Compositions and methods for modulating wisp2 super-enhancer-associated RNA

Abstract

Disclosed herein are modulators of a long noncoding transcript, wherein expression of the long- noncoding transcript is associated with initiation, development, or prognosis of cardiac fibrosis.

Description

COMPOSITIONS AND METHODS FOR MODULATING WISP2 SUPER-ENHANCER- ASSOCIATED RNACROSS REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 538,198, filed September 13, 2023, U.S. Provisional Application No. 63 / 597,821, filed November 10, 2023, U.S. Provisional Application No 63 / 559,107, filed February 28, 2024, and U.S. Provisional Application No. 63 / 655,557, filed June 3, 2024, each of which is incorporated herein by reference in its entirety.BACKGROUND OF THE DISCLOSURE

[0002] Only a small portion of mammalian genome is transcribed to protein-coding mRNAs, with the rest is transcribed to non-coding RNAs. Among them, long non-coding RNAs (IncRNA) are a type of RNA with usually more than 200 nucleotides that are not translated into protein. LncRNAs have been shown to regulate gene expression networks at different levels via various mechanisms (see, e.g., Yao et al., Nature Cell Biology, 21, pp. 542-551, 2019).

[0003] Cardiac fibrosis is one of the leading causes of heart failure. Wisp2 super-enhancer- associated RNA (WISPER) is a IncRNA that has been identified as a cardiac fibroblast-related and / or enriched IncRNA associated with development of cardiac fibrosis (e.g., cardiac fibroblast proliferation, migration, and survival) in the model of myocardial infarction and in the tissues from aortic stenosis, suggesting WISPER as a potential therapeutic target for treating cardiac fibrosis. However, there are no comprehensive WISPER-targeting therapies, calling for a need to further investigate and develop WISPER-targeting therapies that directly or indirectly modulate cardiac fibrosis.INCORPORATION BY REFERENCE

[0004] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over any such contradictory material.SUMMARY OF THE DISCLOSURE

[0005] The present disclosure provides identification of long non-coding RNAs associated with cardiac fibrosis. For example, Wisp2 super-enhancer-associated RNA (WISPER) is a long noncoding RNA that is associated with cardiac fibroblast and / or regulates cardiac fibrosis. The present disclosure further provides compositions and methods of reducing cardiac fibrosis in a subject in need thereof by modulating (e.g., activating, suppressing, or supplementing) the expression or activity of cardiac fibrosis associated IncRNAs (e g., WISPER).

[0006] In some aspects, provided herein is an oligonucleotide modulating the activity or the expression of a long non-coding RNA that is associated with cardiac fibrosis, wherein the oligonucleotide is at least partially complementary to a portion of a sequence of one of SEQ ID NOs: 171-188 or a sequence from Tables 1-3. In some instances, the oligonucleotide is at least 70%, 80%, or 90% complementary to at least 13 consecutive nucleotides from one of SEQ ID NOs: 171 -188 or a sequence from Tables 1-3. In some instances, the oligonucleotide is at least partially complementary to a portion of a sequence of one of SEQ ID NOs: 174-183 and 185-188. In some instances, the oligonucleotide is at least 70%, 80%, or 90% complementary to at least 13 consecutive nucleotides from one of SEQ ID NOs: 174-183 and 185-188. In some instances, the oligonucleotide comprises a nucleic acid sequence having at least 10, 11, 12, or 13 contiguous nucleotides with no more than 1, 2, or 3 mismatches from any one of nucleic acid sequences in Table 4. In some instances, the oligonucleotide comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to one of nucleic acid sequences in Table 4. In some instances, the oligonucleotide is about 14-22 nucleotides long.

[0007] In some instances, the oligonucleotide is a single-stranded antisense oligonucleotide (ASO). In some instances, the oligonucleotide is a gapmer, wherein the oligonucleotide comprises a central region of consecutive DNA nucleotides flanked by a 5 ’-wing region and 3 ’-wing region, wherein at least one of 5’-wing region and 3’-wing region comprises a nucleic acid analogue, wherein the nucleic acid analogue comprises one or more ribose modifications, one or more internucleotide linkage modifications, one or more nucleobase modifications, or a combination thereof.

