicotiana benthamiana (Nb) and Saccharomyces cerevisiae. Furthermore, the enzymes may be hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyl transferase (HCT); caffeoylshikimate esterase (CSE); and / or p- coumaroylshikimate 3’-hydroxylase (C3’H). In particular, enzymes of the Montbretia phenylpropanoid pathway may be Crocosmia × crocosmiiflora hydroxycinnamoyl- CoA:shikimate hydroxycinnamoyl transferase (CcHCT or CcAT8); Crocosmia × crocosmiiflora caffeoylshikimate esterase (CcCSE or CcEST2); and / or Crocosmia × crocosmiiflora p-coumaroylshikimate 3’-hydroxylase (CcC3’H). Furthermore, the production of MbA may also benefit from the increased production of additional enzymes. These enzymes may also include Crocosmia × crocosmiiflora Uridine diphosphate (UDP)- glycosyltransferase 1 or UDP-glycosyltransferase 1 (CcUGT1), Crocosmia × crocosmiiflora UDP-glycosyltransferase 2 (CcUGT2), Crocosmia × crocosmiiflora UDP- glycosyltransferase 3 (CcUGT3), Crocosmia × crocosmiiflora UDP-glycosyltransferase 4 (CcUGT4), and / or Crocosmia × crocosmiiflora UDP-glycosyltransferase 5 (CcUGT5). Furthermore, the enzymes may also include Crocosmia × crocosmiiflora BAHD acyltransferase 1 (CcAT1) and / or Crocosmia × crocosmiiflora BAHD acyltransferase 2 (CcAT2). Furthermore, the enzymes may also include Crocosmia × crocosmiiflora flavonol synthase (CcFLS) and / or Crocosmia × crocosmiiflora flavonol 3’5’-hydroxylase (CcCYP2). Furthermore, the synthesis of heterologous MbA may further be improved with the expression of Crocosmia × crocosmiiflora MYB4 transcription factor (CcMYB4); Tombusvirus P19 core protein (P19); and / or Crocosmia × crocosmiiflora 4-coumaroyl- CoA ligase 1 (Cc4CL). Furthermore, non-Crocosmia × crocosmiiflora enzymes may be substituted. For example, HCT enzymes having the amino acid sequence set forth in SEQ ID NOs:32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, or 66; and CSE enzymes having the amino acid sequence set forth in SEQ ID NOs: 68, 70, 72, or 74. As presented herein, further investigation of the shikimate-shunt of the phenylpropanoid pathway in montbretia for the biosynthesis of the different acyl-CoA precursors for MbA, MbB and MbC biosynthesis is carried out. Both in planta and in vitro characterization of Crocosmia × crocosmiiflora hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyl transferase (CcHCT or CcAT8); Crocosmia × crocosmiiflora caffeoylshikimate esterase (CcCSE or CcEST2); and Crocosmia × crocosmiiflora p-coumaroylshikimate 3’- hydroxylase (CcC3’H), and the reconstruction of the shikimate pathway or shikimate shunt pathway in yeast are shown. Engineered yeast and Nb were used to shed light on the role of this pathway in Montbretia. Heterologous expression of montbretia phenylpropanoid pathway enzymes resulted in increased MbA levels in Nb. This work highlights the importance of the phenylpropanoid pathway for MbA bioengineering in Nb and the metabolic plasticity of this host for production of rare and valuable specialized metabolites. The disclosure provides transgenic organisms, or subcomponents thereof, and related compositions and methods for producing montbretin A and / or its precursors, and methods of detecting and / or monitoring the capacity for enhanced production of montbretin A and / or its precursors. Also provided, are transgenic organisms comprising at least one heterologous nucleic acid operatively linked to a promoter, wherein the heterologous nucleic acid encodes at least one enzyme in a MbA metabolic pathway. In some embodiments, the transgenic organism can be a plant, plant part, or plant cell. In some embodiments, the transgenic organism can be a microorganism, such as a yeast. In some embodiments, the transgenic organism produces at least one precursor of MbA, such as one or more of the following: naringenin, dihydrokaempferol (DHK), kaempferol, eriodictyol, dihydroquercetin (DHQ), quercetin, pentahydroxyflavanon (PHF), dihydromyricetin (DHM), myricetin, myricetin 3-O-rhamnoside (MR), myricetin 3-O-glycosyl rhamnoside (MRG), myricetin 3-O-(6’-O-caffeoyl)-glucosyl rhamnoside (mini-MbA), myricetin 3-O-(glucosyl-6’-O-caffeoyl)-glucosyl rhamnoside (MbA-XR2), and myricetin 3-O-(glucosyl-6’-O-caffeoyl)-glucosyl rhamnoside 4’-O-xyloside (MbA-R2). In some embodiments, the transgenic organism produces MbA. In one embodiment, there is provided a gene expression construct, the gene expression construct including: (a) a nucleotide sequence encoding one or more of the following: (i) a Crocosmia × crocosmiiflora hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyl transferase (CcHCT) having the nucleic acid sequence set forth in SEQ ID NO:1; (ii) a Crocosmia × crocosmiiflora caffeoylshikimate esterase (CcCSE) having the nucleic acid sequence set forth in SEQ ID NO:3; (iii) a Crocosmia × crocosmiiflora p- coumaroylshikimate 3’-hydroxylase (CcC3’H) having the nucleic acid sequence set forth in SEQ ID NO:5; (iv) a hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyl transferase (HCT) having the nucleic acid sequence set forth in SEQ ID NOs:31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, or 65; and (v) a caffeoylshikimate esterase (CSE) having the nucleic acid sequence set forth in SEQ ID NOs: 67, 69, 71, or 73; or (b) a nucleotide sequence that encodes one or more of the following polypeptides: (i) a CcHCT having the amino acid sequence set forth in SEQ ID NO:2; (ii) a CcCSE having the amino acid sequence set forth in SEQ ID NO:4; (iii) a CcC3’H having the amino acid sequence set forth in SEQ ID NO:6; (iv) a HCT having the amino acid sequence set forth in SEQ ID NOs:32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, or 66; and (v) a CSE having the amino acid sequence set forth in SEQ ID NOs: 68, 70, 72, or 74; or (c) a nucleotide sequence that encodes a polypeptide which may have at least 65% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 2, 4, or 6 and having HCT; CSE; or C3’H enzyme activity. The gene expression construct may further include one or more gene expression constructs including: (a) a nucleotide sequence encoding one or more of the following: (i) Crocosmia × crocosmiiflora UDP-glycosyltransferase 1 (CcUGT1) having the nucleic acid sequence set forth in SEQ ID NO:7; (ii) Crocosmia × crocosmiiflora UDP- glycosyltransferase 2 (CcUGT2) having the nucleic acid sequence set forth in SEQ ID NO:9; (iii) Crocosmia × crocosmiiflora UDP-glycosyltransferase 3 (CcUGT3) having the nucleic acid sequence set forth in SEQ ID NO:11; (iv) Crocosmia × crocosmiiflora UDP- glycosyltransferase 4 (CcUGT4) having the nucleic acid sequence set forth in SEQ ID NO:13; (v) Crocosmia × crocosmiiflora UDP-glycosyltransferase 5 (CcUGT5) having the nucleic acid sequence set forth in SEQ ID NO:15; (vi) Crocosmia × crocosmiiflora BAHD acyltransferase 1 (CcAT1) having the nucleic acid sequence set forth in SEQ ID NO:17; (vii) Crocosmia × crocosmiiflora BAHD acyltransferase 2 (CcAT2) having the nucleic acid sequence set forth in SEQ ID NO:19; (viii) Crocosmia × crocosmiiflora flavonol synthase (CcFLS) having the nucleic acid sequence set forth in SEQ ID NO:21; (ix) Crocosmia × crocosmiiflora flavonol 3’5’-hydroxylase (CcCYP2) having the nucleic acid sequence set forth in SEQ ID NO:23; (x) Crocosmia × crocosmiiflora MYB4 transcription factor (CcMYB4) having the nucleic acid sequence set forth in SEQ ID NO:25; (xi) Tombusvirus P19 core protein (P19) having the nucleic acid sequence set forth in SEQ ID NO:27; (xii) Crocosmia × crocosmiiflora 4-coumaroyl-CoA ligase 1 (Cc4CL1) having the nucleic acid sequence set forth in SEQ ID NO:29; and (xiii) Crocosmia × crocosmiiflora 4-coumaroyl- CoA ligase 2 (Cc4CL2) having the nucleic acid sequence set forth in SEQ ID NO:75; (b) a nucleotide sequence that encodes encoding one or more of the following polypeptides: (i) CcUGT1 having the amino acid sequence set forth in SEQ ID NO:8; (ii) CcUGT2 having the amino acid sequence set forth in SEQ ID NO:10; (iii) CcUGT3 having the amino acid sequence set forth in SEQ ID NO:12; (iv) CcUGT4 having the amino acid sequence set forth in SEQ ID NO:14; (v) CcUGT5 having the amino acid sequence set forth in SEQ ID NO:16; (vi) CcAT1 having the amino acid sequence set forth in SEQ ID NO:18; (vii) CcAT2 having the amino acid sequence set forth in SEQ ID NO:20; (viii) CcFLS having the amino acid sequence set forth in SEQ ID NO:22; (ix) CcCYP2 having the amino acid sequence set forth in SEQ ID NO:24; (x) CcMYB4 having the amino acid sequence set forth in SEQ ID NO:26; (xi) P19 having the amino acid sequence set forth in SEQ ID NO:28; and (xii) Cc4CL1 having the amino acid sequence set forth in SEQ ID NO:30; (xiii) Cc4CL2 having the amino acid sequence set forth in SEQ ID NO:76; or (c) a nucleotide sequence that encodes a polypeptide which may have at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, and 30, wherein the polypeptide has UGT1; UGT2; UGT3; UGT4; UGT5; AT1; AT2; FLS; CYP2; MYB4; P19; 4CL1; or 4CL2 activity. The gene expression construct may be a multigene construct. The number of genes may depend on the size of the genes and the capacity of the plasmid or viral vector. The coding sequences may be operably linked to a functional promoter and / or a functional terminator. The gene expression construct may further include, a 5’ UTR and / or a 3’ UTR. The gene expression construct may encode a functional translation initiation site and / or a functional translation termination site. The gene expression construct may be suitable for the expression of the polypeptide(s) in one or more of the following: a bacteria, an archaea, an algae, a yeast, a plant, a plant part, or a plant cell. The bacteria, archaea, algae, yeast, plant, plant part, or plant cell may have a shikimate pathway. The gene expression construct may form part of a plasmid or viral vector. The gene expression construct may be operable to transiently transfect or stably transfect a recombinant host. The recombinant host may be a bacteria, an archaea, an algae, a yeast, a plant, a plant part, or a plant cell. The gene expression construct may be suitable for transfection of Nicotiana benthamiana. The gene expression construct may be suitable for transfection of Saccharomyces cerevisiae. The gene expression construct may be suitable for plant transformation by Agrobacterium tumefaciens. The multigene construct may have a nucleotide sequence one or more of the following: (i) SEQ ID NO:87; (ii) SEQ ID NO:88; (iii) SEQ ID NO:89; (iv) SEQ ID NO:90; and (v) SEQ ID NO:91. The gene expression construct may include: (a) a nucleotide sequence encoding one or more of the following: (i) CcUGT1 having the nucleic acid sequence set forth in SEQ ID NO:7; (ii) CcUGT2 having the nucleic acid sequence set forth in SEQ ID NO:9; (iii) CcUGT3 having the nucleic acid sequence set forth in SEQ ID NO:11; (iv) CcUGT4 having the nucleic acid sequence set forth in SEQ ID NO:13; (v) CcUGT5 having the nucleic acid sequence set forth in SEQ ID NO:15; (vi) CcAT1 having the nucleic acid sequence set forth in SEQ ID NO:17 or CcAT2 having the nucleic acid sequence set forth in SEQ ID NO:19; (vii) CcFLS having the nucleic acid sequence set forth in SEQ ID NO:21; (viii) CcCYP2 having the nucleic acid sequence set forth in SEQ ID NO:23; (ix) CcMYB4 having the nucleic acid sequence set forth in SEQ ID NO:25; (x) P19 having the nucleic acid sequence set forth in SEQ ID NO:27; and (xi) Cc4CL1 having the nucleic acid sequence set forth in SEQ ID NO:29 or Cc4CL2 having the nucleic acid sequence set forth in SEQ ID NO:75; or (b) a nucleotide sequence that encodes encoding one or more of the following polypeptides: (i) CcUGT1 having the amino acid sequence set forth in SEQ ID NO:8; (ii) CcUGT2 having the amino acid sequence set forth in SEQ ID NO:10; (iii) CcUGT3 having the amino acid sequence set forth in SEQ ID NO:12; (iv) CcUGT4 having the amino acid sequence set forth in SEQ ID NO:14; (v) CcUGT5 having the amino acid sequence set forth in SEQ ID NO:16; (vi) CcAT1 having the amino acid sequence set forth in SEQ ID NO:18 or CcAT2 having the amino acid sequence set forth in SEQ ID NO:20; (vii) CcFLS having the amino acid sequence set forth in SEQ ID NO:22; (viii) CcCYP2 having the amino acid sequence set forth in SEQ ID NO:24; (ix) CcMYB4 having the amino acid sequence set forth in SEQ ID NO:26; (x) P19 having the amino acid sequence set forth in SEQ ID NO:28; and (xi) Cc4CL1 having the amino acid sequence set forth in SEQ ID NO:30 or Cc4CL2 having the amino acid sequence set forth in SEQ ID NO:76. The gene expression construct may include: (a) a nucleotide sequence encoding one or more of the following: (i) CcUGT1 having the nucleic acid sequence set forth in SEQ ID NO:7; (ii) CcUGT2 having the nucleic acid sequence set forth in SEQ ID NO:9; (iii) CcUGT3 having the nucleic acid sequence set forth in SEQ ID NO:11; (iv) CcUGT4 having the nucleic acid sequence set forth in SEQ ID NO:13; (v) CcUGT5 having the nucleic acid sequence set forth in SEQ ID NO:15; (vi) CcAT1 having the nucleic acid sequence set forth in SEQ ID NO:17 or CcAT2 having the nucleic acid sequence set forth in SEQ ID NO:19; (vii) CcFLS having the nucleic acid sequence set forth in SEQ ID NO:21; (viii) CcCYP2 having the nucleic acid sequence set forth in SEQ ID NO:23; (ix) CcMYB4 having the nucleic acid sequence set forth in SEQ ID NO:25; and (x) P19 having the nucleic acid sequence set forth in SEQ ID NO:27; or (b) a nucleotide sequence that encodes encoding one or more of the following polypeptides: (i) CcUGT1 having the amino acid sequence set forth in SEQ ID NO:8; (ii) CcUGT2 having the amino acid sequence set forth in SEQ ID NO:10; (iii) CcUGT3 having the amino acid sequence set forth in SEQ ID NO:12; (iv) CcUGT4 having the amino acid sequence set forth in SEQ ID NO:14; (v) CcUGT5 having the amino acid sequence set forth in SEQ ID NO:16; (vi) CcAT1 having the amino acid sequence set forth in SEQ ID NO:18 or CcAT2 having the amino acid sequence set forth in SEQ ID NO:20; (vii) CcFLS having the amino acid sequence set forth in SEQ ID NO:22; (viii) CcCYP2 having the amino acid sequence set forth in SEQ ID NO:24; (ix) CcMYB4 having the amino acid sequence set forth in SEQ ID NO:26; and (x) P19 having the amino acid sequence set forth in SEQ ID NO:28. According to another embodiment, there is provided a method of enhancing montbretin A (MbA) biosynthesis, the method including transfecting a cell with an isolated nucleic molecule encoding CcHCT; CcC3’H; and CcCSE; and growing the transfected cell under conditions such that the MbA is produced, wherein the isolated nucleic acid molecule encoding CcHCT; CcC3’H; and CcCSE includes: (a) a nucleotide sequence encoding one or more of the following: (i) a CcHCT having the nucleic acid sequence set forth in SEQ ID NO:1; (ii) a CcCSE having the nucleic acid sequence set forth in SEQ ID NO:3; (iii) a CcC3’H having the nucleic acid sequence set forth in SEQ ID NO:5;(iv) a HCT having the nucleic acid sequence set forth in SEQ ID NOs:31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, or 65; and (v) a CSE having the nucleic acid sequence set forth in SEQ ID NOs: 67, 69, 71, or 73; or (b) a nucleotide sequence that encodes one or more of the following polypeptides: (i) a CcHCT having the amino acid sequence set forth in SEQ ID NO:2; (ii) a CcCSE having the amino acid sequence set forth in SEQ ID NO:4; (iii) a CcC3’H having the amino acid sequence set forth in SEQ ID NO:6; (iv) a HCT having the amino acid sequence set forth in SEQ ID NOs:32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, or 66; and (v)a CSE having the amino acid sequence set forth in SEQ ID NOs: 68, 70, 72, or 74; or (c) a nucleotide sequence that encodes a polypeptide which may have at least 65% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 2, 4, or 6 and having HCT; CSE; or C3’H enzyme activity. The an isolated nucleic molecule may be part of a gene expression construct. The cell may further transfected with one or more gene expression constructs including: (a) a nucleotide sequence encoding one or more of the following: (i) CcUGT1 having the nucleic acid sequence set forth in SEQ ID NO:7; (ii) CcUGT2 having the nucleic acid sequence set forth in SEQ ID NO:9; (iii) CcUGT3 having the nucleic acid sequence set forth in SEQ ID NO:11; (iv) CcUGT4 having the nucleic acid sequence set forth in SEQ ID NO:13; (v) CcUGT5 having the nucleic acid sequence set forth in SEQ ID NO:15; (vi) CcAT1 having the nucleic acid sequence set forth in SEQ ID NO:17; (vii) CcAT2 having the nucleic acid sequence set forth in SEQ ID NO:19; (viii) CcFLS having the nucleic acid sequence set forth in SEQ ID NO:21; (ix) CcCYP2 having the nucleic acid sequence set forth in SEQ ID NO:23; (x) CcMYB4 having the nucleic acid sequence set forth in SEQ ID NO:25; (xi) P19 having the nucleic acid sequence set forth in SEQ ID NO:27; (xii) Cc4CL1 having the nucleic acid sequence set forth in SEQ ID NO:29; and (xiii) Cc4CL2 having the nucleic acid sequence set forth in SEQ ID NO:75; (b) a nucleotide sequence that encodes encoding one or more of the following polypeptides: (i) CcUGT1 having the amino acid sequence set forth in SEQ ID NO:8; (ii) CcUGT2 having the amino acid sequence set forth in SEQ ID NO:10; (iii) CcUGT3 having the amino acid sequence set forth in SEQ ID NO:12; (iv) CcUGT4 having the amino acid sequence set forth in SEQ ID NO:14; (v) CcUGT5 having the amino acid sequence set forth in SEQ ID NO:16; (vi) CcAT1 having the amino acid sequence set forth in SEQ ID NO:18; (vii) CcAT2 having the amino acid sequence set forth in SEQ ID NO:20; (viii) CcFLS having the amino acid sequence set forth in SEQ ID NO:22; (ix) CcCYP2 having the amino acid sequence set forth in SEQ ID NO:24; (x) CcMYB4 having the amino acid sequence set forth in SEQ ID NO:26; (xi) P19 having the amino acid sequence set forth in SEQ ID NO:28; and (xii) Cc4CL1 having the amino acid sequence set forth in SEQ ID NO:30; (xiii) Cc4CL2 having the amino acid sequence set forth in SEQ ID NO:76; or (c) a nucleotide sequence that encodes a polypeptide which may have at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, and 30, wherein the polypeptide has UGT1; UGT2; UGT3; UGT4; UGT5; AT1; AT2; FLS; CYP2; MYB4; P19; 4CL1; or 4CL2 activity. The multigene construct may have a nucleotide sequence one or more of the following: (i) SEQ ID NO:87; (ii) SEQ ID NO:88; (iii) SEQ ID NO:89; (iv) SEQ ID NO:90; and (v) SEQ ID NO:91. The cell may have a skikimate pathway. The gene expression construct may be a multigene construct. The e coding sequences may be operably linked to a functional promoter and / or a functional terminator. The gene expression construct may further include, a 5’ UTR and / or a 3’ UTR. The gene expression construct may encode a functional translation initiation site and / or a functional translation termination site. The gene expression construct may be suitable for the expression of the polypeptides in a bacteria, an archaea, an algae, a yeast, a plant, a plant part, or a plant cell, having a shikimate pathway. The gene expression construct may form part of a plasmid or viral vector. The gene expression construct may transiently transfect or may stably transfect the cell. The cell may be a bacteria, an archaea, an algae, a yeast, a plant, a plant part, or a plant cell. The gene expression construct may be for transfection of Nicotiana benthamiana. The gene expression construct may be for transfection of Saccharomyces cerevisiae. The gene expression construct may be for transfection by Agrobacterium tumefaciens. According to another embodiment, there is provided a method for producing MbA in a plant, the method including: introducing the gene expression construct as described herein into a plant cell of the plant, whereby MbA is produced by the plant. According to a further embodiment, there is provided a recombinant host that produces montbretin A (MbA) precursor or montbretin A (MbA) in a cell, including: (a) a gene encoding CcHCT having the nucleic acid sequence set forth in SEQ ID NO:1; a gene encoding CcCSE having the nucleic acid sequence set forth in SEQ ID NO:3; and CcC3’H having the nucleic acid sequence set forth in SEQ ID NO:5; or (b) a nucleotide sequence that encodes one or more of the following polypeptides: (i) CcHCT having the amino acid sequence set forth in SEQ ID NO:2; (ii) CcCSE having the amino acid sequence set forth in SEQ ID NO:4; and (iii) CcC3’H having the amino acid sequence set forth in SEQ ID NO:6; or (c) a nucleotide sequence that encodes one or more of the following polypeptides: (i) CcHCT; (ii) CcCSE; and (iii) CcC3’H; which may have at least 65% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 2, 4, and 6. The cell may further include one or more gene expression constructs which may be selected from: (a) a nucleotide sequence encoding one or more of the following: (i) CcUGT1 having the nucleic acid sequence set forth in SEQ ID NO:7; (ii) CcUGT2 having the nucleic acid sequence set forth in SEQ ID NO:9; (iii) CcUGT3 having the nucleic acid sequence set forth in SEQ ID NO:11; (iv) CcUGT4 having the nucleic acid sequence set forth in SEQ ID NO:13; (v) CcUGT5 having the nucleic acid sequence set forth in SEQ ID NO:15; (vi) CcAT1 having the nucleic acid sequence set