Varicella-zoster virus mRNA vaccine and use thereof

Abstract

A varicella-zoster virus mRNA vaccine and the use thereof. First provided is a mRNA molecule, an encoding region sequence of the mRNA molecule comprising a nucleotide sequence that encodes an amino acid sequence shown as SEQ ID NO: 1, and the encoding region sequence preferably comprising a nucleotide sequence shown as any one of SEQ ID NO: 2 to SEQ ID NO: 11, or a nucleotide sequence which has at least 93% similarity as a nucleotide sequence shown as any one of SEQ ID NO: 2 to SEQ ID NO: 11 and encodes an amino acid sequence same as that encoded by said nucleotide sequence. Using the mRNA molecule for preparing vaccines can reduce the production cost of the vaccines and enable the vaccines to have stable physical and chemical properties. In addition, improving the protein expression enhances the immune effect of vaccines, and therefore enhances VZV-gE-specific humoral immunity and cellular immunity effects.

Description

Varicella-zoster virus mRNA vaccine and its application Technical Field

[0001] The present invention relates to a varicella-zoster virus mRNA vaccine and application thereof. Background Art

[0002] Varicella-zoster virus (VZV) is a highly contagious alphaherpesvirus. It manifests as oval particles approximately 150-200 nm in diameter, containing a linear double-stranded DNA molecule encapsidated by an icosahedral nucleocapsid. The nucleocapsid is enveloped by a lipoprotein membrane containing nine glycoproteins: gE, gI, gC, gH, gL, gB, gK, gM, and gN. These glycoproteins are involved in viral infection, replication, assembly, and intercellular transmission. During primary infection, VZV enters local lymph nodes through the respiratory mucosal epithelium and replicates. Infected lymphocytes then enter the bloodstream via the lymphatic system and infect peripheral blood mononuclear leukocytes. The virus then spreads through the bloodstream to the skin, resulting in the clinical manifestation of varicella. After recovery from varicella, the virus remains latent in cranial ganglia, dorsal root ganglia of the spinal cord, autonomic neurons, or enteric neurons. When the body's resistance is reduced, the latent virus is reactivated, replicates, and migrates along the peripheral nerves to the skin, clinically manifesting as herpes zoster.

[0003] There is currently no specific treatment for varicella and herpes zoster. Treatment primarily focuses on symptomatic management, with antiviral medications such as acyclovir, famciclovir, and valacyclovir. While medication can help patients recover quickly from varicella and herpes zoster, it cannot eliminate the virus or prevent undetectable infections. Vaccination is currently the most effective means of preventing and controlling herpes zoster and its complications. Three vaccines are currently approved for marketing: two are live attenuated vaccines and one is a subunit vaccine.

[0004] In 2005, Merk introduced a single, high-dose, live-attenuated Oka strain vaccine to prevent herpes zoster in people aged 50 and older infected with VZV. This vaccine was 60%-70% effective in preventing herpes zoster. However, it required a high dose of antigen and exhibited poor immunogenicity, particularly poor cellular immunity. Its efficacy gradually decreased with age, and its live-attenuated nature limited its use in immunosuppressed individuals and pregnant women. Consequently, by July 2020, this vaccine had been completely replaced by subunit vaccines.

[0005] Shingrix, a herpes zoster subunit vaccine launched by GSK in 2017, uses the conserved viral glycoprotein E (gE protein) expressed by CHO cells as an antigen and is composed of the AS01B adjuvant. It is approved for the prevention of herpes zoster and post-healing neuralgia in people over 50 years old. gE is most abundant in the viral envelope and is the most important glycoprotein recognized by the immune system. It is present on the surface of viral particles and the surface and cytoplasm of infected cells. It is an essential glycoprotein for the production of infectious viral particles. Cellular immunity and humoral immunity induced by it as the main target can protect animals from viral attacks, making it an important target of immunity. The full-length gE is generally 623 amino acids, including a hydrophilic extracellular region (including a signal peptide), a hydrophobic transmembrane region, and an intracellular tail. The Shingrix vaccine uses a truncated gE. The vaccine has an efficiency of 97.2% in preventing herpes zoster. The AS01B adjuvant contains two immunostimulants, MPLA and QS-21. QS-21 is a polysaccharide mixture extracted only from the bark of the soapberry tree, which grows in temperate South America. Currently, it cannot be synthesized artificially, resulting in limited sources and difficult quality control during the preparation process. Furthermore, it is hemolytic and requires liposomes to eliminate its side effects. The Shingrix instructions for use state that the adjuvant must be temporarily mixed with the antigen, suggesting that the stability of this liposome system for vaccine use needs to be further improved.

