Immune cell expressing fusion protein, and expression vector thereof, use thereof and preparation method therefor

Abstract

Provided are a fusion protein of a PD-1 single chain antibody and IL-21, an immune cell capable of expressing and secreting the fusion protein, and an expression vector thereof, the use thereof and a preparation method therefor.

Description

Immune cell expressing fusion protein and its expression vector, application and preparation method

[0001] This application claims priority to the Chinese patent application filed on September 13, 2023, with application number 202311180600.6 and invention name “An immune cell and its expression vector, application and preparation method”, the content of which should be understood as incorporated into this application by reference. Technical Field

[0002] The present application relates to the field of immune cell technology, and in particular to an immune cell and its expression vector, application and preparation method. Background Art

[0003] Chimeric antigen receptor (CAR)-modified T cell (CAR-T) therapy involves introducing an exogenously engineered CAR gene that recognizes tumor cell surface antigens into T cells for genetic modification. This gene-modified CAR-expressing T cells are then expanded in vitro and infused back into the patient for treatment. The CAR molecule primarily consists of three components: an extracellular tumor antigen-binding region, a transmembrane domain, and an intracellular signaling domain. The extracellular antigen-binding region is typically derived from a single-chain antibody (scFv) targeting a tumor cell surface antigen. The intracellular signaling domain primarily consists of the CD3ζ chain of the T cell receptor (TCR) and the intracellular signaling domains of the costimulatory molecules CD28 and 4-1BB. When the CAR on the CAR-T cell specifically binds to the antigen on the tumor cell surface, the intracellular domain transduces activation signals to activate the T cell, thereby exerting its cytotoxic and anti-tumor effects. Currently, in the clinical treatment of hematologic malignancies and in most clinical trials, second-generation CAR-T cell therapy technologies containing the intracellular signaling domains of the costimulatory molecules CD28 or 4-1BB are predominant.

[0004] To address the current low overall efficacy and high relapse rates of CAR-T cell therapy, extensive research and development has been conducted on CAR-T cell technology. Like endogenous T cells, CAR-T cells also upregulate expression of the immune checkpoint PD-1 upon antigen stimulation. Binding of PD-1 on the surface of CAR-T cells to PD-L1 expressed on tumor cells or tissues inhibits the anti-tumor function of CAR-T cells. Therefore, one strategy for improving CAR-T cell function is to inhibit or eliminate intrinsic PD-1 signaling in CAR-T cells. For example, PD-1 expression on CAR-T cells can be suppressed by expressing shRNAs targeting PD-1. PD-1-deficient CD19 CAR-T cells generated using CRISPR / Cas9 technology have entered clinical trials. Cherkassky et al. constructed a dominant negative receptor (DNR) composed of the extracellular domain of PD-1 and the transmembrane domain of the CD8 molecule. Co-transfection of CD19 CAR-T cells with the PD-1 DNR enhanced the anti-tumor activity of T cells in vitro and in vivo. The PD-1 / CD28 chimeric converting receptor is constructed by combining the extracellular domain of PD-1 with the transmembrane and intracellular domains of the CD28 molecule. Transfection into CAR-T cells can convert the PD-1 inhibitory signal into a CD28 activation signal. Alternatively, a gene sequence capable of secreting anti-PD-L1 or PD-1 single-chain antibody can be added to the second-generation CAR-T structure. This allows CAR-T cells to not only kill tumor cells upon contact with them, but also allows the locally secreted single-chain antibody to block the binding of PD-1 to PD-L1, thereby enhancing the CAR-T cell's anti-tumor activity. The tumor microenvironment is a complex immunosuppressive network composed of numerous immunosuppressive signals or mechanisms. These strategies merely block or eliminate the PD-1 inhibitory signal of CAR-T cells and cannot significantly enhance the effector function of CAR-T cells.

[0005] Antibodies can block the binding of PD-1 and PD-L1, enhancing the cytotoxic activity of CAR-T cells against tumor cells. The tumor microenvironment is a complex immunosuppressive network composed of numerous immunosuppressive signals or mechanisms. These strategies simply block or eliminate the PD-1 inhibitory signal of CAR-T cells and cannot significantly enhance the effector function of CAR-T cells.

[0006] Another strategy aims to enhance the anti-tumor effects of CAR-T by boosting the body's innate and adaptive immunity. This includes using CAR-T cells to express the immunostimulatory agent RN7SL1, along with the immunostimulatory molecules IL-12, IL-18, CD40L, and chemokines. These molecules are then delivered to tumor tissues, reshaping the tumor microenvironment and enhancing the therapeutic effects of CAR-T cells. To increase the proliferation and persistence of CAR-T cells in vivo, CAR-T cells that constitutively co-express IL-2, IL-7, IL-15, or IL-21 are being constructed. The immunostimulants, cytokines, or chemokines produced by these CAR-T cells circulate throughout the body, potentially leading to serious side effects. Consequently, these CAR-T cells remain in the early stages of development and have not entered clinical trials.

[0007] Currently, six immune cell therapies, represented by CD19 and BCMCAR-T cells, are available in the United States and two in China for the treatment of hematological malignancies. These products are used to treat B-lymphocytic leukemia and lymphoma, and multiple myeloma, respectively. However, CAR-T cell therapy technology still faces many challenges, such as:

[0008] (1) The overall efficacy of CAR-T cell therapy needs to be improved

[0009] The commercially available CD19 CAR-T cell therapy for acute B-cell leukemia has a complete remission rate exceeding 80%. However, the complete remission rate for B-cell lymphoma is around 60%, and the effect is even worse for large lymphomas (greater than 7 cm in diameter). The effect on other CD19-positive B-cell tumors is less than ideal. The complete remission rate for B-cell CAR-T cells in multiple myeloma is between 60-80%. All CAR-T cell therapies are poorly effective for brain tumors, and therefore, patients with brain tumors are often excluded from CAR-T cell therapy.

[0010] CAR-T cell therapy for solid tumors is still in the early stages of development, and its effectiveness is far from ideal. A major reason for this is the high heterogeneity of tumor cells, resulting in inconsistent expression of target molecules on tumor cells, with some tumors even expressing none at all. CAR-T cell therapy can further downregulate or even eliminate target molecule expression on tumor cells, allowing them to escape CAR-T cell recognition. Furthermore, the immunosuppressive microenvironment of solid tumors inhibits the function of CAR-T cells that enter the tumor and hinders their effective expansion.

[0011] (2) The tumor recurrence rate of CAR-T cell therapy that has been marketed is high

[0012] Although the marketed CD19 and BCMAC CAR-T cell therapies for acute B-lymphoblastic leukemia and multiple myeloma have achieved high remission rates, nearly half of patients who achieve remission relapse within 1-2 years. Relapse after CAR-T cell therapy is attributed to loss or downregulation of the tumor target antigen, insufficient expansion of the CAR-T cells themselves, or an inability to persist in the body. Among children and young adults treated with CD19 CAR-T cells, approximately 50% of relapses in B-ALL are due to CD19 loss; approximately 30% of relapses in lymphoma are also due to CD19 loss, and another 30% have decreased CD19 expression. The primary mechanism of relapse in antigen-negative tumors is antigen loss. Even if antigen loss is not complete, reduced antigen expression or density through immune regulation can be sufficient to allow tumor cell escape. The primary cause of relapse in tumor antigen-positive tumors is the inability of CAR-T cells to persist in the body.

[0013] In summary, the existing technology lacks mature CAR-T cell therapy technology, the tumor treatment effect is poor, and it is easy to cause tumor recurrence.

[0014] Summary of the Invention

[0015] The purpose of this application is to provide a fusion protein of PD-1 single-chain antibody and IL-21, as well as immune cells that can express and secrete the fusion protein, and their expression vectors, applications and preparation methods, to solve at least one of the above-mentioned technical problems. The immune cells of this application can express and secrete PD-1 single-chain antibody and IL-21 fusion protein, significantly enhancing the anti-tumor effect of immune cells and the response of the body's intrinsic anti-tumor T cells.

[0016] This application is implemented as follows:

[0017] In a first aspect, the present application provides a fusion protein of PD-1 single-chain antibody and IL-21 (PD-1Ab21).

[0018] In a preferred embodiment of the present application, the PD-1 single-chain antibody comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises HCDR1, HCDR2 and HCDR3, which respectively comprise or consist of the amino acid sequences of SEQ ID No.69, SEQ ID No.70 and SEQ ID No.71, and the light chain variable region comprises LCDR1, LCDR2 and LCDR3, which respectively comprise or consist of the amino acid sequences of SEQ ID No.72, SEQ ID No.73 and SEQ ID No.74; and IL-21 comprises or consists of the amino acid sequence of SEQ ID No.16.

[0019] In the present application, the HCDR of the heavy chain variable region and the LCDR of the light chain variable region are determined according to Kabat.

[0020] In a preferred embodiment of the present application, the heavy chain variable region of the PD-1 single-chain antibody may comprise or consist of the amino acid sequence of SEQ ID No. 8, and the light chain variable region may comprise or consist of the amino acid sequence of SEQ ID No. 12.

[0021] In a preferred embodiment of the present application, the heavy chain variable region and the light chain variable region in the PD-1 single-chain antibody can be connected together by a linker 1, and the linker 1 comprises or consists of the amino acid sequence of SEQ ID No. 10.

[0022] In a preferred embodiment of the present application, the IL-21 may comprise or consist of the amino acid sequence of SEQ ID No. 16.

[0023] In a preferred embodiment of the present application, the PD-1 single-chain antibody and the IL-21 are linked together via a linker 2 to form the fusion protein. Exemplarily, the linker 2 may comprise or consist of the amino acid sequence of SEQ ID No. 14.

[0024] In an optional embodiment, the C-terminus of the fusion protein further comprises a His tag. In a specific embodiment, the His tag in the fusion protein is connected to the C-terminus via linker 3. Exemplarily, the linker 3 may comprise or consist of the amino acid sequence of SEQ ID No. 18.

[0025] In a preferred embodiment of the present application, the fusion protein comprises or consists of the amino acid sequence of SEQ ID No. 2 or 4. For example, the encoding nucleotide sequence of SEQ ID No. 2 is shown in SEQ ID No. 1; the encoding nucleotide sequence of SEQ ID No. 4 is shown in SEQ ID No. 3.

[0026] In a second aspect, the present application provides an immune cell capable of expressing and secreting the PD-1 single-chain antibody and IL-21 fusion protein as described in the first aspect.

[0027] In a preferred embodiment of the present application, the immune cells of the above-mentioned immune cells specifically recognize at least one of blood malignancies, lung cancer, breast cancer, liver cancer, pancreatic cancer, kidney cancer, prostate cancer, ovarian cancer, digestive tract tumors, brain tumors, neuroendocrine tumors, bone tumors, and soft tissue tumors.

[0028] In a preferred embodiment of the present application, the immune cells are selected from at least one of CAR-T cells, TCR-T cells, CAR-NK cells, and TIL cells.

[0029] In a preferred embodiment of the present application, the immune cells mentioned above can not only exert their own anti-tumor effects but also enhance the body's intrinsic anti-tumor immune response.

[0030] In a third aspect, the present application provides a viral vector capable of expressing the PD-1 single-chain antibody and IL-21 fusion protein as described in the first aspect.

[0031] In a preferred embodiment of the present application, after the viral expression vector of the above viral vector infects cells, the cells secrete the PD-1 single-chain antibody and IL-21 fusion protein as described in the first aspect.

[0032] In a fourth aspect, the present application provides an immune cell expression vector, which includes an expression plasmid targeting a specific antigen, a P2A sequence fragment, and a coding sequence fragment of the PD-1 single-chain antibody and IL-21 fusion protein as described in the first aspect;

[0033] Optionally, a His tag is also included;

[0034] The expression plasmid targeting a specific antigen includes an extracellular domain, a transmembrane domain and an intracellular domain;

[0035] The extracellular domain includes a CD8α signal peptide fragment, a specific antibody fragment and a CD8α hinge region fragment;

[0036] The transmembrane domain includes a CD8α transmembrane region fragment;

[0037] The intracellular domain includes a 4-1BB signaling domain fragment and a CD3ζ signaling domain fragment.

[0038] In a preferred embodiment of the present application, the amino acid sequences of the PD-1 single-chain antibody and IL-21 fusion protein as described in the first aspect described in the above-mentioned immune cell expression vector are shown as SEQ ID No. 2 or 4, and the cDNA sequences of the coding sequence fragments thereof are shown as SEQ ID No. 1 or 3, respectively.

[0039] In a preferred embodiment of the present application, the specific antibody fragment in the above-mentioned immune cell expression vector includes a specific single-chain antibody fragment targeting CD19, and / or a specific single-chain antibody fragment targeting BCMA, and / or a specific antibody fragment targeting Her2 / neu tumor antigen, and / or a specific antibody fragment targeting other tumor antigens.

[0040] In a preferred embodiment of the present application, the nucleotide sequence and amino acid sequence of the light chain variable region in the specific single-chain antibody fragment targeting CD19 are shown as SEQ ID No. 25 and 26, respectively, and the nucleotide sequence and amino acid sequence of the heavy chain variable region are shown as SEQ ID No. 29 and 30, respectively.

[0041] In a specific embodiment of the present application, the light chain variable region and the heavy chain variable region in the specific single-chain antibody fragment targeting CD19 are connected by linker4, and the exemplary nucleotide sequence and amino acid sequence of linker4 can be shown as SEQ ID No. 27 and 28, respectively.

[0042] In an exemplary embodiment of the present application, the nucleotide sequence and amino acid sequence of the specific single-chain antibody fragment targeting CD19 are shown as SEQ ID No. 31 and 32, respectively.