forth in SEQ ID NO:17; (vii) CcAT2 having the nucleic acid sequence set forth in SEQ ID NO:19; (viii) CcFLS having the nucleic acid sequence set forth in SEQ ID NO:21; (ix) CcCYP2 having the nucleic acid sequence set forth in SEQ ID NO:23; (x) CcMYB4 having the nucleic acid sequence set forth in SEQ ID NO:25; (xi) P19 having the nucleic acid sequence set forth in SEQ ID NO:27; (xii) Cc4CL1 having the nucleic acid sequence set forth in SEQ ID NO:29; and (xiii) Cc4CL2 having the nucleic acid sequence set forth in SEQ ID NO:75; (b) a nucleotide sequence that encodes encoding one or more of the following polypeptides: (i) CcUGT1 having the amino acid sequence set forth in SEQ ID NO:8; (ii) CcUGT2 having the amino acid sequence set forth in SEQ ID NO:10; (iii) CcUGT3 having the amino acid sequence set forth in SEQ ID NO:12; (iv) CcUGT4 having the amino acid sequence set forth in SEQ ID NO:14; (v) CcUGT5 having the amino acid sequence set forth in SEQ ID NO:16; (vi) CcAT1 having the amino acid sequence set forth in SEQ ID NO:18; (vii) CcAT2 having the amino acid sequence set forth in SEQ ID NO:20; (viii) CcFLS having the amino acid sequence set forth in SEQ ID NO:22; (ix) CcCYP2 having the amino acid sequence set forth in SEQ ID NO:24; (x) CcMYB4 having the amino acid sequence set forth in SEQ ID NO:26; (xi) P19 having the amino acid sequence set forth in SEQ ID NO:28; and (xii) Cc4CL1 having the amino acid sequence set forth in SEQ ID NO:30; (xiii) Cc4CL2 having the amino acid sequence set forth in SEQ ID NO:76; or (c) a nucleotide sequence that encodes a polypeptide which may have at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, and 30, wherein the polypeptide has UGT1; UGT2; UGT3; UGT4; UGT5; AT1; AT2; FLS; CYP2; MYB4; P19; 4CL1; or 4CL2 activity. The recombinant host may be a plant, plant part, or plant cell. The recombinant host may be a Nicotiana benthamiana. The recombinant host may be a yeast. The yeast may be Saccharomyces cerevisiae. The recombinant host may produce montbretin A (MbA) and / or at least one precursor thereof. In some embodiments, the at least one enzyme is or comprises a Crocosmia x crocosmiiflora hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyl transferase (CcHCT or CcAT8). In some embodiments, the CcHCT is operative to catalyze conversion of coumaroyl-CoA to coumaroylshikamate, or caffeoylshikamate to caffeoyl-CoA, as illustrated in FIGURE 1(c). In some embodiments, the CcHCT has an amino acid sequence with at least 65% identity (e.g., about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identity) to the amino acid sequence set forth SEQ ID NO:2, which reflects an exemplary CcHCT sequence, provided that the polypeptide has HCT activity. In some embodiments, the CcHCT is encoded by a nucleic acid sequence with at least 65% identity (e.g., about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identity) to the nucleic acid sequence set forth SEQ ID NO:1, which reflects an exemplary CcHCT sequence, provided that the polypeptide encoded by the nucleic acid sequence has HCT activity. In some embodiments, the HCT derived from a montbretia (Crocosmia x crocosmiiflora) plant, or a homolog thereof. In some embodiments, the at least one enzyme is or comprises a Crocosmia x crocosmiiflora caffeoylshikimate esterase (CcCSE or CcEST2). In some embodiments, the CcCSE is operative to catalyze conversion of caffeoylshikamate to caffeic acid, as illustrated in FIGURE 1(c). In some embodiments, the CcCSE has an amino acid sequence with at least 65% identity (e.g., about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identity) to the amino acid sequence set forth SEQ ID NO:4, which reflects an exemplary CcCSE sequence, provided that the polypeptide has CSE activity. In some embodiments, the CcCSE is encoded by a nucleic acid sequence with at least 65% identity (e.g., about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identity) to the nucleic acid sequence set forth SEQ ID NO:3, which reflects an exemplary CcCSE sequence, provided that the polypeptide encoded by the nucleic acid sequence has CSE activity. In some embodiments, the CSE derived from a montbretia (Crocosmia x crocosmiiflora) plant, or a homolog thereof. In some embodiments, the at least one enzyme is or comprises a Crocosmia x crocosmiiflora p-coumaroylshikimate 3’-hydroxylase (CcC3’H). In some embodiments, the CcC3’H is operative to catalyze conversion of coumaroylshikamate to caffeoylshikamate, as illustrated in FIGURE 1(c). In some embodiments, the CcC3’H has an amino acid sequence with at least 65% identity (e.g., about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identity) to the amino acid sequence set forth SEQ ID NO:6, which reflects an exemplary CcC3’H sequence, provided that the polypeptide has C3’H activity. In some embodiments, the CcC3’H is encoded by a nucleic acid sequence with at least 65% identity (e.g., about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identity) to the nucleic acid sequence set forth SEQ ID NO:5, which reflects an exemplary CcC3’H sequence, provided that the polypeptide encoded by the nucleic acid sequence has C3’H activity. In some embodiments, the C3’H derived from a montbretia (Crocosmia x crocosmiiflora) plant, or a homolog thereof. This summary of the invention does not necessarily describe all features of the invention. Other aspects, features and advantages of the present invention will become apparent to those of ordinary skill in the art upon review of the following description of specific embodiments of the invention. BRIEF DESCRIPTION OF THE FIGURES FIGURE 1 shows the biosynthesis of montbretin A and hydroxycinnamic acid-CoA esters. (A) Schematic of the six-step assembly pathway of montbretin A (MbA) in montbretia (Irmisch et al., 2018, 2019a, 2019b, 2020). MbA is assembled from seven different building blocks, myricetin, two units of UDP-glucose, two units of UDP- rhamnose, UDP-xylose, and caffeoyl-CoA. The assembly pathway involves five different UDP-glycosyltransferases (CcUGT1-5) and a BAHD acyltransferase (CcAT1 or CcAT2). The different building blocks of the MbA molecule are shown. (B) Structure of montbretin A (MbA), montbretin B (MbB), and montbretin C (MbC). The different acyl moieties are shown and are derived from either caffeoyl-CoA (MbA), coumaroyl-CoA (MbB), or feruloyl-CoA (MbC). (C) Illustration of the general phenylpropanoid pathway from phenylalanine to the hydroxycinnamic acid-CoA esters, caffeoyl-CoA, coumaroyl-CoA and feruloyl-CoA, with focus on the shikimate shunt shown with a box. The shikimate-shunt may not be conserved across all land plants, and additional enzymes may exist in different plant species. Arrows depict one possible direction of pathway flux. PAL, phenylalanine ammonia-lyase; C4H, cinnamate 4-hydroxylase; 4CL, p-coumaroyl ligase; HCT, hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyltransferases; C3H, p-coumarate 3-hydroxylase; C3’H, p- coumaroylshikimate 3’-hydroxylase; CSE, caffeoylshikimate esterase; CAMT, caffeic acid O-methyltransferase; CCoA-OMT, caffeoyl-CoA O-methyltransferase; C3H / APX, bifunctional p-coumarate 3-hydroxylase. FIGURE 2 shows transcript expression patterns of putative caffeic acid biosynthetic genes and previously characterized MbA pathway genes. Heatmap showing relative transcript abundance for known genes of the MbA assembly pathway (UGT 1-5; AT1 and AT2), known genes of MbA precursor biosynthesis (F3H1; 4CL2; CHS2; F3H2; CYP2; CHI2; FLS; CYP1; and 4CL1), candidate genes for caffeic acid / -caffeoyl-CoA biosynthesis identified in this study (AT8; C3’H; AT10; AT9; EST3; EST1; and EST2) in young corms at six different time points of corm development. Details of the time course experiment, including selection of sampling dates, as well as the transcriptome resource and expression analysis are described in Irmisch et al. (2020). Representative images of developing corms at the different time points were previously shown in Irmisch et al. (2018). Previously characterized genes (F3H1; 4CL2; CHS2; F3H2; CYP2; CHI2; FLS; CYP1; 4CL1; UGT 1-5; AT1 and AT2) were described in Irmisch et al. (2019a), Irmisch et al. (2019b), Irmisch et al. (2020) and Sunstrum et al. (2021). Heatmap colors indicate relative up- (unmarked) and down- (vertical line*) regulation. AT1, acetyltransferase 1; AT2, acetyl-transferase 2; AT8, acetyltransferase 8; AT9, acetyltransferase 9; AT10, acetyltransferase 10; CHS2, chalcone synthase 2; CHI2, chalcone isomarase 2; CYP1, flavonoid 3′-hydroxylase; CYP2, flavonoid 3′5′-hydroxylase; EST1, esterase 1; EST2, esterase 2; EST3, esterase 3; FLS, flavonol synthase; F3H1, flavanone 3-hydroxylase 1; F3H2, flavanone 3-hydroxylase 2; UGT1-5, UDP-dependent glycosyltransferases 1-5; 4CL1, p-coumaroyl ligase 1; 4CL2, p-coumaroyl ligasae 2. FIGURE 3 shows levels of MbA, MbB and MbC in N. benthamiana as affected by co- expression of CcAT8 (CcHCT) or CcEST2 (CcCSE). (A) Levels of MbA, MbB, and MbC, and (B) percent of MbA of total montbretins (MbA+MbB+MbC). N. benthamiana leaves were transiently transformed using A. tumefaciens strains carrying plasmids with a set of ten genes previously shown to be significant for montbretin production in Nb serving as the control (Irmisch et al., 2020), plus the additional transient transfection with CcAT8 or CcEST2. Leaves were collected 5 days post-infiltration. Metabolites were extracted with 50% MeOH and analyzed by LC-MS. Montbretin concentrations were calculated based on an external calibration curve of MbA. Error bars represent the standard error of the mean for four biological replicates (n=4). Individual data points are shown as black dots. Asterisk symbols indicate significant differences (*, p- value<0.05; **, p-value<0.01; ***, p-value<0.001). FIGURE 4 shows levels of MbA, MbB and MbC in N. benthamiana as affected by co- expression of shikimate pathway genes AT8, AT9, AT10, EST1, EST2, EST3, and C3’H. (A) Levels of MbA, MbB, and MbC. (B) Close up showing levels of MbA only. (C) Percent proportion of MbA relative to the total of the three montbretins, MbA, MbB and MbC. N. benthamiana leaves were transiently transfected using A. tumefaciens strains carrying plasmids with a set of ten genes previously shown to be significant for montbretin production in Nb serving as the control (Irmisch et al., 2020), plus the additional transient transfection with CcAT8, CcAT9, CcAT10, CcEST1, CcEST2, CcEST3 or CcC3’H. Leaves were collected 5 days post-infiltration. Metabolites were extracted with 50% MeOH and analyzed by LC-MS. Montbretin concentrations were calculated based on an external calibration curve of MbA. Error bars represent the standard error of the mean for four biological replicates (n=4) and black dots represent individual data points. Asterisk symbols indicate significant differences (*, p-value<0.05; **, p- value<0.01; ***, p-value<0.001). FIGURE 5 shows enzyme activity of recombinant CcAT8. CcAT8 was heterologously expressed in E. coli and Ni-affinity purified protein was assayed with shikimate or quinate and either coumaroyl-CoA, caffeoyl-CoA or feruloyl-CoA (as indicated). Controls were performed with a protein preparation from E. coli transformed with the empty vector (not shown). (A) Products were analyzed by LC-MS and extracted ion chromatograms (EICs) with peaks for the detected products are shown. The mass to charge ratio (m / z) in negative ionization mode is given for each expected product. Peak 1, coumaroylquinate (m / z 337.0906); peak 2, caffeoylshikimate (m / z 335.0893); peak 3, coumaroylshikimate (m / z 319.0807); peak 4, feruloylshikimate (m / z 349.0932). (B) Bar graphs showing the observed relative peak area of the detected products and black dots show individual data points. Three independent enzyme assay replicates were performed, and the peak area was normalized using the internal standard (IS, chloramphenicol). Error bars show the standard error of the mean (n=3) and black dots indicate individual data points. FIGURE 6 shows activity of recombinant CcEST2 with caffeoylshikimate detected in coupled assays with CcAT. CcEST2 and CcAT8 enzymes were heterologously expressed in E. coli and Ni-affinity purified protein was used in assays. Substrates for CcEST2 were produced by incubating CcAT8 (CcHCT) for 1 hour with shikimate and caffeoyl-CoA to produce caffeoylshikimate. After 1 hr, CcEST2 was added and samples were taken at four different time points (0, 10, 30, and 60 minutes) over a 1-hour time course and analyzed using LC-MS. (A) Representative extracted ion chromatograms (EICs) for the product caffeic acid (m / z 179.0443) and (B) the substrate caffeoylshikimate (m / z 335.0753). Peak height is normalized to the highest peak across all shown chromatograms (relative peak height). (C) Bar graph showing the observed relative peak area for caffeic acid and caffeoylshikimate. The peak area was normalized using the internal standard (IS, chloramphenicol). Coupled assays revealed a time-dependent increase in the product caffeic acid (A) and decrease in the substrate caffeoylshikimate (B). Error bars represent the standard error of the mean for three independent assay replicates (n=3) and black dots indicate individual data points. Peak 2, caffeoylshikimate; Peak 5, caffeic acid. FIGURE 7 shows levels of (A) caffeic acid, (B) caffeoylshikimate and (C) chlorogenic acid (caffeoylquinate) in N. benthamiana affected by co-expression of phenylpropanoid pathway genes. N. benthamiana leaves were transiently transformed using A. tumefaciens strains carrying plasmids with a set of ten genes previously shown to be significant for montbretin production in Nb serving as the control (Irmisch et al., 2020), plus the additional transient transfection with CcAT8, CcAT9, CcAT10, CcEST1, CcEST2, CcEST3 or CcC3’H. Metabolites were extracted five days after infiltration and measured using LC-MS. Bars represent the peak area of the detected peak. The standard error for four biological replicates is shown (n=4) and black dots show individual data points. Peaks were identified by retention time, mass or in comparison to authentic standards. Asterisk symbols indicate significant differences (***, p-value<0.001). FIGURE 8 shows montbretin formation in N. benthamiana co-expressing MbA-genes and different combinations of phenylpropanoid pathway genes. N. benthamiana leaves were transiently transformed with different Agrobacterium strains carrying plasmids with a set of ten genes needed to produce MbA in Nb and different combinations of the putative phenylpropanoid pathway genes (CcAT8 (CcHCT), CcEST2 (CcCSE), CcC3’H and Cc4CL2). Two independent experiments (experiment one; panel A, B, C and experiment two; panel D, E) were performed to test different combinations. Combination shown in panel A, B, and C were tested in the same experiment as the individual gene tests shown in FIGURE 4. Metabolites were extracted five days after infiltration and measured using LC-MS. (A) Levels of MbA, MbB, and MbC. (B) Levels of MbA shown in greater detail. (C) Ratio of MbA in comparison to all other montbretins (MbA+MbB+MbC) in percent are shown. (D) MbA levels expressed as relative peak area from a second experiment confirming the results of the first experiment. (E) The ratio of MbA to other montbretins in percent found in the second experiment are shown. The standard error for four biological replicates is shown (n=2- 4) and black dots show individual data points. Asterisk symbols indicate significant differences (*, p-value<0.05; **, p-value<0.01; ***, p-value<0.001). FIGURE 9 shows functional validation and reconstruction of the montbretia shikimate shunt in yeast. (A) Four different single-gene and four different multigene constructs were made to constitutively express the montbretia shikimate shunt genes, Cc4CL2, CcHCT (CcAT8), CcC3’H, and CcCSE (CcEST2) in Saccharomyces cerevisiae. Shown for each construct are the montbretia gene(s), the promoter(s), and terminator(s) used. Details of the construct design are shown in FIGURE 10. (B) Conversion of coumaric acid, which was fed to transformed yeast strains, and product formation was measured after three days of incubation and detected by LC-MS analyses. Representative extracted ion chromatograms of the main product for each of the four multigene constructs are shown. (C) Integrated peak area for products detected in yeast carrying single-gene or multigene constructs. A yeast strain carrying a plasmid expressing GFP was used as control. Error bars represent the standard error of four independent replicates (n=4). Dots indicate individual data points. Peak area was normalized to the internal standard (m / z 191.0275). A second experiment was conducted in the same manner and is summarized in FIGURE 11. Peak 2, caffeoylshikimate; Peak 3, coumaroylshikimate; Peak 5, caffeic acid. FIGURE 10 shows the design of multigene constructs for yeast expression. All plasmids were assembled using the MoClo YTK kit™ (Lee et al., 2015; Addgene™ Kit #1000000061, https: / / www.addgene.org / kits / moclo-ytk / ). The design of position- specific GFP dropout vectors (A), cassette vectors (B), GFP multi-gene dropout vector (C), and the final assembled multigene constructs are shown (D). Plasmids used from the kit are given in gray below each part. For simplicity, all plasmids are illustrated in a linear form. POS1-5 denotes position 1 to 5 in the final multigene construct, and CDS stands for coding sequence. All other abbreviations and labels are according to the MoClo YTK kit (Lee et al., 2015). FIGURE 11 shows functional validation of the montbretia shikimate shunt in yeast. Yeast strains were fed with coumaric acid and grown for 3 days. Product detection was done using LC-MS (not shown). Product formation in yeast expressing caffeic acid biosynthetic genes. Independent replicated experiment to the one in FIGURE 9. Error bars represent the standard error of four independent replicates (n=4) and black dots indicate individual data points. FIGURE 12 shows MbA production in N. benthamiana using multigene constructs (MGCs). (A) Five different MGCs were designed to achieve the transient expression of eleven genes in N. benthamiana using a two-plasmid or three-plasmid system to streamline the transfection system. For each construct, the containing genes and the promoter and terminators controlling the expression are shown. Details on how constructs were made are shown in FIGURE 13. (B) N. benthamiana leaves were infiltrated with 11 different Agrobacterium strains carrying the 11 different genes on individual pCAMBIA230035Su plasmids (pCAMBIA); on individual Level-1 plasmids (L1); or infiltrated with 2 or 3 Agrobacterium strains carrying the 11 genes on two plasmids MGC1 and MGC2 (MGC1+MGC2); or on three plasmids MGC3, MGC4 and MGC5 (MGC3+MGC4+MGC5). Metabolites were extracted five days post-infiltration and montbretin concentrations were determined using an external MbA standard curve. (C) Percent proportion of MbA relative to the total of the three montbretins, MbA, MbB and MbC. Error bars represent the standard error of five biological replicates (n=5). Individual datapoints are shown as black dots. Asterisk symbols indicate significant differences (*, p-value<0.05). FIGURE 13 shows Level-1 (L1) and Level-2 (L2) constructs for MGC transfection and transient expression in N. benthamiana. Constructs were assembled using the MoClo Toolkit (Addgene Kit #1000000044, https: / / www.ad-dgene.org / kits / marillonnet- moclo / #kit-details) and MoClo Plant Parts Kit™ (Addgene™ Kit #1000000047, https: / / www.addgene.org / kits / -patron-moclo / ). Plasmids used from either of the kits are indicated in gray below each part. For simplicity, all plasmids are illustrated in a linear form. LB stands for the left border of the binary plasmid, RB for the right border, and POS1-7 denotes position 1-7 in the final MGC. Dummy sequences are 15bp short DNA sequences to be placed into MGCs instead of a L1 transcriptional unit, allowing assembly of different MGCs from a single position specific L1 unit. All additional abbreviations and labels are according to the MoClo Toolkit™ (Weber et al., 2011; Werner et al., 2012) and the MoClo Plant Parts Kit™ (Engler et al., 2014). FIGURE 14 shows an alignment of the three montbretia candidate HCTs, CcAT8 (CcHCT), CcAT9 and CcAT10, with the A. thaliana HCT (AtHCT). The alignment was created with Geneious v2022.2.2™ using the implemented Geneious Alignment Builder™ and default settings. Amino acids in agreement with the consensus sequence are highlighted with different shading. The canonical BAHD motifs HxxxD and DFGWG are outlined with boxes. FIGURE 15 shows an alignment of the montbretia candidate CcC3’H sequence with the C3H from A. thaliana (AtC3H). The alignment was created with Geneious v2022.2.2™ with the Geneious Alignment Builder™ and default settings. Amino acids in agreement with the consensus sequence are highlighted with different shading. FIGURE 16 shows an alignment of the montbretia candidate CcEST sequences with the CSE from A. thaliana (AtCSE). The alignment was created with Geneious v2022.2.2™ using the implemented Geneious Alignment Builder™ and default settings. Amino acids in agreement with the consensus sequence are highlighted with different shading.