[0006] Summary of the Invention

[0007] One object of the present invention is to provide a varicella-zoster virus vaccine that reduces the production cost of the vaccine, stabilizes the physical and chemical properties of the vaccine itself, enhances the immune effect of the vaccine by improving protein expression, and / or enhances the humoral and cellular immunity specific to VZV-gE.

[0008] Another object of the present invention is to provide applications of the vaccine.

[0009] According to some embodiments of the present invention, the present invention provides an mRNA molecule, the nucleotide coding region sequence of which comprises:

[0010] The nucleotide sequence shown in any one of SEQ ID NO: 2 to SEQ ID NO: 11; or

[0011] A nucleotide sequence that is at least 93% similar, at least 95% similar, at least 98% similar, or at least 99% similar to the nucleotide sequence of any one of SEQ ID NO: 2 to SEQ ID NO: 11 and encodes the same amino acid sequence.

[0012] According to some specific embodiments of the present invention, the mRNA molecule of the present invention has one or more of the following modifications:

[0013] Modified with 1-methylpseudouridine;

[0014] After 3' tailing modification;

[0015] After at least one 5' capping modification;

[0016] Include at least one 5'UTR sequence;

[0017] Includes at least one 3'UTR sequence.

[0018] According to some specific embodiments of the present invention, in the mRNA molecule of the present invention, the 5' cap structure of the modified cap is selected from one or more of Cap1, Cap2(38), Cap2(2-1), Cap2(2-2), Cap2(2-6), Cap2(2-48), and Cap2(2-51). The chemical formulas of the cap structures are shown in Table 2.

[0019] According to some embodiments of the present invention, the present invention further provides an mRNA molecule, which includes a coding region sequence, and further includes: a 5' cap structure, a 5'UTR sequence, a 3'UTR sequence and a PloyA tail sequence;

[0020] Wherein, the coding region sequence includes a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1; preferably, the coding region sequence is selected from the nucleotide sequence shown in any one of SEQ ID NO: 2 to SEQ ID NO: 11, or is selected from a nucleotide sequence having at least 93% similarity, at least 95% similarity, at least 98% similarity or at least 99% similarity to the nucleotide sequence shown in any one of SEQ ID NO: 2 to SEQ ID NO: 11;

[0021] The 5' cap structure is selected from one or more of Cap1, Cap2(38), Cap2(2-1), Cap2(2-2), Cap2(2-6), Cap2(2-48), and Cap2(2-51). The chemical formulas of the cap structures are shown in Table 2.

[0022] According to some specific embodiments of the present invention, in the mRNA molecule of the present invention, the 5'UTR sequence includes the nucleotide sequence shown in SEQ ID NO:12.

[0023] According to some specific embodiments of the present invention, in the mRNA molecule of the present invention, the 3'UTR sequence includes the nucleotide sequence shown in SEQ ID NO:13.

[0024] According to some specific embodiments of the present invention, in the mRNA molecule of the present invention, the PloyA tail sequence includes the nucleotide sequence shown in SEQ ID NO:14.

[0025] According to some embodiments of the present invention, the present invention further provides a DNA molecule that can be transcribed in vitro into the mRNA molecule of the present invention.

[0026] According to some embodiments of the present invention, the present invention further provides a recombinant plasmid containing the DNA molecule of the present invention.

[0027] According to some embodiments of the present invention, the present invention also provides a lipid nanoparticle loaded with the mRNA molecule of the present invention.

[0028] According to some embodiments of the present invention, the present invention further provides a pharmaceutical composition comprising: an mRNA molecule according to the present invention, and a pharmaceutically acceptable excipient. The excipient may be selected from a solvent, an aqueous solvent, a non-aqueous solvent, a dispersion medium, a diluent, a dispersant, a suspending aid, a surfactant, an isotonic agent, a thickener or emulsifier, a preservative, a lipid, a lipidoid liposome, a lipid nanoparticle, a core-shell nanoparticle, a polymer, a lipoplex peptide, a protein, a cell, a hyaluronidase, and mixtures thereof.