[0043] In a preferred embodiment of the present application, the nucleotide sequence and amino acid sequence of the light chain variable region of the specific single-chain antibody fragment targeting BCMA are shown as SEQ ID Nos. 47 and 48, respectively, and the nucleotide sequence and amino acid sequence of the heavy chain variable region are shown as SEQ ID Nos. 51 and 52, respectively.

[0044] In a specific embodiment of the present application, the light chain variable region and the heavy chain variable region in the specific single-chain antibody fragment targeting BCMA are connected by linker5. The nucleotide sequence and amino acid sequence of exemplary linker5 can be shown as SEQ ID No. 49 and 50, respectively.

[0045] In an exemplary embodiment of the present application, the nucleotide sequence and amino acid sequence of the specific single-chain antibody fragment targeting BCMA are shown as SEQ ID No. 45 and 46, respectively.

[0046] In a preferred embodiment of the present application, the nucleotide sequence and amino acid sequence of the light chain variable region in the Her2-targeting specific single-chain antibody fragment are shown as SEQ ID No. 59 and 60, respectively, and the nucleotide sequence and amino acid sequence of the heavy chain variable region are shown as SEQ ID No. 63 and 64, respectively.

[0047] In a specific embodiment of the present application, the light chain variable region and the heavy chain variable region in the specific single-chain antibody fragment targeting Her2 are connected by linker6, and the exemplary nucleotide sequence and amino acid sequence of linker6 can be shown as SEQ ID No.61 and 62, respectively.

[0048] In an exemplary embodiment of the present application, the nucleotide sequence and amino acid sequence of the Her2-targeting specific single-chain antibody fragment are shown in SEQ ID No. 57 and 58, respectively. In a fifth aspect, the present application provides a use of an immune cell in the treatment of B-cell leukemia, B-cell lymphoma, myeloma, Her2 / neu+ breast cancer, and advanced B-cell malignancies, wherein the immune cell is the immune cell as described in the second aspect.

[0049] In the sixth aspect, the present application provides a method for treating B cell leukemia, B cell lymphoma, myeloma, Her2 / neu+ breast cancer, and advanced B cell malignancies, characterized in that a therapeutically effective amount of immune cells as described in the first aspect is administered to the subject.

[0050] In a seventh aspect, the present application provides a method for preparing immune cells, comprising:

[0051] Constructing the coding genes for the PD-1 single-chain antibody and IL-21 fusion protein as described in the first aspect;

[0052] Constructing an immune cell expression vector expressing the PD-1 single-chain antibody and IL-21 fusion protein as described in the first aspect;

[0053] Performing viral packaging on the immune cell expression vector to obtain viral particles;

[0054] Immune cells are prepared by using the virus particles.

[0055] In a preferred embodiment of the present application, in the above-mentioned method for preparing immune cells, the gene encoding the fusion protein of the PD-1 single-chain antibody and IL-21 as described in the first aspect comprises:

[0056] A humanized PD-1 antibody was selected, and the heavy chain variable region and the light chain variable region were connected together through Linker 1 to obtain a PD-1 single-chain antibody targeting specific cells;

[0057] The PD-1 single-chain antibody targeting specific cells is connected to the cDNA sequence of the IL-21 cytokine through the linker Linker2 and DNA fragment synthesis is performed to obtain the coding gene of the fusion protein of the PD-1 single-chain antibody and IL-21 as described in the first aspect.

[0058] In a preferred embodiment of the present application, in the above-mentioned method for preparing immune cells, the construction of an immune cell expression vector expressing the PD-1 single-chain antibody and IL-21 fusion protein as described in the first aspect comprises:

[0059] A lentiviral vector pCDH is used to construct an expression plasmid targeting a specific antigen, wherein the expression plasmid targeting a specific antigen includes an extracellular domain, a transmembrane domain, and an intracellular domain;

[0060] The extracellular domain includes a CD8α signal peptide fragment, a specific antibody fragment and a CD8α hinge region fragment;

[0061] The specific antibody fragments include specific single-chain antibody fragments targeting CD19, and / or specific single-chain antibody fragments targeting BCMA, and / or specific antibody fragments targeting Her2 / neu tumor antigen, and / or specific antibody fragments targeting other tumor antigens;

[0062] The transmembrane domain includes a CD8α transmembrane region fragment;

[0063] The intracellular domain includes a 4-1BB signal transduction domain fragment and a CD3ζ signal transduction domain fragment; the coding sequence fragments of the PD-1 single-chain antibody and IL-21 fusion protein as described in the first aspect are connected to the back of the coding fragment of the expression plasmid targeting a specific antigen through the P2A sequence fragment;

[0064] Optionally, a His tag is connected to the C-terminus of the entire sequence to obtain an immune cell expression vector expressing the PD-1 single-chain antibody and IL-21 fusion protein as described in the first aspect.

[0065] For example, the nucleotide sequences and amino acid sequences of the specific single-chain antibody fragment targeting CD19, the specific single-chain antibody fragment targeting BCMA, and the specific antibody fragment targeting Her2 / neu tumor antigen are as described above.

[0066] In a preferred embodiment of the present application, in the above-mentioned method for preparing immune cells, the step of packaging the immune cell expression vector into a virus to obtain viral particles comprises:

[0067] Calcium phosphate transfection was used for virus packaging;

[0068] 16-20 hours before transfection, select 293T cells for passage and seed 4×10 cells per cell culture dish. 6 293T cells;

[0069] 20-24 hours after inoculation, the passage of 293T cells was observed, and transfection was performed when the 293T cells reached 50% coverage;

[0070] The transfection method includes: preparing a transfection reagent, the transfection reagent including liquid A and liquid B, the liquid A including 35 μg of plasmid (including 15 μg of CAR expression vector plasmid, 7.5 μg of helper plasmid RRE, 6 μg of REV and 6 μg of VSVG), 2.5 mol CaCl250 μl, ddH2O Pto500 μl, the liquid B including 500 μl of 2×HEPES salt buffer, the liquid A is allowed to stand for 3 minutes after preparation, the liquid A is added to the liquid B, and bubbles are simultaneously added to the reagent tube with an electric pipette to mix the liquid A and the liquid B, so that the solution in the reagent tube becomes white and turbid, thereby preparing the transfection reagent, adding 1 ml of the transfection reagent to a culture dish of 293T cells, gently shaking, and culturing in a 37° C. incubator for transfection;

[0071] 12-16 hours after transfection, the medium was changed, the culture supernatant was discarded, and 15 ml of DMEM medium containing 10% FBS was added;

[0072] After 48 hours of medium replacement, the culture supernatant was collected by filtering through a 0.45 μm filter, supplemented with 10 ml of DMEM medium containing 10% FBS, and stored at 4°C.

[0073] After 24 h of storage, the culture supernatant was collected by filtration through a 0.45 μm filter;

[0074] The 48-hour culture supernatant and the 72-hour culture supernatant were both concentrated 50 times by a concentration pump and then filtered through a 0.22 μm filter. The filtered virus concentrate was collected, divided into 1.5 ml EP tubes, and stored at -80°C to obtain virus particles.

[0075] In a preferred embodiment of the present application, in the above-mentioned method for preparing immune cells, the preparation of immune cells by using the virus particles comprises:

[0076] removing the virus particles to obtain a virus concentrate;

[0077] Human anticoagulated peripheral blood was collected and diluted with an equal volume of PBS. The diluted human anticoagulated peripheral blood was separated with human lymphocyte separation medium, and peripheral blood mononuclear cells (PBMCs) were collected.

[0078] The T cell concentration in peripheral blood mononuclear cells (PBMCs) was adjusted to 1x10 7 / ml, anti-CD3 and anti-CD28 magnetic beads were added to sort the T cells and activate the cells to make the T cells enter the activated state;

[0079] After 24 hours of T cell activation, the T cells were cultured at a rate of 5x10 510 cells / mL were inoculated into a 24-well plate, and the virus concentrate and 1 ml of infection medium were added for virus infection;

[0080] After 6 h of infection, 1 ml of fresh infection medium was added;

[0081] Continue infection for 48 hours, discard the culture supernatant, and replace with fresh infection medium;

[0082] After the infection continues to expand the T cells for 6-8 days, immune cells are obtained.

[0083] The beneficial effects of the embodiments of the present application are:

[0084] In addition to playing the anti-tumor role of ordinary immune cells, the immune cells of this application can also express and secrete PD-1 single-chain antibody and IL-21 fusion protein. The secreted fusion protein can block the PD-1 inhibitory signal on CAR-T and simultaneously target IL-21 to immune cells, promoting the proliferation of immune cells and their differentiation into memory cells, which can significantly enhance the anti-tumor effect of immune cells and improve the efficacy of tumor treatment.

[0085] Because cytokines act on numerous target cells, systemic application has significant side effects, greatly limiting their use in disease treatment. The fusion protein secreted by PD-1Ab21-CAR-T cells (PD-1Ab21-TCR-T cells, PD-1Ab21-CAR-NK cells, PD-1Ab21-TIL cells) can target PD-1+ anti-tumor T cells in vivo, reducing the chance of acting on other cells and greatly reducing the systemic side effects of the cytokine IL-21. BRIEF DESCRIPTION OF THE DRAWINGS

[0086] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following is a brief introduction to the drawings required for use in the embodiments. It should be understood that the following drawings only show certain embodiments of the present application and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without creative work.

[0087] FIG1 is a schematic diagram of the construction structure of the expression sequence of this application;

[0088] Figures 1a and 1b are schematic diagrams of the construction structure of the fusion protein of the present application; Figure 1c is a schematic diagram of the construction structure of an expression plasmid that targets a specific antigen but does not contain the fusion protein of the present application; Figures 1d and 1e are schematic diagrams of the construction structure of an expression plasmid that targets a specific antigen and contains the fusion protein of the present application.

[0089] FIG2 is a schematic diagram of the preparation of PD-1Ab21-CD19CAR-T cells and the functional identification of the secreted PD-1Ab21 fusion protein of the present application;

[0090] Figure 2a shows the CAR in the prepared PD-1Ab21-CD19CAR-T cells + Schematic diagram of the cell scale;

[0091] Figure 2b is a schematic diagram of the binding of PD-1Ab21 fusion protein in the culture supernatant of PD-1Ab21-CD19CAR-T cells to CHO cells expressing PD-1 (CHO-PD-1). 5 CHO-PD-1 cells were incubated with CAR-T cell culture supernatant (concentrated 30-fold in ultrafiltration tubes, 1 ml) at 4°C for 30 minutes. 3 μg of anti-PD-1 single-chain antibody (PD-1Ab-scFv) was also incubated for 30 minutes as a control sample. Proteins bound to CHO-PD-1 cells were detected using PE-labeled anti-His antibody.

[0092] Figure 2c is a schematic diagram showing the blocking effect of PD-1Ab21 fusion protein in the culture supernatant of PD-1Ab21-CD19CAR-T cells on PD-1 molecules on the surface of CHO-PD1 cells. 5 CHO-PD-1 cells were incubated with CAR-T cell culture supernatant (concentrated 30-fold using ultrafiltration tubes, 1 ml) at 4°C for 30 minutes. PD-1 expression on CHO-PD1 cells was detected using APC-labeled anti-hPD-1 (if there was a blocking effect, the test result was negative);

[0093] Figure 2d is a schematic diagram of the activation effect of PD-1Ab21 fusion protein on IL-21R in the culture supernatant of PD-1Ab21-CD19CAR-T cells. 5 The cells were seeded into 24-well plates at 100 μg / well and then incubated with 0.3 μM IL-21 (positive control) or CAR-T supernatant for 30 minutes. Anti-pSTAT3 antibody was then used for intracellular staining, and the phosphorylation level of intracellular STAT3 was detected by flow cytometry.

[0094] FIG3 is a schematic diagram comparing the proliferation capacity and differentiation phenotype of PD-1Ab21-CD19CAR-T and CD19CAR-T cells cultured in vitro;

[0095] Figure 3a shows that the prepared CD19CAR-T or PD-1Ab21-CD19CAR-T cells were cultured in vitro for 11 days in the presence of 100U / ml (left figure) or 10U / ml (right figure) IL-2, and the proliferation times of CD19CAR-T and PD-1Ab21-CD19CAR-T cells were counted and counted every day to draw the cell proliferation curve;

[0096] Figure 3b shows CD19CAR-T and PD-1Ab21-CD19CART cells collected and cultured on day 14, and flow cytometry analysis of the phenotype of CAR-T cells (CD45RA and CCR7);

[0097] Figure 3c shows that CD19CAR-T and PD-1Ab21-CD19CART cells were cultured under 10U / ml IL-2 conditions, and the cultured CAR-T cells were taken out for staining at a certain time, and CD4 + and CD8 + The proportion of Tscm (CD45RA+CCR7+) cells in CAR-T cells;

[0098] Figure 3d shows the staining of CAR-T cells cultured for 14 days, and flow cytometry analysis of CD4 + and CD8 + CD45RA in CAR-T cells + ,CCR7 + ,CD62L + ,CD45RO + ,CD28 + the proportion of cells;

[0099] FIG4 is a schematic diagram of the in vitro killing function detection of PD-1Ab21-CD19CAR-T cells of the present application;

[0100] Figure 4a shows that CD19CAR-T and PD-1Ab21-CD19CAR-T cells were cultured in vitro under 100U / ml IL-2 conditions for the fifth day, and then a certain number of CAR-T cells were taken and co-cultured with Daudi-PDL1 according to the E(CAR-T):M(Daudi-PDL1) ratio as shown in the figure for 24 hours, and the killing ability of CAR-T cells was detected by flow cytometry;

[0101] Figure 4b shows the sustained killing ability of CD19CAR-T and PD-1Ab21-CD19CAR-T after CAR-T was cultured for 8 days with IL-2 100 U / ml at the E(CAR-T):M(Daudi-PDL1) ratio as shown in the figure.