[0002] DETAILED DESCRIPTION The following detailed description will be better understood when read in conjunction with the appended figures. For the purpose of illustrating the invention, the figures demonstrate embodiments of the present invention. However, the invention is not limited to the precise arrangements, examples, and instrumentalities shown. Definitions Montbretin A (MbA) is also known as 2-(4-{[4-O-(6-deoxy-alpha-L-mannopyranosyl)- beta-D-xylopyranosyl]oxy}-3,5-dihydroxyphenyl)-5,7-dihydroxy-4-oxo-4H-chromen-3-yl beta-D-glucopyranosyl-(1->2)-6-O-[(2E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]-beta-D- glucopyranosyl-(1->2)-6-deoxy-alpha-L-mannopyranoside and has CAS Number 115712- 92-0. As used herein, a “gene expression construct” refers to one or more coding sequences for expression. However, the gene expression construct may also include one or more of the following: a functional promoter; a functional terminator; a 5’ UTR; a 3’ UTR; a functional translation initiation site; a functional translation termination site; a reporter; plasmid specific sequences, viral specific sequences; bacterial specific sequences; archaea specific sequences; algal specific sequences; fungal specific sequences; yeast specific sequences; plant specific sequences; restriction sites. The gene expression construct may also include a viral vector or plasmid for delivery of the expression construct to a host thus making the host a recombinant host. As used herein, a “shikimate pathway” or a “shikimate shunt” refers to the central phenylpropanoid pathway as shown in FIGURE 1C, and in particular the reactions catalyzed by 4CL, HCT, C3’H, and CSE enzymes. Furthermore, when a recombinant host organism, a cell transformed by one or more of the gene expression constructs described herein may already have a functional “shikimate pathway” as a result of having evolved to have a shikimate pathway or being engineered to have a “shikimate pathway”. As used herein, “recombinant host” is meant to include any bacteria, archaea, fungi (including yeast), algae, plant, plant part, or plant cell, or any cell that may be transiently transfected or stably transfected with the gene expression constructs described herein to express one or more of the polypeptides encoded described herein and capable of producing MbA. In another aspect the disclosure provides a vector comprising a nucleic acid encoding at least one enzyme in a montbretin A (MbA) metabolic pathway operatively linked to a promoter. In one embodiment, the vector is a viral vector, a circularized nucleic acid, or a nanoparticle. In one embodiment, the vector is a viral vector selected from DNA viruses (for example, Bean yellow dwarf virus (BYDV), Wheat streak mosaic virus (WSMV) and Barley stripe mosaic virus (BSMV), and Cabbage leaf curl virus (CLCV)) and RNA virus (for example, Tobacco rattle virus (TRV)) vector. As used herein, a “plasmid” is a small DNA molecule that is able to replicate independently from chromosomal DNA. Plasmids are most commonly found as small circular, double- stranded DNA molecules in bacteria, archaea and some eukaryotic cells, but plasmids may also be engineered and may be used as vectors for molecular cloning. As used herein, a “viral vector” is a modified virus engineered to deliver genetic material (RNA or DNA) into cells. Viral vectors, are able to integrate their transgene(s) or gene expression constructs into the host genome by stable integration or transiently with non- integrative vectors. Depending on the virus used different plants may be targeted and different constructs may be tailored to the particular virus vector and desired use. Furthermore, a combination of vectors may be used where Agrobacterium-mediated delivery is used to deliver viral vectors, whereby bacteria are transformed with plasmids encoding the viral vector construct. As used herein “5′ untranslated region” or “5’ UTR” is the region of a messenger RNA (mRNA) that is directly upstream from the initiation codon. The 5’ UTR will usually vary depending on whether the it is a prokaryotic or eukaryotic 5’UTR. Prokaryotic 5′ UTRs have a ribosome binding site (RBS), called the Shine–Dalgarno sequence (AGGAGGU), which is usually 3–10 base pairs upstream from the initiation codon, while eukaryotic 5′ UTRs contain the Kozak consensus sequence (ACCAUGG), which contains the initiation codon. Also, eukaryotic 5’ UTRs may have cis-acting regulatory elements called upstream open reading frames (uORFs), upstream AUGs (uAUGs), and termination codons, that facilitate more complex regulation of eukaryotic translation. As used herein “3′ untranslated region” or “3’ UTR” is a region of mRNA that immediately follows the translation termination codon and the 3′-UTR often contains regulatory regions that post-transcriptionally influence gene expression. Regulatory regions in the 3′ UTR are able to influence polyadenylation, translation efficiency, localization, inhibit the expression, and stability or decay rate of the mRNA. As used herein, a “functional translation initiation site” is a start codon and other initiation binding sites, which may reside in the 5’ UTR. As used herein, a “functional translation termination site” is a stop codon and other termination binding sites, which may reside in the 3’ UTR. As used herein, a “transcription promotor” or “functional promotor” or “promotor” is a sequence of DNA to which proteins bind to initiate transcription of a single RNA transcript from the DNA downstream of the promoter. Promoters are typically located near the transcription start sites of genes, upstream on the DNA (towards the 5' region of the sense strand). Promoters may be anywhere between about 50–1,000 base pairs, the sequence of which is highly dependent on the gene and product of transcription, type or class of RNA polymerase recruited to the site, and species of organism. As used herein, a “transcription terminator” or “functional terminator” or “terminator” is a section of nucleic acid sequence that marks the end of a gene or the end of an operon in genomic DNA and signals where transcription should end. This sequence mediates transcriptional termination by providing signals in the newly synthesized transcript RNA that trigger processes, which release the transcript RNA from the transcriptional complex. These processes include the direct interaction of the mRNA secondary structure with the complex and / or the indirect activities of recruited termination factors. Release of the transcriptional complex frees RNA polymerase and related transcriptional machinery to begin transcription of new mRNAs. In some embodiments, the nucleic acid molecule may further include a detectable label. There is a wide variety of available detectable moieties used to label oligonucleotides, including fluorescent labels, radiolabels, and the like, all of which are encompassed by this disclosure. The labels can be linked to the isolated nucleic acid molecule accordingly to routine techniques known in the art. The isolated nucleic acid can further comprise a promotor sequence operatively linked to the encoding sequence. Promoters are described elsewhere herein in more detail. In some embodiments, the encoding sequence and promoter sequence do not naturally occur together. In some embodiments, encoding sequence and promoter sequence are configured in a manner not found in nature (e.g., the isolate nucleic acid has been engineered and does not consist of a naturally occurring sequence). The disclosure encompasses methods of generating a transgenic organism, whereby the host organism is transformed to receive at least one heterologous nucleic acid operatively linked to a promoter, wherein the heterologous nucleic acid encodes at least one enzyme in a montbretin A (MbA) metabolic pathway heterologous nucleic acid. In particular, an enzyme of the shikimate shunt selected from CcHCT, CcCSE, and CcC4’H. Embodiments of the organisms, nucleic acids, enzymes and enzyme combinations are described in more detail above. The method can comprise contacting the host organism with the heterologous nucleic acid and continue to culture or cultivate the transformed organism. Appropriate vectors can be selected for the organism of choice according to the knowledge and skill in the art. For example, for target plant organisms, the practitioner can, for example, refer to, Dunwell, J.M. and Wetten A.C.2012. Furthermore, a person of skill in the art would have access to alternative resources relating to transfection, cloning and expression systems (for example, Ausubel, F.M., et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, New York (2010); Coligan, J.E., et al. (eds.), Modern Proteomics – Sample Preparation, Analysis and Practical Applications in Advances in Experimental Medicine and Biology, Springer International Publishing, 2016, and Comai, L, et al., (eds.); and Proteomic: Methods and Protocols in Methods in Molecular Biology, Springer International Publishing, 2017). For convenience, certain terms employed herein, in the specification, examples and appended claims are provided here. The definitions are provided to aid in describing particular embodiments and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless the context clearly requires otherwise, throughout the description and the claims, the words “comprise”, “comprising”, and the like, are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense, which is to indicate, in the sense of “including, but not limited to”. Words using the singular or plural number also include the plural and singular number, respectively. The word “about” indicates a number within range of minor variation above or below the stated reference number. For example, in some embodiments, the term “about” refers to a number within a range of 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% above and / or below the indicated reference number. As used herein, the term “polypeptide” or “protein” refers to a polymer in which the monomers are amino acid residues that are joined together through amide bonds. When the amino acids are alpha-amino acids, either the L-optical isomer or the D-optical isomer can be used, the L isomers being preferred. The term polypeptide or protein as used herein encompasses any amino acid sequence and includes modified sequences such as glycoproteins. The term polypeptide is specifically intended to cover naturally occurring proteins, as well as those that are recombinantly or synthetically produced. One of skill will recognize that individual substitutions, deletions or additions to a peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a percentage of amino acids in the sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative amino acid substitution tables providing functionally similar amino acids are well known to one of ordinary skill in the art. The following six groups are examples of amino acids that are considered to be conservative substitutions for one another: (1) Alanine (A), Serine (S), Threonine (T), (2) Aspartic acid (D), Glutamic acid (E), (3) Asparagine (N), Glutamine (Q), (4) Arginine (R), Lysine (K), (5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V), and (6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W). Reference to “sequence identity” addresses the degree of similarity of two polymeric sequences, such as protein sequences or nucleic acid sequences. Determination of sequence identity can be readily accomplished by persons of ordinary skill in the art using accepted algorithms and / or techniques. Sequence identity is typically determined by comparing two optimally aligned sequences over a comparison window, where the portion of the peptide or polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical amino-acid residue or nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Various software driven algorithms are readily available, such as BLAST N or BLAST P to perform such comparisons. Unless specifically stated alignments and determinations of “sequence identity” utilized default parameters. For example, the amino acid sequence identity between Crocosmia × crocosmiiflora (Cc) and Arabidopsis thaliana (At) enzymes are 65% for AtHCT and CcHCT; 74% for AtC3’H and CcC3’H; and 65% for AtCSE and CcCSE. The hydroxycinnamoyl-CoA: shikimate hydroxycinnamoyl transferase (HCT) enzymes belong to the BAHD acyltransferase family and can have quite low sequence similarity despite having the same or very similar enzymatic activity. For example, amino acid sequence identity between AtHCT and CcHCT is only 65%. However, these two enzymes still have very similar activities suggesting that CcHCT may be exchanged with AtHCT or another HCT as described herein in MbA production. All land plants have HCTs, so there are many options for finding an HCT that improves MbA production similar to CcHCT. Likewise, the inventors expect similar alternatives to the CcC3'H and CcCSE enzymes from other sources, having a sequence identity as low as 65% yet still having the same or similar enzymatic activity. In part, the expectation that even enzymes with low sequence identity would still have the same or similar enzymatic activity as the CcHCT, CcCSE, and CcC3'H because these enzymes are part of the primary metabolism of most land plants. However, for other enzymes involved in MbA production (i.e. CcUGT1-5, CcAT1 / 2, CcFLS, CcCYP2, and Cc4CL1 / 2) and other polypeptides (i.e. CcMYB4 and P19), inventors expect there to be a requirement for much more similar sequence identity (i.e.85% or 90% or more), because these enzymes and other polypeptides are much more specialized for a very specific reaction, which at present is only know to occur in Crocosmia. Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. It is understood that, when combinations, subsets, interactions, groups, etc., of these materials are disclosed, each of various individual and collective combinations is specifically contemplated, even though specific reference to each and every single combination and permutation of these components may not be explicitly disclosed. This concept applies to all aspects of this disclosure including, but not limited to, steps in the described methods. Thus, specific elements of any foregoing embodiments can be combined or substituted for elements in other embodiments. For example, if there are a variety of additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed. Additionally, it is understood that the embodiments described herein can be implemented using any suitable material such as those described elsewhere herein or as known in the art. As used herein, the term “messenger RNA” or “mRNA”, refers to a polynucleotide that encodes and expresses the secretory protein. The nucleic acid polymers as used herein encompasses both modified and unmodified. In one embodiment, the nucleic acid polymers comprise one or more coding and non-coding regions. The nucleic acid polymers can be purified from natural sources, produced using recombinant expression systems and optionally purified, or may be chemically synthesized. Modifications to the nucleic acid polymers can improve immunogenicity, stability, and translational efficiency and fidelity of the nucleic acid polymers and thus improve desired activity. When a plurality of heterologous nucleic acids is present, each of the plurality of heterologous nucleic acids can be operatively linked to its own promoter sequence. In such instances, the individual promoter sequences on the different heterologous nucleic acids can be the same or different, although all promoter sequences are preferably operable to induce expression of the encoding heterologous nucleic acid in the organism. Alternatively, two or more of the plurality of heterologous nucleic acids can be operatively linked to the same promoter, as in an expression cassette leading capable of expressing multiple transcripts from a single promoter sequence. In embodiments where the heterologous nucleic acid is not integrated into the organism's chromosomes, the different heterologous nucleic acids (and the operatively linked promoter(s)) can reside on the same nucleic acid construct (e.g., a plasmid vector within the transgenic organism) or each can reside on different nucleic acid constructs within the same cell of the transgenic organism. Operatively linked promoters can encompass any promoter that facilitates expression in a target cell of interest, which can be appropriately selected by persons of ordinary skill in the art. The vectors can comprise additional elements providing, e.g., resistance or other selection markers, origin of replication, and the like, which facilitate delivery and expression of the nucleic acid to a target cell of interest. Non-limiting examples of vectors encompassed by the present disclosure are described in more detail in the Examples. The isolated nucleic acid can further comprise a promotor sequence operatively linked to the encoding sequence. Promoters are described elsewhere herein in more detail. In some embodiments, the encoding sequence and promoter sequence do not naturally occur together. In some embodiments, encoding sequence and promoter sequence are configured in a manner not reflected in nature (e.g., the isolate nucleic acid has been engineered and does not consist of a naturally occurring sequence). In some embodiments, the nucleic acid molecule can further comprise a detectable label. There is a wide variety of available detectable moieties used to label oligonucleotides, including fluorescent labels, radiolabels, and the like, all of which are encompassed by this disclosure. The labels can be linked to the isolated nucleic acid molecule accordingly to routine techniques known in the art. The isolated nucleic acid molecule can be a single stranded oligo (e.g., DNA or RNA). The isolated nucleic acid molecule can be between about 10 and 50 nucleotides in length, such as about 10, about 12, about 15, about 17, about 20, about 25, about 30, about 35, about 40, about 45, and about 50 nucleotides or more. In some embodiments, the sequence of the isolated nucleotide is selected to avoid formation of hairpin constructs through self- hybridization under standard hybridization conditions. Materials & Methods Identification and cloning of montbretia candidate genes and phylogenetic sequence analyses The databases and methods for the identification of montbretia (Crocosmia x crocosmiiflora) candidate transcripts and their open reading frames (ORF) and CDS were as described previously (Irmisch et al., 2018, 2019a, 2019b, 2020). In brief, a BLASTP search against the translated transcriptome database that covers a time course of montbretia corm development (Irmisch et al., 2020) was conducted using sequences from A. thaliana as query sequences (TABLE 1A). TABLE 1A. A. thaliana sequences used for identification of candidate genes. Sequences were used in blast searches against the translated montbretia transcriptome to identify putative candidate sequences. Name, annotation and sequence NCBI™ accession number and SEQ ID NO are given. Name Annotation Accession number SEQ ID NO: AtCYP98A3 p-coumarate 3-hydroxylase NP_850337.1 86 (C3’H) AtHCT hydroxycinnamoyl- NP_199704.1 60 CoA:shikimate hydroxycinnamoyl transferase (HCT) AtCSE caffeoyl-shikimate esterase NP_175685.1 68 Montbretia candidate sequences were filtered based on ≥40% identity to the query amino acid (aa) sequence and ≥ 300 aa length. In addition, for the identification of esterases, two sequences were identified with an e-value of 0 that returned the term esterase in a BLASTP™ (Camacho et al., 2009) search and showed >2-fold higher expression in June compared to October, the period of MbA biosynthesis in young corms as described in Irmisch et al., 2020 (Irmisch et al., 2020). This approach yielded three candidate acyltransferases (CcAT8-10), three candidate esterase (CcEST1-3), and one candidate p- coumarate 3- hydroxylase (CcC3H). The sequences of which are shown in TABLE 1B below. TABLE 1B: SEQ ID NO:1 hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyl transferase (CcHCT or CcAT8); Crocosmia × crocosmiiflora (Cc) GAGGGTGGTGGACAAGTGA SEQ ID NO:4 caffeoylshikimate esterase (CcCSE or CcEST2); Cc Full-length ORFs were obtained for all seven candidate genes by PCR from young corm cDNA attained from RNA (see TABLE 2 for primer information) (Irmisch 2018). The ORFs were cloned into the pJET1.2 / blunt vector (Thermo Fisher Scientific™, https: / / www.thermofisher.com / ) and sequences were verified through sequencing. Phylogenetic sequence analyses were performed using methods described in Kruse et al., 2022; 2023 (Kruse et al., 2022, 2023). Additional sequences for the esterase phylogeny were obtained using a BLAST search of the A. thaliana AtCSE against the UNIPROT™ (The UniProt Consortium™, 2023) database. Amino acid sequence alignments of montbretia sequences and sequences from other plants (for sequences, see Sequence Listing) were constructed with default settings in the GENEIOUS v2022.2.2 plugin of MAFFT v.7.453™ (Katoh et al., 2002) and used to generate a maximum likelihood phylogenetic tree (non- parametric bootstrap, 1000 replicates) with IQ-Tree v1.6.10 (Nguyen et al., 2015). ITOL v5.6.2 (Letunic and Bork, 2021) was used to visualize the phylogenetic tree. TABLE 2. Oligonucleotide sequences used in this study. Primer number, name, sequence, and the usage of the primer are given. #  Name  Sequence (5’ – 3’)SEQ ID Usage  NO  P1  CcEST2‐1f ATGGCGGCGGTCCACCACCCT92 P2  CcEST2‐1r TCATATCCCTTCAGCCACACTCTTA93 P3  CcEST1‐2f ATGCCGACAAAATACTTCTGGGGC94 P4  CcEST1‐2r TCACTTGTCCACCACCCTCTTGTC95 P5  CcEST3‐3f ATGGAGGTAGACTACCAAGAGG96 P6  CcEST3‐3r TTACATAGCCGACTGAGGATGCATC97 P7  CcAT10‐f ATGAGGATGGTGGGGATAACTG 98 Blunt end cloning  for sequence  P8  CcAT10‐r  TCATGCCTCATTCAATTCCTCATAG 99  verification  P9  CcAT9‐f  ATGGTAGAGATAATCGAGTCATGT 100  P10  CcAT9‐r  TCACATACAAGATACACCATGCTTC 101  P11  CcAT8‐f  ATGGCGACGGTGGAGATAACAG 102  P12  CcAT83‐r  CTACAAGTCATAGAGCAACTT 103  P13  CcC3H‐f  ATGACCAAAGTGACAACAATGGAA 104  P14  CcC3H‐r  TTACATATCGGCAGCGACACGG 105  P15  CcCSE‐F1 ATGGTAGGTCTCAGCGCATGCCGACAA106  AATACTTCTGGGGP16  CcCSE‐R1 ATGGTAGGTCTCATATCACTTGTCCAC107  CACCCTCTTGTCACloning into pASK‐P17  CcHCT‐F1 ATGGTAGGTCTCAGCGCATGGCGACGG108  TGGAGATAACAGIBA37 vector via  BsaI P18  CcHCT‐R1 ATGGTAGGTCTCATATCACAAGTCATA109  GAGCAACTTTTCAAATCP19  CcUGT1‐L0‐F1 ATGAAGACATAATGGATTCAGCCAGCA110  GGCAGCP20  CcUGT1‐L0‐F2  ATGAAGACCCTCCCCATCGGCCCCCTC 111 P21  CcUGT1‐L0‐F3 ATGAAGACACGAATGCGAGGATGGTGT112  CGGCloning of CcUGT1  as three fragments P22  CcUGT1‐L0‐R1  113  into pICH41308  CAGusing BpiI P23  CcUGT1‐L0‐R2 ATGAAGACGCATTCGTCTTGTGGTCTG114  CGAACP24  CcUGT1‐L0‐R3 ATGAAGACATAAGCTTAATTAGCAGTC115  CCACGTACCATCTCCP29  CcUGT2_L0_F1 ATGAAGACATAATGGCAGAGAAAGAAG116  CAAAACATCCloning of CcUGT2  ATGAAGACATAinto pICH41308 P30  CcUGT2_L0_R1 AGCCTAAAAACCCGAA117  GTACTTGAACP31 CcUGT3mut_L0_ATGAAGACATAATGAGCTCCAAAGAAG 118  F1  GCCAGP32 CcUGT3mut_L0_ATGAAGACTCGCCAAGGTGTTCAGAGA 119  F2  TC Cloning of CcUGT3 P33 CcUGT3mut_L0_120  into pICH41308  R1 ATGAAGACCTTGGCGAATGGATCTCGP34 CcUGT3mut_L0_ATGAAGACATAAGCTCAAATTGCTTGT 121  R2  GTACGTGAGTTGP35  CcUGT4_L0_F1  ATGAAGACATAATGGCGTCAGAAACTA122  GTCCAACTCTCCACATTCTCTTCTTCCATGAAGACTCCCTCACCGCATCGAGAT 123  Cloning of CcUGT4  GCTGAAAACTTACATGCCTGATCCACG into pICH41308  P36  CcUGT4_L0_F2  CGAAATGCATCCGGTCTTGTTTGAACT CATCCCACAGAT ATGAAGACGTGAGGGAGGCCCGGGATA 124  ACGAACGACTCTTCTTCGGAAGGAAGG P37  CcUGT4_L0_R1  TCTTGCAAGACCTTGTGACGGTCTAAG GCGTCGAP38  CcUGT4_L0_R2 ATGAAGACATAAGCTCATTTAGTTTTC125  TGGCTCTCCTTCAGCTCCTTTATAAGAP43 CcUGT5mut_L0_ATGAAGACATAATGGATTCCGAACCCA 126  F1  GGAAGAAG Cloning of CcUGT5  ATGAAGACATAAGCTCAAGAAGTAGCA 127  into pICH41308 P44 CcUGT5mut_L0_R1  GCAGCAGCP45  CcAT1_L0_F1 ATGAAGACATAATGAGCTTCACAGTGA128  CCAAGACCloning of CcAT1  ATGAAGACATAAGCCTAinto pICH41308 P46  CcAT1_L0_R1 GGTAAAATCA129  TTCATCTCP47 CcCYP2‐ATGAAGACATAATGACAATGACTTCCC 130  TTGATATTATCCTCTTCATCTCTGCCA Cloning of CcCYP2  mut1_L0_F1  TTGTATTCCTCTCTATC into pICH41308 and  removal of internal P48 CcCYP2‐ATGAAGACATAAGCTTATTTCATCTTG 131 BpiI restriction site mut1_L0_R1  GGCGAATAAGCCTTTGGAGCCAACCP49  CcFLS‐mut1_F1 AGCAGCCCGGCAAGACGACGT132 P50  CcFLS‐mut1_F2 GTCATGTCTTTAAGGAAGCACTCGG 133 P51  CcFLS‐mut1_F3  TGCAGGTCTTTAAGGACGATC 134  Site‐directed  P52  CcFLS‐mut1_F4  TTAGTGAAGATACCCCTGCCA 135  mutagenesis to  remove BpiI and  P53  CcFLS‐mut1_R1  CGTGCTCGGAACGGATGAATTC 136  BsaI restriction sites  P54  CcFLS‐mut1_R2  CCTCCAGTCCTAGCCCCA 137  from CcFLS  P55  CcFLS‐mut1_R3  AGCCAGGGACTTCATTTG 138  P56  CcFLS‐mut1_R4  CAAGTTGCGGCAATGTAC 139  CcFLS‐ATGAAGACATAATGGAGGTGGAGAG 140 P57 AG mut_L0_F1  TTCAAGCAAT Cloning of CcFLS  CcFLS‐ATGAAGACATAAGCTTACTG 141  into pICH41308 P58 GGGAAGC mut_L0_R1  TTGTTAAGTTTGC CcHCT3‐ATGAAGACATAAGCCTACAAGTCATA 142  Cloning of CcHCT P59 G 1_L0_R1  AGCAACTTTTCAAATC into pICH41308 P60  CcHCT3‐1_L0_F1 ATGAAGACATAATGGCGACGGTGGAGA143  TAACAGTGP61  CcMYB4_L0_F1 ATGAAGACATAATGGTGAAGAGAAGCC144  AAAGAGP62  CcMYB4_L0_F2 ATGAAGACCATCATTCGACTTCACAAT145  C Cloning of CcMYB4  ATGAAGACGAATGATGAGGTCCTinto pICH41308  P63  CcMYB4_L0_R1 CTTC146  ATCP64  CcMYB4_L0_R2 ATGAAGACATAAGCTTAGGATTGGCAA147  TCCAAGGCATCGTCTCATCGGTCTCATATGGCG 148  Cloning of CcHCT  ACGGTGGAGATAACAGTGAGGGACACG P65  HCT3‐BBa‐f  (CcAT8) into entry  TCGATGGTGGTCCCGGCGGAGGAaACG vector (EV) for the  CC MoClo‐YTK Kit.  ATGCCGTCTCAGGTCTCAGGATTTACA149 Separate PCRs with  P66  HCT3‐Bba‐r   AGTCATAGAGCAACTTTTCAAATCBBa‐f and iB‐r were  performed and the  P67  HCT3‐iB‐f AACGTCTCACGTTGACGATTTCGGCGA150  products BsmBI‐ TTTTGcloned into EVs. The  151  iB primers introduce  AACGTCTCAAACGmutations that  P68  HCT3‐iB‐r AGAGATTCTGTCTCGGCGremove internal  BsmBI sites.  GCATCGTCTCATCGGTCTCATATGCCG 152  Cloning of CcCSE  ACAAAATACTTCTGGGGCGACGAGCCC P69  EST2‐Bba‐f  (CcEST2) into entry  GAAGAATCCGAGTACTATGCCTCCCAT vector (EV) for the  GGaGTCTC MoClo‐YTK Kit.  Separate PCRs with  P70  EST2‐Bba‐r ATGCCGTCTCAGGTCTCAGGATTTACT153  TGTCCACCACCCTCTTGBBa‐f and iB‐r were  performed and the  P71  EST2‐iB‐f AACGTCTCATCCCCGCCTTCCTCTTCG154  products BsmBI‐ G cloned into EVs. The  155  iB primers introduce  mutations  ‐r AACGTCTCAGGGAGATthat  P72  EST2‐iBCATCTCCATGATGAremove internal  BsmBI sites.  P73  C3H‐Bba‐f GCATCGTCTCATCGGTCTCATATGACC 156 Cloning of CcC3H AAAGTGACAACAATGGAinto entry vector P74  C3H‐Bba‐r ATGCCGTCTCAGGTCTCAGGATTTACA157  (EV) for the MoClo‐ TATCGGCAGCGACACGYTK Kit. Separate  AACGTCTCAGCTCTGAGCTPCRs with BBa‐f and  P75  C3H‐iB‐f1 GGCACGGG158  A iB‐r were performed  and the products  P76  C3H‐iB‐r1 AACGTCTCAGAGCTGGATACGACCACG159  BsmBI‐cloned into  TTGEVs. The iB primers  AACGTCTCAATCATintroduce mutations  P77  C3H‐iB‐f2 AATGGAGGAGCAT160  ACGCthat remove internal  BsmBI sites.  