[0029] According to some embodiments of the present invention, the present invention also provides the use of the mRNA molecule, the DNA molecule, the recombinant plasmid, the lipid nanoparticle or the pharmaceutical composition in the preparation of a herpes zoster mRNA vaccine.

[0030] According to some embodiments of the present invention, the present invention also provides a herpes zoster mRNA vaccine, which comprises the mRNA molecule described in the present invention.

[0031] In some specific embodiments of the present invention, the vaccine is in the form of lipid nanoparticles.

[0032] According to a specific embodiment of the present invention, in the vaccine of the present invention, the particle size of the lipid nanoparticles is 50nm to 200nm, preferably 50nm to 150nm.

[0033] According to a specific embodiment of the present invention, the vaccine of the present invention is in a freeze-dried dosage form or a frozen dosage form.

[0034] According to a specific embodiment of the present invention, the vaccine of the present invention is a subcutaneous or intramuscular vaccine.

[0035] According to a specific embodiment of the present invention, in the vaccine of the present invention, the lipid nanoparticles include mRNA and lipid LNPs, wherein the lipid LNPs include one or more of cationic lipids, supporting lipids, sterols, and polymer-conjugated lipids.

[0036] According to a specific embodiment of the present invention, in the vaccine of the present invention, the cationic lipids include but are not limited to one or more of 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl) azadiyl) bis(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), 8-((7-((3-(hexylthio)-2-methylpropionyl)oxy)n-heptyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanol (T19, see Table 5 for the structural formula), and 8-((5-((3-(octylthio)-2-methylpropionyl)oxy)n-pentyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanol (T13, see Table 5 for the structural formula).

[0037] According to a specific embodiment of the present invention, in the vaccine of the present invention, the polymer-conjugated lipid includes but is not limited to PEG-modified lipids, such as one or more of PEG-DMG, ALC0159, PEG-DSPE, and PEG-DSG.

[0038] According to a specific embodiment of the present invention, in the vaccine of the present invention, the supporting phospholipids (or neutral auxiliary lipids) include but are not limited to one or more of DSPC, DOPE, DOPC, and DOPS.

[0039] According to a specific embodiment of the present invention, in the vaccine of the present invention, the sterol substances include but are not limited to one or more of cholesterol and β-sitosterol.

[0040] According to a specific embodiment of the present invention, in the vaccine of the present invention, based on the total molar amount of lipids as 100%, the molar ratio of each lipid component is: cationic lipids 35%-57.5%, supporting lipids 5%-16%, sterol substances 27.5%-55%, polymer-conjugated lipids 0-3%, preferably 0.5%-2.5%.

[0041] According to a specific embodiment of the present invention, the mRNA vaccine of the present invention further includes an excipient; the excipient may be, for example, an aqueous solution of salt and sugar. Specifically, the salt is selected from one or more of citrate, acetate, phosphate, or Tris salt; and the sugar is selected from one or more of sucrose and trehalose. More specifically, in the vaccine product, the excipient salt concentration is 5mM to 50mM, more preferably 5mM to 25mM; and the excipient sugar concentration is 5% to 20% w / v.

[0042] According to a specific embodiment of the present invention, the pH of the mRNA vaccine of the present invention is 6.5 to 8.5, preferably 7.0 to 8.0.

[0043] According to a specific embodiment of the present invention, the vaccine is used to prevent and / or ameliorate varicella, herpes zoster, and / or postherpetic neuralgia. The vaccine can effectively induce specific humoral immunity and stimulate CD4+ cellular immune responses, enhancing long-term protection. It also reduces the use of adjuvants, improving safety, and reducing side effects.

[0044] According to some embodiments of the present invention, the present invention also provides a method for preparing the mRNA vaccine, which includes a process for preparing the mRNA molecule. Specifically, it includes the following steps:

[0045] Synthesizing a DNA fragment encoding the amino acid sequence shown in SEQ ID NO: 1, for example, a nucleotide sequence shown in any one of SEQ ID NO: 2 to SEQ ID NO: 11;

[0046] The DNA fragment is cloned into a plasmid as a template and transcribed to prepare the target mRNA molecule.