[0102] Figure 4c shows the changes in the total number of T cells and the ratio of CD8 / CD4 during the continuous killing process of CAR-T cells. In the killing experiment of Figure 4b above, cells were counted at different time points and flow cytometry was used to analyze the CD3+, CD4 + and CD8 + The proportion of T cells, calculated as CD3 + The total number of T cells and CD8 / CD4 ratio were plotted as a function of time.

[0103] FIG5 is a schematic diagram of the in vitro proliferation and cytokine secretion capacity detection of PD-1Ab21-CD19CAR-T cells of the present application;

[0104] Figure 5a shows the expression of Ki-67 in CD19CAR-T and PD-1Ab21-CD19CAR-T cells after CAR-T was cultured for 48 hours in vitro with IL-2 100 U / ml for the fifth day at an E(CAR-T):M(Daudi-PDL1) ratio of 1:5;

[0105] Figure 5b shows the secretion and expression of IL-2 and IFN-γ in CD19CAR-T and PD-1Ab21-CD19CAR-T cells detected by flow cytometry (B) under the culture conditions of Figure 5a;

[0106] Figure 5c shows the levels of IL-2 and IFN-γ secreted in the culture supernatants of CD19CAR-T and PD-1Ab21-CD19CAR-T cells detected by ELISA (C) under the conditions of Figure 5a;

[0107] FIG6 is a schematic diagram of the exhaustion phenotype detection of PD-1Ab21-CD19CAR-T cells of the present application;

[0108] Figure 6a shows the CAR-T cells cultured in vitro for 5 days with IL-2 100 U / ml at an E(CAR-T):M(Daudi-PDL1) ratio of 1:5. The CD19CAR-T and PD-1Ab21-CD19CAR-T cells, as well as the ratio of T cells to tumor cells, were detected after co-culture for 8 days.

[0109] Figure 6b shows the CAR-T cells cultured in vitro for 5 days with IL-2 100 U / ml at an E(CAR-T):M(Daudi-PDL1) ratio of 1:5, and the number of CD19CAR-T and PD-1Ab21-CD19CAR-T cells, T cells, and tumor cells were detected for 8 days;

[0110] Figure 6c shows the expression of PD-1, TIGIT, TOX, and LAG3, the exhaustion markers on CD8 T cells, after CAR-T cells were cultured in vitro for 5 days with 100 U / ml of IL-2 at an E(CAR-T):M(Daudi-PDL1) ratio of 1:5 and co-cultured for 8 days.

[0111] FIG7 is a schematic diagram showing that the PD-1Ab21-CD19CAR-T cells in the immune cells of the present application have significant anti-tumor therapeutic effects in a humanized mouse B cell leukemia model;

[0112] Figure 7a shows that 5x10 Raji-luc cells were injected into the tail vein of NSG mice 7 days later. 6 CAR+CD19CAR-T and PD-1Ab21-CD19CAR-T cells;

[0113] Figure 7b shows in vivo imaging of small animals to monitor tumor progression;

[0114] FIG8 is a schematic diagram showing that PD-1Ab21-CD19CAR-T cells, among the immune cells of the present application, have significant anti-tumor therapeutic effects in a humanized mouse lymphoma model;

[0115] Figure 8a shows that 2x10 Daudi-hPD-L1 cells were injected into NSG mice 19 days later. 6 CAR + CD19CAR-T and PD-1Ab21-CD19CAR-T cells;

[0116] Figure 8b shows the survival curve of NSG mice after subcutaneous inoculation of Daudi-hPD-L1 cells. The PD-1Ab21-CD19CAR-T cell treatment group had a higher survival rate than CD19CAR-T;

[0117] Figure 8c shows the tumor growth curve. The tumor length (a) and width (b) were measured, and the tumor volume was calculated as (ab 2 / 2);

[0118] FIG8 d is a flow cytometry analysis of the percentage of CD3+CD45+CAR-T cells infused into the peripheral blood of tumor-bearing NSG mice;

[0119] FIG9 is a schematic diagram showing that PD-1Ab21 of the present application promotes the proliferation and stemness differentiation of CAR-T cells in immune cells, thereby mediating a stronger anti-tumor effect;

[0120] Figure 9a shows that 5x10 Daudi-hPD-L1 cells were injected into NSG mice 33 days later. 6CAR+CD19CAR-T and PD-1Ab21-CD19CAR-T cells were used. On the 12th day after treatment, peripheral blood, spleen, and tumor of the mice were collected for flow cytometry analysis.

[0121] Figure 9b shows the CD3 expression in peripheral blood, spleen, and tumor tissues of NSG mice. + CD8 + The proportion of CAR-T cells;

[0122] Figure 9c shows flow cytometry detection of CD3 in spleen and tumor tissues. + CD8 + Expression of Ki67 in CAR-T cells and CD3 + CD8 + The positive rate of Ki67 in CAR-T cells;

[0123] Figure 9d shows flow cytometry detection of CD3 in tumor sites. + CD8 + The phenotype of CAR-T cells was analyzed, and the proportions of CD45RA+CD62L+ stem memory CD8+ T cells and CD45RA-CD62L+ central memory CD8+ T cells were counted;

[0124] FIG10 is a schematic diagram showing that PD-1Ab21-BCMACAR-T cells, among the immune cells of the present application, have significant anti-tumor therapeutic effects in a humanized mouse myeloma model;

[0125] Figure 10a shows that 2x10 U266-luc cells were injected into the tail vein of NSG mice 24 days later. 6 CAR+BCMACAR-T and PD-1Ab21-BCMACAR-T cells;

[0126] Figure 10b shows in vivo imaging of small animals to monitor tumor progression;

[0127] FIG11 is a schematic diagram showing that the PD-1Ab21-Her2CAR-T cells in the immune cells of the present application have significant anti-tumor therapeutic effects in a humanized mouse breast cancer model;

[0128] Figure 11a shows that 3x10 BT474-PD-L1 cells were injected subcutaneously into NSG mice 34 days later. 6 CAR + Her2CAR-T and Her2CAR-T-hPD-1Ab21 cells;

[0129] Figure 11b shows the survival curve of tumor-bearing mice. The PD-1Ab21-Her2CAR-T cell treatment group had a higher survival rate than Her2CAR-T.

[0130] Figure 11c shows the tumor growth curve. The tumor length (a) and width (b) were measured, and the tumor volume was calculated as (ab 2 / 2); DETAILED DESCRIPTION

[0131] To make the objectives, technical solutions, and advantages of the embodiments of the present application more clear, the technical solutions in the embodiments of the present application will be clearly and completely described below in conjunction with the accompanying drawings of the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments. Generally, the components of the embodiments of the present application described and shown in the drawings herein can be arranged and designed in various different configurations.

[0132] In particular, it is well known that due to the degeneracy of nucleotide codons, each amino acid sequence can have multiple nucleotide coding sequences. Therefore, the encoding nucleotide sequences of the amino acid sequences given in this application are only exemplary. For each amino acid sequence, all nucleotide sequences that can encode the amino acid sequence are functional equivalents and are included in the scope of this application.

[0133] The present application provides a PD-1 single-chain antibody and an IL-21 fusion protein PD-1Ab21. For the specific structure of the fusion protein, please refer to Figures 1a and 1b.

[0134] In a preferred embodiment of the present application, the PD-1 single-chain antibody comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises HCDR1, HCDR2 and HCDR3, which respectively comprise or consist of the amino acid sequences of SEQ ID No.69, SEQ ID No.70 and SEQ ID No.71, and the light chain variable region comprises LCDR1, LCDR2 and LCDR3, which respectively comprise or consist of the amino acid sequences of SEQ ID No.72, SEQ ID No.73 and SEQ ID No.74; and IL-21 comprises or consists of the amino acid sequence of SEQ ID No.16.

[0135] In a preferred embodiment of the present application, the heavy chain variable region of the PD-1 single-chain antibody may comprise or consist of the amino acid sequence of SEQ ID No. 8, and the light chain variable region may comprise or consist of the amino acid sequence of SEQ ID No. 12.

[0136] In a preferred embodiment of the present application, the heavy chain variable region and the light chain variable region in the PD-1 single-chain antibody can be connected together by a linker 1, and the linker 1 comprises or consists of the amino acid sequence of SEQ ID No. 10.

[0137] In a preferred embodiment of the present application, the IL-21 may comprise or consist of the amino acid sequence of SEQ ID No. 16.

[0138] In a preferred embodiment of the present application, the PD-1 single-chain antibody and the IL-21 are linked together via a linker 2 to form the fusion protein PD-1Ab21. Exemplarily, the linker 2 may comprise or consist of the amino acid sequence of SEQ ID No. 14.

[0139] In an optional embodiment, the C-terminus of the fusion protein PD-1Ab21 further comprises a His tag. In a specific embodiment, the His tag in the fusion protein PD-1Ab21 is connected to the C-terminus via linker 3. Exemplarily, the linker 3 may comprise or consist of the amino acid sequence of SEQ ID No. 18.

[0140] In a specific embodiment, the fusion protein PD-1Ab21 comprises or consists of the amino acid sequence of SEQ ID No. 2 or 4. For example, the encoding nucleotide sequences of SEQ ID No. 2 and 4 are shown in SEQ ID No. 1 or 3, respectively. The present invention also provides an immune cell capable of expressing and secreting the PD-1 single-chain antibody and IL-21 fusion protein described above.

[0141] In a preferred embodiment of the present application, the immune cells of the above-mentioned immune cells specifically recognize at least one of blood malignancies, lung cancer, breast cancer, liver cancer, pancreatic cancer, kidney cancer, prostate cancer, ovarian cancer, digestive tract tumors, brain tumors, neuroendocrine tumors, bone tumors, and soft tissue tumors.

[0142] In a preferred embodiment of the present application, the immune cells are selected from at least one of CAR-T cells, TCR-T cells, CAR-NK cells, and TIL cells.

[0143] In a preferred embodiment of the present application, the immune cells mentioned above can not only exert their own anti-tumor effects but also enhance the body's intrinsic anti-tumor immune response.

[0144] The present application provides a viral vector capable of expressing PD-1 single-chain antibody and IL-21 fusion protein PD-1Ab21.

[0145] In a preferred embodiment of the present application, after the viral expression vector of the above viral vector infects cells, the cells secrete PD-1 single-chain antibody and IL-21 fusion protein PD-1Ab21.

[0146] The present application provides an immune cell expression vector, which includes an expression plasmid targeting a specific antigen, a P2A sequence fragment, a PD-1 single-chain antibody, and a coding sequence fragment of an IL-21 fusion protein PD-1Ab21;

[0147] Preferably, it also includes a His tag;

[0148] The structure of the expression plasmid targeting a specific antigen is shown in Figures 1d and 1e, which includes an extracellular domain, a transmembrane domain and an intracellular domain;

[0149] The extracellular domain includes a CD8α signal peptide fragment (the region indicated by CD8αleader in Figures 1d and 1e), a specific antibody fragment (the region indicated by scFv in Figures 1d and 1e, including a heavy chain variable region VH, a light chain variable region VL and a linker) and a CD8α hinge region fragment (the region indicated by CD8αhinge in Figures 1d and 1e);

[0150] The transmembrane domain includes a CD8α transmembrane region fragment (the region indicated as CD8αTM in Figures 1d and 1e);

[0151] The intracellular domain includes a 4-1BB signaling domain fragment (the region shown as the 4-1BB signaling domain in Figures 1d and 1e) and a CD3ζ signaling domain fragment (the region shown as the CD3ζ signaling domain in Figures 1d and 1e).

[0152] In a preferred embodiment of the present application, the amino acid sequences of the PD-1 single-chain antibody and IL-21 fusion protein PD-1Ab21 in the above-mentioned immune cell expression vector are shown as SEQ ID No. 2 or 4, and the cDNA sequences of the coding sequence fragments thereof are shown as SEQ ID No. 1 or 3, respectively.

[0153] In a preferred embodiment of the present application, the specific antibody fragment in the above-mentioned immune cell expression vector includes a specific single-chain antibody fragment targeting CD19, and / or a specific single-chain antibody fragment targeting BCMA, and / or a specific antibody fragment targeting Her2 / neu tumor antigen, and / or a specific antibody fragment targeting other tumor antigens.

[0154] In a preferred embodiment of the present application, the nucleotide sequence and amino acid sequence of the light chain variable region in the specific single-chain antibody fragment targeting CD19 are shown as SEQ ID No. 25 and 26, respectively, and the nucleotide sequence and amino acid sequence of the heavy chain variable region are shown as SEQ ID No. 29 and 30, respectively.

[0155] In a specific embodiment of the present application, the light chain variable region and the heavy chain variable region in the specific single-chain antibody fragment targeting CD19 are connected by linker4, and the exemplary nucleotide sequence and amino acid sequence of linker4 can be shown as SEQ ID No. 27 and 28, respectively.

[0156] In an exemplary embodiment of the present application, the nucleotide sequence and amino acid sequence of the specific single-chain antibody fragment targeting CD19 are shown as SEQ ID No. 31 and 32, respectively.

[0157] In a preferred embodiment of the present application, the nucleotide sequence and amino acid sequence of the light chain variable region of the specific single-chain antibody fragment targeting BCMA are shown as SEQ ID Nos. 47 and 48, respectively, and the nucleotide sequence and amino acid sequence of the heavy chain variable region are shown as SEQ ID Nos. 51 and 52, respectively.

[0158] In a specific embodiment of the present application, the light chain variable region and the heavy chain variable region in the specific single-chain antibody fragment targeting BCMA are connected by linker5. The nucleotide sequence and amino acid sequence of exemplary linker5 can be shown as SEQ ID No. 49 and 50, respectively.

[0159] In an exemplary embodiment of the present application, the nucleotide sequence and amino acid sequence of the specific single-chain antibody fragment targeting BCMA are shown as SEQ ID No. 45 and 46, respectively.