P78  C3H‐iB‐r2 AACGTCTCATGATTCTGGTTAGACGAT161  CTCTCP79  C3H‐iB‐f3 AACGTCTCACCAACGCCACTCATGCTC162  CP80  C3H‐iB‐r3 AACGTCTCATTGGCGGGTGAAGACGGA163  GP81  SI‐pCAM‐HCT2f GGCTTAAUATGGTAGAGATAATCGAGT164  CATGUser cloning of  CTGCcAT10 into  P90  SI‐pCAM‐HCT1r GGTTTAAUTCATGCCTCATTCAATTCC173 pCAMBIA2300U TCATAGP91  SI‐pCAM‐CSE‐1f  GGCTTAAUAtGGCGGCGGTCCACCAC 174  175  User cloning of  P92  SI‐pCAM‐CSE‐1r GGTTTAAUTCATATCCCTTCAGCCACACTCCcEST1 into  pCAMBIA2300U    Candidate gene expression in Escherichia coli The ORFs for CcHCT (CcAT8) and CcCSE (CcEST2), and CcC3H were sub-cloned into expression vectors, heterologously expressed in E. coli, and proteins purified following previously described methods (Irmisch et al., 2018; Kruse et al., 2022). Briefly, sequences covering complete open reading frames were amplified and cloned using BsaI or BspMI into the pASK-IBA37 vector (IBA Lifesciences™, https: / / www.iba-lifesciences.com / ). The E. coli 5-alpha strain (New England Biolabs™, https: / / international.neb.com / ) was used for heterologous enzyme expression. For this, cultures of 250 mL were grown to OD600 = 0.5 at 37°C and 210 rpm, expression induced using 200 µg / L anhydrotetracycline (Sigma- Aldrich™, https: / / www.sigmaaldrich.com / ), and grown for another 16 h at 25°C. Cells were collected by centrifugation, resuspended in 8 mL lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 1 mg / mL lysozyme, pH 8.0), and incubated for 1 h at 4°C. Final cell lysis was achieved by using BUGBUSTER™ (MilliporeSigma™, https: / / www.sigmaaldrich.com / ) at half the recommended concentration (0.5X) according to the manufacturer's protocol. Cell debris and insoluble proteins were removed through centrifugation (30 min, 21,000 g, 4°C) and the cell-free lysate was incubated with 200 µL of 50% Ni-NTA-Agarose matrix (Qiagen™, https: / / www.qiagen.com) for 30 min. After removing the lysate, the matrix was washed with 1 mL wash buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0) and then transferred to a 2 mL spin column (BioRad Laboratories™, https: / / www.bio-rad.com / ) fitted with a frit. The matrix was washed again with 500 µL wash buffer, after which proteins were eluted five times with 100 µL elution buffer (50 mM NaH2PO4, 50 mM NaCl, 250 mM imidazole, pH 8.0). The protein concentration of the eluate fractions was determined by measuring the absorbance at 280 nm and fractions with similar protein concentrations (~0.2-0.3 mg / mL) were combined. Subsequently, PD MINITRAP™ SEPHADEX™ G-25 columns (GE Healthcare™, https: / / www.gehealthcare.com / ) were used according to the manufacturer's instructions to transfer the protein into assay buffer (10 mM TRIS-HCL, pH 7.2). Glycerol was added to the protein samples to a final concentration of 50% (v / v) and samples were stored at -20°C or used directly for enzyme assays. As a control, a protein preparation of E. coli harboring the empty pASK-IBA37 vector was obtained in the same way (empty vector control). E. coli plasmids (1) pASK-IBA37plus (IBA Lifesciences™) carrying the CcAT8 (CcHCT) accession number OR245368.1 inserted at the BsaI restriction site and having a tetracycline promoter / operator; and (2) pASK-IBA37plus (IBA Lifesciences™) carrying the CcEST2 (CcCSE) accession number OR245364.1 inserted at the BsaI restriction site and having a tetracycline promoter / operator. CcHCT and CcCSE enzyme assays In vitro assays were performed with CcHCT (CcAT8) and CcCSE (CcEST2) to confirm enzyme functions. To test for CcHCT activity, 1 µg of Ni-affinity purified CcHCT was incubated with 100 µM acyl donor substrate (coumaroyl-CoA, caffeoyl-CoA, or feruloyl- CoA; all from TransMIT, https: / / chemicals.transmit.shop / ) and 200 µM acceptor substrate (shikimate or quinate). Reactions were carried out in assay buffer in a total volume of 25 µL for 1h and were shaken at 30°C. Control assays contained 5 µL of empty vector enzyme preparation. Assays were stopped by adding an equal volume of 100% (v / v) methanol (LC-MS grade, Sigma-Aldrich™, https: / / www.sigmaaldrich.com / ) which contained 25 µM chloramphenicol as internal standard. After vortexing, the samples were centrifuged at 21,000 g for 20 min at 4°C and 25 µL of the supernatant was transferred into LC vials with glass inserts and stored at -80°C until LC-MS analysis. To test for CSE activity, two different types of assays were performed. One set of assays used chlorogenic acid as a surrogate substrate. Here, 200 µM chlorogenic acid were incubated with CcSE (CcEST2) in 25 µL reactions at 30°C for 0 min, 10 min, 30 min, and 60 min. The reactions were stopped by adding an equal volume of 100% (v / v) methanol (LC-MS grade, Sigma- Aldrich™, https: / / www.sigmaaldrich.com / ). As described above, after vortexing and centrifugation 25 µL were used for LC-MS analysis. In a second set of assays, coupled assays with CcHCT were performed to generate the substrates caffeoylshikimate and coumaroylshikimate to be tested with CcCSE. For the coupled assays, CcHCT reactions were set up as described above for HCT assays to produce caffeoylshikimate (using shikimate and caffeoyl-CoA as substrates) or to produce coumaroylshikimate (using shikimate and coumaroyl-CoA as substrates) and incubated for 1h. Reactions were then placed on ice and 1.5 µg Ni-affinity purified CcCSE (CcEST2) was added and the reactions were continued for up to 1 h at 30°C. Samples were taken at 0 min, 10 min, 30 min, and 60 min after addition of CSE. The addition of the empty vector preparation (5 µL) instead of CcCSE served as a negative control. Assays were stopped by adding an equal volume of 100% (v / v) methanol (LC-MS grade, Sigma- Aldrich™, https: / / www.sigmaaldrich.com / ) which contained 25 µM chloramphenicol as internal standard. After vortexing, the samples were centrifuged at 21,000 g for 20 min at 4°C and 25 µL of the supernatant was transferred into LC vials with glass inserts. Products of CcHCT and CcCSE assays were analyzed and quantified using LC-MS as described below. Transfection and transient expression of candidate genes in Nicotiana benthamiana Transient expression of CcUGT1-5, CcAT1-2, CcMYB4, CcFLS, CcCYP2, CcAT8-10, CcEST1-3, CcC3H, and Cc4CL in N. benthamiana was performed as described previously (Irmisch et al., 2018, 2019b, 2020). In brief, the complete ORFs for each gene were cloned into the pCAMBIA230035Su vector following the User Cloning method (Nour- Eldin et al., 2006; Geu-Flores et al., 2007). The resulting plasmids (TABLE 3) were transformed into Agrobacterium tumefaciens strain C58pMP90. Over-night cultures of 1 mL were used to inoculate 10 mL cultures (LB-media containing 50 µg / mL kanamycin, 25 µg / mL rifampicin, and 25 µg / mL gentamycin) and grown over-night at 28°C. Cells were harvested by centrifugation and resuspended in infiltration buffer (10 mM MES, pH 5.6, 10 mM MgCl2, 100 μM acetosyringone) to a final OD600 of 0.5 and incubated at room temperature for 1-3 h. Before infiltration, equal volumes of each strain required for a particular combination of genes were combined and used to infiltrate leaves of 3-4-week- old N. benthamiana plants using a needleless syringe (not shown). An Agrobacterium strain carrying the pBIN:p19 plasmid was included in each combination. Infiltrated plants were kept in the growth chamber (8 h light / 16 h dark, at 24°C) for five days, after which the infiltrated leaves were sampled using a 9 mm hole puncher to obtain leaf disks. For each infiltrated leaf, two leaf disks were cut and pooled (total of 4 disks per plant). Intact leaf disks were extracted with 1mL of 50% MeOH (v / v; 12.5 µM chloramphenicol as internal standard) per 100 mg (fresh weight) plant material by shaking at 100 rpm for 4 h at room temperature. The same process was used for transient expression using multigene constructs, except kanamycin was replaced with 50 µg / mL carbenicillin for growing Agrobacterium strains transformed with level 1 plasmids. Construction of multigene plasmids for transient expression in Nicotiana benthamiana Multigene plasmids for transient expression in N. benthamiana were assembled using the MoClo Toolkit™ (Addgene™ Kit #1000000044) and the MoClo Plant Parts Kit™ (Addgene™ Kit #1000000047) (Weber et al., 2011; Werner et al., 2012; Engler et al., 2014). Site-directed mutagenesis was used to remove internal BsaI and BpiI restriction sites from the candidate sequences without altering the encoded protein sequence using the Q5 Site- Directed Mutagenesis Kit (New England Biolabs™, https: / / international.neb.com / ) according to the manufacturer protocol (for primers see TABLE 2). As template, the previously generated pJET1.2 / blunt vector constructs were used and the modified coding sequences were then amplified using gene-specific primers (TABLE 2) and cloned as BpiI fragments into the Level 0 (L0) vector pICH41308. The L0served as the basis for the assembly of Level 1 plasmids and subsequently Level 2 plasmids (FIGURE 13, and TABLE 3), following the process described in Weber et al. (2011) and Engler et al. (2014) (Weber et al., 2011; Engler et al., 2014). TABLE 3. Plasmids created in this study. Plasmid name, vector backbone, containing genes, and usage are given. #  Plasmid Name  Vector backbone  Containing genes  Usage  1  pCAMBIA_UGT1  pCAMBIA230035Su  CcUGT1  2  pCAMBIA_UGT2  pCAMBIA230035Su  CcUGT2  3  pCAMBIA_UGT3  pCAMBIA230035Su  CcUGT3  4  pCAMBIA_UGT4  pCAMBIA230035Su  CcUGT4  5  pCAMBIA_UGT5  pCAMBIA230035Su  CcUGT5  Expression of genes  6  pCAMBIA_AT1  pCAMBIA230035Su  CcAT1  transiently in  7  pCAMBIA_FLS  pCAMBIA230035Su  CcFLS  Nicotiana  8  pCAMBIA_CYP2  pCAMBIA230035Su  CcCYP2  benthamiana  9  pCAMBIA_MYB4  pCAMBIA230035Su  CcMYB4  10  pCAMBIA_AT8  pCAMBIA230035Su  CcAT8  11  pCAMBIA_AT9  pCAMBIA230035Su  CcAT9  12  pCAMBIA_AT10  pCAMBIA230035Su  CcAT10  pCAMBIA_EST1  pCAMBIA230035Su  CcEST1  pCAMBIA_EST2  pCAMBIA230035Su  CcEST2  pCAMBIA_EST3  pCAMBIA230035Su  CcEST3  pCAMBIA_C3H  pCAMBIA230035Su  CcC3H  pBIN_P19  pCAMBIA230035Su  p19  L0_UGT1  pICH41308  CcUGT1  L0_UGT2  pICH41308  CcUGT2  L0_UGT3  pICH41308  CcUGT3  L0_UGT4  pICH41308  CcUGT4  L0_UGT5  pICH41308  CcUGT5  Entry modules  L0_AT1  pICH41308  CcAT1  (level 0, L0) for the  L0_FLS  pICH41308  CcFLS  creation of level 1  L0_CYP2  pICH41308  CcCYP2  (L1) construccts  L0_MYB4  pICH41308  CcMYB4  L0_HCT  pICH41308  CcAT8  L0_CSE  pICH41308  CcAT9  L0_P19  pICH41308  CcAT10  L1_UGT1  pICH47732  CcUGT1  L1_UGT2  pICH47742  CcUGT2  L1_UGT3  pICH47751  CcUGT3  Expression of genes  L1_UGT4  pICH47761  CcUGT4  transiently in  L1_UGT5  pICH47772  CcUGT5  Nicotiana  L1_AT1  pICH47781  CcAT1  benthamiana and  L1_FLS  pICH47742  CcFLS  modules for the  L1_CYP2  pICH47751  CcCYP2  creation of  L1_MYB4  pICH47761  CcMYB4  multigene  L1_HCT  pICH47732  CcHCT  constructs  L1_CSE  pICH47732  CcCSE  L1_P19  pICH47772  p19  CcUGT1, CcUGT2,  MGC1  pAGM4673  CcUGT3, CcUGT4,  CcUGT5, CcAT1 MGC2  pAGM4673 CcHCT, CcFLS, CcCYP2, Transient  CcMYB4, p19  expression of genes MGC3  pAGM4673 CcUGT1, CcUGT2, in Nicotiana  CcUGT3, CcUGT4  benthamiana MGC4  pAGM4673 CcHCT, CcUGT5, CcAT1 MGC5  pAGM4673 CcFLS, CcCYP2, CcMYB4, p19  1‐GFP‐DO‐1  ‐  ‐  GFP dropout  48  3‐GFP‐DO‐1  ‐  ‐  vectors for creating  49  4‐GFP‐DO‐1  ‐  ‐  cassette plasmids  50  5‐GFP‐DO‐1  ‐  ‐  51  POS1_CcHCT  1‐GFP‐DO‐1  CcHCT Expression in yeast 52  POS3_CcC3H  3‐GFP‐DO‐1  CcC3H  and assembly of  53  POS4_Cc4CL  4‐GFP‐DO‐1  Cc4CL  yeast multigene  54  POS5_CcCSE  5‐GFP‐DO‐1  CcCSE  constructs  GFP dropout vector  55  1‐GFP‐DO‐MG  ‐  ‐  to create multigene  constructs  56  HCE4CL  1‐GFP‐DO‐MG CcHCT, CcC3H, Cc4CL,  59  H4CL  1‐GFP‐DO‐MG  CcHCT, Cc4CL    Construction of multigene plasmids for heterologous expression in yeast The generation of constructs for heterologous gene expression in Saccharomyces cerevisiae was as previously described (Sunstrum et al., 2021). In short, the yeast modular cloning toolkit (MoClo YTK™, Addgene™ Kit #1000000061, https: / / www.addgene.org / kits / moclo-ytk / ) (Lee et al., 2015) was used and cds were cloned into entry vectors, transcriptional units and multigene constructs using Golden- Gate™ cloning and BsaI and BsmBI restriction sites (see FIGURE 10). Plasmids were transformed into the Saccharomyces cerevisiae strain BY4741 (GE Life Sciences™, https: / / gelifesciences.com / ). 4CL1, p-coumaroyl ligase 1 and 4CL2, p-coumaroyl ligasae 2 are used primarily for yeast engineering (for example, S. cerevisiae) and are potentially also significant for other engineered constructs. Four yeast plasmids were prepared as follows: (1) HCE4CL wherein CcHCT, CcCSE, CcC3'H are expressed under control of the pTDH3 promoter and tTDH1 terminator; Cc4CL is expressed under the pHHF1 promoter and tTDH1 terminator; (2) HC4CL wherein CcHCT and CcC3'H are expressed under control of the pTDH3 promoter and tTDH1 terminator; Cc4CL is expressed under the pHHF1 promoter and tTDH1 terminator; (3) HE4CL wherein CcHCT and CcCSE are expressed under control of the pTDH3 promoter and tTDH1 terminator; Cc4CL is expressed under the pHHF1 promoter and tTDH1 terminator; and (4) H4CL wherein CcHCT is expressed under control of the pTDH3 promoter and tTDH1 terminator; Cc4CL is expressed under the pHHF1 promoter and tTDH1 terminator. In each yeast plasmid position 1 is CcHCT, position 2 is a spacer, and position 4 is Cc4CL, while plasmids (1) and (2) have CcC3’H at position 3 and (3) and (4) have a spacer at position 3, and while plasmids (1) and (3) have CcCSE at position 3 and (2) and (4) have a spacer at position 3. Yeast in vivo Assays Yeast in vivo feeding assays were performed as described previously (Sunstrum et al., 2021) with minor modifications. Specifically, starter cultures were grown over night at 28°C with shaking at 180 rpm in 6-well plates (Greiner bio-one™, CELLSTAR™) containing 2.5 mL SD-URA media and using a single yeast colony carrying one of the plasmids (TABLE 3). The next day, starter cultures were used to inoculate 250 µL SD- URA media in 48-well plates (Greiner bio-one™, CELLSTAR™) to OD600 = 0.1. Cultures were supplied with 1 mM coumaric acid as substrate and grown for 72 h (28°C, 180 rpm). Plates were covered with breathable film (AXYGEN™) and placed in a plastic container with high humidity during cultivation to prevent evaporation. For cultivation of wild-type yeast, YPD media or SD media was used. Assays were stopped by transferring cultures to glass LC vials (Agilent Technologies™, https: / / www.agilent.com / ), adding equal volumes of 100% (v / v) MeOH, and subsequent incubation at 42°C for 10 minutes. After centrifugation (15 min,4°C, 4,300 g) 50 µL of the supernatant was transferred to glass inserts (Agilent Technologies™) placed in 1.5 mL glass LC vials and stored at -80°C until LC-MS analysis. As an internal standard for peak normalization, a peak consistently present across all samples with stable intensity (m / z 191.0275, retention time: 0.84 min) was used. For each multigene construct, cultures were grown with four replicates for each experiment and each experiment was replicated twice for a total of eight-fold replication. Liquid Chromatography - Mass Spectrometry (LC-MS) analyses LC-MS analyses were performed as previously described (Irmisch et al., 2020). Samples from experiments with N. benthamiana, except for those using multigene constructs, were analyzed on an Agilent 1100 LC™ system (Agilent Technologies™, https: / / www.agilent.com / ) coupled to an Agilent MSD Trap XCT-Plus™ mass spectrometer with electro-spray in negative ionization mode (capillary voltage, 4000 eV; temp, 350°C; nebulizing gas, 60 psi; dry gas 12 L min−1). Analyses of products from enzyme in vitro assays, yeast in vivo assays assays and N. benthamiana samples from experiments with multigene constructs were done on an Agilent 1290 Infinity LC™ system coupled to an Agilent 6530 Accurate Mass Q-TOF™ mass spectrometer (both Agilent Technologies™) with an electrospray ion source operated in negative ionization mode (capillary voltage, 4000 eV; temp, 350°C; nebulizing gas, 60 psi; dry gas 12 L × min−1) and an Agilent 1290 DAD, detection 190– 400 nm. As reference compounds for mass calibration, Hexakis™ (1H,1H,3H tetrafluoropropoxy)phosphazene, purine and ammonium trifluoroacetate were used according to the manufacturer's (Agilent Technologies™) instructions. For data analysis and processing, we used the LC / MSD Trap Software 5.2™ (Bruker Daltonik™, https: / / www.bruker.com / ) and the MASSHUNTER Workstation Software vB.07.00™, 2015 (Agilent Technologies™). The same separation methods and protocols were used with both LC-MS systems: For analyses of N. benthamiana extracts, LC was performed on an Agilent ZORBAX SB-C18™ column (50 × 4.6 mm, 1.8 μm particle size) using water with 0.2%(v / v) formic acid (solvent A) against a gradient of acetonitrile with 0.2%(v / v) formic acid (solvent B). The gradient profile was: 0-0.5 min of 95% (v / v) solvent A, 0.5-5 min from 5 to 20% (v / v) solvent B, 5-7 min of 90% (v / v) of solvent B, followed by equilibration to 95% (v / v) solvent A for 3 min. For analyses of products from enzyme in vitro assays and yeast in vivo assays, the concentration of formic acid in both solvents was increased to 2%(v / v) while keeping all other LC conditions the same. The injection volumes of 1 µL and 5 µL were used for samples analyzed on the Agilent 6530 Accurate Mass Q-TOF™ and for samples analyzed on the Agilent MSD Trap XCT-Plus MS™, respectively. Statistical Analyses All statistical analyses were performed in GRAPHPAD v9.5.1™. One-Way analysis of variance (One-way ANOVA) was used after testing for normal distribution to compare the accumulation of metabolites between multiple samples and Tukey’s HSD test was used to test for differences in individual treatments. For comparing two groups of samples the unpaired t-test was used. Data Availability All sequences newly described in this study have been deposited in NCBI GenBank™ with the following accession numbers: CcHCT (CcAT8), OR245368; CcAT9, OR245367; CcAT10, OR245366; CcEST1, OR245363; CcCSE (CcEST2), OR245364; CcEST3, OR245365; CcC3’H (CYP98A216), OR245362. Transcriptome data from Crocosmia x crocosmiiflora has been published previously in the NCBI / GenBank™ under the project number PRJNA389589 (SRP108844). EXAMPLES Example 1: Identification of montbretia HCT candidates To identify montbretia enzymes involved in the biosynthesis of caffeic acid and caffeoyl- CoA, we used BLASTP™ searches against a translated transcriptome database that covers a time course of corm development, previously described in (Irmisch et al., 2020). Known plant HCT sequences typically belong into Clade 5 of the BAHD-acyltransferase (AT) family (Kruse et al., 2022, 2023; Moghe et al., 2023). A search of the montbretia transcriptome using A. thaliana HCT (NP_199704.1) revealed three candidate genes, for which we cloned the coding sequences (CDS) from young corms. We named these acyltransferases CcAT8, CcAT9 and CcAT10, prior to testing them for HCT function. The three translated amino acid sequences showed the typical BAHD motifs, HxxxD and DFGWG (FIGURE 14), and fell into Clade 5 of the BAHD-AT family (n). CcAT8 grouped with known monocot HCTs within the Sub-Clade 5a / b, while CcAT9 and CcAT10 appear on the margins of this subclade (not shown). The latter two grouped together with OsHCT4 (XM_015786263.1) and PvHCT1-like (AFY17066.1) involved in the formation of glycerolesters and chlorogenic acid biosynthesis, respectively (Kim et al., 2012; Escamilla- Treviño et al., 2014). Previously characterized genes involved in the MbA assembly pathway, CcUGT1- 5 and CcAT1-2, are co-expressed with highest transcript levels during early seasonal development of young corms coinciding with MbA accumulation (Irmisch et al., 2018, 2020). Analysis of the transcriptome data that cover the six different time points of corm development (Irmisch et al., 2020) did not reveal strong correlation (>0.8) of expression patterns of CcAT8, CcAT9 or CcAT10 with the MbA assembly genes (FIGURE 2 and TABLE 4). TABLE 4. Co-expression analysis of montbretia genes. Expression correlation between newly identified montbretia genes in this study (rows) and previously identified montbretia genes involved in MbA biosynthesis (column). Correlation scores are expressed as Pearson Correlation Coefficient (PCC) and PCCs ≥0.8 (strong correlation) are sh aded.CcUGT1  CcUGT2  CcUGT3  CcUGT4  CcUGT5  CcAT1  CcAT2  CcCYP2  CcFLS  Example 2: Identification of montbretia C3H candidates A BLASTP™ search of the montbretia transcriptome for putative C3H sequences using the C3H (CYP98A3) sequence from A. thaliana (NP_850337.1, CYP98A3) as bait identified a single montbretia transcript, CcC3H (CYP98A216), for which we cloned the full-length CDS. The translated amino acid sequence shared 75% identity with A. thaliana CYP98A3 (FIGURE 15). The time course transcript expression pattern of CcC3H did not strongly correlate (>0.8) with the expression of previously characterized MbA biosynthetic genes (FIGURE 3 and TABLE 4). Example 3: Identification of montbretia CSE candidates A BLASTP™ search of the montbretia transcriptome for putative CSE sequences using the A. thaliana CSE (AtCSE, NP_175685.1) as query revealed three montbretia esterase-like transcripts, CcEST1, CcEST2 and CcEST3, which were cloned as full-length CDS. Their translated amino acid sequences shared 37%, 65%, and 33% identity with AtCSE, respectively (FIGURE 16). A phylogeny with characterized CSEs from other species and uncharacterized homologs from the UniProt™ database (The UniProt Consortium™, 2023) placed CcEST2 into a large clade that contained functionally characterized CSEs from A. thaliana (AtCSE, AT1G52760.1), switchgrass (Panicum virgatum; PvCSE, Pavir.Ab00639.1), poplar (PtCSE, XP_002298118.2), and barrel clover (Medicago truncatula; MtCSE, XP_003610038.1). In contrast, CcEST1 and CcEST3 clustered outside of the CSE containing clade, suggesting they encode esterases that are functionally different from CSEs. All three transcripts showed strong co-expression (correlation > 0.8) with MbA biosynthetic genes during the time course of corm development (FIGURE 2 and TABLE 4). Example 4: Expression of individual montbretia phenylpropanoid pathway genes increases MbA formation in N. benthamiana To test if MbA yields in Nb could be affected by expression of CcAT8-10, CcEST1-3 or CcC3H, we transiently co-expressed one of each of these seven genes (hereafter referred to as phenylpropanoid genes) together with a set of ten genes previously described as significant for heterologous MbA production in Nb (Irmisch et al., 2020). These ten genes are the six montbretia genes, CcUGT1-5 and CcAT1 (or CcAT2), significant for the assembly of MbA from its different building blocks (FIGURE 1); a set of three montbretia genes to enhance myricetin biosynthesis, CcMYB4, CcCYP2, and CcFLS; and the p19 silencer of repression. Hereafter, we will refer to these ten genes as the "10-gene set", and use this term in the description of co-expression experiments with the montbretia candidate phenylpropanoid pathway genes described here. CcAT8-10, CcEST1-3 and CcC3H were individually cloned into pCAMBIA230035Su and plasmids were individually transformed into Agrobacterium tumefaciens. All genes were expressed in Nb under the control of the 35S promoter. For each experiment, Nb leaves were co-infiltrated with the ten different Agrobacterium strains comprising the 10-gene set and one strain carrying one of the putative phenylpropanoid pathway genes. Experiments were performed with four biological replicates. As a control, leaves were infiltrated with only the 10-gene set. Leaf extracts were analyzed by liquid chromatography-mass spectrometry (LC-MS), and MbA, MbB, and MbC were quantified (FIGURE 4). Controls, transformed with only the 10- gene set, yielded approximately 5 µg MbA x g-1 leaf fresh weight (FW), which accounted for 1.3% of the total of the three different montbretins (MbA plus MbB plus MbC) (FIGURE 2B and C), confirming previous results (Irmisch et al., 2020). Of the seven different putative phenylpropanoid pathway genes tested here, co-expression with CcAT8 and CcEST2, resulted in significant increases of MbA compared to the control (FIGURE 4B). Co-expression with CcAT8 resulted in a 5-fold increase of MbA (p-value≤0.001, ~29 µg MbA x g-1 FW, 7.4% of total montbretins); and co- expression with CcEST2 resulted in an 8-fold increase of MbA (p-value≤0.001, ~45 µg MbA x g-1 FW, 7% of total montbretins). Co-expression with CcC3H increased MbA levels slightly, but not significantly (p-value=0.13, ~15 µg MbA x g-1 FW, 1.8% total montbretins, FIGURE 4B). Co-expression with all other genes did not yield changes in MbA levels. The increase of MbA levels effected by CcAT8 or CcEST2 co- expression was confirmed with a second independent set of experiments, also performed with four replicates each (FIGURE 3). Here, control plants produced ~4 µg MbA x g-1 FW (1.2% of total montbretins). Co-expression with CcAT8 resulted in a 15.2-fold (p- value=0.018) increase of MbA yielding ~64 µg MbA x g-1 FW (13.5% of total montbretins) (FIGURE 3A and B). Co-expression with CcEST2 resulted in a 9.4-fold (p-value≤0.001) increase of MbA yielding ~40 µg MbA x g-1 FW (16% of total montbretins) (FIGURE 3A and B). In addition to MbA, MbC levels also increased significantly by 3-fold (p- value≤0.001) in co-expression experiments with CcAT8, resulting in ~185 µg MbC x g-1 FW in comparison to ~60 µg MbC x g-1 FW in the controls. MbC levels also increased (but not significant) in comparison to the control in co-expression experiments with CcEST2 to ~127 µg MbC x g- 1 FW. MbB levels decreased significantly by 0.57-fold (p-value=0.011) to ~150 µg MbB x g- 1 FW and 0.51-fold (p-value=0.005) to ~134 µg MbB x g-1 FW, in co-expression experiments with CcAT8 and CcEST2, respectively, in comparison to ~260 µg MbB x g-1 FW in controls. Beyond the three montbretins, we also attempted to measure intermediates within the shikimate shunt (FIGURE 1C) as well as chlorogenic acid (i.e. caffeoylquinate), an important sink for caffeic acid in some plant species (Niggeweg et al., 2004; Cardenas et al., 2021). We did not observe significant changes in the levels of caffeic acid and chlorogenic acid relative to the controls (FIGURE 7A and C). Levels of caffeoylshikimate significantly increased 34.4-fold (p-value<0.001) as an effect of CcAT8 co-expression (FIGURE 7B). Efforts to measure coumaroylshikimate and coumaroyl / caffeoyl-CoA were not successful. Example 5: Expression of different combinations of montbretia phenylpropanoid pathway genes has no obvious additive effect on MbA formation in N. benthamiana In parallel with testing individual genes in the set of co-expression experiments shown in FIGURE 4, we also tested the effect of co-expression with different combinations of the candidate phenylpropanoid / shikimate shunt genes, specifically CcAT8, CcEST2, CcC3H as well as the previously described Cc4CL2 (identified in Sunstrum et al., 2021) in combination with the 10-gene set (FIGURE 8). Here we tested initially six additional combinations and quantified MbA, MbB, and MbC levels (FIGURE 8A). None of these combinations resulted in significantly increased MbA levels in comparison to co- expressing CcAT8 or CcEST2 alone with the 10-gene set (FIGURE 8A). To validate these results and test other possible combinations, we performed another set of similar experiments with a total of 13 combinations of CcAT8, CcEST2, CcC3H and Cc4CL with the 10-gene set (FIGURE 8D and E). Results from these experiments confirmed the individual effects of CcAT8 and CcEST2, where individual co-expression of CcAT8 or CcEST resulted in 3.0-fold (p-value<0.001, 9.9% of total montbretins) and 4.2-fold (p- value<0.001, 11.2% of total montbretins) increases of MbA levels, respectively (FIGURE 8D and E). The additional combinations tested here did not yield further increases of MbA (FIGURE 8E). Example 6: In vitro enzyme activities support CcAT8 as bona fide CcHCT and CcEST2 as bona fide CcCSE in the montbretia phenylpropanoid pathway Given that CcAT8 and CcEST2 had the strongest significant in vivo effect on increasing MbA levels in Nb, we performed in vitro enzyme assays to verify the biochemical functions of CcAT8 and CcEST2. The full-length CDS of CcAT8 and CcEST2 were cloned into pASK- IBA37 for heterologous expression in Escherichia coli. Ni-affinity purified proteins were used for enzyme assays, and products identified based on accurate mass and authentic standards. CcAT8 was assayed with the acyl acceptor shikimate or quinate, and one of the acyl donors caffeoyl-, coumaroyl- or feruloyl-CoA, which are substrates typically used by HCTs from other plant species (Kruse et al., 2022, 2023; Moghe et al., 2023). With shikimate as the acyl acceptor, all three acyl-CoA donors were converted into the respective shikimate esters, caffeoylshikimate (m / z 335.0893), coumaroylshikimate (m / z 319.0807) and feruloylshikimate (m / z 349.0932) (FIGURE 5 and TABLE 5). With quinate as the acceptor, CcAT8 was active only with coumaroyl-CoA as the acyl donor resulting in coumaroylquinate (m / z 353.0893) production. Protein preparations from E. coli carrying an empty vector were used as control. While most substrate combinations did not yield unspecific product formation in the control assays, trace amounts of product formation were observed when shikimate and coumaroyl-CoA were used in control assays, possibly due to spontaneous, non-enzymatic reaction or unspecific E. coli enzyme activity, similar to what has been observed before (Kruse et al., 2022). The substrate for CSE (Vanholme et al., 2013), caffeoylshikimate, is not commercially available. Thus, we initially tested CcEST2 for activity with the surrogate substrate chlorogenic acid (i.e., caffeoylquinate). Consistent with esterase activity, samples taken at different time points of incubation with CcEST2 showed an increase in free caffeic acid and quinate, as well as a decrease in the substrate chlorogenic acid. To enable