[0047] In some specific embodiments of the present invention, a method for preparing the mRNA molecule is provided, wherein the process of synthesizing a DNA fragment encoding the amino acid sequence shown in SEQ ID NO: 1 can be synthesized in-house or commissioned. The DNA fragment is cloned into a plasmid as a template, and the target mRNA molecule can be prepared according to the following reaction:

[0048] a. Three-step method: Uncapped and untailed mRNA is obtained by in vitro transcription. A polyA structure (a linker may or may not be inserted in the middle of the polyA structure) is added to the tail of the mRNA in the presence of RNA polymerase and ATP. A capping enzyme is then used to catalyze the addition of a cap to the 5' end of the uncapped mRNA, yielding a capped and tailed mRNA molecule.

[0049] b. Two-step method: in vitro transcription to obtain tailed but uncapped mRNA; under the catalysis of capping enzyme, a cap structure is added to the 5' end of the uncapped mRNA to obtain a capped and tailed mRNA molecule;

[0050] c. One-step method: perform in vitro transcription and capping to obtain capped and tailed mRNA molecules.

[0051] In some specific embodiments of the present invention, the method for preparing the mRNA molecule further comprises an mRNA purification process: subjecting the mRNA to lithium chloride / ethanol precipitation, centrifugal column, chloride extraction / ethanol precipitation or gel purification to obtain purified mRNA.

[0052] According to a specific embodiment of the present invention, the method for preparing the mRNA vaccine of the present invention further includes:

[0053] The prepared mRNA molecules are dissolved in an aqueous phase consisting of a citric acid buffer, and are mixed with lipid components dissolved in an ethanol phase using a microfluidics or impact jet method to prepare lipid nanoparticles loaded with mRNA.

[0054] According to a specific embodiment of the present invention, the method for preparing the mRNA vaccine of the present invention also includes a process of making the prepared lipid nanoparticles into a frozen preparation or a freeze-dried preparation.

[0055] In summary, the herpes zoster mRNA vaccine described in this invention can be prepared by in vitro transcription, effectively reducing production costs compared to live attenuated and subunit protein vaccines. Furthermore, its freeze-dried formulation increases stability and shelf life at room temperature, significantly reducing transportation costs and improving accessibility. The vaccine itself has stable physical and chemical properties, and the production process is simple and standardized, saving time and costs.

[0056] Experimental studies of the present invention have shown that the herpes zoster mRNA vaccine of the present invention can have a self-adjuvant effect without the addition of additional adjuvants. It can be activated by Toll-like receptor 7 / 8 (TLR7 / 8), and the activated receptors are transmitted by downstream molecular signals, such as Myd88, and ultimately produce IFN-γ and other pro-inflammatory factors such as IL-2. These signal pathways activate and promote different innate immune responses to induce specific immune responses against pathogens.

[0057] The herpes zoster mRNA vaccine described in the present invention further improves the stability of mRNA through modifications such as 5' capping, introduction of 3' end PolyA sequence, and pseudouridine replacement, effectively reducing the body's recognition of exogenous mRNA, and reducing the degradation rate by regulating the activity of RNaseI, increasing translation efficiency, and improving protein expression to enhance the vaccine's immune effect.

[0058] The herpes zoster mRNA vaccine described in the present invention can increase its distribution in immune organs, such as lymph nodes and spleen, and increase the chance of contact with APC antigen-presenting cells and T cells. It is recognized by CD4+ helper T cells through presentation, and B cells interact with Th to produce specific antibodies and factors, thereby generating a dual response of humoral immunity and cellular immunity, enhancing the VZV-gE-specific humoral immunity and cellular immunity effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 shows the effect of sequence optimization of Seq ID No. 2 to 11 on the expression level of gE protein.

[0060] Figure 2 shows the effects of mRNA-LNPs formed by mRNA with different capping methods on the expression levels of gE-specific binding antibodies and CD4+ cytokines in the cap analog experiment.

[0061] FIG3 shows the effects of different delivery vectors on gE-specific binding antibodies and CD4+ cytokine expression levels in the delivery vector experiment.

[0062] FIG4 shows the effect of freeze-dried mRNA-LNP on the expression levels of gE-specific binding antibodies and CD4+ cytokines. DETAILED DESCRIPTION

[0063] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be understood as limiting the scope of the present invention. The experimental methods in each embodiment without specifying specific conditions are operated according to conventional conditions in the relevant field. The starting reagents and materials used in the examples can be obtained commercially or prepared with reference to the existing technology in the field.