[0008] In some instances, the nucleic acid analogue comprises a 2’-methoxyethyl (2’ -MOE) RNA. In some instances, the 5’-wing region comprises at least two 2’-MOE RNAs. In some instances, the 3’-wing region comprises at least two 2’-M0E RNAs. In some instances, the 5’-wing region comprises three or five 2’-M0E RNAs In some instances, the 3’-wing region comprises three or five 2’-MOE RNAs.

[0009] In some instances, the nucleic acid analogue comprises a locked nucleic acid (LNA). In some instances, the LNA comprises a beta-D-oxy LNA, an alpha-L-oxy-LNA, a beta-D-amino-LNA, an alpha-L-amino-LNA, a beta-D-thio-LNA, an alpha-L-thio-LNA, a 5'-methyl-LNA, a beta-D-ENA, or an alpha-L-ENA. In some instances, the 5’-wing region comprises at least two LNAs. In some instances, the 3 ’-wing region comprises at least one LNA. In some instances, the 5’ -wing region comprises three consecutive LNAs. In some instances, the 3’-wing region comprises two consecutive LNAs. In some instances, the 5 ’-wing region comprises three consecutive LNAs, and wherein the third and the second nucleotides counting from the 3’ end in the 3 ’-wing region comprise two consecutive LNAs, and the last nucleotide in the 3’-wing region is a DNA nucleotide.

[0010] In some instances, the oligonucleotide comprises a phosphorodiamidate morpholino oligomer (PMO).

[0011] In some instances, the oligonucleotide comprises one or more modified intemucleotide linkages. In some instances, the one or more modified internucleotide linkages comprise a phosphorothioate intemucleotide linkage, a phosphorodithioate internucleotide linkage, or a combination thereof. In some instances, wherein the one or more modified intemucleotide linkages is a phosphorothioate intemucleotide linkage, the phosphorothioate intemucleotide linkage is located between each nucleotide of the oligonucleotide.

[0012] In some instances, the oligonucleotide comprises or consists of a nucleic acid sequence selected from Table 4. In some instances, the oligonucleotide comprises or consists of a nucleic acid sequence selected from SEQ ID NOs: 55, 81, 83, 89, 91, and 129-133.

[0013] In some aspects, provided herein is a pharmaceutical composition comprising the oligonucleotide described herein and a pharmaceutically acceptable salt or derivative thereof.

[0014] In some aspects, provided herein is a method of inducing a cell state transition of a cell from a myofibroblast state to a quiescent fibroblast state, comprising contacting the cell with the oligonucleotide described herein or the pharmaceutical composition described herein. In some instances, an expression level of a IncRNA selected from Tables 1-3 is reduced in the cell. In some instances, a gene expression of a fibrotic marker gene is reduced in the cell. In some instances, the fibrotic marker gene comprises CoLlAl, ACTA2, FN1, COL3A1, ME0X1, RUNX1 / 2, PTN, MMP15, or a combination thereof. In some instances, an expression of a down-regulated gene specific to the myofibroblast is increased or an expression of an up-regulated gene specific to the myofibroblast is reduced In some instances, the up-regulated gene specific to the myofibroblast comprises CILP, COL14A1, COL1A1, PLOD2, SMAD9, or a combination thereof.