testing of caffeoylshikimate as well as coumaroylshikimate as substrates, we performed combined enzyme assays with CcAT8 and CcEST2. First, CcAT8 was incubated with shikimate and either caffeoyl-CoA or coumaroyl-CoA to produce the corresponding shikimate esters. Then CcEST2 was added and samples were analyzed for product formation over a 60 min incubation time course, showing an increase of free caffeic acid and a decrease of caffeoylshikimate over time (FIGURE 6). Negative control assays, performed with empty vector preparations instead of CcEST2, did not show this change in product formation and substrate depletion, nor did changes occur in samples where coumaroylshikimate served as substrate. Together with the in vivo results, the results from in vitro enzyme assays support a role of CcAT8 as bona fide HCT and a role of CcEST2 as bona fide CSE involved in caffeic acid and caffeoyl-CoA biosynthesis in montbretia. We are therefore annotating CcAT8 as CcHCT and CcEST2 as CcCSE. Hereafter, we will use the identifiers CcAT8 / CcHCT and CcEST2 / CcCSE, interchangeably depending on context. TABLE 5. Compounds identified from extracts of Nb, yeast and enzyme assays. Compound name, alternative name, chemical formula, theoretical mass from formula (m / z), experimental mass (m / z) and method of identification are given. Theoretical  Experimental  Name  Formula  mass   mass   Identified by  [M‐H]‐  [M‐H]‐  Shikimate  C7H10O5  173.0455  173.0442  Authentic standard  Quinate  C7H12O6  191.0561  191.0572  Authentic standard  Chloramphenicol  C11H12Cl2N2O5  321.0054  321.0066  Authentic standard  Caffeic acid  C9H8O4  179.0349  179.0443  Authentic standard  p‐Coumaric acid  C9H8O3  163.0400  163.0411  Authentic standard  Mass and  Coumaroylshikimate  C16H15O7  319.0823  319.0807  comparison to  control  Mass and  Caffeoylshikimate  C16H15O8  335.0772  335.0794  comparison to  control  Mass and  Feruloylshikimate  C17H18O8  349.0928  349.0932  comparison to  control  Mass and  Coumaroylquinate  C16H18O8  337.0928  337.0906  comparison to  control  Chlorogenic acid  C16H O   353.0878  353.0893  Authentic standard (Caffeoylquinate) 18 9Montbretin A  C53H64O33  1227.3257  1227.3207  Authentic standard  Montbretin B  C53H64O32  1211.3307  1211.3317  Authentic standard  Montbretin C  C54H66O33  1241.3413  1241.3431  Authentic standard  Example 7: Validationof the montbretia shikimate shunt pathway and its functional reconstruction in Saccharomyces cerevisiae After having identified the four genes involved in the montbretia shikimate-shunt (FIGURE 1), Cc4CL (specifically Cc4CL2, Sunstrum et al., 2021), CcHCT (CcAT8 first described herein), CcC3’H (first described herein), and CcCSE (CcEST2, first described herein), we reconstructed and assessed the pathway in yeast (Saccharomyces cerevisiae) for functionality. Step-wise reconstruction in yeast provides a means to identify potential bottlenecks and assess flux through the pathway. Plasmids for heterologous expression of combinations of two, three or four of these genes under the control of constitutive promotors were assembled using the yeast modular cloning toolkit (Lee et al., 2015) (FIGURE 9A and FIGURE 10) and transformed into the yeast strain BY4741. Single gene constructs, a non-transformed wild-type BY4741 strain, as well as a GFP expressing strain served as controls (FIGURE 9A and FIGURE 10). Yeast cultures were fed with coumaric acid as substrate and the formation of phenylpropanoid shikimate shunt intermediates and products, specifically coumaroyl-CoA, coumaroylshikimate, caffeoylshikimate, caffeic acid and caffeoyl-CoA was analyzed by LC-MS. Expression of Cc4CL alone did not yield detectable levels of the expected product 4- coumaroyl-CoA, despite depletion of the coumaric acid substrate, which was only observed when expressing Cc4CL alone or together with different combination of CcHCT, CcC3H and CcCSE. However, previous in vitro characterization of Cc4CL showed that this enzyme efficiently produces 4-coumaroyl- CoA (Sunstrum et al., 2021). It is possible that coumaroyl-CoA produced in these experiments was converted by endogenous yeast metabolism to avoid toxicity, which may be caused by coumaroyl-CoA as well as caffeoyl- CoAs (Parke and Ornston, 2004; Incha et al., 2019; Liu et al., 2022). Co-expression of Cc4CL and CcHCT led to the formation of the expected coumaroylshikimate intermediate in the shikimate shunt, confirming the functions of both Cc4CL and CcHCT (FIGURE 9B and C, and FIGURE 11). The additional expression of CcC3H (CYP98A216) led to the formation of caffeoylshikimate, the next intermediate in the shikimate shunt, which validated the role of CcC3’H in hydroxylating coumaroylshikimate (FIGURE 9B and C, and FIGURE 11). While caffeoylshikimate accumulated, only traces of caffeic acid could be detected (FIGURE 9B, and FIGURE 11). Finally, with the addition of CcCSE, the co- expression of all four shikimate shunt genes in yeast led to the conversion of coumaric acid to caffeic acid, which validated the function of CcCSE (FIGURE 9B and C, and FIGURE 11). Here, only trace amounts of the intermediates coumaroylshikimate and caffeoylshikimate were detected, highlighting efficient metabolic flux from coumaric acid to caffeic acid via shikimate esters, and demonstrating the successful reconstruction of the shikimate shunt in yeast. Interestingly, yeast expressing the full shikimate shunt did not show depletion of coumaric acid as observed in other scenarios which expressed 4CL2, perhaps indicating a feed-back regulation. Competitive inhibition of 4CL by caffeic acid has previously been reported (Harding et al., 2002; Chen et al., 2013; Watanabe et al., 2018). As with coumaroyl-CoA, we were not able to detect caffeoyl-CoA. In additional experiments we tested if CcCSE could hydrolyze coumaroylshikimate. Yeast co-expressing Cc4CL, CcHCT and CcCSE accumulated less coumaroylshikimate than yeast co-expressing Cc4CL and CcHCT, suggesting that coumaroylshikimate can be used as substrate by CcCSE as well (FIGURE 9B, and FIGURE 11). Yeast expressing CcC3’H alone also converted coumaric acid into caffeic acid (FIGURE 9C), which represents the shikimate-independent route of the phenylpropanoid pathway (FIGURE 1). This direct conversion produced 7-fold (p- value<0.001) less caffeic acid compared to yeast expressing the complete shikimate shunt (FIGURE 9C). As expected, individual expression of CcHCT, CcCSE or GFP did not lead to accumulation of coumaroylshikimate, caffeoylshikimate or caffeic acid (FIGURE 9C, and FIGURE 11). Example 8: Reconstruction of MbA biosynthesis in N. benthamiana using multigene constructs Here we showed that MbA production in Nb can be improved by co-expression of the phenylpropanoid pathway shikimate shunt genes CcHCT (CcAT8) or CcCSE (CcEST2) in combination with the a “10-gene set” for heterologous montbretin biosynthesis (FIGURE 3). The current laboratory process involves the transient transfection of Nb with eleven different and separately cultivated Agrobacterium strains, each containing a single gene on a separate plasmid. This approach would not be suitable for an industrial process due to risk of process failure and being highly labor intensive. To streamline the system with fewer plasmids, we used the MoClo Tool Kit™ (Weber et al., 2011; Werner et al., 2012; Engler et al., 2014) to combine the eleven genes into two or three multigene constructs (MGC) (FIGURE 12A, FIGURE 13, and TABLE 6A and 6B). As CcHCT and CcCSE effected MbA yield similarly (FIGURE 3), but no additive effect was observed with the two genes together (FIGURE 8), we chose to include CcHCT in the MGC. Eleven separate transcriptional units (Level 1, FIGURE 13) were generated using the p35S promotor for constitutive expression and a set of different terminators (Engler et al., 2014) (FIGURE 12 and FIGURE 13). Level 1 units were used to assemble five different MGCs and each MGC contained different combinations of three to six different genes. Combinations of either two (two-plasmid system) or three (three-plasmid system) of these MGCs would cover the complete set of 11 genes for MbA biosynthesis. The two-plasmid transfection system comprised transfection of Nb leaves with MGC1 (18.8kb) [35Spro:(CcUGT1-5, CcAT1)] and MGC2 (15.3kb) [35Spro:(CcFLS, CcCYP2, CcMYB4, CcHCT, P19)]; the three-plasmid transfection system comprised transfection of Nb leaves with MGC3 (14kb) [35Spro:(CcUGT1-4)], MGC4 (11.8kb) [35Spro:(CcUGT5, CcHCT, CcAT1)], and MGC5 (13.2kb) [35Spro:(CcFLS, CcMYB4, CcCYP2, P19)] (FIGURE 12A and FIGURE 13). For comparison, transfections were performed with a set of 11 plasmids representing the 11 different Level 1 constructs, and a set of 11 different pCAMBiA constructs. Montbretin levels were quantified in Nb leaf extracts using LC-MS (FIGURE 12B). The use of the two-plasmid transfection system and the three-plasmid transfection system resulted in the accumulation of MbA at levels of 104.3 (±19.0 SE) µg MbA x g-1 FW and 151.6 (±22.1 SE) µg MbA x g-1 FW, respectively (Fig.7B). In comparison, 11 individual pCAMBIA and Level 1 plasmids achieved 99.5 (±16.7 SE) µg MbA x g-1 FW and 114.8 (±12.4 SE) µg MbA x g-1 FW, respectively (FIGURE 12B). Overall, the amounts of MbA and MbB produced with these four different conditions were not found to be different. However, we found that the two-plasmid system produces less MbC in comparison to the 11 individual plasmid system, both for pCAMBIA and Level 1 (p- value=0.013 and 0.016, respectively, FIGURE 12B). Interestingly, when comparing the percent MbA relative to total montbretins between the different systems, we found that the three-plasmid system led to the production of a larger proportion of MbA (39.6% MbA of total montbretins). In comparison percent MbA achieved with the two 11-plasmid systems, pCAMBIA (27.8% MbA of total montbretins, p-value=0.015) or Level 1 MbA at (29.4% MbA of total montbretins, p-value=0.037) (FIGURE 12C), were lower. These results highlight that the process of transient transfection for MbA production in Nb was successfully streamlined with the use of either two or three MGCs, instead of 11 individual plasmids, without compromising on the amount of MbA produced and potentially increasing the ratio of MbA relative to other montbretins. Efforts to generate a single MGC with all eleven genes (35.4kb) were not successful. TABLE 6A: N. benthamiana Gene Expression Constructs Plasmid Backbone Promotor 5’UTR CDS 3’UTR + pCAMBIA230035Su_CcEST2  pCAMBIA230035Su  CaMV 35S  CcEST2  CaMV  CaMV 35S  CCSE CCSE l A Plasmid Backbone P1 P2 P3 P4 P5 P6 P7 * - - Discussion MbA is a promising new treatment option for T2D and clinical obesity (Tarling et al., 2008; Andersen et al., 2009; Williams et al., 2015; Yuen et al., 2016), but supply issues pose a challenge for its development as a pharmaceutical or nutraceutical. In previous work, we identified the genes and enzymes for MbA biosynthesis in montbretia and established proof-of-concept for bioengineering of MbA production in Nb (Irmisch et al., 2018, 2019a, 2019b, 2020). Here, we investigated the biosynthesis of caffeic acid and caffeoyl-CoA, which are precursors for the formation of MbA in montbretia. While MbA is the predominant of the different montbretin metabolites that accumulates in montbretia corms, additional bioengineering tools are needed to improve MbA yields in Nb in absolute terms and relative to MbB and MbC. We identified and characterized a set of montbretia genes, specifically the shikimate shunt genes CcHCT (CcAT8), CcC3’H and CcCSE (CcEST2), and showed the utility of CcHCT and CcCSE to improve MbA yields in Nb. Using the extended set of genes for MbA bioengineering in Nb, we then improved the process of transient MbA pathway transfection by designing and testing variations of multigene constructs, instead of single-gene constructs, suitable for industrial process adaptation. Montbretia shikimate shunt enzymes It is not known which mechanisms control the preferential formation of MbA, relative to MbB and MbC, in montbretia. One possible mechanism, which we had previously tested, considered substrate specificity of the montbretin pathway branchpoint enzyme CcAT1 or its isoform CcAT2 (Irmisch et al., 2018, 2020). This enzyme introduces the different acyl sidechains, caffeoyl, coumaroyl or feruloyl, into MbA, MbB and MbC, respectively. Another hypothesized mechanism is the preferential biosynthesis of caffeoyl-CoA, relative to coumaroyl-CoA and feruloyl-CoA, by Cc4CLs. However, we found that CcAT is not specific for caffeoyl-CoA, relative to coumaroyl-CoA or feruloyl-CoA, and thus does not control selectivity for MbA formation (Irmisch et al., 2018, 2020). Similarly, montbretia 4CL enzymes are also not selective for favoring caffeoyl-CoA formation over coumaroyl- CoA and feruloyl-CoA (Sunstrum et al., 2021). We therefore set out to investigate other steps of the montbretia phenylpropanoid pathway, specifically for the formation of caffeic acid and caffeoyl-CoA (FIGURE 1). Within the phenylpropanoid pathway, coumaroyl- CoA is formed from coumaric acid by 4CL, and caffeoyl- and feruloyl-CoA can then be produced from coumaroyl-CoA via shikimate ester intermediates, a pathway referred to as the shikimate shunt. We identified and characterized three montbretia genes, CcHCT, CcC3’H and CcCSE, which we used together with Cc4CL to reconstitute the montbretia shikimate shunt for the conversion of coumaroyl-CoA into caffeic acid and caffeoyl-CoA in Nb and also in yeast. CcHCT catalyzes the conjugation of coumaroyl-CoA and shikimate to coumaroylshikimate, the first step of the shikimate shunt (Hoffmann et al., 2003; Kruse et al., 2022; Moghe et al., 2023). Like HCTs from other plant species, CcHCT also uses caffeoyl-CoA and feruloyl-CoA in addition to coumaroyl-CoA; however, the latter together with shikimate is considered the bona fide hydroxycinnamoyl-CoA HCT substrate (Kruse et al., 2022; Moghe et al., 2023). CcHCT clustered most closely with characterized HCTs from other plant species (not shown), specifically with other characterized monocot HCTs from switchgrass and great millet (Sorghum bicolor) supporting its role as HCT in montbretia (Walker et al., 2013; Escamilla-Treviño et al., 2014). The second step of the shikimate shunt is catalyzed by CcC3’H (CYP98A3) (FIGURE 1), a cytochrome P450 enzyme of the CYP98 family that hydroxylates coumaroylshikimate to caffeoylshikimate (Schoch et al., 2001). In addition, CcC3H also converted coumaric acid into caffeic acid, although with lower efficiency compared to the conversion of the CoA esters. This is similar to what has been reported for C3H enzymes from other plant species (Schoch et al., 2001; Franke et al., 2002). There are two possibilities for the third step from caffeoylshikimate to caffeoyl-CoA. One involves the reverse reaction of HCT; the other involves an ester hydrolysis catalyzed by CSE to yield caffeic acid, which is then converted by 4CL to caffeoyl-CoA (Hoffmann et al., 2005; Vanholme et al., 2013; Kriegshauser et al., 2021). HCTs from A. thaliana, switchgrass and poplar can catalyze the reverse reaction from caffeoylshikimate to caffeoyl-CoA and shikimate, but preferentially catalyze the forward-reaction (Escamilla- Treviño et al., 2014; Wang et al., 2014; Ha et al., 2016; Saleme et al., 2017). Interestingly, these three species also possess functional CSEs, and downregulation or knock-out of CSE in these species resulted in severe growth and lignin phenotypes (Vanholme et al., 2013; Ha et al., 2016; Saleme et al., 2017; de Vries et al., 2021a). CSE was first described in A. thaliana (Vanholme et al., 2013) and subsequently CSEs have been characterized in switchgrass, barrel clover, and poplar (Ha et al., 2016; Saleme et al., 2017; de Vries et al., 2021a). CSE genes have been annotated in both monocots and dicots, but in some species (e.g., Brachypodium distachyon, Zea mays, Beta vulgaris, Ricinus communis, Physcomitrium patens) CSE homologous genes seem to be missing (Ha et al., 2016). This pattern indicates that the CSE enzymatic function evolved independently in different species or CSEs were lost in several lineages (Ha et al., 2016; de Vries et al., 2021a). We could not find evidence supporting the HCT reverse reaction in montbretia, but we identified a functional CcCSE, which clustered with other class I esterases (Ha et al., 2016) and displayed the canonical esterase activity. CcCSE is active with caffeoylshikimate and chlorogenic acid as substrates, but did not show activity with coumaroylshikimate when assayed in vitro. However, the shikimate pathway reconstruction in yeast indicated that CcCSE also uses coumaroylshikimate, albeit with lower activity. This apparent preference of CcCSE towards caffeoylshikimate is similar to AtCSE, which strongly preferred caffeoylshikimate over coumaroylshikimate (Vanholme et al., 2013). Other characterized CSEs, such as the two CSEs from poplar, display broad substrate specificity, accepting caffeoylshikimate, feruloylshikimate, coumaroylshikimate and sinapoylshikimate, although with highest affinity for caffeoylshikimate (de Vries et al., 2021a). CcCSE showed a pattern of transcript expression matching that of previously characterized MbA biosynthetic genes and MbA accumulation during the early summer in developing young corms (Irmisch et al., 2018, 2019b, 2019a, 2020). The results described here from the identification of montbretia shikimate shunt genes, and successful functional reconstruction of the shikimate shunt in yeast using these genes, support a model whereby caffeic acid and caffeoyl-CoA for MbA formation in montbretia are provide via the shikimate shunt. Of the different montbretia shikimate shunt genes, the transcript expression pattern of CcCSE in developing young corms matches that of other genes of the MbA biosynthetic system, suggesting that CcCSE may play a critical role for MbA precursor biosynthesis in the shikimate shunt. The reconstruction of a functional shikimate shunt module in yeast expands the toolbox to metabolically engineer heterologous hosts for caffeic acid and caffeoyl-CoA production. While simpler biosynthetic pathways for caffeic acid production have been engineered in yeast (Liu et al., 2019; Zhou et al., 2021), the shikimate shunt may offer a system to produce high levels of caffeoyl-CoA, and low levels of coumaroyl-CoA. The MbA biosynthetic system serves as an example where selective incorporation of caffeoyl- CoA is important, and the same applies for other biosynthetic pathways that require caffeoyl moieties. Co-expression of the shikimate shunt improves MbA formation in N. benthamiana We had previously shown that transient expression of montbretia MbA pathway genes, together with montbretia myricetin precursor biosynthesis genes, in Nb resulted in approximately 10 µg MbA x g-1 FW, and more than 50-times higher levels of MbB (Irmisch et al., 2020). Here, we leverage the capacity of engineered Nb to produce montbretins (MbA, MbB and MbC) and the metabolic plasticity of this system to tailor caffeoyl-CoA precursor biosynthesis, which resulted in the intended decrease of MbB and increase of MbA. The previous predominant formation of MbB in Nb may have been due to high endogenous availability of coumaroyl-CoA (Vanholme et al., 2019). Using co-expression of the shikimate shunt genes CcHCT or CcCSE we were able to significantly decrease MbB levels and increase MbA levels, presumably through improved availability of caffeoyl-CoA (FIGURE 3 and FIGURE 4). MbC levels also increased, indicating conversion of caffeoyl-CoA by Nb endogenous O-methyltransferase activity to feruloyl-CoA (FIGURE 1B) (Zhong, 1998), which will be a target for downregulation in future work to further improve MbA levels and reduce MbC levels. Importantly, the overall amount of the three montbretins combined did not change, supporting our hypothesis that availability of the different hydroxycinnamoyl-CoA esters, caffeoyl-CoA, coumaroyl-CoA and feruloyl-CoA controls the ratio of MbA, MbB and MbC in engineerined Nb and possibly also in montbretia. It was not necessary to co-express the complete shikimate shunt in Nb along with other MbA biosynthetic pathway genes to achieve improved production of MbA, but we observed similar increases in MbA levels by co-expression of either CcHCT or CcCSE, implicating endogenous Nb enzymes in the precursor biosynthesis. Increase of MbA together with the accumulation of the pathway intermediate caffeoylshikimate upon co- expression of CcHCT (FIGURE 7B) suggests that coumaroylshikimate is efficiently transformed into caffeoylshikimate by Nb C3H and also suggests that Nb has a functional CSE. Indeed, while Nb CSE has not yet been reported, we found two predicted protein sequences (Niben261Chr08g0084016.1, Niben261Chr01g1081002.1) with approximately 88% identity to Arabidopsis CSE (AT1G52760.1) in the Nb genome assembly (v2.6.1; https: / / solgenomics.net / organism / Nicotiana_benthamiana / genome). The present work indicated remaining metabolic bottlenecks that will be explored in future work for further improvement of MbA production in Nb. The interplay and integration of heterologously expressed montbretia genes and endogenous Nb metabolism is of particular interest. For example, we observed accumulation of caffeoylshikimate in Nb when CcHCT was co-expressed with the 10-gene set for MbA biosynthesis. This compound did not accumulate in the co-expression of the entire montbretia shikimate shunt in yeast (FIGURE 9), indicating efficient flux through the montbretia shunt pathway that was not yet fully achieved when utilizing both montbretia genes and endogenous metabolism in Nb. CcCSE co-expression with the 10-gene set for MbA biosynthesis led to increased MbA levels, suggesting NbHCT contributes to the pathway in this scenario. It also is possible that chlorogenic acid, which is abundant in Nb leaves, may be cleaved by CcCSE and contribute to increased caffeic acid and caffeoyl-CoA levels. However, we did not observe changes in chlorogenic acid levels affected by CcCSE expression (FIGURE 7). Chlorogenic acid appears to be closely linked with lignin biosynthesis (Escamilla-Treviño et al., 2014; Volpi e Silva et al., 2019; Serrani-Yarce et al., 2021), however recent analyses suggest that the pathways leading to either lignin or chlorogenic acid seem to occur independently and are not part of a metabolic network (Cardenas et al., 2021). In our approach of engineering the biosynthesis of a complex molecule, such as MbA, into Nb we are taking advantage of the host plant’s endogenous metabolism (i.e., MbA building blocks), which would not be available in microbial hosts such as yeast or E. coli. However, the extent to which such metabolic precursors can be accessed and redirected may be limited. Precursor limitation has previously been observed for example in the engineering of etoposide (Lau and Sattely, 2015; Schultz et al., 2019) or triterpenoid biosynthesis (Reed et al., 2017; De La Peña and Sattely, 2021) in Nb. Expression of biosynthetic genes or transcriptional regulators that enhance individual precursor supply, or entire metabolic networks can alleviate bottlenecks and reshape endogenous precursor pathways (Butelli et al., 2008; Pandey et al., 2014; Wang et al., 2016). Previously, we showed that expression of montbretia myricetin biosynthetic genes and a montbretia MYB transcription factor enhance myricetin availability for MbA biosynthesis in Nb (Irmisch et al., 2019b). In the present study we targeted caffeoyl-CoA availability to increase MbA yields. These two approaches generally represent the “push” strategy in metabolic engineering (Yuan and Grotewold, 2015), enhancing precursor push towards MbA. In the present work, we found that individual co-expression of either CcHCT or CcCSE with the 10-gene set similarly increased MbA levels. CcHCT expression may deliver a “push” effect into the shikimate shunt by producing more coumaroylshikimate, while the effect of CcCSE could be a “pull” of metabolic flux towards caffeic acid by hydrolyzing caffeoylshikimate. In this case, both the “push” and the “pull” resulted in the same intended increase of MbA levels, which illustrates the metabolic plasticity of the Nb system. Combinations of “push” and “pull” strategies may result in the highest levels of desired end products (Yuan and Grotewold, 2015). However, co-expressing multiple montbretia shikimate shunt enzymes, including combinations of CcHCT and CcCSE, did not result in additive effects (FIGURE 8), indicating additional potential bottlenecks in Nb. Identifying these bottlenecks will open up new opportunities to improve MbA yields in Nb in the future. Use of multigene constructs towards improved processes for MbA production Transfection of Nb with multiple different Agrobacterium strains may reduce transfection efficiency (Montague et al., 2011; Stephenson et al., 2020). To address this general concern, and more specifically to streamline the transfection system for MbA production in Nb, we successfully designed and tested the stacking of eleven different genes onto two or three multigene constructs. As this approach requires the handling of fewer plasmids and fewer Agrobacterium strains for transient transformation, compared to individual- gene constructs, it reduces the risk of process failure in an industrial production system, which is being developed for MbA biosynthesis. The construction of plasmids carrying multigene expression cassettes was enabled by modular cloning. The number of genes per plasmid is, in theory, only limited by the final plasmid size, and constructs of up to 50 kb have been assembled and used for Agrobacterium transformation (Werner et al., 2012; Dudley et al., 2022; Grzech et al., 2022). In addition to the benefit of a streamlined process, we had speculated that the use of multigene constructs vs. single-gene constructs may further improve the MbA yield. However, we found similar MbA levels when using either two or three Agrobacterium strains carrying multigene constructs compared to the use of 11 Agrobacterium strains carrying single-gene constructs (FIGURE 7). This observation is similar to another recent study of metabolic engineering with multigene constructs in Nb (Grzech et al., 2022). Overall, co-expression of CcHCT and the previously described 10-gene set using multigene constructs resulted in improved MbA yields in a streamlined transient Nb transfection system. We achieved reproducible levels of ~0.1 mg MbA x g-1 FW, which is about 30 times higher than previously reported yields (Irmisch et al., 2020). For comparison, the level of MbA achieved here is in the range of other plant metabolites heterologously produced in Nb, such as strictosidine (0.23 mg MbA x g-1 dry weight) (Dudley et al., 2022) or artemisinin (0.8 mg MbA x g-1 dry weight) (Malhotra et al., 2016). MbA is promising new treatment option for T2D and clinical obesity, but development and application as a pharmaceutical or nutraceutical is limited by MbA supply from montbretia plants. Investigations of the montbretia phenylpropanoid shikimate shunt and the use of its genes to optimize caffeoyl-CoA availability in Nb for MbA production is presented herein. The findings suggest a model where CSE facilitates enhanced caffeic acid production and thus may enable preferential MbA formation in montbretia. Utilizing the newly identified montbretia genes improved MbA production in Nb and demonstrated how the endogenous metabolism of Nb can be tuned for the production of high-value small metabolites. This work highlights the potential to overcome limitation for MbA production in Nb, which may also be applicable to other metabolites derived from phenylpropanoid precursors. Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in accordance with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range. The word “comprising” is used herein as an open-ended term, substantially equivalent to the phrase “including, but not limited to”, and the word “comprises” has a corresponding meaning. As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a thing” includes more than one such thing. Citation of references herein is not an admission that such references are prior art to an embodiment of the present invention. The invention includes all embodiments and variations substantially as hereinbefore described and with reference to the examples and drawings.