[0064] The corresponding relationship between the amino acid and nucleotide sequences used in each example and the sequence listing is as follows:

[0065] Amino acid sequence derived from mutation of herpes zoster virus glycoprotein E: SEQ ID NO: 1;

[0066] Sequence eight: SEQ ID NO: 2;

[0067] Sequence 1: SEQ ID NO: 3;

[0068] Sequence 2: SEQ ID NO: 4;

[0069] Sequence 3: SEQ ID NO: 5;

[0070] Sequence 4: SEQ ID NO: 6;

[0071] Sequence 5: SEQ ID NO: 7;

[0072] Sequence 6: SEQ ID NO: 8;

[0073] Sequence 7: SEQ ID NO: 9;

[0074] Sequence 9: SEQ ID NO: 10;

[0075] Sequence ten: SEQ ID NO:11.

[0076] Example 1: Vaccines with different mRNA sequences

[0077] Using SM102:Cholesterol:DSPC:PEG2k -DMG was dissolved in anhydrous ethanol at a ratio of 50:38.5:10:1.5 to prepare organic phase A (average lipid concentration was 10 mg / ml), and mRNAs transcribed from sequences in SEQ ID No. 2 to 11 were selected (each mRNA was modified with 100% mlψ, and the 5' cap structure was Cap2 (2-6) as shown in Table 2), 5'UTR sequence: AGGGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC (SEQ ID NO: 12), 3'UTR sequence: CTGCCTTCTGCGGGGCTTGCCTTCTGGCCATG CCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG (SEQ ID NO: 13), and PloyA tail sequence: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO:14) was dissolved in a pH 4.0 citric acid / sodium citrate buffer to form aqueous phase B (mRNA concentration was 0.54 mg / ml). mRNA-LNPs were prepared using a microfluidic device in a 1:3 volume ratio of solution A:solution B. After preparation, the mRNA was dialyzed against 20 mM Tris buffer for 24 hours, with the buffer replaced every 8 hours. After 24 hours, the solution was sterilized by filtering through a 0.22 μm filter membrane to obtain the herpes zoster vaccine.

[0078] The prepared vaccine was transfected into 293T cells, and western samples were prepared 24 hours after transfection. First, discard the culture medium, rinse three times with 2-3 ml PBS, and discard. Then add lysis buffer for lysis, gently scrape the bottom with a scraper, transfer the sample to an EP tube, and then centrifuge. The centrifugation conditions are: 13500r / min, 4℃ centrifugation for 15min. Transfer the supernatant to a new EP tube. Use the BCA kit (Biyuntian Biotechnology Co., Ltd.) to detect the protein concentration, and add lysis buffer to adjust according to the concentration. Finally, add loading buffer, boil at 100℃ for 8min, and store frozen at -20℃.

[0079] The sample was added to the SDS-PAGE gel prepared in advance, connected to the electrode for running, and transferred to a PVDF membrane after running. Anti-gE protein antibody (abcam, ab272686) was added. After incubation at 4°C overnight, the primary antibody was recovered and the membrane was washed with TBST solution three times for 10 minutes each time. Then, goat anti-mouse secondary antibody (Proteintech, SA00001-1) was added and incubated at room temperature for 1 hour. The membrane was then washed with TBST three times for 10 minutes each time. Finally, ECL color developer was used for development to detect the expression level of gE protein.

[0080] The results are shown in Figure 1 and Table 1.

[0081] Table 1. Expression ratios of gE proteins with different sequences

[0082] Example 2: Vaccines with different capping methods

[0083] SEQ ID NO: 2 (i.e., sequence eight) was used as the target sequence. Different cap analogs were used during in vitro transcription, namely Cap1 (CleanCap AG, Shanghai Zhaowei Technology Co., Ltd.), Cap2 (38), Cap2 (2-1), Cap2 (2-2), Cap2 (2-6), Cap2 (2-48), and Cap2 (2-51) to form different mRNAs. Each mRNA was modified with 100% m1ψ, 5'UTR, 3'UTR, and 3'Poly A tail as in Example 1.