[0015] In some aspects, provided herein is a method of preventing, alleviating, or treating a cardiac fibrosis-mediated cardiac pathology in a subject in need thereof, comprising administering to the subject an effective amount of the oligonucleotide described herein or the pharmaceutical composition described herein. In some instances, an expression of a biomarker associated with the cardiac fibrosis-mediated cardiac pathology is changed in the subject to be similar to a level that is observed in a healthy individual. In some instances, the biomarker is selected from a group consisting of coagulation factor 2 receptor (F2R), CITED4, MYH7B, HDAC9, ACTN2, KLF11, HEY2, MYH11, TPM1, TNNT2, TNNC1, NPPB, AP3D1, NDUF1 IB, SLC25A4, KCNJ5, TRIP6, ATP5PO / 5F1C, NDUFA2 / 9, NDUFB8 / B9 / A9, SAMM50, UQCRC1, CYC1, COX5B, ATP2A, TPM1, TNNT2, TNNC1, NPPB, MMP9, COL1A1, IL1RL1, NT-proBNP, BNP, MMP9, PICP3, soluble ST2, MYBPC3, MY0M3, SCN5A, SCN10A, HANOI, MYP2, HANOI, KLF15, TTN, miR-21, PLK2, NCAM1 , TGFB1 , activin A, FSTL3, MPK9, fibrinogen, PDE5A, SULF2, CILP, THBS1, PTK2B, TGFB1, PCTP, CXCL16, a gene identified in Table 5 and 6, and a combination thereof. In some instances, a collagen or a fibrotic scar in a border zone or an infarct zone of a heart is reduced in the subject. In some instances, proliferation of a cardiac myofibroblast of the subject is reduced. In some instances, migration of a cardiac myofibroblast of the subject is reduced. In some instances, apoptosis of a cardiac myofibroblast of the subject is increased. In some instances, cardiomyocyte diameter is reduced. In some instances, the cardiac fibrosis-mediated cardiac pathology is a hypertrophic cardiomyopathy, a myocardial infarction, a heart failure with preserved or reduced ejection fraction, a dilated cardiomyopathy, an aortic stenosis, a diabetic cardiomyopathy, a restrictive cardiomyopathy, a cardiac amyloidosis, a genetic disease causal of attendant cardiomyopathy, or an excessive interstitial fibrosis pathology.

[0016] In some aspects, provided herein is a method of diagnosing cardiac fibrosis-mediated cardiac pathology in a subject, wherein the method comprises (a) obtaining a biological sample derived from the subject; (b) detecting an amount and / or an activity of a biomarker from the biological sample, wherein the biomarker comprises a sequence from Tables 1, 5, and 6; and (c) diagnosing the subject with cardiac fibrosis-mediated cardiac pathology if the amount and / or the activity of the biomarker is at least 50%, at least 60%, at least 70%, at least 80%, at least 90% higher when compared to a healthy individual.

[0017] In some aspects, provided herein is a method of monitoring or predicting the progression of cardiac fibrosis-mediated cardiac pathology in a subject, wherein the method comprises (a) obtaining a biological sample derived from the subject at an earlier time point and a later time point; (b) detecting an amount and / or an activity of a biomarker from the biological sample, wherein thebiomarker comprises a sequence from Tables 1, 5, and 6; and (c) concluding or predicting the cardiac fibrosis-mediated cardiac pathology persists or progresses if the amount and / or the activity of the biomarker at the later time point at least 10% higher than the amount and / or the activity of the biomarker at the earlier time point.BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative instances, in which the principles of the disclosure are utilized, and the accompanying drawings (also “Figure” and “FIG.” herein), of which:

[0019] FIGs. 1 A-1B illustrate the effect of WISPER targeting antisense oligonucleotide (ASO) on TIA1 -related protein (TIAR) expression in the nucleus of mouse, pig, and human myofibroblasts. FIG. 1A shows TIAR expression in the nucleus of mouse, pig, and human myofibroblasts upon transfection with WISPER targeting ASO (mouse: mmGRM / SEQ ID NO: 135; pig: pWis_67 / SEQ ID NO: 56; G117 / SEQ ID NO: 55) or scramble / non-wisper targeting ASO control. FIG. IB shows TIAR expression in the nucleus of mouse, pig, and human myofibroblasts upon transfection with different doses of WISPER targeting ASO (mouse: mmGRM / SEQ ID NO: 135; pig: pWis_67 / SEQ ID NO: 56; human: G36 / SEQ ID NO: 83) or no treatment. Bars present the means + / - SD of percentage fibroblasts with nuclear TIAR or fluorescence intensity (arbitrary units), and p-value of ordinary one-way ANOVA multiple comparisons.