[0003] References Alber, A. V., Renault, H., Basilio-Lopes, A., Bassard, J.-E., Liu, Z., Ullmann, P., et al. (2019). Evolution of coumaroyl conjugate 3-hydroxylases in land plants: lignin biosynthesis and defense. Plant J. Cell Mol. Biol.99, 924–936. doi: 10.1111 / tpj.14373. Andersen, R., Brayer, G., Tarling, A. C., Withers, S., and Woods, K. (2009). Alpha- amylase inhibitors: the montbretins and uses thereof. Available at: https: / / patents.google.com / patent / CA2738834A1 / en?oq=Montbretin+A [Accessed August 20, 2021]. Asada, Y., Hirayama, Y., and Furuya, T. (1988). Acylated flavonols from Crocosmia crocosmiiflora. Phytochemistry 27, 1497–1501. doi: 10.1016 / 0031-9422(88)80223-1. Ausubel, F.M., et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, New York (2010). Bally, J., Jung, H., Mortimer, C., Naim, F., Philips, J. G., Hellens, R., et al. (2018). The rise and rise of Nicotiana benthamiana: A plant for all reasons. Annu. Rev. Phytopathol.56, 405– 426. doi: 10.1146 / annurev-phyto-080417-050141. Barros, J., Escamilla-Trevino, L., Song, L., Rao, X., Serrani-Yarce, J. C., Palacios, M. D., et al. (2019).4-Coumarate 3-hydroxylase in the lignin biosynthesis pathway is a cytosolic ascorbate peroxidase. Nat. Commun.10, 1994. doi: 10.1038 / s41467-019-10082-7. Butelli, E., Titta, L., Giorgio, M., Mock, H.-P., Matros, A., Peterek, S., et al. (2008). Enrichment of tomato fruit with health-promoting anthocyanins by expression of select transcription factors. Nat. Biotechnol.26, 1301–1308. doi: 10.1038 / nbt.1506. Calgaro-Kozina, A., Vuu, K. M., Keasling, J. D., Loqué, D., Sattely, E. S., and Shih, P. M. (2020). Engineering plant synthetic pathways for the biosynthesis of novel antifungals. ACS Cent. Sci.6, 1394–1400. doi: 10.1021 / acscentsci.0c00241. Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., et al. (2009). BLAST+: architecture and applications. BMC Bioinformatics 10, 421. doi: 10.1186 / 1471-2105-10-421. Cardenas, C. L., Costa, M. A., Laskar, D. D., Moinuddin, S. G. A., Lee, C., Davin, L. B., et al. (2021). RNAi modulation of chlorogenic acid and lignin deposition in Nicotiana tabacum and insufficient compensatory metabolic cross-talk. J. Nat. Prod.84, 694–706. doi: 10.1021 / acs.jnatprod.1c00054. Chen, H.-C., Li, Q., Shuford, C. M., Liu, J., Muddiman, D. C., Sederoff, R. R., et al. (2011). Membrane protein complexes catalyze both 4- and 3-hydroxylation of cinnamic acid derivatives in monolignol biosynthesis. Proc. Natl. Acad. Sci.108, 21253–21258. doi: 10.1073 / pnas.1116416109. Chen, H.-C., Song, J., Williams, C. M., Shuford, C. M., Liu, J., Wang, J. P., et al. (2013). Monolignol pathway 4-coumaric acid:coenzyme A ligases in Populus trichocarpa: Novel specificity, metabolic regulation, and simulation of coenzyme A ligation fluxes. Plant Physiol. 161, 1501–1516. doi: 10.1104 / pp.112.210971. Chezem, W. R., and Clay, N. K. (2016). Regulation of plant secondary metabolism and associated specialized cell development by MYBs and bHLHs. Phytochemistry 131, 26–43. doi: 10.1016 / j.phytochem.2016.08.006. Coligan, J.E., et al. (eds.), Modern Proteomics – Sample Preparation, Analysis and Practical Applications in Advances in Experimental Medicine and Biology, Springer International Publishing, 2016. Comai, L, et al., (eds.); and Proteomic: Methods and Protocols in Methods in Molecular Biology, Springer International Publishing, 2017. Costa, M. A., Bedgar, D. L., Moinuddin, S. G. A., Kim, K.-W., Cardenas, C. L., Cochrane, F. C., et al. (2005). Characterization in vitro and in vivo of the putative multigene 4- coumarate:CoA ligase network in Arabidopsis: syringyl lignin and sinapate / sinapyl alcohol derivative formation. Phytochemistry 66, 2072–2091. doi: 10.1016 / j.phytochem.2005.06.022. De La Peña, R., Hodgson, H., Liu, J. C.-T., Stephenson, M. J., Martin, A. C., Owen, C., et al. (2023). Complex scaffold remodeling in plant triterpene biosynthesis. Science 379, 361–368. doi: 10.1126 / science.adf1017. De La Peña, R., and Sattely, E. S. (2021). Rerouting plant terpene biosynthesis enables momilactone pathway elucidation. Nat. Chem. Biol.17, 205–212. doi: 10.1038 / s41589-020- 00669-3. de Vries, L., Brouckaert, M., Chanoca, A., Kim, H., Regner, M. R., Timokhin, V. I., et al. (2021a). CRISPR-Cas9 editing of CAFFEOYL SHIKIMATE ESTERASE 1 and 2 shows their importance and partial redundancy in lignification in Populus tremula × P. alba. Plant Biotechnol. J.19, 2221–2234. doi: 10.1111 / pbi.13651. de Vries, S., Fürst-Jansen, J. M. R., Irisarri, I., Dhabalia Ashok, A., Ischebeck, T., Feussner, K., et al. (2021b). The evolution of the phenylpropanoid pathway entailed pronounced radiations and divergences of enzyme families. Plant J.107, 975–1002. doi: 10.1111 / tpj.15387. Diabetes Canada (2020). Food security and diabetes - Diabetes Canada. Ottawa: Diabetes Canada Available at: https: / / www.diabetes.ca / advocacy---policies / our-policy-positions / food- security-and-diabetes [Accessed February 27, 2023]. Douglas, C. J., Ellard, M., Hauffe, K. D., Molitor, E., de Sá, M. M., Reinold, S., et al. (1992). “General phenylpropanoid metabolism: regulation by environmental and developmental signals,” in Phenolic Metabolism in Plants Recent Advances in Phytochemistry., eds. H. A. Stafford and R. K. Ibrahim (Boston, MA: Springer US), 63–89. doi: 10.1007 / 978-1-4615-3430- 3_3. Dudley, Q. M., Jo, S., Guerrero, D. A. S., Chhetry, M., Smedley, M. A., Harwood, W. A., et al. (2022). Reconstitution of monoterpene indole alkaloid biosynthesis in genome engineered Nicotiana benthamiana. Commun. Biol.5, 1–12. doi: 10.1038 / s42003-022-03904-w. Duke, S. O., and Vaughn, K. C. (1982). Lack of involvement of polyphenol oxidase in ortho-hydroxylation of phenolic compounds in mung bean seedlings. Physiol. Plant.54, 381– 385. doi: 10.1111 / j.1399-3054.1982.tb00696.x. Dunwell, J.M. and Wetten A.C. (eds.), Transgenic Plants: Methods and Protocols¸ Second Edition, Humana Press, 2012. Engler, C., Youles, M., Gruetzner, R., Ehnert, T.-M., Werner, S., Jones, J. D. G., et al. (2014). A golden gate modular cloning toolbox for plants. ACS Synth. Biol.3, 839–843. doi: 10.1021 / sb4001504. Escamilla-Treviño, L. L., Shen, H., Hernandez, T., Yin, Y., Xu, Y., and Dixon, R. A. (2014). Early lignin pathway enzymes and routes to chlorogenic acid in switchgrass (Panicum virgatum L.). Plant Mol. Biol.84, 565–576. doi: 10.1007 / s11103-013-0152-y. FAO, IFAD, UNICEF, WFP, and WHO (2021). The State of Food Security and Nutrition in the World 2021. Rome, Italy: FAO, IFAD, UNICEF, WFP and WHO doi: 10.4060 / cb4474en. Franke, R., Humphreys, J. M., Hemm, M. R., Denault, J. W., Ruegger, M. O., Cusumano, J. C., et al. (2002). The Arabidopsis REF8 gene encodes the 3-hydroxylase of phenylpropanoid metabolism. Plant J.30, 33–45. doi: 10.1046 / j.1365-313X.2002.01266.x. Fraser, C. M., and Chapple, C. (2011). The phenylpropanoid pathway in Arabidopsis. Arab. Book Am. Soc. Plant Biol.9, e0152. doi: 10.1199 / tab.0152. Geu-Flores, F., Nour-Eldin, H. H., Nielsen, M. T., and Halkier, B. A. (2007). USER fusion: a rapid and efficient method for simultaneous fusion and cloning of multiple PCR products. Nucleic Acids Res.35, e55. doi: 10.1093 / nar / gkm106. Gou, M., Ran, X., Martin, D. W., and Liu, C.-J. (2018). The scaffold proteins of lignin biosynthetic cytochrome P450 enzymes. Nat. Plants 4, 299–310. doi: 10.1038 / s41477-018-0142- 9. Grzech, D., Hong, B., Caputi, L., Sonawane, P. D., and O’Connor, S. E. (2022). Engineering the biosynthesis of late-stage vinblastine precursors precondylocarpine acetate, catharanthine, tabersonine in Nicotiana benthamiana. ACS Synth. Biol.12, 27–34. doi: 10.1021 / acssynbio.2c00434. Ha, C. M., Escamilla-Trevino, L., Yarce, J. C. S., Kim, H., Ralph, J., Chen, F., et al. (2016). An essential role of caffeoyl shikimate esterase in monolignol biosynthesis in Medicago truncatula. Plant J.86, 363–375. doi: 10.1111 / tpj.13177. Harding, S. A., Leshkevich, J., Chiang, V. L., and Tsai, C.-J. (2002). Differential substrate inhibition couples kinetically distinct 4-coumarate:coenzyme A ligases with spatially distinct metabolic roles in quaking aspen. Plant Physiol.128, 428–438. doi: 10.1104 / pp.010603. Hoffmann, L., Besseau, S., Geoffroy, P., Ritzenthaler, C., Meyer, D., Lapierre, C., et al. (2005). Acyltransferase-catalysed p-coumarate ester formation is a committed step of lignin biosynthesis. Plant Biosyst.-Int. J. Deal. Asp. Plant Biol.139, 50–53. Hoffmann, L., Maury, S., Martz, F., Geoffroy, P., and Legrand, M. (2003). Purification, cloning, and properties of an acyltransferase controlling shikimate and quinate ester intermediates in phenylpropanoid metabolism. J. Biol. Chem.278, 95–103. doi: 10.1074 / jbc.M209362200. Incha, M. R., Thompson, M. G., Blake-Hedges, J. M., Liu, Y., Pearson, A. N., Schmidt, M., et al. (2019). Leveraging host metabolism for bisdemethoxycurcumin production in Pseudomonas putida. Metab. Eng. Commun.10, e00119. doi: 10.1016 / j.mec.2019.e00119. Irmisch, S., Jancsik, S., Man Saint Yuen, M., Madilao, L. L., and Bohlmann, J. (2020). Complete biosynthesis of the anti-diabetic plant metabolite montbretin A. Plant Physiol.184, 97–109. doi: 10.1104 / pp.20.00522. Irmisch, S., Jancsik, S., Yuen, M. M. S., Madilao, L. L., and Bohlmann, J. (2019a). Biosynthesis of the anti-diabetic metabolite montbretin A: glucosylation of the central intermediate mini-MbA. Plant J.100, 879–891. doi: https: / / doi.org / 10.1111 / tpj.14493. Irmisch, S., Jo, S., Roach, C. R., Jancsik, S., Yuen, M. M. S., Madilao, L. L., et al. (2018). Discovery of UDP-glycosyltransferases and BAHD-acyltransferases involved in the biosynthesis of the antidiabetic plant metabolite montbretin A. Plant Cell 30, 1864–1886. doi: 10.1105 / tpc.18.00406. Irmisch, S., Ruebsam, H., Jancsik, S., Man Saint Yuen, M., Madilao, L. L., and Bohlmann, J. (2019b). Flavonol biosynthesis genes and their use in engineering the plant antidiabetic metabolite montbretin A. Plant Physiol.180, 1277–1290. doi: 10.1104 / pp.19.00254. Katoh, K., Misawa, K., Kuma, K., and Miyata, T. (2002). MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res.30, 3059– 3066. Kim, I. A., Kim, B.-G., Kim, M., and Ahn, J.-H. (2012). Characterization of hydroxycinnamoyltransferase from rice and its application for biological synthesis of hydroxycinnamoyl glycerols. Phytochemistry 76, 25–31. doi: 10.1016 / j.phytochem.2011.12.015. Kim, S. S., Wengier, D. L., Ragland, C. J., and Sattely, E. S. (2022). Transcriptional reactivation of lignin biosynthesis for the heterologous production of etoposide aglycone in Nicotiana benthamiana. ACS Synth. Biol.11, 3379–3387. doi: 10.1021 / acssynbio.2c00289. Kojima, M., and Takeuchi, W. (1989). Detection and characterization of p-coumaric acid hydroxylase in mung bean, Vigna mungo, seedlings. J. Biochem. (Tokyo) 105, 265–270. doi: 10.1093 / oxfordjournals.jbchem.a122651. Koncz, C., and Schell, J. (1986). The promoter of TL-DNA gene 5 controls the tissue- specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. MGG 204, 383–396. doi: 10.1007 / BF00331014. Kriegshauser, L., Knosp, S., Grienenberger, E., Tatsumi, K., Gütle, D. D., Sørensen, I., et al. (2021). Function of the HYDROXYCINNAMOYL-CoA:SHIKIMATE HYDROXYCINNAMOYL TRANSFERASE is evolutionarily conserved in embryophytes. Plant Cell 33, 1472–1491. doi: 10.1093 / plcell / koab044. Kruse, L. H., Fehr, B., Chobirko, J. D., and Moghe, G. D. (2023). Phylogenomic analyses across land plants reveals motifs and coexpression patterns useful for functional prediction in the BAHD acyltransferase family. Front. Plant Sci.14. doi: 10.3389 / fpls.2023.1067613. Kruse, L. H., Weigle, A. T., Irfan, M., Martínez-Gómez, J., Chobirko, J. D., Schaffer, J. E., et al. (2022). Orthology-based analysis helps map evolutionary diversification and predict substrate class use of BAHD acyltransferases. Plant J.111, 1453–1468. doi: 10.1111 / tpj.15902. Lau, W., and Sattely, E. S. (2015). Six enzymes from mayapple that complete the biosynthetic pathway to the etoposide aglycone. Science 349, 1224–1228. doi: 10.1126 / science.aac7202. Lee, M. E., DeLoache, W. C., Cervantes, B., and Dueber, J. E. (2015). A highly characterized yeast toolkit for modular, multipart assembly. ACS Synth. Biol.4, 975–986. doi: 10.1021 / sb500366v. Letunic, I., and Bork, P. (2021). Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res.49, W293–W296. doi: 10.1093 / nar / gkab301. Liu, D., Sica, M. S., Mao, J., Chao, L. F.-I., and Siewers, V. (2022). A p-coumaroyl-CoA biosensor for dynamic regulation of naringenin biosynthesis in Saccharomyces cerevisiae. ACS Synth. Biol.11, 3228–3238. doi: 10.1021 / acssynbio.2c00111. Liu, L., Liu, H., Zhang, W., Yao, M., Li, B., Liu, D., et al. (2019). Engineering the biosynthesis of caffeic acid in Saccharomyces cerevisiae with heterologous enzyme combinations. Engineering 5, 287–295. doi: 10.1016 / j.eng.2018.11.029. Malhotra, K., Subramaniyan, M., Rawat, K., Kalamuddin, Md., Qureshi, M. I., Malhotra, P., et al. (2016). Compartmentalized metabolic engineering for artemisinin biosynthesis and effective malaria treatment by oral delivery of plant cells. Mol. Plant 9, 1464–1477. doi: 10.1016 / j.molp.2016.09.013. Moghe, G., Kruse, L. H., Petersen, M., Scossa, F., Fernie, A. R., Gaquerel, E., et al. (2023). BAHD company: The ever-expanding roles of the BAHD acyltransferase gene family in plants. Annu. Rev. Plant Biol.74, null. doi: 10.1146 / annurev-arplant-062922-050122. Montague, N. P., Thuenemann, E. C., Saxena, P., Saunders, K., Lenzi, P., and Lomonossoff, G. P. (2011). Recent advances of Cowpea mosaic virus-based particle technology. Hum. Vaccin.7, 383–390. doi: 10.4161 / hv.7.3.14989. Nett, R. S., and Sattely, E. S. (2021). Total biosynthesis of the tubulin-binding alkaloid colchicine. J. Am. Chem. Soc.143, 19454–19465. doi: 10.1021 / jacs.1c08659. Nguyen, L.-T., Schmidt, H. A., von Haeseler, A., and Minh, B. Q. (2015). IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol.32, 268–274. doi: 10.1093 / molbev / msu300. Niggeweg, R., Michael, A. J., and Martin, C. (2004). Engineering plants with increased levels of the antioxidant chlorogenic acid. Nat. Biotechnol.22, 746–754. doi: 10.1038 / nbt966. Nour-Eldin, H. H., Hansen, B. G., Nørholm, M. H. H., Jensen, J. K., and Halkier, B. A. (2006). Advancing uracil-excision based cloning towards an ideal technique for cloning PCR fragments. Nucleic Acids Res.34, e122. doi: 10.1093 / nar / gkl635. Ong, K. L., Stafford, L. K., McLaughlin, S. A., Boyko, E. J., Vollset, S. E., Smith, A. E., et al. (2023). Global, regional, and national burden of diabetes from 1990 to 2021, with projections of prevalence to 2050: a systematic analysis for the Global Burden of Disease Study 2021. The Lancet 402, 203–234. doi: 10.1016 / S0140-6736(23)01301-6. Pandey, A., Misra, P., Khan, M. P., Swarnkar, G., Tewari, M. C., Bhambhani, S., et al. (2014). Co-expression of Arabidopsis transcription factor, AtMYB12, and soybean isoflavone synthase, GmIFS1, genes in tobacco leads to enhanced biosynthesis of isoflavones and flavonols resulting in osteoprotective activity. Plant Biotechnol. J.12, 69–80. doi: 10.1111 / pbi.12118. Parke, D., and Ornston, L. N. (2004). Toxicity caused by hydroxycinnamoyl-coenzyme A thioester accumulation in mutants of Acinetobacter sp. strain ADP1. Appl. Environ. Microbiol. 70, 2974–2983. doi: 10.1128 / AEM.70.5.2974-2983.2004. Reed, J., and Osbourn, A. (2018). Engineering terpenoid production through transient expression in Nicotiana benthamiana. Plant Cell Rep.37, 1431–1441. doi: 10.1007 / s00299-018- 2296-3. Reed, J., Stephenson, M. J., Miettinen, K., Brouwer, B., Leveau, A., Brett, P., et al. (2017). A translational synthetic biology platform for rapid access to gram-scale quantities of novel drug-like molecules. Metab. Eng.42, 185–193. doi: 10.1016 / j.ymben.2017.06.012. Renault, H., Werck-Reichhart, D., and Weng, J.-K. (2019). Harnessing lignin evolution for biotechnological applications. Curr. Opin. Biotechnol.56, 105–111. doi: 10.1016 / j.copbio.2018.10.011. Royal Botanical Garden, Kew (2023). The international plant names index and world checklist of vascular plants 2023. Plants World Online. Available at: http: / / powo.science.kew.org / taxon / urn:lsid:ipni.org:names:20292-1 [Accessed July 4, 2023]. Saleme, M. de L. S., Cesarino, I., Vargas, L., Kim, H., Vanholme, R., Goeminne, G., et al. (2017). Silencing CAFFEOYL SHIKIMATE ESTERASE affects lignification and improves saccharification in poplar. Plant Physiol.175, 1040–1057. doi: 10.1104 / pp.17.00920. Schillberg, S., and Finnern, R. (2021). Plant molecular farming for the production of valuable proteins – Critical evaluation of achievements and future challenges. J. Plant Physiol. 258–259, 153359. doi: 10.1016 / j.jplph.2020.153359. Schoch, G., Goepfert, S., Morant, M., Hehn, A., Meyer, D., Ullmann, P., et al. (2001). CYP98A3 from Arabidopsis thaliana Is a 3′-hydroxylase of phenolic esters, a missing link in the phenylpropanoid pathway. J. Biol. Chem.276, 36566–36574. doi: 10.1074 / jbc.M104047200. Schultz, B. J., Kim, S. Y., Lau, W., and Sattely, E. S. (2019). Total biosynthesis for milligram-scale production of etoposide intermediates in a plant chassis. J. Am. Chem. Soc.141, 19231–19235. doi: 10.1021 / jacs.9b10717. Serrani-Yarce, J. C., Escamilla-Trevino, L., Barros, J., Gallego-Giraldo, L., Pu, Y., Ragauskas, A., et al. (2021). Targeting hydroxycinnamoyl CoA: shikimate hydroxycinnamoyl transferase for lignin modification in Brachypodium distachyon. Biotechnol. Biofuels 14, 50. doi: 10.1186 / s13068-021-01905-1. Stafford, H. A., and Dresler, S. (1972).4-Hydroxycinnamic acid hydroxylase and polyphenolase activities in Sorghum vulgare. Plant Physiol.49, 590–595. Stephenson, M. J., Reed, J., Patron, N. J., Lomonossoff, G. P., and Osbourn, A. (2020). “6.11 - Engineering tobacco for plant natural product production,” in Comprehensive Natural Products III, eds. H.-W. (Ben) Liu and T. P. Begley (Oxford: Elsevier), 244–262. doi: 10.1016 / B978-0-12-409547-2.14724-9. Sunstrum, F. G., Liu, H. L., Jancsik, S., Madilao, L. L., Bohlmann, J., and Irmisch, S. (2021).4-Coumaroyl-CoA ligases in the biosynthesis of the anti-diabetic metabolite montbretin A. PLOS ONE 16, e0257478. doi: 10.1371 / journal.pone.0257478. Tarling, C. A., Woods, K., Zhang, R., Brastianos, H. C., Brayer, G. D., Andersen, R. J., et al. (2008). The search for novel human pancreatic alpha-amylase inhibitors: high-throughput screening of terrestrial and marine natural product extracts. Chembiochem Eur. J. Chem. Biol.9, 433–438. doi: 10.1002 / cbic.200700470. The Lancet (2023). Diabetes: a defining disease of the 21st century. The Lancet 401, 2087. doi: 10.1016 / S0140-6736(23)01296-5. The UniProt Consortium (2023). UniProt: the universal protein knowledgebase in 2023. Nucleic Acids Res.51, D523–D531. doi: 10.1093 / nar / gkac1052. Tschofen, M., Knopp, D., Hood, E., and Stöger, E. (2016). Plant molecular farming: Much more than medicines. Annu. Rev. Anal. Chem.9, 271–294. doi: 10.1146 / annurev-anchem- 071015-041706. Vanholme, R., Cesarino, I., Rataj, K., Xiao, Y., Sundin, L., Goeminne, G., et al. (2013). Caffeoyl shikimate esterase (CSE) is an enzyme in the lignin biosynthetic pathway in Arabidopsis. Science 341, 1103–1106. doi: 10.1126 / science.1241602. Vanholme, R., De Meester, B., Ralph, J., and Boerjan, W. (2019). Lignin biosynthesis and its integration into metabolism. Curr. Opin. Biotechnol.56, 230–239. doi: 10.1016 / j.copbio.2019.02.018. Volpi e Silva, N., Mazzafera, P., and Cesarino, I. (2019). Should I stay or should I go: are chlorogenic acids mobilized towards lignin biosynthesis? Phytochemistry 166, 112063. doi: 10.1016 / j.phytochem.2019.112063. Walker, A. M., Hayes, R. P., Youn, B., Vermerris, W., Sattler, S. E., and Kang, C. (2013). Elucidation of the structure and reaction mechanism of Sorghum hydroxycinnamoyltransferase and its structural relationship to other coenzyme A-dependent transferases and synthases. Plant Physiol.162, 640–651. doi: 10.1104 / pp.113.217836. Wang, J. P., Naik, P. P., Chen, H.-C., Shi, R., Lin, C.-Y., Liu, J., et al. (2014). Complete proteomic-based enzyme reaction and inhibition kinetics reveal how monolignol biosynthetic enzyme families affect metabolic flux and lignin in Populus trichocarpa. Plant Cell 26, 894– 914. doi: 10.1105 / tpc.113.120881. Wang, Q., Reddy, V. A., Panicker, D., Mao, H.-Z., Kumar, N., Rajan, C., et al. (2016). Metabolic engineering of terpene biosynthesis in plants using a trichome-specific transcription factor MsYABBY5 from spearmint (Mentha spicata). Plant Biotechnol. J.14, 1619–1632. doi: 10.1111 / pbi.12525. Watanabe, B., Kirikae, H., Koeduka, T., Takeuchi, Y., Asai, T., Naito, Y., et al. (2018). Synthesis and inhibitory activity of mechanism-based 4-coumaroyl-CoA ligase inhibitors. Bioorg. Med. Chem.26, 2466–2474. doi: 10.1016 / j.bmc.2018.04.006. Weber, E., Engler, C., Gruetzner, R., Werner, S., and Marillonnet, S. (2011). A modular cloning system for standardized assembly of multigene constructs. PLoS ONE 6, e16765. doi: 10.1371 / journal.pone.0016765. Weng, J.-K., and Chapple, C. (2010). The origin and evolution of lignin biosynthesis. New Phytol.187, 273–285. doi: 10.1111 / j.1469-8137.2010.03327.x. Werner, S., Engler, C., Weber, E., Gruetzner, R., and Marillonnet, S. (2012). Fast track assembly of multigene constructs using Golden Gate cloning and the MoClo system. Bioengineered 3, 38–43. doi: 10.4161 / bbug.3.1.18223. Williams, L. K., Zhang, X., Caner, S., Tysoe, C., Nguyen, N. T., Wicki, J., et al. (2015). The amylase inhibitor montbretin A reveals a new glycosidase inhibition motif. Nat. Chem. Biol. 11, 691–696. doi: 10.1038 / nchembio.1865. Xie, M., Zhang, J., Tschaplinski, T. J., Tuskan, G. A., Chen, J.-G., and Muchero, W. (2018). Regulation of lignin biosynthesis and its role in growth-defense tradeoffs. Front. Plant Sci.9. doi: 10.3389 / fpls.2018.01427. Yuan, L., and Grotewold, E. (2015). Metabolic engineering to enhance the value of plants as green factories. Metab. Eng.27, 83–91. doi: 10.1016 / j.ymben.2014.11.005. Yuen, V. G., Coleman, J., Withers, S. G., Andersen, R. J., Brayer, G. D., Mustafa, S., et al. (2016). Glucose lowering effect of montbretin A in Zucker Diabetic Fatty rats. Mol. Cell. Biochem.411, 373–381. doi: 10.1007 / s11010-015-2599-4. Zhong, R., Morrison, W. H., III, Negrel, J., and Ye, Z.-H. (1998). Dual methylation pathways in lignin biosynthesis. Plant Cell 10, 2033–2045. doi: 10.1105 / tpc.10.12.2033. Zhong, R., and Ye, Z.-H. (2009). Transcriptional regulation of lignin biosynthesis. Plant Signal. Behav.4, 1028–1034. doi: 10.4161 / psb.4.11.9875. Zhou, P., Yue, C., Shen, B., Du, Y., Xu, N., and Ye, L. (2021). Metabolic engineering of Saccharomyces cerevisiae for enhanced production of caffeic acid. Appl. Microbiol. Biotechnol. 105, 5809–5819. doi: 10.1007 / s00253-021-11445-1.