[0160] In a preferred embodiment of the present application, the nucleotide sequence and amino acid sequence of the light chain variable region in the Her2-targeting specific single-chain antibody fragment are shown as SEQ ID No. 59 and 60, respectively, and the nucleotide sequence and amino acid sequence of the heavy chain variable region are shown as SEQ ID No. 63 and 64, respectively.

[0161] In a specific embodiment of the present application, the light chain variable region and the heavy chain variable region in the specific single-chain antibody fragment targeting Her2 are connected by linker6, and the exemplary nucleotide sequence and amino acid sequence of linker6 can be shown as SEQ ID No.61 and 62, respectively.

[0162] In an exemplary embodiment of the present application, the nucleotide sequence and amino acid sequence of the Her2-targeting specific single-chain antibody fragment are shown as SEQ ID No. 57 and 58, respectively.

[0163] The present application provides an application of immune cells in the treatment of B cell leukemia, B cell lymphoma, myeloma, Her2 / neu+ breast cancer, and advanced B cell malignancies, wherein the immune cells are the immune cells described above.

[0164] The present application provides a method for treating B-cell leukemia, B-cell lymphoma, myeloma, Her2 / neu+ breast cancer, and advanced B-cell malignancies, which comprises administering a therapeutically effective amount of the aforementioned immune cells to the patient.

[0165] The present application provides a method for preparing immune cells, which comprises:

[0166] Construct the genes encoding the PD-1 single-chain antibody and IL-21 fusion protein PD-1Ab21;

[0167] Construct an immune cell expression vector expressing PD-1 single-chain antibody and IL-21 fusion protein PD-1Ab21;

[0168] Performing viral packaging on the immune cell expression vector to obtain viral particles;

[0169] Immune cells are obtained by the virus.

[0170] In a preferred embodiment of the present application, in the above-mentioned method for preparing immune cells, the gene encoding the fusion protein PD-1Ab21 of the PD-1 single-chain antibody and IL-21 comprises:

[0171] A humanized PD-1 antibody was selected, and the heavy chain variable region and the light chain variable region were connected together through Linker 1 to obtain a PD-1 single-chain antibody targeting specific cells;

[0172] The PD-1 single-chain antibody targeting specific cells and the cDNA sequence of the IL-21 cytokine fusion protein are connected through a linker Linker 2 and DNA fragment synthesis is performed to obtain the coding gene of the fusion protein PD-1Ab21 of the PD-1 single-chain antibody and IL-21.

[0173] In a preferred embodiment of the present application, in the above-mentioned method for preparing immune cells, the construction of an immune cell expression vector expressing PD-1 single-chain antibody and IL-21 fusion protein PD-1Ab21 comprises:

[0174] A lentiviral vector pCDH is used to construct an expression plasmid targeting a specific antigen, wherein the expression plasmid targeting a specific antigen includes an extracellular domain, a transmembrane domain, and an intracellular domain;

[0175] The extracellular domain includes a CD8α signal peptide fragment (the region indicated by CD8αleader in Figures 1d and 1e), a specific antibody fragment (the region indicated by scFv in Figures 1d and 1e, including a heavy chain variable region VH, a light chain variable region VL and a linker) and a CD8α hinge region fragment (the region indicated by CD8αhinge in Figures 1d and 1e);

[0176] The specific antibody fragments include specific single-chain antibody fragments targeting CD19, and / or specific single-chain antibody fragments targeting BCMA, and / or specific antibody fragments targeting Her2 / neu tumor antigen, and / or specific antibody fragments targeting other tumor antigens;

[0177] The transmembrane domain includes a CD8α transmembrane region fragment (the region indicated as CD8αTM in Figures 1d and 1e);

[0178] The intracellular domain includes a 4-1BB signaling domain fragment (the region shown in Figures 1d and 1e as the 4-1BB signaling domain) and a CD3ζ signaling domain fragment (the region shown in Figures 1d and 1e as the CD3ζ signaling domain); the coding sequence fragments of the PD-1 single-chain antibody and the IL-21 fusion protein PD-1Ab21 are connected to the back of the coding fragment of the expression plasmid targeting the specific antigen through the P2A sequence fragment;

[0179] Optionally, a His tag is connected to the C-terminus of the entire sequence to obtain an immune cell expression vector expressing the PD-1 single-chain antibody and the IL-21 fusion protein PD-1Ab21.

[0180] Illustratively, the nucleotide sequences and amino acid sequences of the specific single-chain antibody fragment targeting CD19, the specific single-chain antibody fragment targeting BCMA, and the specific antibody fragment targeting Her2 / neu tumor antigen are as described above. In a preferred embodiment of the present application, in the above-mentioned method for preparing immune cells, the viral packaging of the immune cell expression vector to obtain viral particles comprises:

[0181] Calcium phosphate transfection was used for virus packaging;

[0182] 16-20 hours before transfection, select 293T cells for passage and seed 4×10 cells per cell culture dish. 6 293T cells;

[0183] 20-24 hours after inoculation, the passage of 293T cells was observed, and transfection was performed when the 293T cells reached 50% coverage;

[0184] The transfection method includes: preparing a transfection reagent, the transfection reagent including liquid A and liquid B, the liquid A including 35 μg of plasmid (including 15 μg of CAR expression vector plasmid, 7.5 μg of helper plasmid RRE, 6 μg of REV and 6 μg of VSVG), 2.5 mol CaCl250 μl, ddH2O Pto500 μl, the liquid B including 500 μl of 2×HEPES salt buffer, the liquid A is allowed to stand for 3 minutes after preparation, the liquid A is added to the liquid B, and bubbles are simultaneously added to the reagent tube with an electric pipette to mix the liquid A and the liquid B, so that the solution in the reagent tube becomes white and turbid, thereby preparing the transfection reagent, adding 1 ml of the transfection reagent to a culture dish of 293T cells, gently shaking, and culturing in a 37° C. incubator for transfection;

[0185] 12-16 hours after transfection, the medium was changed, the culture supernatant was discarded, and 15 ml of DMEM medium containing 10% FBS was added;

[0186] After 48 hours of medium replacement, the culture supernatant was collected by filtering through a 0.45 μm filter, supplemented with 10 ml of DMEM medium containing 10% FBS, and stored at 4°C.

[0187] After 24 h of storage, the culture supernatant was collected by filtration through a 0.45 μm filter;

[0188] The 48-hour culture supernatant and the 72-hour culture supernatant were both concentrated 50 times by a concentration pump and then filtered through a 0.22 μm filter. The filtered virus concentrate was collected, divided into 1.5 ml EP tubes, and stored at -80°C to obtain virus particles.

[0189] In a preferred embodiment of the present application, in the above-mentioned method for preparing immune cells, the preparation of immune cells by using the virus particles comprises:

[0190] removing the virus particles to obtain a virus concentrate;

[0191] Human anticoagulated peripheral blood was collected and diluted with an equal volume of PBS. The diluted human anticoagulated peripheral blood was separated with human lymphocyte separation medium, and peripheral blood mononuclear cells (PBMCs) were collected.

[0192] The T cell concentration in peripheral blood mononuclear cells (PBMCs) was adjusted to 1x10 7 / ml, anti-CD3 and anti-CD28 magnetic beads were added to sort the T cells and activate the cells to make the T cells enter the activated state;

[0193] After 24 hours of T cell activation, the T cells were cultured at a rate of 5x10 5Cells / mL were inoculated into 24-well plates, and the virus concentrate (MOI=5) and infection medium (X-VIVO TM 15 Medium (containing 200 U / mL IL-2 and 8 μg / mL Polybrene) 1 ml for viral infection;

[0194] After 6 h of infection, 1 ml of fresh infection medium was added;

[0195] Continue infection for 48 hours, discard the culture supernatant, and replace with fresh infection medium (X-VIVO TM 15 Medium, containing 100 U / mL IL-2);

[0196] After the infection continues to expand the T cells for 6-8 days, immune cells are obtained.

[0197] The present application provides a method for detecting and functionally identifying the PD-1Ab21 fusion protein in the culture supernatant of PD-1Ab21-CD19CAR-T cells:

[0198] The prepared PD-1Ab21-CD19CAR-T and ordinary CD19CAR-T cells were cultured in CAR-T cell culture medium for 48 hours, and the supernatant was collected. The concentration of PD-1Ab21 fusion protein in the supernatant was detected by ELISA. In order to detect the function of PD-1Ab21 fusion protein in the supernatant to bind to PD-1 molecules expressed on the cell surface, CHO cells stably expressing PD-1 (PD-1 + CHO) cell lines were resuspended in FASC buffer, and a certain amount of CAR-T cell culture supernatant or recombinantly expressed anti-PD-1 single-chain antibody protein was added. After incubation at 4°C for 20 minutes, the supernatant was washed away by centrifugation. CHO was resuspended in FASC buffer, and fluorescently labeled anti-His antibody (PD-1Ab21 fusion protein with a His tag) was added and incubated at 4°C for 20 minutes. The anti-His antibody was washed away by centrifugation, and the PD-1Ab21 fusion protein bound to the CHO cell surface was detected by flow cytometry. The results showed that the ability of the PD-1Ab21 fusion protein in the CAR-T cell culture supernatant to bind to the cell surface PD-1 was basically the same as that of the anti-PD-1 single-chain antibody. + After CHO cells were incubated with PD-1Ab21-CD19CAR-T or ordinary CD19CAR-T cell culture supernatant for 20 minutes, a certain amount of fluorescently labeled anti-PD-1 antibody was added, and the cells were incubated at 4°C for 20 minutes. The anti-PD-1 antibody was washed away by centrifugation, and the PD-1 antibody bound to the CHO cell surface was detected by flow cytometry. The results showed that the PD-1Ab21-CD19CAR-T cell culture supernatant could block the binding of anti-PD-1 antibody to CHO cells, while the ordinary CD19CAR-T cell culture supernatant had no blocking effect.

[0199] To test the biological activity of the PD-1Ab21 fusion protein IL-21 in the supernatant, IL-21R-expressing Baf3 cells were seeded at 5×105 cells / well in 24-well plates. A certain amount of PD-1Ab21-CD19 CAR-T cell culture supernatant or 0.3 μM recombinant IL-21 (positive control) was then added and co-cultured for 30 minutes. Intracellular STAT3 phosphorylation was measured by intracellular flow cytometry. The results showed that the CAR-T cell culture supernatant had the same biological activity as recombinant IL-21 in stimulating IL-21R activation. These results demonstrate that the fusion protein secreted by CAR-T cells has both the binding and blocking effects of the PD-1 antibody and the normal biological activity of IL-21.

[0200] The ELISA detection method for the concentration of PD-1Ab21 fusion protein in the culture supernatant of CAR-T cells is as follows: plate with PD-1 protein, 0.1ug per well, overnight at 4°C; wash the plate 3 times, block with 100ul of 10% FBS per well for 30-60min; wash the plate 3 times, dilute the standard concentration from 200ng / ml in a doubling gradient, 50ul per well, and measure the sample according to the stock solution / 10x / 100x / 1000x, and incubate at room temperature for 2h; wash the plate 3 times, incubate with antibody anti-IL-21-HRP (600x), 50ul per well, incubate at room temperature for 1h in the dark; wash the plate 5 times, add 50ul TMB to each well for color development, the color development time is determined according to the color development degree of the standard curve, generally about 2-3 minutes (determined by the color development effect of the standard curve), add 50ul of 1MH2SO4 to each well to terminate the reaction, and read the analysis at 460nm OD.

[0201] The present application provides a method for in vitro proliferation and phenotypic identification of PD-1Ab21-CD19CAR-T cells:

[0202] In order to study the effect of expression and secretion of PD-1Ab21 on the proliferation and differentiation of CAR-T cells in vitro, the prepared PD-1Ab21-CD19CAR-T and ordinary CD19CAR-T cells were cultured in a culture medium containing 100U / ml or 10U / ml IL-2 for 11 days, and the proliferation fold changes of CD19CAR-T and PD1Ab21-CD19CAR-T were counted and counted every day. The results showed that when cultured in a culture medium containing 100U / mlIL-2, there was no difference in the proliferation of the two CAR-T cells; when cultured in a culture medium containing 10U / mlIL-2, the number of CD19CAR-T cells did not increase significantly, but PD-1Ab21-CD19CAR-T cells were significantly expanded. The phenotype of cultured CAR-T cells was analyzed by flow cytometry, and the results showed that under the culture conditions of 100U / mlIL-2, the stem memory T cells (T cells) in the CAR-T cells secreting PD-1Ab21 increased significantly. SCM , CD45RA+CCR7+) was higher than that of ordinary CD19CAR-T cells. This difference was even more pronounced under the culture conditions of 10U / ml IL-2. At different culture time points, the proportion of stem memory T cells in CAR-T cells secreting PD-1Ab21 was significantly higher than that of ordinary CD19CAR-T cells. These results indicate that PD-1Ab21-CD19CAR-T cells are more likely to differentiate into stem memory T cells.

[0203] To test the proliferation ability of CAR-T cells after stimulation with tumor antigens, the prepared PD-1Ab21-CD19CAR-T and CD19CAR-T cells were mixed with target cells (Daudi-PDL1) at a ratio of 1:5 in the presence of 100 U / ml IL-2 and cultured in 96-well cell culture plates for 2 days. The expression of Ki-67 on the surface of CAR-T cells was detected by flow cytometry. The results showed that the expression of Ki-67 on the surface of PD-1Ab21-CD19CAR-T cells was significantly higher than that of CD19CAR-T cells, indicating that the proliferation ability of PD-1Ab21-CD19CAR-T cells after stimulation with tumor cell surface antigens was significantly higher than that of CD19CAR-T cells.