[0020] FIG. 2 shows change in TIAR-mRNA target expression landscape in myofibroblasts upon transfection with different WISPER targeting ASOs or controls. 27 ASOs (corresponding to SEQ ID NOs: 57-83, starting from left / bottom to right / top) were tested. 4 controls were used in this experiment. Starting from the right side they are: “Xtreme” transfection media only (without ASO); Untreated MyoFB (Starvation 48h); Scramble MOE control; Scramble LNA control.

[0021] FIG. 3 shows TIAR target expression in human myofibroblasts upon transfection with different WISPER targeting ASOs (G34 / SEQ ID NO: 81 or G36 / SEQ ID NO: 83) or scramble / non- wisper targeting ASO control. Boxplots represent the distribution of all genes; each dot represents a gene.

[0022] FIGs. 4A-4D illustrate expression of pig WISPER, WISPER target engagement panel (TEP), and signature genes associated with human cardiac fibroblasts (HCF) and hypertrophic cardiomyopathy (HCM) in pig myofibroblasts upon transfection with pig WISPER targeting ASOs.FIG. 4A shows a diagram of the locations of “Region X” and “Region Y” used in FIGs. 4B-4D side by side with snATAC-seq results and CUT&Run results for CTCF. FIG. 4B shows WISPER expression in pig myofibroblasts upon transfection with pig WISPER targeting ASOs (ASO1 targeting “Region Y’VSEQ ID NO: 84; pWis_67 targeting “Region X” / SEQ ID NO: 56) or scramble / non-wisper targeting ASO control. FIG. 4C shows TEP level in myofibroblasts upon transfection with pig WISPER targeting ASOs (ASO1 targeting “Region Y7SEQ ID NO: 84; pWis_67 targeting “Region X’7SEQ ID NO: 56) or scramble / non-wisper targeting ASO control. FIG. 4D shows changes in TEP and signature genes associated with HCF and HCM in pig myofibroblasts upon transfection with pig WISPER targeting ASOs (ASO1 targeting “Region Y’VSEQ ID NO: 84; pWis_67 targeting “Region X” / SEQ ID NO: 56) or scramble / non-wisper targeting ASO control.

[0023] FIGs. 5A-5B illustrate human WISPER expression, TEP, and signature genes associated with HCF and HCM in human myofibroblasts upon transfection with human WISPER targeting ASOs (ASO1 (SEQ ID NO: 61); ASO2 (SEQ ID NO: 57); ASO3 (SEQ ID NO: 55); ASO4 (SEQ ID NO: 85); ASO5 (SEQ ID NO: 86); ASO6 (SEQ ID NO: 87 and SEQ ID NO: 91). FIG. 5A shows WISPER expression in human myofibroblasts upon transfection with human WISPER targeting ASOs or scramble / non-wisper targeting ASO control. FIG. 5B shows changes in TEP and signature genes associated with HCF and HCM in human myofibroblasts upon transfection with human WISPER targeting ASOs or scramble / non-wisper targeting ASO control.

[0024] FIG. 6 shows changes in different target gene signatures in fibroblasts, myofibroblasts, or myofibroblasts upon transfection with different doses of human WISPER targeting ASOs (SEQ ID NO: 83) or control.

[0025] FIG. 7 shows changes in proliferation, migration, and apoptosis of myofibroblasts upon transfection with different human WISPER targeting ASOs. The ASOs tested in FIG. 7 were G115 (SEQ ID NO: 89), G103 (SEQ ID NO: 91), G117 (SEQ ID NO: 55), G149 (SEQ ID NO: 66), G145 (SEQ ID NO: 62), G119 (SEQ ID NO: 92), G1000 (previously named as RUDI ASO or mmGRM, SEQ ID NO: 135), G109 (SEQ ID NO: 88), G107 (SEQ ID NO: 90), G110 (SEQ ID NO: 93), and G113 (SEQ ID NO: 85).