Claims

CLAIMS:

1. A gene expression construct, the gene expression construct comprising: (a) a nucleotide sequence encoding one or more of the following: (i) a Crocosmia × crocosmiiflora hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyl transferase (CcHCT) having the nucleic acid sequence set forth in SEQ ID NO:1; (ii) a Crocosmia × crocosmiiflora caffeoylshikimate esterase (CcCSE) having the nucleic acid sequence set forth in SEQ ID NO:3; (iii) a Crocosmia × crocosmiiflora p-coumaroylshikimate 3’-hydroxylase (CcC3’H) having the nucleic acid sequence set forth in SEQ ID NO:5; (iv) a hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyl transferase (HCT) having the nucleic acid sequence set forth in SEQ ID NOs:31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, or 65; and (v) a caffeoylshikimate esterase (CSE) having the nucleic acid sequence set forth in SEQ ID NOs: 67, 69, 71, or 73; or (b) a nucleotide sequence that encodes one or more of the following polypeptides: (i) a CcHCT having the amino acid sequence set forth in SEQ ID NO:2; (ii) a CcCSE having the amino acid sequence set forth in SEQ ID NO:4; (iii) a CcC3’H having the amino acid sequence set forth in SEQ ID NO:6; (iv) a HCT having the amino acid sequence set forth in SEQ ID NOs:32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, or 66; and (v) a CSE having the amino acid sequence set forth in SEQ ID NOs: 68, 70, 72, or 74; or (c) a nucleotide sequence that encodes a polypeptide having at least 65% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 2, 4, or 6 and having HCT; CSE; or C3’H enzyme activity.