[0204] This application provides a method for detecting the killing ability of CAR-T cells in vitro and a method for detecting the cytokine production ability of CAR-T cells:

[0205] CD19CAR-T and PD-1Ab21-CD19CAR-T cells were cultured and expanded for 5 days in a medium supplemented with 100 U / ml IL-2. They were mixed with target cells (Daudi-PDL1) at varying effector-target ratios (1:1, 2:1, 5:1, and 10:1) and co-cultured in 96-well plates for 24 hours. Flow cytometry was used to assess the cytotoxicity of CAR-T cells against target cells. The results showed no significant difference in the cytotoxicity of CD19CAR-T and PD-1Ab21-CD19CAR-T cells against CD19+ tumor cells. However, when co-cultured with tumor cells for 8 days at a low effector-target ratio of 1:5, the sustained cytotoxicity of PD-1Ab21-CD19CAR-T cells was significantly enhanced compared to CD19CAR-T cells. Furthermore, the proliferation of PD-1Ab21-CD19CAR-T cells was significantly higher than that of CD19CAR-T cells. On the 8th day, the phenotype of CAR-T cells was detected by flow cytometry, and the results showed that the expression of immune checkpoint molecules (PD-1, TOX, TIGIT) on PD-1Ab21-CD19CAR-T cells was significantly lower than that on CD19CAR-T cells.

[0206] To test the cytokine production capacity of CAR-T cells, the prepared PD-1Ab21-CD19CAR-T and CD19CAR-T cells were mixed with target cells (Daudi-PDL1) at a ratio of 1:5 in the presence of 100 U / ml IL-2 and cultured in 24-well cell culture plates for 2 days. The cells and culture supernatant were collected and intracellular staining was performed. Flow cytometry was used to detect cells expressing cytokines. The results showed that the proportion of IL-2-positive and IFN-γ-positive cells in PD-1Ab21-CD19CAR-T cells was significantly higher than that in CD19CAR-T cells. At the same time, cytokine expression in the culture supernatant was detected using an ELISA kit. The results showed that the concentration of IL-2 in the culture supernatant of PD-1Ab21-CD19CAR-T cells was approximately twice that of the culture supernatant of CD19CAR-T cells, and the concentration of IFN-γ was also significantly higher than that of the culture supernatant of CD19CAR-T cells.

[0207] The above results show that PD-1Ab21-CD19CAR-T cells have stronger anti-tumor functions and proliferation capabilities in the process of identifying and killing tumor cells. At the same time, they tend to differentiate into memory cells and can resist functional failure induced by the tumor microenvironment.

[0208] This application provides preclinical experimental methods for the treatment of B-cell leukemia with PD-1Ab21-CD19CAR-T cells:

[0209] Severely immunodeficient (NSG) mice were inoculated with 2x10 5Human lymphoma cells Raji-Luc (fluorescent) were injected into the tail vein of mice at 5x10 6 The researchers used either CD19CAR-T or PD-1Ab21-CD19CAR-T cells in the humanized B-cell leukemia model, and monitored tumor progression regularly through in vivo imaging of small animals. The results showed that compared to CD19CAR-T, PD-1Ab21-CD19CAR-T significantly inhibited the progression of B-cell leukemia and even completely eliminated the tumor. These results demonstrate that PD-1Ab21-CD19CAR-T has a stronger in vivo anti-tumor effect than CD19CAR-T in the humanized B-cell leukemia model.

[0210] This application provides preclinical experimental methods for the treatment of B-cell lymphoma with PD-1Ab21-CD19CAR-T cells:

[0211] Severely immunodeficient (NSG) mice were subcutaneously inoculated with 5x10 6 Human lymphoma cells Daudi-PDL1, wait until the tumor grows to 150-250mm 3 2x10 6 The mice were treated with CD19CAR-T or PD-1Ab21-CD19CAR-T cells, and the tumor size was measured regularly. The number of CAR-T cells was analyzed by flow cytometry in peripheral blood. The tumor, spleen and peripheral tissues of the mice were taken at certain time points to analyze the CAR-T cells in the tissues. The results showed that compared with CD19CAR-T, PD-1Ab21-CD19CAR-T significantly inhibited tumor growth and significantly improved the survival rate of tumor-bearing mice. In the peripheral blood monitoring of treated mice, we found that the number of CD3 + CD45 + The proportion of cells in the PD-1Ab21-CD19CAR-T cell treatment group was significantly higher than that in the CD19CAR-T cell treatment group. In the analysis of mouse tissues, we found that on the 12th day after CAR-T infusion, the CD3 + CD8 + The T cell ratio and proliferation capacity (Ki67 expression) were significantly higher in the CD19CAR-T cell treatment group. These results indicate that PD-1Ab21-CD19CAR-T has stronger in vivo anti-tumor function than CD19CAR-T in humanized lymphoma models.

[0212] This application provides preclinical experimental methods for the treatment of myeloma with PD-1Ab21-CD19CAR-T cells:

[0213] Severe immunodeficient (NSG) mice were injected with 1x10 7 When the tumors grew to a size where they could be clearly seen using small animal in vivo imaging, 2x10 human myeloma cells were injected into the tail vein of tumor-bearing mice. 6 The researchers treated patients with either BCMACAR-T or PD-1Ab21-BCMACAR-T cells, and regularly monitored tumor progression through in vivo imaging of small animals. The results showed that PD-1Ab21-BCMACAR-T significantly inhibited myeloma progression, and even completely eliminated tumors, compared to BCMACAR-T. These results demonstrate that PD-1Ab21-BCMACAR-T has a stronger in vivo anti-tumor effect than BCMACAR-T in humanized myeloma models.

[0214] This application provides preclinical experimental methods for the treatment of Her2 / neu+ breast cancer with PD-1Ab21-Her2CAR-T cells:

[0215] To study the therapeutic effect of CAR-T cells expressing and secreting PD-1Ab21 on solid tumors, a human Her2 / neu+ breast cancer mouse model was used to treat Her2CAR-T cells. 1x10 7 Human Her2 / neu+ breast cancer cells BT474, wait until the tumor grows to 150-200 mm 3 3x10 6 The researchers treated patients with either Her2CAR-T or PD-1Ab21-Her2CAR-T cells, and measured tumor size regularly. The results showed that PD-1Ab21-Her2CAR-T significantly inhibited tumor growth compared to Her2CAR-T, demonstrating a stronger anti-tumor therapeutic effect. These results suggest that CAR-T cells secreting PD-1Ab21 also possess stronger in vivo anti-tumor activity against solid tumors than conventional CAR-T cells.

[0216] The following provides examples of the preparation and efficacy verification of the CAR-T cells of the present application.

[0217] Six- to eight-week-old female NSG mice were purchased from Jiangsu Jicui Laboratory Animal Co., Ltd. and housed in the immunodeficiency unit of the Institute of Biophysics, Chinese Academy of Sciences. The experimental procedures and mouse handling procedures adhered to the Good Laboratory Animal Care Regulations and were approved by the Institute's Animal Care and Use Committee.

[0218] Cell lines and cell culture used in the examples of this application: human embryonic kidney epithelial cell line 293T, human breast cancer cell line BT474-PDL1, human Burkitt's lymphoma cell line Daudi-PDL1, and human PBMC were obtained from this laboratory. Mouse B cell precursor cell line Baf3 was purchased from Beina Chuanglian Biotechnology Co., Ltd. 293T cells were cultured in DMEM medium (GIBCO) containing 10% inactivated fetal bovine serum (Hyclone) and 1% penicillin / streptomycin (Invitrogen). BT474-PDL1, Daudi-PDL1, and Baf3 cells were cultured in 1640 medium (GIBCO) containing 10% inactivated fetal bovine serum (Hyclone) and 1% penicillin / streptomycin (Invitrogen). All cells were cultured in a 5% CO2 cell culture incubator at 37°C.

[0219] Antibodies in the examples of this application:

[0220] Table 1 Human lymphocyte surface detection antibodies

[0221] Table 2 Human lymphocyte intracellular detection antibodies

[0222] The main reagents and kits of the present invention are:

[0223] Table 3 Reagents and kits

[0224] Example 1: Construction of fusion protein and CD19CAR and PD-1Ab21-CD19CAR

[0225] 1. Construction of fusion protein

[0226] The anti-human PD-1 antibody hybridoma cells were subjected to exon sequencing and humanized antibody sequences were obtained through engineering. The following primers were designed based on the antibody heavy and light chain gene sequences, and the antibody heavy and light chain variable region encoding genes were cloned by PCR. The primer sequences are as follows:

[0227] By PCR technology, respectively using:

[0228] Anti-human PD-1 antibody heavy chain (H) upstream primer:

[0229] Anti-human PD-1 antibody heavy chain (H) downstream primer:

[0230] Anti-human PD-1 antibody light chain (L) upstream primer:

[0231] Anti-human PD-1 antibody light chain (L) downstream primer:

[0232] After cloning the antibody heavy chain (H) and light chain (L) variable region encoding genes, they were connected through a linker sequence (linker1): GGAGGAGGAGGATCTGGAGGAGGAGGAAGCGGAGGAGGAGGATCC to form the coding gene sequence of an anti-PD-1 single-chain antibody PD-1Ab.

[0233] Furthermore, the obtained sequence of PD-1 single-chain antibody (PD-1Ab) was linked to the sequence of human IL-21 encoding gene sequence (SEQ ID No. 15) through another linker sequence consisting of 15 amino acids: linker2: GGAGGAGGAGGAAGCGGAGGAGGAGGATCCGGCGGCGGCGGCTCT. The coding gene of the anti-PD-1 single-chain antibody and IL-21 fusion protein (PD-1Ab21) was obtained, the nucleotide sequence of which is shown in SEQ ID No. 3, and its specific structure is shown in Figure 1a.

[0234] For subsequent protein purification and detection, a gene sequence encoding a linker3 consisting of 5 amino acids and a tag protein 10xHis was added to the C-terminus of the obtained fusion protein. The nucleotide sequence is shown in SEQ ID No. 1, and its specific structure is shown in Figure 1b.

[0235] The primer sequences are as follows:

[0236] IL-21 upstream primer sequence

[0237] IL-21 downstream primer sequences

[0238] 2. Construction of CD19CAR

[0239] CD19CAR consists of an extracellular domain, a transmembrane region, and an intracellular region. The extracellular domain segment is composed of a CD8α signal peptide (its nucleotide sequence and amino acid sequence are shown in SEQ ID No. 23 and 24, respectively), a human CD19 single-chain antibody (its nucleotide sequence and amino acid sequence are shown in SEQ ID No. 31 and 32, respectively), and a CD8α hinge region (its nucleotide sequence and amino acid sequence are shown in SEQ ID No. 33 and 34, respectively). The transmembrane region is composed of a CD8α transmembrane region (its nucleotide sequence and amino acid sequence are shown in SEQ ID No. 35 and 36, respectively). The intracellular domain is composed of a 4-1BB intracellular signaling domain (its nucleotide sequence and amino acid sequence are shown in SEQ ID No. 37 and 38, respectively), and a CD3ζ chain intracellular domain sequence (its nucleotide sequence and amino acid sequence are shown in SEQ ID No. 39 and 40, respectively). The CD19CAR sequence is formed by concatenating the extracellular domain, transmembrane region, and intracellular domain of the CAR. The nucleotide sequence and amino acid sequence are shown in SEQ ID No. 43 and 44, respectively. The specific structural diagram is shown in Figure 1c.

[0240] 3 Construction of PD-1Ab21-CD19CAR

[0241] The obtained fusion protein nucleotide sequence is connected to the CD19CAR sequence through the P2A sequence (whose nucleotide sequence and amino acid sequence are shown in SEQ ID No. 41 and 42, respectively) to form the PD-1Ab21-CD19CAR sequence, whose nucleotide sequence and amino acid sequence are shown in SEQ ID No. 19 and 20, respectively. See Figure 1e for a schematic diagram of the specific construction structure.

[0242] 3. Construction of expression vector plasmid

[0243] The nucleotide sequences of CD19CAR and PD-1Ab21-CD19CAR, SEQ ID No. 43 and 19, were respectively inserted into the CAR expression vector plasmid, and sequencing was performed to verify whether the sequences were correct.

[0244] Example 2: Preparation of CAR-T cells and functional identification of secreted PD-1Ab21 fusion protein

[0245] CAR lentivirus packaging

[0246] 1) Day 1: 16-20 hours before transfection, passage 293T cells in a 10 cm dish at 4 × 106 cells / dish;

[0247] 2) Day 2: Observe the cells from the first passage. When the cells reach 50% confluence, transfection can be performed. First, bring the transfection reagent (2× HEPES saline buffer), the expression vector plasmid constructed in Example 1, and the lentiviral packaging helper plasmid to room temperature. Prepare the transfection complex in a 50ml centrifuge tube. One 50ml centrifuge tube can prepare enough for up to 50 transfection dishes. The transfection system and reagent amounts for a single dish are as follows:

[0248] Solution A: 35 μg of plasmid (including 15 μg of CAR expression vector plasmid, 7.5 μg of helper plasmids RRE, 6 μg of REV), 50 μl of 2.5 mol CaCl2

[0249] ddH2O Up to 500μl

[0250] Solution B: 2×HEPES 500 μl

[0251] After solution A is prepared and allowed to stand for 3 minutes, it is added to solution B 2× HEPES saline buffer. At the same time, use an electric pipette to create bubbles in the tube to quickly and thoroughly mix the two solutions. After mixing, white turbidity can be seen in the solution in the tube, which is the calcium transfer particle. It should be noted that if the mixing is too fast, the calcium transfer particle formation is poor, and if it is too slow, the particles will aggregate. Both situations will reduce the transfection efficiency.

[0252] Add 1 ml of the mixture to the culture dish of 293T cells, shake gently, and culture in a 37°C incubator overnight (12-16 hours);

[0253] 3) On the third day, discard the culture supernatant and carefully and slowly add 15 ml of DMEM medium containing 10% FBS to the cells.