[0084] The specific structures of each cap are shown in Table 2. In addition to commercially available products, each cap analog can also be synthesized according to the methods described in CN202310391954.9 and / or CN118373866A (CN202310091020.3), the entire contents of which are incorporated herein by reference. For example, Cap2 (2-6) can be synthesized as follows:

[0085] Table 2. Names and structures of different cap analogs

[0086] Using T19:Cholesterol:DSPC:PEG 2k-DMG was dissolved in anhydrous ethanol at a ratio of 50:38.5:10:1.5 to form organic phase A (average lipid concentration of 10 mg / ml). The mRNA transcribed from SEQ ID NO: 2 was selected (modified with different cap analogs from Table 2 during in vitro transcription, and modified with 100% mlψ as in Example 1, with the same 5'UTR, 3'UTR, and 3'PolyA tail added). It was dissolved in citric acid / sodium citrate buffer at pH 4.0 to form aqueous phase B (mRNA concentration of 0.54 mg / ml). mRNA-LNPs were prepared using a microfluidic device at a volume ratio of 1:3 for solution A:solution B. After preparation, the mRNA was dialyzed against 20 mM Tris buffer for 24 h, with the buffer replaced every 8 h. After 24 h, the mRNA-LNPs were sterilized by filtering through a 0.22 μm filter membrane to obtain mRNA-LNPs. C57 mice (10 / group, female, 8 weeks old at first immunization, weighing 18-22 g) were set up in experimental and blank control groups. Two weeks after the experimental groups, C57 mice were immunized twice with intramuscular injections of LNP containing 5 μg of the above-mentioned different mRNAs. Two weeks after each immunization, blood was collected from the orbits of the experimental and control mice, and the serum was centrifuged and stored at -20 degrees Celsius for later use. Two weeks after the second immunization, the spleens of the experimental and control mice were removed for later use.

[0087] The above-mentioned experimental group mouse serum was diluted to a gradient of 10000x, 20000x, 40000x, 80000x, 160000x, 320000x, and 640000x, and added to the Elisa plate pre-coated with standard gE protein together with the serum of the negative control group. 100 μL of each sample was taken, and three parallel wells were made. The plates were sealed with sealing film and incubated at 4°C for 2 h. Remove the 96-well plate after primary antibody incubation, discard the primary antibody solution, and pat dry on absorbent paper until no residue remains. Add 100 μL of diluted secondary antibody (Goat pab to Ms IgG (HRP), 1:50,000) to each well of the 96-well plate. Seal the plate with film and incubate at room temperature in the dark for 1 hour. Remove the ELISA plate after secondary antibody incubation, discard the secondary antibody solution, and pat dry on absorbent paper until no residue remains. At room temperature in the dark, remove the disposable sample reservoir and pour TMB (3,3′,5,5′-Tetramethylbenzidine) solution into the reservoir. Use a dispenser to add 100 μL of TMB to each well. Develop the plate at room temperature in the dark for 20 minutes, at which point positive samples will develop a blue color. Record the addition and development times for each plate to ensure consistent incubation times. After color development is completed, add 100 μL Stop Solution to each well using a dispenser. The sample will now turn yellow and its absorbance will be measured at 450 nm. Read the plate within two minutes after adding the Stop Solution to each ELISA plate.

[0088] Add mouse lymphocyte separation solution to a six-well plate, place a 70μm cell sieve, place the spleen of the immunized mouse on the sieve, grind the spleen with a syringe piston until it becomes colorless, draw the lower cell suspension into a 15ml centrifuge tube, slowly add 1ml RPMI1640 medium to the cell suspension layer (do not break the interface), centrifuge at 800g for 30min at room temperature (3 up and 3 down), draw the lymphocyte layer, add 10mL RPMI-1640, centrifuge at 350g for 10min at room temperature, discard the supernatant, and resuspend in 2mL RPMI-1640 complete medium (+10% inactivated serum + 1% double antibody) to prepare spleen cell fluid. Spleen cells were added to the cell culture 2×10 6 Each well was filled with culture medium to 200 μL, and the corresponding peptide library (2 μg / mL) or an equal volume of solvent was added for stimulation; after standing in a 37°C carbon dioxide incubator for 1 hour, 0.4 μL of protein transport inhibitor was added to each well, and the cells were cultured at 37°C for 5 hours and stored at 4°C overnight. Then, the cells in the well plate were aspirated into a 2 mL centrifuge tube, centrifuged at 350 g, 4°C for 5 min, the supernatant was discarded, 100 μL of Zombie staining solution was added to each well, the centrifugation was continued and the supernatant was discarded, and 1% BSA PBS containing anti-mouse CD16 / CD32 (Biolegend) mAb, 50 μL of anti-mouse CD3 (Biolegend), anti-mouse CD4 (Biolegend), and anti-mouse CD8 (Biolegend) were added in sequence, 150 μL of Fixation / Permeabilization solution (Biolegend), and a mixture of anti-mouse IFN-γ (Biolegend) and anti-mouse IL-2 (Biolegend) were added. The supernatant was discarded after each step of the centrifugation. Finally, 200 μL of PBS containing 1% BSA was added and detected by flow cytometry. The CD3 cytometry results of peptide-stimulated and unstimulated cells were recorded. + CD4 + IFN-γ + 、CD3 + CD8 + IFN-γ + 、CD3 + CD4 + IL-2 + 、CD3 + CD8 + IL-2 + The cell ratios were calculated and processed using CytExpert 2.4 software.