[0026] FIGs. 8A-8E illustrate results of single nucleus RNA-sequencing (snRNA-seq) of pig cardiac myofibroblasts upon transfection with pig WISPER targeting ASO (SEQ ID NO: 56). FIG. 8A shows an experimental schematic diagram of differentiating cardiac fibroblasts into myofibroblasts and transfection with WISPER targeting ASO (SEQ ID NO: 56) prior to subjecting myofibroblast to snRNA-seq. FIG. 8B shows WISPER expression in myofibroblast upontransfection with WISPER targeting ASO (SEQ ID NO: 56) or scramble ASO by snRNA-seq analysis. FIG. 8C shows cluster analysis of the snRNA-seq data of myofibroblasts upon transfection with WISPER targeting ASO (SEQ ID NO: 56) or scramble ASO. FIG. 8D shows the uniform manifold approximation and projection for dimension reduction (UMAP) representation of the snRNA-seq data of pig myofibroblasts upon transfection with WISPER targeting ASO (SEQ ID NO: 56) or scramble ASO. FIG. 8E shows ACTA2 and FN expression levels in myofibroblasts upon transfection with WISPER ASO(SEQ ID NO: 56) by snRNA-seq analysis.

[0027] FIGs. 9A-9B illustrate snRNA-seq results of human cardiac myofibroblasts upon transfection with human WISPER targeting ASOs. FIG. 9A shows result of snRNA-seq of human cardiac myofibroblast upon transfection with human WISPER targeting ASO (SEQ ID NO: 91) or scramble / non-Wisper targeting (NT) ASO. FIG. 9B shows analysis of snRNA-seq for WISPER expression in human myofibroblasts upon transfection with human WISPER targeting ASO (SEQ ID NO: 83) or scramble / non-Wisper targeting (NT) ASO.

[0028] FIG. 10 shows analysis of snRNA-seq data of pig cardiac myofibroblasts upon transfection with pig WISPER targeting ASO (SEQ ID NO: 56) or scramble / non-Wisper targeting (NT) ASO to assess change in cell state.

[0029] FIG. 11 shows expression score of TIAR myofibroblast specific gene signature and WISPER TEP in myofibroblasts upon transfection with human WISPER targeting ASO (SEQ ID NO: 83) or scramble / non-Wisper targeting (NT) ASO.

[0030] FIGs. 12A-12C illustrate WISPER expression, myofibroblast gene signature expression and WISPER TEP in myofibroblasts upon transfection with different doses of human WISPER targeting ASO (SEQ ID NO: 83) or scramble / non-Wisper targeting (NT) ASO. FIG. 12A shows WISPER expression in myofibroblast upon transfection with different doses of human WISPER targeting ASO (SEQ ID NO: 83) or scramble / non-Wisper targeting (NT) ASO. FIG. 12B shows expression score of myofibroblast specific gene signature upon transfection with different doses of human WISPER targeting ASO (SEQ ID NO: 83) or scramble / non-Wisper targeting (NT) ASO. FIG. 12C shows expression score of WISPER TEP upon transfection with different doses of human WISPER targeting ASO (SEQ ID NO: 83) or scramble / non-Wisper targeting (NT) ASO.

[0031] FIG. 13 shows single nucleus assay for transposase-accessible chromatin using sequencing (snATAC-seq) analysis of pig myofibroblasts upon transfection with pig WISPER targeting ASO (SEQ ID NO: 56) or scramble / non-Wisper targeting (NT) ASO

[0032] FIG. 14 shows snATAC-seq analysis for myofibroblast specific gene signature in myofibroblasts upon transfection with different doses of human WISPER targeting ASO (SEQ ID NO: 83) or scramble / non-Wisper targeting (NT) ASO.

[0033] FIG. 15 shows analysis of in vivo patient snRNA-seq data for analysis of WISPER, sulfatase-2 (SULF2) and COL14A1 expression.

[0034] FIGs. 16A-16B illustrate WISPER and SULF2 expression in myofibroblasts upon transfection with human WISPER targeting ASO or scramble ASO. FIG. 16A shows expression of WISPER in myofibroblasts upon transfection with different doses of human WISPER targeting ASO (SEQ ID NO: 91). FIG. 16B shows expression of SULF2 in human myofibroblasts upon transfection with different doses of human WISPER targeting ASO (SEQ ID NO: 83) or scramble / non-Wisper targeting (NT) ASO.