[0254] 4) On the fifth day, collect the viral culture supernatant 48 hours after the medium change and add 10 ml of culture medium; filter through a 0.45 μm filter and store at 4°C for 1 day;

[0255] 5) On the sixth day, the viral culture supernatant 72 hours after the medium change was collected, filtered through a 0.45 μm filter, and concentrated 50-fold using a concentrator pump along with the viral culture supernatant from the 48-hour period. After concentration, the supernatant was filtered again through a 0.22 μm filter, aliquoted into 1.5 ml EP tubes, and stored at -80°C.

[0256] Isolation of PBMC from healthy individuals

[0257] 1) Take concentrated human peripheral blood and dilute it according to the ratio. Dilute 50 ml of concentrated peripheral blood with 70 ml of serum-free 1640 medium and mix well.

[0258] 2) Add 15 ml of lymphocyte separation medium to a 50 ml centrifuge tube, then slowly add 30 ml of diluted peripheral blood along the tube wall using a pipette;

[0259] 3) Slowly place the centrifuge tube into the centrifuge, adjust the centrifuge speed to 3, the speed reduction to 1, and centrifuge at 2200 rpm for 25 minutes;

[0260] 4) After centrifugation, the cells in the centrifuge tube will separate into four layers. Slowly remove the top layer of liquid with a pipette.

[0261] 5) Slowly aspirate the lymphocytes from the second layer into a new 50ml centrifuge tube. Add serum-free 1640 medium to 50ml, mix thoroughly, and centrifuge. Return both the acceleration and deceleration speeds to 9, 1800 rpm, for 10 minutes.

[0262] 6) Discard the supernatant, resuspend the cells in serum-free medium, and centrifuge at 1600 rpm for 6 minutes. Repeat the centrifugation once.

[0263] 7) Count cells and freeze them.

[0264] Activation of T cells in human peripheral blood

[0265] 1) Remove frozen cells from liquid nitrogen, thaw at 37°C, count the cells, adjust the cell density to 1 × 107 / ml, seed into 24-well plates, and incubate overnight.

[0266] 2) The next day, count the cells and calculate the volume of magnetic beads needed based on 1 μl of magnetic beads corresponding to 4 × 105 cells.

[0267] 3) Cell activation with anti-CD3 and anti-CD28 magnetic beads: First, add 1 ml of Gibco medium to a sterile flow cytometry tube, then add the magnetic beads. Place the sterile flow cytometry tube in the magnet groove for about half a minute. Remove the medium from the tube, add the cell suspension, and gently mix with the magnetic beads. After incubating for half an hour with a mixer, transfer the cells to a 24-well plate and incubate the cells overnight.

[0268] 4) Generally, lentiviral infection is performed 24 hours after activation.

[0269] Preparation of CAR-T cells

[0270] 1) Take T cells activated by CD3 / CD28 beads for 24 hours and adjust the density to 1×10 6 / ml, add 500 μl of cell suspension to each well of a 48-well plate;

[0271] 2) Remove the lentivirus from the -80°C freezer, return to room temperature, and add 500 μl to each well;

[0272] 3) Add 8 μg / ml of polybrene and 10 ng / ml of IL-2 to the wells, mix well, and wrap the plate with plastic wrap.

[0273] 4) Centrifugal infection: 2000 g, 30°C, centrifuge for 60 min, acceleration 9, deceleration 0. After centrifugation, remove the plate and place it in a 37°C cell culture incubator.

[0274] 5) On the second day, carefully remove 500 μl of culture medium from the wells and add 500 μl of retrovirus supplemented with Polybrene and IL-2. Centrifuge and infect using the same conditions as above.

[0275] 6) After centrifugation, return the cells to the cell culture incubator. After 6 hours, remove 500 μl of the cells and add CAR-T culture medium. Incubate the cells overnight.

[0276] 7) On the third day, the cells were removed from the wells, 10 ml of CAR-T culture medium was added, centrifuged at 2000 rpm for 10 min, the supernatant was discarded, and the cells were resuspended to 5 × 10 5 / ml, and the expression of CAR (CD19Fc-PE) was detected by flow cytometry, see (Figure 2A), and subsequent operations were performed according to experimental requirements.

[0277] Detection of PD-1Ab21 biological function

[0278] To test the biological function of the PD-1 single-chain antibody of PD-1Ab21 protein, the CHO-PD-1 cell line was used, which highly expresses human PD-1 molecules on its cell surface.

[0279] Binding of PD-1Ab21 protein to cell surface PD-1

[0280] 1) Collect the supernatant of PD-1Ab21CD19CAR-T and CD19CAR-T cultured for 48 hours and concentrate the supernatant 100 times using a 10KD ultrafiltration tube at 2800 rpm (the centrifugation time depends on the concentration);

[0281] 2) Take 1×105 CHO-PD-1 cells and add 50 μl of concentrated supernatant to each cell. Mix the cells thoroughly. Incubate at 4°C for 30 minutes. Add 1 ml of 1x PBS and centrifuge at 4000 rpm for 3 minutes. Discard the supernatant.

[0282] 3) Resuspend the cells in 50 μl FACS medium (1 ml fetal bovine serum + 49 ml PBS). Add 0.5 μl anti-His-PE antibody to the cell suspension, incubate at 4°C for 30 min, add 1 ml 1x PBS, centrifuge at 4000 rpm for 3 min, and discard the supernatant.

[0283] 4) Add 100 μl of PBS to resuspend the cells, pass through a sieve, and analyze by upflow cytometry.

[0284] PD-1Ab21 protein blocks the binding of PD-1 antibody to cell surface PD-1

[0285] 1) Collect the supernatant of PD-1Ab21CD19CAR-T and CD19CAR-T cultured for 48 hours and concentrate the supernatant 100 times using a 10KD ultrafiltration tube at 2800 rpm (the centrifugation time depends on the concentration);

[0286] 2) Take 1×105 CHO-PD-1 cells and add 50 μl of concentrated supernatant to each cell. Mix the cells thoroughly. Incubate at 4°C for 30 minutes. Add 1 ml of 1x PBS and centrifuge at 4000 rpm for 3 minutes. Discard the supernatant.

[0287] 3) Resuspend the cells in 50 μl FACS medium (1 ml fetal bovine serum + 49 ml PBS). Add 0.5 μl anti-PD-1-APC antibody to the cell suspension, incubate at 4°C for 30 min, add 1 ml 1x PBS, centrifuge at 4000 rpm for 3 min, and discard the supernatant.

[0288] 4) Add 100 μl of PBS to resuspend the cells, pass through a sieve, and analyze by upflow cytometry.

[0289] CAR in prepared PD-1Ab21-CD19CAR-T cells + The cell ratio is shown in Figure 2a. After adding the 48h supernatant of PD-1Ab21-CD19CAR-T cells to CHO-PD-1 cells, since the PD-1Ab21 protein secreted by PD-1Ab21-CD19CAR-T cells carries a His tag, the His-positive signal can be detected using an anti-His flow cytometry antibody, that is, the binding of the PD-1Ab21 protein to the PD-1 molecule (Figure 2b); when anti-PD-1 antibody is added, the binding of the PD-1Ab21 protein to the PD-1 molecule blocks the binding of the anti-PD-1 antibody to the PD-1 surface, and no anti-PD-1 positive signal can be detected (Figure 2c).

[0290] PD-1Ab21 protein phosphorylates STAT3 in Baf3 cells

[0291] To detect the biological functions of IL-21 in PD-1Ab21 protein, human IL-21 (0.3uM) and 48h supernatant of PD-1Ab21-CD19CAR-T cells were added to the Baf3 culture system for stimulation, and the effects of human IL-21 and PD-1Ab21 proteins on STAT3 phosphorylation at tyrosine 705 (Y705) were detected.

[0292] 1) Place Baf3 cells in serum-free 1640 Resting overnight;

[0293] 2) Collect the overnight Baf3 cells, centrifuge at 1200 rpm for 3 min, discard the supernatant, and resuspend the cells to 1x10 6 / ml, 24-well plate, 500ul per well;

[0294] 3) IL-21 (0.3 μM) and 48-hour concentrated supernatant of PD-1Ab21-CD19CAR-T cells were added to each well for stimulation and incubated at 37°C for 30 minutes;

[0295] 4) Collect the stimulated Baf3 cells into 500 μl of pre-chilled 4% paraformaldehyde, fix at 4°C for 30 min, then centrifuge at 4000 rpm for 3 min and discard the supernatant;

[0296] 5) Add 1 ml of -20°C pre-cooled methanol to permeabilize the membrane, incubate at 4°C for 30 min, then centrifuge at 4000 rpm for 3 min and discard the supernatant;

[0297] 6) Add 1 ml of FACS buffer to resuspend the cells, centrifuge at 4000 rpm for 3 minutes, discard the supernatant, and repeat once;

[0298] 7) Resuspend the cells by adding 50 μl FACS tubes, add 0.5 μl anti-pSTAT3 antibody to the cell suspension, incubate at 4°C for 30 min, add 1 ml FACS tube, centrifuge at 4000 rpm for 3 min, and discard the supernatant;

[0299] 8) Add 100 μl of PBS to resuspend the cells, pass through a sieve, and analyze by upflow cytometry.

[0300] The results showed that both IL-21 and PD-1Ab21 promoted the phosphorylation of STAT3 at tyrosine 705 (Y705) in Baf3 cells ( Figure 2 d).

[0301] Example 3: In vitro proliferation and phenotypic identification of PD-1Ab21-CD19CAR-T cells

[0302] CAR-T cells were prepared according to the method of Example 2. After 48 hours of viral infection, the virus was removed. CD19CAR-T and PD-1Ab21-CD19CAR-T were cultured under the conditions of IL-2: 10U or 100U respectively.

[0303] The results showed that under the in vitro culture conditions of IL-2 100U / ml, there was no significant difference in the proliferation times of the two CAR-T cells.

[0304] When we lowered the IL-2 concentration to 10 U / ml during in vitro CAR-T culture, we monitored the changes in the proliferation folds of the two CAR-T cells by cell counting during the low-concentration IL-2 in vitro culture. The results showed that in the in vitro CAR-T culture system with an IL-2 concentration of 10 U / ml, CD19CAR-T cells were essentially non-proliferative, while PD-1Ab21-CD19CAR-T cells showed sustained proliferation during the first 7 days of culture, showing a stronger proliferation capacity than CD19CAR-T cells (Figure 3a).

[0305] We further analyzed the changes in the two CAR-T phenotypes during in vitro culture using flow cytometry.

[0306] Surface dyeing:

[0307] 1) Take 5×10 5 Cells / samples were placed in a 1.5 ml EP tube and resuspended with 100 μl FACS buffer;

[0308] 2) Take the fluorescently labeled antibody to be tested and the isotype control antibody, label them in the dark at 4°C for 20 minutes, wash with 1 ml of FACS buffer, and centrifuge at 4000 rpm for 3 minutes;

[0309] 3) Add 100 μl of PBS to resuspend the cells, pass through a sieve, and analyze by upflow cytometry.

[0310] We found that under IL-2 10U / ml conditions, the proportion of Tscm (CD45RA+CCR7+) cells in CD4 or CD8 T cells at different culture days was counted (Figures 3b and 3c). At the same time, under IL-2 10U / ml conditions, the expression of CD45RA, CCR7, CD62L, CD45RO, and CD28 in CD4 or CD8 T cells at different culture days was counted (Figure 3d). The results showed that PD-1Ab21 can induce CD19CAR-T cells to differentiate into Tscm (CD45RA+CCR7+) cells and have stronger sustained proliferation ability.

[0311] Example 4: Identification of the in vitro killing function of PD-1Ab21-CD19CAR-T cells

[0312] In order to detect the difference in the ability of PD-1Ab21-CD19CAR-T and CD19CAR-T to kill tumor cells in vitro, CAR-T cells were prepared according to the method of Example 2. We selected CAR-T cultured for the fifth day in vitro with IL-2 100U / ml and co-cultured in 96-well plates for 24 hours at an E(CAR-T):M(Daudi-PDL1) ratio of 1:1 / 2:1 / 5:1 / 10:1 to detect the killing ability of CAR-T cells. The results showed that there was no difference in the short-term tumor cell killing ability of CD19CAR-T and PD-1Ab21-CD19CAR-T (Figure 4a).

[0313] In order to study the sustained killing ability of PD-1Ab21-CD19CAR-T and CD19CAR-T on tumor cells, we selected CAR-T cultured for the fifth day with IL-2 100U / ml in vitro and cultured for 8 days at an E(CAR-T):M(Daudi-PDL1) ratio of 1:5 to detect the sustained killing ability of CD19CAR-T and PD-1Ab21-CD19CAR-T; during the sustained killing process, the ratio of T cells and tumor cells was detected by flow cytometry (Figure 4b). The surface staining method of Example 3 was used for staining, and the number of T cells and tumor cells (Daudi-PDL1) and the changes in the CD8 / CD4 Ratio were detected by cell counting (Figure 4c). The results showed that the sustained killing ability of PD-1Ab21-CD19CAR-T was significantly enhanced compared with CD19CAR-T.

[0314] Example 5: In vitro proliferation and cytokine secretion capacity detection of PD-1Ab21-CD19CAR-T cells

[0315] In order to detect the differences in proliferation and cytokine secretion between PD-1Ab21-CD19CAR-T and CD19CAR-T after co-culture with tumor cells, CAR-T cells were prepared according to the method of Example 2. We used CAR-T cultured for the fifth day with IL-2 100U / ml in vitro and co-cultured for 2 days with an E(CAR-T):M(Daudi-PDL1) ratio of 1:5 to detect the expression of Ki-67 in CD19CAR-T and PD-1Ab21-CD19CAR-T cells (Figure 5a).