2. The gene expression construct of claim 1, further comprising one or more gene expression constructs comprising: (a) a nucleotide sequence encoding one or more of the following: (i) Crocosmia × crocosmiiflora UDP-glycosyltransferase 1 (CcUGT1) having the nucleic acid sequence set forth in SEQ ID NO:7; (ii) Crocosmia × crocosmiiflora UDP-glycosyltransferase 2 (CcUGT2)having the nucleic acid sequence set forth in SEQ ID NO:9; (iii) Crocosmia × crocosmiiflora UDP-glycosyltransferase 3 (CcUGT3) having the nucleic acid sequence set forth in SEQ ID NO:11; (iv) Crocosmia × crocosmiiflora UDP-glycosyltransferase 4 (CcUGT4) having the nucleic acid sequence set forth in SEQ ID NO:13; (v) Crocosmia × crocosmiiflora UDP-glycosyltransferase 5 (CcUGT5) having the nucleic acid sequence set forth in SEQ ID NO:15; (vi) Crocosmia × crocosmiiflora BAHD acyltransferase 1 (CcAT1) having the nucleic acid sequence set forth in SEQ ID NO:17; (vii) Crocosmia × crocosmiiflora BAHD acyltransferase 2 (CcAT2) having the nucleic acid sequence set forth in SEQ ID NO:19; (viii) Crocosmia × crocosmiiflora flavonol synthase (CcFLS) having the nucleic acid sequence set forth in SEQ ID NO:21; (ix) Crocosmia × crocosmiiflora flavonol 3’5’-hydroxylase (CcCYP2) having the nucleic acid sequence set forth in SEQ ID NO:23; (x) Crocosmia × crocosmiiflora MYB4 transcription factor (CcMYB4) having the nucleic acid sequence set forth in SEQ ID NO:25; (xi) Tombusvirus P19 core protein (P19) having the nucleic acid sequence set forth in SEQ ID NO:27; (xii) Crocosmia × crocosmiiflora 4-coumaroyl-CoA ligase 1 (Cc4CL1) having the nucleic acid sequence set forth in SEQ ID NO:29; and (xiii) Crocosmia × crocosmiiflora 4-coumaroyl-CoA ligase 2 (Cc4CL2) having the nucleic acid sequence set forth in SEQ ID NO:75; (b) a nucleotide sequence that encodes encoding one or more of the following polypeptides: (i) CcUGT1 having the amino acid sequence set forth in SEQ ID NO:8; (ii) CcUGT2 having the amino acid sequence set forth in SEQ ID NO:10; (iii) CcUGT3 having the amino acid sequence set forth in SEQ ID NO:12; (iv) CcUGT4 having the amino acid sequence set forth in SEQ ID NO:14; (v) CcUGT5 having the amino acid sequence set forth in SEQ ID NO:16; (vi) CcAT1 having the amino acid sequence set forth in SEQ ID NO:18; (vii) CcAT2 having the amino acid sequence set forth in SEQ ID NO:20;(viii) CcFLS having the amino acid sequence set forth in SEQ ID NO:22; (ix) CcCYP2 having the amino acid sequence set forth in SEQ ID NO:24; (x) CcMYB4 having the amino acid sequence set forth in SEQ ID NO:26; (xi) P19 having the amino acid sequence set forth in SEQ ID NO:28; and (xii) Cc4CL1 having the amino acid sequence set forth in SEQ ID NO:30; (xiii) Cc4CL2 having the amino acid sequence set forth in SEQ ID NO:76; or (c) a nucleotide sequence that encodes a polypeptide having at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, and 30, wherein the polypeptide has UGT1; UGT2; UGT3; UGT4; UGT5; AT1; AT2; FLS; CYP2; MYB4; P19; 4CL1; or 4CL2 activity.

3. The gene expression constructs of claim 2, wherein the gene expression construct is a multigene construct.

4. The gene expression constructs of claim 3, wherein the multigene construct has a nucleotide sequence one or more of the following: (i) SEQ ID NO:87; (ii) SEQ ID NO:88; (iii) SEQ ID NO:89; (iv) SEQ ID NO:90; and (v) SEQ ID NO:

91.

5. The gene expression constructs of any one of claims 1-4, wherein the coding sequences are operably linked to a functional promoter and a functional terminator.

6. The gene expression constructs of any one of claims 1-5, wherein the gene expression construct further comprises, a 5’ UTR and a 3’ UTR.

7. The gene expression constructs of any one of claims 1-6, wherein the gene expression construct encodes a functional translation initiation site and a functional translation termination site.

8. The gene expression construct of any one of claims 1-7, wherein the gene expression construct is suitable for the expression of the polypeptides in a bacteria, an archaea, an algae, a yeast, a plant, a plant part, or a plant cell, having a shikimate pathway.

9. The gene expression construct of any one of claims 1-8, wherein the gene expression construct forms part of a plasmid or viral vector.

10. The gene expression construct of any one of claims 1-9, wherein the gene expression construct is operable to transiently transfect or stably transfect a recombinant host.

11. The gene expression construct of claim 10, wherein the recombinant host is a bacteria, an archaea, an algae, a yeast, a plant, a plant part, or a plant cell.

12. The gene expression construct of any one of claims 1-11, wherein the gene expression construct is suitable for transfection of Nicotiana benthamiana.

13. The gene expression construct of any one of claims 1-11, wherein the gene expression construct is suitable for transfection of Saccharomyces cerevisiae.

14. The gene expression construct of any one of claims 1-13, wherein the gene expression construct is suitable for plant transformation by Agrobacterium tumefaciens.

15. The gene expression construct of any one of claims 1-14, wherein the gene expression construct comprises: (a) a nucleotide sequence encoding one or more of the following: (i) CcUGT1 having the nucleic acid sequence set forth in SEQ ID NO:7; (ii) CcUGT2 having the nucleic acid sequence set forth in SEQ ID NO:9; (iii) CcUGT3 having the nucleic acid sequence set forth in SEQ ID NO:11; (iv) CcUGT4 having the nucleic acid sequence set forth in SEQ ID NO:13; (v) CcUGT5 having the nucleic acid sequence set forth in SEQ ID NO:15; (vi) CcAT1 having the nucleic acid sequence set forth in SEQ ID NO:17 or CcAT2 having the nucleic acid sequence set forth in SEQ ID NO:19; (vii) CcFLS having the nucleic acid sequence set forth in SEQ ID NO:21; (viii) CcCYP2 having the nucleic acid sequence set forth in SEQ ID NO:23; (ix) CcMYB4 having the nucleic acid sequence set forth in SEQ ID NO:25; (x) P19 having the nucleic acid sequence set forth in SEQ ID NO:27; and (xi) Cc4CL1 having the nucleic acid sequence set forth in SEQ ID NO:29 or Cc4CL2 having the nucleic acid sequence set forth in SEQ ID NO:75; or (b) a nucleotide sequence that encodes encoding one or more of the following polypeptides: (i) CcUGT1 having the amino acid sequence set forth in SEQ ID NO:8; (ii) CcUGT2 having the amino acid sequence set forth in SEQ ID NO:10; (iii) CcUGT3 having the amino acid sequence set forth in SEQ ID NO:12; (iv) CcUGT4 having the amino acid sequence set forth in SEQ ID NO:14;(v) CcUGT5 having the amino acid sequence set forth in SEQ ID NO:16; (vi) CcAT1 having the amino acid sequence set forth in SEQ ID NO:18 or CcAT2 having the amino acid sequence set forth in SEQ ID NO:20; (vii) CcFLS having the amino acid sequence set forth in SEQ ID NO:22; (viii) CcCYP2 having the amino acid sequence set forth in SEQ ID NO:24; (ix) CcMYB4 having the amino acid sequence set forth in SEQ ID NO:26; (x) P19 having the amino acid sequence set forth in SEQ ID NO:28; and (xi) Cc4CL1 having the amino acid sequence set forth in SEQ ID NO:30 or Cc4CL2 having the amino acid sequence set forth in SEQ ID NO:

76.

16. The gene expression construct of any one of claims 1-14, wherein the gene expression construct comprises: (a) a nucleotide sequence encoding one or more of the following: (i) CcUGT1 having the nucleic acid sequence set forth in SEQ ID NO:7; (ii) CcUGT2 having the nucleic acid sequence set forth in SEQ ID NO:9; (iii) CcUGT3 having the nucleic acid sequence set forth in SEQ ID NO:11; (iv) CcUGT4 having the nucleic acid sequence set forth in SEQ ID NO:13; (v) CcUGT5 having the nucleic acid sequence set forth in SEQ ID NO:15; (vi) CcAT1 having the nucleic acid sequence set forth in SEQ ID NO:17 or CcAT2 having the nucleic acid sequence set forth in SEQ ID NO:19; (vii) CcFLS having the nucleic acid sequence set forth in SEQ ID NO:21; (viii) CcCYP2 having the nucleic acid sequence set forth in SEQ ID NO:23; (ix) CcMYB4 having the nucleic acid sequence set forth in SEQ ID NO:25; and (x) P19 having the nucleic acid sequence set forth in SEQ ID NO:27; or (b) a nucleotide sequence that encodes encoding one or more of the following polypeptides: (i) CcUGT1 having the amino acid sequence set forth in SEQ ID NO:8; (ii) CcUGT2 having the amino acid sequence set forth in SEQ ID NO:10; (iii) CcUGT3 having the amino acid sequence set forth in SEQ ID NO:12; (iv) CcUGT4 having the amino acid sequence set forth in SEQ ID NO:14; (v) CcUGT5 having the amino acid sequence set forth in SEQ ID NO:16; (vi) CcAT1 having the amino acid sequence set forth in SEQ ID NO:18 orCcAT2 having the amino acid sequence set forth in SEQ ID NO:20; (vii) CcFLS having the amino acid sequence set forth in SEQ ID NO:22; (viii) CcCYP2 having the amino acid sequence set forth in SEQ ID NO:24; (ix) CcMYB4 having the amino acid sequence set forth in SEQ ID NO:26; and (x) P19 having the amino acid sequence set forth in SEQ ID NO:

28.

17. A method of enhancing montbretin A (MbA) biosynthesis, the method comprising transfecting a cell with an isolated nucleic molecule encoding CcHCT; CcC3’H; and CcCSE; and growing the transfected cell under conditions such that the MbA is produced, wherein the isolated nucleic acid molecule encoding CcHCT; CcC3’H; and CcCSE comprises: (a) a nucleotide sequence encoding one or more of the following: (i) a CcHCT having the nucleic acid sequence set forth in SEQ ID NO:1; (ii) a CcCSE having the nucleic acid sequence set forth in SEQ ID NO:3; (iii) a CcC3’H having the nucleic acid sequence set forth in SEQ ID NO:5; (iv) a HCT having the nucleic acid sequence set forth in SEQ ID NOs:31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, or 65; and (v) a CSE having the nucleic acid sequence set forth in SEQ ID NOs: 67, 69, 71, or 73; or (b) a nucleotide sequence that encodes one or more of the following polypeptides: (i) a CcHCT having the amino acid sequence set forth in SEQ ID NO:2; (ii) a CcCSE having the amino acid sequence set forth in SEQ ID NO:4; (iii) a CcC3’H having the amino acid sequence set forth in SEQ ID NO:6; (iv) a HCT having the amino acid sequence set forth in SEQ ID NOs:32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, or 66; and (v) a CSE having the amino acid sequence set forth in SEQ ID NOs: 68, 70, 72, or 74; or (c) a nucleotide sequence that encodes a polypeptide having at least 65% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 2, 4, or 6 and having HCT; CSE; or C3’H enzyme activity.

18. The method of claim 17, wherein the cell is further transfected with one or more gene expression constructs comprising: (a) a nucleotide sequence encoding one or more of the following:(i) CcUGT1 having the nucleic acid sequence set forth in SEQ ID NO:7; (ii) CcUGT2 having the nucleic acid sequence set forth in SEQ ID NO:9; (iii) CcUGT3 having the nucleic acid sequence set forth in SEQ ID NO:11; (iv) CcUGT4 having the nucleic acid sequence set forth in SEQ ID NO:13; (v) CcUGT5 having the nucleic acid sequence set forth in SEQ ID NO:15; (vi) CcAT1 having the nucleic acid sequence set forth in SEQ ID NO:17; (vii) CcAT2 having the nucleic acid sequence set forth in SEQ ID NO:19; (viii) CcFLS having the nucleic acid sequence set forth in SEQ ID NO:21; (ix) CcCYP2 having the nucleic acid sequence set forth in SEQ ID NO:23; (x) CcMYB4 having the nucleic acid sequence set forth in SEQ ID NO:25; (xi) P19 having the nucleic acid sequence set forth in SEQ ID NO:27; (xii) Cc4CL1 having the nucleic acid sequence set forth in SEQ ID NO:29; and (xiii) Cc4CL2 having the nucleic acid sequence set forth in SEQ ID NO:75; (b) a nucleotide sequence that encodes encoding one or more of the following polypeptides: (i) CcUGT1 having the amino acid sequence set forth in SEQ ID NO:8; (ii) CcUGT2 having the amino acid sequence set forth in SEQ ID NO:10; (iii) CcUGT3 having the amino acid sequence set forth in SEQ ID NO:12; (iv) CcUGT4 having the amino acid sequence set forth in SEQ ID NO:14; (v) CcUGT5 having the amino acid sequence set forth in SEQ ID NO:16; (vi) CcAT1 having the amino acid sequence set forth in SEQ ID NO:18; (vii) CcAT2 having the amino acid sequence set forth in SEQ ID NO:20; (viii) CcFLS having the amino acid sequence set forth in SEQ ID NO:22; (ix) CcCYP2 having the amino acid sequence set forth in SEQ ID NO:24; (x) CcMYB4 having the amino acid sequence set forth in SEQ ID NO:26; (xi) P19 having the amino acid sequence set forth in SEQ ID NO:28; and (xii) Cc4CL1 having the amino acid sequence set forth in SEQ ID NO:30; (xiii) Cc4CL2 having the amino acid sequence set forth in SEQ ID NO:76; or (c) a nucleotide sequence that encodes a polypeptide having at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 8, 10, 12, 14,16, 18, 20, 22, 24, 26, 28, and 30, wherein the polypeptide has UGT1; UGT2; UGT3; UGT4; UGT5; AT1; AT2; FLS; CYP2; MYB4; P19; 4CL1; or 4CL2 activity.

19. The method of claim 17 or 18, wherein the cell has a skikimate pathway.

20. The method of claim 17, 18, or 19, wherein the gene expression construct is a multigene construct.

21. The method of claim 20, wherein the multigene construct has a nucleotide sequence one or more of the following: (i) SEQ ID NO:87; (ii) SEQ ID NO:88; (iii) SEQ ID NO:89; (iv) SEQ ID NO:90; and (v) SEQ ID NO:

91.

22. The method of any one of claims 17-21, wherein the coding sequences are operably linked to a functional promoter and a functional terminator.

23. The method of any one of claims 17-22, wherein the gene expression construct further comprises, a 5’ UTR and a 3’ UTR.

24. The method of any one of claims 17-23, wherein the gene expression construct encodes a functional translation initiation site and a functional translation termination site.

25. The method of any one of claims 17-24, wherein the gene expression construct is suitable for the expression of the polypeptides in a bacteria, an archaea, an algae, a yeast, a plant, a plant part, or a plant cell, having a shikimate pathway.

26. The method of any one of claims 17-24, wherein the gene expression construct forms part of a plasmid or viral vector.

27. The method of any one of claims 17-26, wherein the gene expression construct transiently transfects or stably transfects the cell.

28. The method of claim 27, wherein the cell is a bacteria, an archaea, an algae, a yeast, a plant, a plant part, or a plant cell.

29. The method of any one of claims 17-28, wherein the gene expression construct is for transfection of Nicotiana benthamiana.

30. The method of any one of claims 17-28, wherein the gene expression construct is for transfection of Saccharomyces cerevisiae.

31. The method of any one of claims 17-28, wherein the gene expression construct is for transfection by Agrobacterium tumefaciens.

32. A method for producing MbA in a plant, the method comprising: introducing the gene expression construct of any one of claims 1-16 into a plant cell of the plant, whereby MbA is produced by the plant.

33. A recombinant host that produces montbretin A (MbA) precursor or montbretin A (MbA) in a cell, comprising: (a) a gene encoding CcHCT having the nucleic acid sequence set forth in SEQ ID NO:1; a gene encoding CcCSE having the nucleic acid sequence set forth in SEQ ID NO:3; and CcC3’H having the nucleic acid sequence set forth in SEQ ID NO:5; or (b) a nucleotide sequence that encodes one or more of the following polypeptides: (i) CcHCT having the amino acid sequence set forth in SEQ ID NO:2; (ii) CcCSE having the amino acid sequence set forth in SEQ ID NO:4; and (iii) CcC3’H having the amino acid sequence set forth in SEQ ID NO:6; or (c) a nucleotide sequence that encodes one or more of the following polypeptides: (i) CcHCT; (ii) CcCSE; and (iii) CcC3’H; having at least 65% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 2, 4, and 6.

34. The recombinant host of claim 33, wherein the cell further comprises one or more gene expression constructs comprising: (a) a nucleotide sequence encoding one or more of the following: (i) CcUGT1 having the nucleic acid sequence set forth in SEQ ID NO:7; (ii) CcUGT2 having the nucleic acid sequence set forth in SEQ ID NO:9; (iii) CcUGT3 having the nucleic acid sequence set forth in SEQ ID NO:11; (iv) CcUGT4 having the nucleic acid sequence set forth in SEQ ID NO:13; (v) CcUGT5 having the nucleic acid sequence set forth in SEQ ID NO:15; (vi) CcAT1 having the nucleic acid sequence set forth in SEQ ID NO:17; (vii) CcAT2 having the nucleic acid sequence set forth in SEQ ID NO:19; (viii) CcFLS having the nucleic acid sequence set forth in SEQ ID NO:21; (ix) CcCYP2 having the nucleic acid sequence set forth in SEQ ID NO:23; (x) CcMYB4 having the nucleic acid sequence set forth in SEQ ID NO:25; (xi) P19 having the nucleic acid sequence set forth in SEQ ID NO:27; (xii) Cc4CL1 having the nucleic acid sequence set forth in SEQ ID NO:29;and (xiii) Cc4CL2 having the nucleic acid sequence set forth in SEQ ID NO:75; (b) a nucleotide sequence that encodes encoding one or more of the following polypeptides: (i) CcUGT1 having the amino acid sequence set forth in SEQ ID NO:8; (ii) CcUGT2 having the amino acid sequence set forth in SEQ ID NO:10; (iii) CcUGT3 having the amino acid sequence set forth in SEQ ID NO:12; (iv) CcUGT4 having the amino acid sequence set forth in SEQ ID NO:14; (v) CcUGT5 having the amino acid sequence set forth in SEQ ID NO:16; (vi) CcAT1 having the amino acid sequence set forth in SEQ ID NO:18; (vii) CcAT2 having the amino acid sequence set forth in SEQ ID NO:20; (viii) CcFLS having the amino acid sequence set forth in SEQ ID NO:22; (ix) CcCYP2 having the amino acid sequence set forth in SEQ ID NO:24; (x) CcMYB4 having the amino acid sequence set forth in SEQ ID NO:26; (xi) P19 having the amino acid sequence set forth in SEQ ID NO:28; and (xii) Cc4CL1 having the amino acid sequence set forth in SEQ ID NO:30; (xiii) Cc4CL2 having the amino acid sequence set forth in SEQ ID NO:76; or (c) a nucleotide sequence that encodes a polypeptide having at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NOs: 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, and 30, wherein the polypeptide has UGT1; UGT2; UGT3; UGT4; UGT5; AT1; AT2; FLS; CYP2; MYB4; P19; 4CL1; or 4CL2 activity.

35. The recombinant host of claim 33 or 34, wherein the recombinant host is a plant, plant part, or plant cell.

36. The recombinant host of claim 35, wherein the plant is Nicotiana benthamiana.

37. The recombinant host of claim 33 or 34, wherein the recombinant host is a yeast.

38. The recombinant host of claim 37, wherein the yeast is Saccharomyces cerevisiae.

39. The recombinant host of any one of claims 34-38, wherein the recombinant host produces montbretin A (MbA) and / or at least one precursor thereof.

Images