[0035] FIGs. 17A-17B illustrate SULF2 expression in myofibroblasts upon transfection with human, pig, or mouse WISPER targeting ASO or scramble / non-Wisper targeting (NT) ASO. FIG. 17A shows expression of SULF2 in human, pig, and mouse myofibroblasts transfected with different doses of human WISPER targeting ASO (SEQ ID NO: 83), pig WISPER targeting ASO (SEQ ID NO: 56), or mouse WISPER targeting ASO (SEQ ID NO: 139), respectively. FIG. 17B shows expression of SULF2 in pig myofibroblasts upon transfection with different doses of pig WISPER targeting ASO (SEQ ID NO: 56) or scramble ASO.

[0036] FIG. 18 shows snRNA-seq analysis for SULF2 and WISPER expression in myofibroblasts upon transfection with different doses of a human WISPER targeting ASO (G117, SEQ ID NO: 55).

[0037] FIGs. 19A-19B illustrate analysis of in vivo data from post-myocardial infarction (MI) pig model treated with pig WISPER targeting ASO (SEQ ID NO: 56) FIG. 19A shows SULF2 expression in the border zone, infarct zone, remote zone middle, and remote zone top of the pig’s hearts obtained from a post-MI pig model treated with pig WISPER targeting ASO (SEQ ID NO: 56) 13 days post-MI. FIG. 19B shows SULF2 expression in the border zone and infarct zone of the pig’s hearts obtained from a post-MI pig model treated with pig WISPER targeting ASO (SEQ ID NO: 56), after 13 days or 42 days post-MI Border and infarct zone shown in FIG. 19A is the same as the ones shown in FIG. 19B.

[0038] FIG. 20 shows experimental schematic of generating a post-MI pig model and treating the pig with vehicle or pig WISPER targeting ASO (SEQ ID NO: 56) before harvesting the various zones of the heart tissue for downstream analysis at day 13 post-MI

[0039] FIGs. 21A-21D illustrate assessment of anti-fibrosis in post-MI pigs treated with pig WISPER targeting ASO (SEQ ID NO: 56) or vehicle, at day 13 post-MI. FIG. 21A showspercentage of fibrosis across the LV heart regions (e.g., remote zone top, remote zone middle, border zone, and infarct zone) in post-MI pigs treated with pig WISPER targeting ASO (SEQ ID NO: 56) or vehicle. FIG. 21A further shows collagen expression in histology sections of the infarct zone of the heart in post-MI pigs treated with pig WISPER targeting ASO (SEQ ID NO: 56) or vehicle. FIG. 21B shows Wisper relative expression across the LV heart regions. FIG. 21C shows equivalent readouts as FIG. 21A but for a Day 42 post-MI model. FIG. 2 ID shows measurement of cardiac function at day 42 post-MI in pigs treated with pig WISPER targeting ASO (SEQ ID NO: 56) or vehicle through subcutaneous administration at day 3 and day 24.

[0040] FIG. 22 shows pig WISPER expression measured by RNAscope in post-MI pigs treated with different doses of pig WISPER targeting ASO (SEQ ID NO: 56) or vehicle.

[0041] FIG. 23 shows pig WISPER TEP level in border zone and infarct zone of the heart in post- MI pigs treated with different doses of pig WISPER targeting ASO (SEQ ID NO: 56) or vehicle.

[0042] FIG. 24 shows HCM gene signature level in border zone and infarct zone of the heart in post-MI pigs treated with pig WISPER targeting ASO (SEQ ID NO: 56) or vehicle.

[0043] FIGs. 25A-25B show expression level of genes sensitive to WISPER knockdown, expression of F2R, and expression of MMP15 in border zone and infarct zone of the heart in post-MI pigs treated with different doses of pig WISPER targeting ASO (SEQ ID NO: 56) or vehicle. Each dot represents an animal. Data in FIG. 25B are represented as median + / - IQR. Statistical analysis was performed using Wilcoxon test.