[0316] Ki-67 staining in the nucleus

[0317] 1) Place 1 × 106 cells / sample in a 1.5 ml EP tube and resuspend in 100 μl FACS Buffer;

[0318] 2) Add surface marker antibody and label for 20 minutes at 4°C in the dark. Simultaneously set up an isotype control tube (same number of cells).

[0319] 3) Wash twice with 1 ml FACS Buffer;

[0320] 4) For nuclear staining of Ki-67 and TCF-1, suspend the cells in 200 μl of Fixation / Permeabilization working solution, incubate at 4°C in the dark, and fix overnight.

[0321] 5) Wash twice with 1 ml of 1× Permeabilization Buffer to permeabilize the membrane;

[0322] 6) Resuspend the cells in 100 μl Permeabilization Buffer; then add anti-Ki-67 and anti-TCF-1 and incubate at 4°C for 30 minutes;

[0323] 7) Wash twice with 1 ml of Permeabilization Buffer to remove unbound antibodies.

[0324] 8) Add 100 μl of PBS to resuspend the cells, pass through a sieve, and analyze by upflow cytometry.

[0325] The results showed that the expression of Ki-67, a proliferation marker, was significantly enhanced in CD19CAR-T cells that secreted PD-1Ab21, indicating that CD19CAR-T cells that secreted PD-1Ab21 had stronger proliferation ability.

[0326] Under the above conditions, the secretion and expression of IL-2 and IFN-γ by CD19CAR-T and PD-1Ab21-CD19CAR-T cells were detected by flow cytometry and ELISA kits (Figures 5b and 5c). The methods were referred to the kit instructions (Invitrogen: Catalog Number 88-7025). The results showed that the ability of PD-1Ab21-CD19CAR-T cells to secrete cytokines was significantly enhanced compared with CD19CAR-T cells. This further demonstrates that the proliferation ability and cytokine secretion ability of PD-1Ab21-CD19CAR-T cells are significantly enhanced compared with CD19CAR-T cells.

[0327] Example 6: Detection of Exhaustion Phenotype of PD-1Ab21-CD19CAR-T Cells

[0328] In order to detect the expression of exhaustion markers of PD-1Ab21-CD19CAR-T and CD19CAR-T after co-culture with tumor cells in vitro, cell surface staining and nuclear staining were performed as described in Example 5. We selected CAR-T cultured with IL-2 100 U / ml in vitro for the fifth day at an E(CAR-T):M(Daudi-PDL1) ratio of 1:10. After 8 days of co-culture, we first detected the changes in the ratio and number of CD19CAR-T and PD-1Ab21-CD19CAR-T after 8 days of co-culture with tumor cells by flow cytometry and cell counting (Figures 6a and 6b). The results again showed that PD-1Ab21-CD19CAR-T had significantly stronger proliferation and sustained killing ability against tumor cells than CD19CAR-T.

[0329] Flow cytometry was used to detect the expression of exhaustion markers PD-1, TIGIT, TOX, and LAG3 on CD8 T cells in CD19CAR-T and PD-1Ab21-CD19CAR-T cells after 8 days of co-culture with tumor cells. The results showed that the expression of exhaustion markers in PD-1Ab21-CD19CAR-T was significantly weakened compared with CD19CAR-T (Figure 6c).

[0330] Example 7: PD-1Ab21-CD19CAR-T cells have significant anti-tumor therapeutic effects in a humanized mouse B cell leukemia model

[0331] In the animal experiments of this example and Examples 8-9 below, we constructed and used CAR-T cells that can express and secrete fusion proteins without His tags, and the construction method thereof is basically as described in Examples 1 and 2. Specifically, first, referring to the method of Example 1, a CAR expression vector was constructed, wherein, except that the nucleotide sequence of the fusion protein PD-1Ab21 was replaced by SEQ ID No.1 with SEQ ID No.3, the nucleotide sequences of the remaining domains were as shown in Example 1. The specific construction structure schematic is shown in Figure 1d. The nucleotide sequence and amino acid sequence of the finally constructed PD-1Ab21-CD19CAR are shown in SEQ ID No.21 and 22, respectively; then, using the CAR expression vector, PD-1Ab21-CD19CAR-T cells were constructed according to the method of Example 2.

[0332] To explore whether the PD-1Ab21-CD19CAR-T cells we constructed have better anti-tumor effects, we first conducted anti-tumor therapeutic effects in a humanized mouse B cell leukemia model. We inoculated 2×10 5Raji-Luc tumor cells were injected into the tail vein (iv) with CAR + 5×10 6 CD19CAR-T and PD-1Ab21-CD19CAR-T cells (Figure 7a). Tumor progression was detected by in vivo imaging of small animals every 3 days as follows:

[0333] Small Animal Imaging

[0334] 1) Each mouse was intraperitoneally injected with 2 mg of Luciferin substrate and the timer was started simultaneously;

[0335] 2) Anesthetize the mouse by intraperitoneal injection of tribromoethanol or ethylflurane anesthesia;

[0336] 3) Approximately 5 minutes after the injection of sodium fluorescein, the mouse was placed in an IVIS Lumina3 in vivo imager with an exposure time of 1 minute to collect images for detection.

[0337] In vivo imaging of small animals monitoring tumor progression is shown in Figure 7b. The results show that, under high tumor burden conditions, while CD19CAR-T cells can inhibit leukemia progression to a certain extent compared to the control group, they ultimately fail to eliminate the tumor and the mice die. However, PD-1Ab21-CD19CAR-T cells can significantly inhibit tumor progression and completely eliminate the tumor, achieving a cure. These results demonstrate that PD-1Ab21-CD19CAR-T cells have significantly superior anti-tumor therapeutic efficacy to CD19CAR-T cells in a humanized mouse B-cell leukemia model.

[0338] Example 8: PD-1Ab21-CD19CAR-T cells have significant anti-tumor therapeutic effects in a humanized mouse lymphoma model

[0339] To investigate whether our constructed PD-1Ab21-CD19CAR-T cells mediate a stronger anti-tumor effect than CD19CAR-T in humanized mouse lymphoma models, we subcutaneously inoculated 5×10 6 Daudi-PDL1 tumor cells, wait until the tumor grows to 150-250 mm3 2x10 6The mice were treated with CD19CAR-T or PD-1Ab21-CD19CAR-T cells, and the tumor size was measured regularly (Figure 8a). The results showed that PD-1Ab21-CD19CAR-T cells significantly improved the survival rate of mice compared with CD19CAR-T cells (Figure 8b) and inhibited tumor growth (Figure 8c). By monitoring the changes in the proportion of CD3+CD45+CAR-T cells in the peripheral blood after treatment, cell surface staining was performed as described in Example 5. We found that the proportion of CD3+CD45+CAR-T cells in the PD-1Ab21-CD19CAR-T cell treatment group in the peripheral blood was significantly higher than that in the CD19CAR-T cell treatment group (Figure 8d). Therefore, these results indicate that in the Daudi-PDL1 tumor treatment model, the PD-1Ab21-CD19CAR-T cells we constructed have stronger anti-tumor function in vivo than CD19CAR-T cells.

[0340] Example 9: PD-1Ab21 promotes the proliferation and stemness differentiation of CAR-T cells, thereby mediating stronger anti-tumor effects

[0341] The above results prove that the PD-1Ab21-CD19CAR-T cells we constructed have stronger anti-tumor function in vivo than CD19CAR-T cells. Next, we further explored the mechanism by which the PD-1Ab21-CD19CAR-T cells we constructed mediate stronger anti-tumor function. The proportion of CD3+CD45+CAR-T cells in the peripheral blood of mice treated with PD-1Ab21-CD19CAR-T cells was significantly higher than that in the CD19CAR-T cell treatment group (Figure 8d). This result attracted our attention. We hypothesized that the PD-1Ab21 synthesized and secreted by the constructed PD-1Ab21-CD19CAR-T cells acts on itself in an autocrine or paracrine form, promoting the proliferation of CAR-T cells in vivo, thereby inducing a stronger anti-tumor effect.

[0342] To verify our hypothesis, we used the Daudi-PDL1 treatment model and collected peripheral blood, spleen, tumor and other tissues of mice for flow cytometry analysis on the 12th day after CAR-T therapy (Figure 9a).

[0343] Detection of CAR-T cells in peripheral blood

[0344] 1) Add 20ul of EDTA (50mM) to the EP tube in advance and collect about 3 drops of blood from each animal.

[0345] 2) Add 1 ml of ACK Lysis Red to each tube, lyse until transparent, and centrifuge at 4000 rpm for 3 minutes. Discard the supernatant with a pipette.

[0346] 3) Resuspend cells in 1 ml FACS medium (1 ml serum + 49 ml 1X PBS), centrifuge at 4000 rpm for 3 min, and discard the supernatant with a pipette.

[0347] 4) Mix for flow cytometry: 50 μl of the mix per sample. Two more samples can be mixed depending on the number of samples to be tested. Prepare the sample for FACS. For flow cytometry antibodies, add 0.5 μl of human antibody per sample and 0.25 μl of mouse antibody per sample. Add 50 μl of the mix to each sample, resuspend the cells with a pipette, and incubate at 4°C for 30 minutes.

[0348] 5) Add 1 ml of FACS buffer to each sample to wash away the antibodies, centrifuge at 4000 rpm for 3 min, and discard the supernatant.

[0349] 6) Add 100 μl of PBS to resuspend the cells, pass through a sieve, and analyze by upflow cytometry.

[0350] Preparation of spleen single cell suspension

[0351] 1) After killing mice by dislocation, the spleen was removed and placed in a culture dish containing 1640 culture medium.

[0352] 2) Gently grind the tissue using a frosted glass slide, resuspend in culture medium, and pass through a 40 μm mesh;

[0353] 3) Centrifuge at 2000 rpm for 10 min and discard the supernatant;

[0354] 4) Add 1 ml of ACK red blood cell lysis buffer to lyse the red blood cells, mix well, and lyse for 5 minutes;

[0355] 5) Add 10 ml of PBS to terminate the lysis reaction and centrifuge at 2000 rpm for 10 min;

[0356] 6) Discard the supernatant and resuspend the cells in 1640 complete medium to prepare a single-cell suspension.

[0357] Preparation of tumor single cell suspension

[0358] 1) After killing the mouse by dislocation, the subcutaneous tumor tissue was removed with scissors;

[0359] 2) Place the tumor tissue in a 5ml EP tube and mince it as finely as possible with scissors. Then, add a certain amount of three-enzyme digestion solution based on the tumor weight and digest at 37°C for approximately 20 minutes.

[0360] 3) Remove the tumor tissue, add 10 times the volume of digestive enzyme in PBS solution to terminate the reaction, and centrifuge at 2000 rpm for 10 minutes;

[0361] 4) Resuspend the cells in FACS buffer and pass through a 40 μm sieve to prepare a single-cell suspension.

[0362] First, the proportion of CAR-T cells infused back into these sites was detected by flow cytometry. In the body, anti-tumor effects are mainly exerted by CD8+CAR-T cells. Therefore, we detected the proportion of CD3+CD8+CAR-T cells in these sites in the PD-1Ab21-CD19CAR-T cell treatment group and the CD19CAR-T cell treatment group. The results showed that the proportion of CD3+CD8+CAR-T cells in the CD19CAR-T-hPD-1Ab21 cell treatment group was significantly higher than that in the CD19CAR-T cell treatment group (Figure 9b).

[0363] Ki67 is a marker of cell proliferation, so we detected the expression of Ki67 of CD8+CART in the spleen and tumor sites. The intranuclear staining was referred to Example 5; the results showed that the proportion of Ki67+CD8+ cells in the PD-1Ab21-CD19CAR-T cell treatment group in the tumor and spleen sites was significantly higher than that in the CD19CAR-T cell treatment group (Figure 9c). These results once again indicate that the infused PD-1Ab21-CD19CAR-T cells have a stronger proliferation ability than CD19CAR-T cells, and the proliferated CAR-T cells are mainly CD3+CD8+CAR-T cells.

[0364] In order to analyze the effector function of effector CD8+T cells in tumor sites on tumor killing, we next detected the phenotype of CD3+CD8+CAR-T cells infiltrating the tumor sites of the two CAR-T cell treatment groups. Cell surface staining was performed with reference to Example 4. The results showed that there was no significant difference in CD45RA+CD62L- effector CD8+T cells and CD45RA-CD62L- effector memory CD8+T cells between the two CAR-T treatment groups (Figure 9d). At the same time, we found that the proportion of CD45RA+CD62L+ stem memory CD8+T cells and CD45RA-CD62L+ central memory CD8+T cells was significantly increased in the PD-1Ab21-CD19CAR-T treatment group, which further indicates that the PD-1Ab21 secreted by the PD-1Ab21-CD19CAR-T cells we constructed promotes the proliferation and stem differentiation of CAR-T cells, thereby mediating a stronger anti-tumor effect.

[0365] Example 10: PD-1Ab21-BCMACAR-T cells have significant anti-tumor therapeutic effects in a humanized mouse myeloma model

[0366] In order to study the therapeutic effect of CAR-T cells expressing and secreting PD-1Ab21 on myeloma, a human myeloma mouse model was used to treat BCMACAR-T cells. We constructed BCMACAR-T and PD-1Ab21-BCMACAR-T with reference to the methods in Examples 1 and 2. Specifically, first, referring to the method in Example 1, CAR expression vectors of BCMACAR and PD-1Ab21-BCMACAR were constructed, wherein the nucleotide sequence of the fusion protein PD-1Ab21 was replaced by SEQ ID No.1 with SEQ ID No.3, and the nucleotide sequence of the specific single-chain antibody fragment targeting CD19, SEQ ID No.31, was replaced with the nucleotide sequence of the specific single-chain antibody fragment targeting BCMA, SEQ ID No.45. The nucleotide sequences of the remaining domains are as shown in Example 1, and the schematic diagrams of the specific construction structures are shown in Figures 1c and 1d, respectively. The nucleotide sequence and amino acid sequence of the finally constructed BCMACAR are shown in SEQ ID No. 53 and 54, respectively, and the nucleotide sequence and amino acid sequence of PD-1Ab21-BCMACAR are shown in SEQ ID No. 55 and 56, respectively; then, BCMACAR-T cells and PD-1Ab21-BCMACAR-T cells were constructed using the CAR expression vector according to the method of Example 2.