[0089] The results are shown in Figure 2 and Tables 3 and 4.

[0090] Table 3. Expression levels of different cap mRNA experiments combined with antibodies

[0091] Table 4. Experiments with different cap mRNAs IL2 + IFN-g + CD4 + T cell factor levels

[0092] Example 3: Vaccines with different carriers

[0093] T13 and T19 were selected as cationic lipids, and LNPs with different proportions were formed based on the cationic lipids, cholesterol, DSPC, and PEG-DMG. The groups were named T13-3 (T13:DSPC:PEG-DMG:CHOL=48:9.5:2:40.5), T13-5 (T13:DSPC:PEG-DMG:CHOL=48:16:1.5:34.5), T19-5 (T19:DSPC:PEG-DMG:CHOL=48:16:1.5:34.5), T13-6 (T13:DSPC:PEG-DMG:CHOL=48:16:2:34), and T19-6 (T19:DSPC:PEG-DMG:CHOL=48:16:2:34). The lipids were dissolved in anhydrous ethanol according to the designed ratio to form solution A. The mRNA transcribed from SEQ ID NO: 2 (modified with a Cap2 (2-6) cap analog during in vitro transcription and modified with 100% mlψ as in Example 1, with the same 5'UTR, 3'UTR, and 3'PolyA tail) was dissolved in a citric acid / sodium citrate buffer at pH = 4.0 to form aqueous phase B (mRNA concentration was 0.54 mg / ml). The mRNA-LNP was prepared using a microfluidic device at a volume ratio of 1:3 for solution A:solution B. After preparation, the mRNA was dialyzed against 20 mM Tris buffer for 24 h, and the solution was replaced every 8 h. After 24 h, the mRNA-LNP was sterilized by filtering through a 0.22 μm filter membrane to obtain the mRNA-LNP. C57 mice (10 / group, female, 8 weeks of age for primary immunization, weighing 18-22 g) were set up in experimental and blank control groups. The experimental group was immunized once with 5 μg of mRNA by intramuscular injection of the above-mentioned different LNP vectors. Two weeks after immunization, blood was collected from the orbits of the experimental and control mice, and the serum was centrifuged and stored at -20 degrees Celsius for later use. The spleens were removed for later use, and the binding antibodies and T cell factor detection were performed according to the procedures in Example 2.

[0094] The structural diagrams of T13 and T19 are shown in Table 5.

[0095] Table 5. Cationic lipid structures

[0096] The results are shown in Figure 3, Table 6 and Table 7.

[0097] Table 6. Antibody expression levels in different vector experiments

[0098] Table 7. Experimental IL2 with different vectors + IFN-g + CD4 + T cell factor levels

[0099] Example 4

[0100] The vaccine containing the T13-5 vector in Example 3 was selected and freeze-dried to form a freeze-dried preparation. The samples before and after freeze-drying of the commercial vector (ALC0315:DSPC:cholesterol:PEG-DMG=46.3:9.4:42.7:1.6) and the samples before and after freeze-drying of the T13-5 vector were compared. The animal experiments were as follows: C57 mice (10 mice / group, female, 8 weeks of age for primary immunization, weighing 18-22 g) were immunized once with T13-5 or commercial LNP containing 5 μg mRNA before and after freeze-drying. Three weeks after immunization, blood was collected from the orbits and centrifuged to obtain serum, which was stored at -20 degrees Celsius for future use. The spleen was also removed for future use.

[0101] The binding antibody and T cell factor detection were performed according to the procedure of Example 2.

[0102] The results are shown in Figure 4, Table 8 and Table 9.