[0044] FIG. 26A-26C show improvement of some disease markers by the pig WISPER targeting ASO treatment (SEQ ID NO: 56). FIG. 26A shows expression level of genes associated with the hallmarks of glycolysis (top panel) and fatty acid beta oxidation (bottom panel) in remote zone top, remote zone middle, border zone, and infarct zone of the heart in post-MI pigs treated pig WISPER targeting ASO (SEQ ID NO: 56) or vehicle. FIG. 26B and FIG. 26C show heart tissue expression levels of NPPB, MMP9, COL1A1, and IL1RL1 in border zone and infarct zone of the heart in post- MI pigs treated pig WISPER (SEQ ID NO: 56) targeting ASO or vehicle.

[0045] FIGs. 27A-27B show effectiveness of ASO treatment (SEQ ID NO: 135) in a mouse post- myocardial infarction model. FIG. 27A shows expression of pro-fibrotic gene such as Acta2. FIG. 27B shows left ventricular internal dimension.

[0046] FIGs. 28A-28D illustrate expression of WISPER and target gene signatures in cardiac myofibroblast or lung myofibroblast upon transfection of different human WISPER targeting ASOs or scramble, non-targeting ASO (SCRL). FIG. 28A shows WISPER expression in cardiac myofibroblasts or lung myofibroblasts upon transfection of different human WISPER targetingASOs by qPCR analysis. The ASOs used in FIG. 28A are G36 (SEQ ID NO: 83), G103 (SEQ ID NO: 91), G115 (SEQ ID NO: 89), G117 (SEQ ID NO: 55), G126 (SEQ ID NO: 94), G149 (SEQ ID NO: 66). FIG. 28B shows expression level of target gene signatures in cardiac myofibroblasts or lung myofibroblasts upon transfection of different human WISPER targeting ASOs by RNA-seq analysis. The ASOs used in FIG. 28B, from right (top) to left (bottom), are G36 (SEQ ID NO: 83), G103 (SEQ ID NO: 91), G115 (SEQ ID NO: 89), G1 17 (SEQ ID NO: 55), G126 (SEQ ID NO: 94), G149 (SEQ ID NO: 66). FIG. 28C shows a diagram of the locations of “Region 1” and “Region 2” in human WISPER as used in FIG. 28D, side by side with snATAC-seq results and CUT&Run results for CTCF. FIG. 28D shows apoptosis over time of cardiac myofibroblast or lung myofibroblast upon transfection of different human WISPER targeting ASOs (SEQ ID NO: 91 targets Region 1, and SEQ ID NO: 89 targets Region 2), measured by incucyte.

[0047] FIG. 29 shows cytotoxicity of hepatocytes upon transfection with different doses of human WISPER targeting ASOs: G117 (SEQ ID NO: 55), G103 (SEQ ID NO: 91), G34.2 (SEQ ID NO: 95), G34.3 (SEQ ID NO: 96), G36 (SEQ ID NO: 83), G34 (SEQ ID NO: 81), G122 (SEQ ID NO: 97), and G126 (SEQ ID NO: 94). “X” means maximum releasable LDH activity in the cells. Data show two technical replicates.

[0048] FIG. 30 shows IL- 10 levels released by human peripheral blood mononuclear cells (PBMCs) upon transfection with different doses of human WISPER targeting ASOs: G117 (SEQ ID NO: 55), G103 (SEQ ID NO: 91), G36 (SEQ ID NO: 83), G122 (SEQ ID NO: 97), and G126 (SEQ ID NO: 94).

[0049] FIG. 31 (top panel) shows ATP released by human renal proximal tubular epithelial cells (PTEC) upon transfection with different doses of human WISPER targeting ASOs: G117 (SEQ ID NO: 55) , G103 (SEQ ID NO: 91), G34.2 (SEQ ID NO: 95), G34.3 (SEQ ID NO: 96), G36 (SEQ ID NO: 83), G34 (SEQ ID NO: 81), and G126 (SEQ ID NO: 94); FIG. 31 (bottom panel) shows EGF levels released by PTEC upon transfection for different durations with different doses of human WISPER targeting ASOs: G117 (SEQ ID NO: 55), G36 (SEQ ID NO: 83), and G34 (SEQ ID NO: 81).