[0367] We inoculated 1×10 7 U266-Luc myeloma cells were transfused with CAR+2×10 6 BCMACAR-T and PD-1Ab21-BCMACAR-T cells (Figure 10a). Tumor progression was detected by in vivo imaging of small animals every week. For specific methods, see Example 7.

[0368] The results showed that compared with the control group, BCMACAR-T cells were able to inhibit myeloma progression after reinfusion but were unable to eliminate the tumor; however, PD-1Ab21-BCMACAR-T cells were able to rapidly inhibit myeloma progression within a week after reinfusion and were able to completely eliminate the tumor burden, achieving tumor cure (Figure 10b). These results demonstrate that PD-1Ab21-BCMACAR-T cells have a significant anti-tumor therapeutic effect in a humanized mouse myeloma model.

[0369] Example 11: PD-1Ab21-Her2CAR-T cells have significant anti-tumor therapeutic effects in a humanized mouse breast cancer model

[0370] To study the therapeutic effect of CAR-T cells expressing and secreting PD-1Ab21 on solid tumors, a human Her2 / neu+ breast cancer mouse model was used for Her2CAR-T cell therapy.

[0371] We constructed Her2CAR-T and PD-1Ab21-Her2CAR-T by referring to the methods in Examples 1 and 2. Specifically, first, referring to the method of Example 1, CAR expression vectors of Her2CAR and PD-1Ab21-Her2CAR were constructed, wherein the nucleotide sequence of the fusion protein PD-1Ab21 was replaced by SEQ ID No.1 to SEQ ID No.3, and the nucleotide sequence of the specific single-chain antibody fragment targeting CD19 SEQ ID No.31 was replaced by the nucleotide sequence of the specific single-chain antibody fragment targeting Her2 SEQ ID No.57. The nucleotide sequences of the remaining domains are as shown in Example 1, and the specific construction structure schematics are shown in Figures 1c and 1d, respectively. The nucleotide sequence and amino acid sequence of the Her2CAR finally constructed are shown in SEQ ID No.65 and 66, respectively, and the nucleotide sequence and amino acid sequence of PD-1Ab21-Her2CAR are shown in SEQ ID No.67 and 68, respectively; then, Her2CAR-T cells and PD-1Ab21-Her2CAR-T cells were constructed using the CAR expression vector according to the method of Example 2. 1x10 7 Human Her2 / neu+ breast cancer cells BT474, wait until the tumor grows to 150-200 mm3 3x10 6 The tumor size was measured regularly (Figure 11a). The results showed that compared with Her2CAR-T, PD-1Ab21-Her2CAR-T significantly inhibited tumor growth and showed a stronger anti-tumor therapeutic effect (Figure 11b). The tumor length (a) and width (b) were measured, and the tumor volume was calculated as (ab 2 / 2) (Figure 11c). The above results show that CAR-T cells secreting PD-1Ab21 also have stronger in vivo anti-tumor function against solid tumors compared with ordinary CAR-T cells.

[0372] The present invention aims to protect an immune cell and its expression vector, application and preparation method, which have the following effects:

[0373] 1. The immune cells of the present application (PD-1Ab21-CAR-T cells, PD-1Ab21-TCR-T cells, PD-1Ab21-CAR-NK cells, PD-1Ab21-TIL cells), while playing the role of ordinary immune cells in recognizing and killing tumor cells, can express and secrete PD-1 single-chain antibody and IL-21 fusion protein PD-1Ab21, which can block the PD-1 inhibitory signal on CAR-T, and at the same time target IL-21 to immune cells, promote the proliferation of immune cells, and differentiate into memory cells, which can significantly enhance the anti-tumor effect of immune cells and improve the effect of tumor treatment.

[0374] 2. Since cytokines act on numerous target cells, systemic application has significant side effects, which greatly limits the application of cytokines in disease treatment. The PD-1Ab21 fusion protein secreted by immune cells in this application can target PD-1+ anti-tumor T cells in vivo, reducing the chance of acting on other cells and greatly reducing the systemic side effects of the cytokine IL-21.

[0375] It should be understood that the above-mentioned specific embodiments of the present application are merely illustrative or explain the principles of the present application and do not constitute a limitation of the present application. Therefore, any modifications, equivalent substitutions, improvements, etc. made without departing from the spirit and scope of the present application should be included in the scope of protection of the present application. In addition, the claims attached hereto are intended to cover all variations and modifications that fall within the scope and boundaries of the appended claims, or the equivalent forms of such scope and boundaries.

Claims

1. A fusion protein, characterized in that The fusion protein includes PD-1 single-chain antibody and IL-21.

2. The fusion protein according to claim 1, characterized in that The PD-1 single-chain antibody comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises HCDR1, HCDR2 and HCDR3, which respectively comprise or consist of the amino acid sequences of SEQ ID No.69, SEQ ID No.70 and SEQ ID No.71, the light chain variable region comprises LCDR1, LCDR2 and LCDR3, which respectively comprise or consist of the amino acid sequences of SEQ ID No.72, SEQ ID No.73 and SEQ ID No.74; and IL-21 comprises or consists of the amino acid sequence of SEQ ID No.

16.

3. An immune cell, characterized in that The fusion protein according to claim 1 or 2 can be expressed and secreted.

4. The immune cell according to claim 3, characterized in that The immune cells specifically recognize at least one of blood malignancies, lung cancer, breast cancer, liver cancer, pancreatic cancer, kidney cancer, prostate cancer, ovarian cancer, digestive tract tumors, brain tumors, neuroendocrine tumors, bone tumors, and soft tissue tumors.

5. The immune cell according to claim 3 or 4, characterized in that The immune cells are selected from at least one of CAR-T cells, TCR-T cells, CAR-NK cells, and TIL cells.

6. A viral vector, characterized in that Capable of expressing the fusion protein as claimed in claim 1 or 2.

7. The viral vector according to claim 6, characterized in that The PD-1 single-chain antibody comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises HCDR1, HCDR2 and HCDR3, which respectively comprise or consist of the amino acid sequences of SEQ ID No.69, SEQ ID No.70 and SEQ ID No.71, the light chain variable region comprises LCDR1, LCDR2 and LCDR3, which respectively comprise or consist of the amino acid sequences of SEQ ID No.72, SEQ ID No.73 and SEQ ID No.74; and IL-21 comprises or consists of the amino acid sequence of SEQ ID No.

16.

8. The viral vector according to claim 6 or 5, characterized in that After the viral expression vector infects cells, the cells secrete the fusion protein as claimed in claim 1 or 2.

9. An immune cell expression vector, characterized in that: It comprises an expression plasmid targeting a specific antigen, a P2A sequence fragment, and a coding sequence fragment of the fusion protein according to claim 1 or 2; The expression plasmid targeting a specific antigen comprises an extracellular domain, a transmembrane domain and an intracellular domain; The extracellular domain includes a CD8α signal peptide fragment, a specific antibody fragment and a CD8α hinge region fragment; The transmembrane domain includes a CD8α transmembrane region fragment; The intracellular domain includes a 4-1BB signal transduction domain fragment and a CD3ζ signal transduction domain fragment.

10. The immune cell expression vector according to claim 9, characterized in that: The PD-1 single-chain antibody comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises HCDR1, HCDR2 and HCDR3, which respectively comprise or consist of the amino acid sequences of SEQ ID No.69, SEQ ID No.70 and SEQ ID No.71, the light chain variable region comprises LCDR1, LCDR2 and LCDR3, which respectively comprise or consist of the amino acid sequences of SEQ ID No.72, SEQ ID No.73 and SEQ ID No.74; and IL-21 comprises or consists of the amino acid sequence of SEQ ID No.

16.

11. The immune cell expression vector according to claim 9 or 8, characterized in that: The cDNA sequence of the coding sequence fragment of the fusion protein according to claim 1 or 2 is shown as SEQ ID No. 1 or 3.

12. The immune cell expression vector according to any one of claims 9 to 11, characterized in that: The specific antibody fragments include specific single-chain antibody fragments targeting CD19, and / or specific single-chain antibody fragments targeting BCMA, and / or specific antibody fragments targeting Her2 / neu tumor antigen.

13. Use of immune cells in the treatment of B cell leukemia, B cell lymphoma, myeloma, Her2 / neu+ breast cancer, and advanced B cell malignancies, characterized in that: The immune cell is the immune cell according to any one of claims 3 to 5.

14. The method for preparing immune cells according to any one of claims 3 to 5, characterized in that: include: Constructing a gene encoding the fusion protein as claimed in claim 1 or 2; Constructing an immune cell expression vector expressing the fusion protein according to claim 1 or 2; Performing virus packaging on the immune cell expression vector to obtain virus particles; Immune cells are prepared by using the virus particles.

15. The method for preparing immune cells according to claim 14, characterized in that: The gene encoding the fusion protein of claim 1 or 2 comprises: A humanized PD-1 antibody is selected, and the heavy chain variable region and the light chain variable region are connected together through Linker1 to obtain a PD-1 single-chain antibody targeting specific cells; The PD-1 single-chain antibody targeting specific cells is connected to the cDNA sequence of the IL-21 cytokine through a linker Linker2 and DNA fragments are synthesized to obtain a gene encoding the fusion protein as claimed in claim 1 or 2.

16. The method for preparing immune cells according to claim 14, characterized in that: The immune cell expression vector constructed to express the fusion protein according to claim 1 or 2 comprises: Using a lentiviral vector pCDH to construct an expression plasmid targeting a specific antigen, wherein the expression plasmid targeting a specific antigen includes an extracellular domain, a transmembrane domain, and an intracellular domain; The extracellular domain includes a CD8α signal peptide fragment, a specific antibody fragment and a CD8α hinge region fragment; The specific antibody fragments include specific single-chain antibody fragments targeting CD19, and / or specific single-chain antibody fragments targeting BCMA, and / or specific antibody fragments targeting Her2 / neu tumor antigen; The transmembrane domain includes a CD8α transmembrane region fragment; The intracellular domain includes a 4-1BB signal transduction domain fragment and a CD3ζ signal transduction domain fragment; Connecting the coding sequence fragment of the fusion protein as claimed in claim 1 or 2 to the back of the coding fragment of the expression plasmid targeting the specific antigen through the P2A sequence fragment; Optionally, a His tag is connected to the C-terminus of the entire sequence to obtain an immune cell expression vector expressing the fusion protein as described in claim 1 or 2.

17. The method for preparing immune cells according to claim 14, characterized in that: The step of packaging the immune cell expression vector with a virus to obtain virus particles comprises: Virus packaging was performed using the calcium phosphate transfection method; 16-20 hours before transfection, select 293T cells for subculture and seed each cell culture dish with 4×10 6 293T cells; 20-24 h after inoculation, the passage of 293T cells was observed, and transfection was performed when the coverage of 293T cells reached 50%; The transfection method comprises: preparing a transfection reagent, wherein the transfection reagent comprises liquid A and liquid B, wherein the liquid A comprises 35 μg of plasmid, 50 μl of 2.5 mol CaCl2, and 500 μl of ddH2O, wherein the plasmid comprises 15 μg of CAR expression vector plasmid, 7.5 μg of auxiliary plasmid RRE, 6 μg of REV, and 6 μg of VSVG, and the liquid B comprises 500 μl of 2×HEPES salt buffer, the liquid A is allowed to stand for 3 minutes after preparation, the liquid A is added to the liquid B, and bubbles are simultaneously created in a reagent tube with an electric pipette to mix the liquid A and the liquid B, and the solution in the reagent tube becomes white turbid, thereby preparing the transfection reagent, and 1 ml of the transfection reagent is added to a culture dish of 293T cells, gently shaken, and placed in a 37° C. incubator for culture to perform transfection; 12-16 hours after transfection, change the medium, discard the culture supernatant, and add 15 ml of DMEM medium containing 10% FBS; After 48 hours of medium replacement, the culture supernatant was collected by filtering through a 0.45 μm filter, supplemented with 10 ml of DMEM medium containing 10% FBS, and stored at 4°C; After 24 h of storage, the culture supernatant was collected by filtering through a 0.45 μm filter; The 48h culture supernatant and the 72h culture supernatant were concentrated 50 times by a concentration pump, and then filtered through a 0.22μm filter. The filtered virus concentrate was collected, divided into 1.5ml EP tubes, and stored at -80°C to obtain virus particles.

18. The method for preparing immune cells according to claim 14, characterized in that: The immune cells prepared by the virus particles include: Taking out the virus particles to obtain a concentrated virus solution; Take human anticoagulated peripheral blood, dilute it with an equal volume of PBS, separate the diluted human anticoagulated peripheral blood with human lymphocyte separation solution, and collect peripheral blood mononuclear cells (PBMCs); The concentration of T cells in peripheral blood mononuclear cells (PBMCs) was adjusted to 1x10 7 / ml, add anti-CD3 and anti-CD28 magnetic beads to sort T cells, and activate the cells to make T cells enter the activated state; After 24 hours of T cell activation, the T cells were cultured at 5x10 5 10 cells / mL were inoculated into a 24-well plate, and 1 ml of the virus concentrate and infection medium were added for virus infection; After 6 h of infection, 1 ml of fresh infection medium was added; Continue infection for 48 hours, discard the culture supernatant, and replace with fresh infection medium; After continued infection to allow T cells to expand for 6-8 days, immune cells were obtained.

Images