[0103] Table 8. Expression levels of binding antibodies before and after lyophilization

[0104] Table 9. IL2 before and after lyophilization + IFN-g + CD4 + T cell factor levels

[0105] The research results of this example prove that the freeze-dried dosage form of the herpes zoster candidate vaccine is achievable.

Claims

1. An mRNA molecule, the coding region sequence of which comprises: A nucleotide sequence as shown in any one of SEQ ID NO:2 to SEQ ID NO:11; or A nucleotide sequence that has at least 93% similarity, at least 95% similarity, at least 98% similarity or at least 99% similarity to the nucleotide sequence shown in any one of SEQ ID NO:2 to SEQ ID NO:11 and encodes the same amino acid sequence.

2. The mRNA molecule according to claim 1, wherein The mRNA has one or more of the following modifications: Modified with 1-methylpseudouridine; After 3' tailing modification; After at least one 5' capping modification; preferably, the cap structure of the 5' capping modification is selected from one or more of Cap1, Cap2 (38), Cap2 (2-1), Cap2 (2-2), Cap2 (2-6), Cap2 (2-48), Cap2 (2-51); including at least one 5'UTR sequence; Includes at least one 3'UTR sequence.

3. An mRNA molecule comprising a coding region sequence, further comprising: 5' cap structure, 5' UTR sequence, 3' UTR sequence, and PloyA tail sequence; Wherein, the coding region sequence includes a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1; Wherein, the 5' cap structure is selected from one or more of Cap1, Cap2(38), Cap2(2-1), Cap2(2-2), Cap2(2-6), Cap2(2-48), and Cap2(2-51); Preferably, the 5'UTR sequence comprises the nucleotide sequence shown in SEQ ID NO: 12; Preferably, the 3'UTR sequence comprises the nucleotide sequence shown in SEQ ID NO: 13; Preferably, the PloyA tail sequence includes the nucleotide sequence shown in SEQ ID NO:

14.

4. A DNA molecule which can be transcribed in vitro into the mRNA molecule according to any one of claims 1 to 3. A recombinant plasmid comprising the DNA molecule according to claim 4. A lipid nanoparticle loaded with the mRNA molecule according to any one of claims 1 to 3.

7. A pharmaceutical composition comprising: the mRNA molecule according to any one of claims 1 to 3, and a pharmaceutically acceptable excipient.

8. Use of the mRNA molecule according to any one of claims 1 to 3, the DNA molecule according to claim 4, the recombinant plasmid according to claim 5, the lipid nanoparticle according to claim 6 or the pharmaceutical composition according to claim 7 in the preparation of a herpes zoster mRNA vaccine.

9. A herpes zoster mRNA vaccine comprising the mRNA molecule according to any one of claims 1 to 3; Preferably, the vaccine is in the form of lipid nanoparticles; Preferably, the vaccine dosage form is a freeze-dried dosage form or a frozen dosage form; Preferably, the vaccine is administered subcutaneously or intramuscularly.

10. The herpes zoster mRNA vaccine according to claim 9, wherein The lipid nanoparticles include mRNA and lipid LNP, wherein: The lipid LNP comprises one or more of a cationic lipid, a supporting lipid, a sterol substance, and a polymer-conjugated lipid; Preferably, the cationic lipids include 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl) azadiyl) bis(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), 8-((7-((3-(hexylthio)-2-methylpropanoyl)oxy)n-heptyl)(2-hydroxyethyl) The polymer-conjugated lipid comprises one or more of PEG-DMG, ALC0159, PEG-DSPE, and PEG-DSG; the supporting phospholipid comprises one or more of DSPC, DOPE, DOPC, and DOPS; the sterol comprises one or more of cholesterol and β-sitosterol; Preferably, based on the total molar amount of lipid as 100%, the molar ratio of each lipid component is: cationic lipid 35%-57.5%, supporting lipid 5%-16%, sterol substance 27.5%-55%, polymer conjugated lipid 0-3%, preferably 0.5%-2.5%; Preferably, the mRNA vaccine further comprises an adjuvant; the adjuvant used may be, for example, an aqueous solution of salt and sugar; preferably, the salt is selected from one or more of citrate, acetate, phosphate or Tris salt; the sugar is selected from one or more of sucrose and trehalose; Preferably, the vaccine is a vaccine for preventing and / or ameliorating varicella, herpes zoster and / or postherpetic neuralgia.

Images