[0050] FIG. 32 shows JPH2 expression in myofibroblasts upon transfection of pig WISPER targeting ASO (SEQ ID NO: 56) or scramble / non-Wisper targeting (NT) ASO. “pPCF” refers to primary porcine cardiac fibroblasts.

[0051] FIGs. 33A-33O illustrate effects of pWis_67 (SEQ ID NO: 56) in an in vivo 42 days post- myocardial infarction pig model. FIG. 33A shows porcine WISPER was reduced after treatment of pWis 67 (SEQ ID NO: 56). FIG. 33B shows pWis 67 TEP genes were reduced after treatment ofpWis_67 (SEQ ID NO: 56). FIG. 33C shows pWis_67 signature and cross-species WISPER TEP were predominantly reduced in fibroblasts, not in cardiomyocytes, after treatment of pWis_67 (SEQ ID NO: 56). FIG. 33D shows miR-21 in vivo targets was reduced after treatment of pWis_67 (SEQ ID NO: 56). Data presented as Median ± IQR, and each dot represents a pig. Statistical analysis performed using Wilcoxon test between Vehicle- and ASO-treated animals. FIG. 33E shows the genes targeted by RUNX2 after treatment of pWis_67 (SEQ ID NO: 56). FIG. 33F shows the genes targeted by SMAD5 were reduced after treatment of pWis_67 (SEQ ID NO: 56). FIG. 33G shows cardiomyocyte diameter changes after treatment of pWis_67 (SEQ ID NO: 56). FIG. 33H shows a change in gene signature involved in cardiac hypertrophy response after treatment of pWis_67 (SEQ ID NO: 56). For both FIG. 33G and FIG. 33H, analysis was done in left ventricle regions. Data presented as Median ± IQR. Porcine orthologous signature was derived from Heineke J, Molkentin ID. Nat Rev Mol Cell Biol. 2006. FIG. 331 shows PLK2 expression was restored after treatment of pWis_67 (SEQ ID NO: 56). Data presented as Median ± IQR. Statistical analysis performed using Wilcoxon test between Vehicle- and pWis 67-treated animals. FIG. 33J shows NACM1 expression was reduced after treatment of pWis_67 (SEQ ID NO: 56). FIG. 33K shows TGFB1 expression was reduced after treatment of pWis_67 (SEQ ID NO: 56). For FIG. 33J and FIG. 33K, data presented as Median ± IQR. Statistical analysis performed using Wilcoxon test between Vehicle- and pWis_67-treated animals. FIG. 33L shows several plasma proteins were reduced after treatment of pWis_67 (SEQ ID NO: 56). Data presented as Median Relative RFU Change (%) of each treatment group at Day 14 and Day 42, respectively, when compared to Day 3. FIG. 33M shows NT-proBNP, Activin A, and FSTL3 were reduced after treatment of pWis_67. Data presented as relative percentage change to day 3 post-MI, median ± IQR. FIG. 33N shows FSTL3 was reduced in several regions of heart tissues after treatment of pWis_67 (SEQ ID NO: 56) on day 42. Data presented as median ± IQR. FIG. 330 shows PDE5A, CILP, and SULF2 were reduced in plasma after treatment of pWis_67 (SEQ ID NO: 56).

[0052] FIGs. 34A-34E illustrate the expression of WISPER and its related genes in human patient biopsies or MI mouse heart tissues. FIG. 34A shows human WISPER expression in fibroblasts from biopsies of myocardial infarction patients. CTRL, control; IZ, Infarcted Zone; BZ, Boarder Zone; RZ, Remote Zone; FZ, Fibrotic Zone. FIG. 34B shows spatial transcriptomics and the expression of human WISPER TEP and associated genes CILP and SULF2, which were identified in-house, in fibroblasts / myofibroblasts in a patient biopsy from the fibrotic zone after myocardial infarction FIG. 34C shows the spatial transcriptomics of cardiac fibroblast / myofibroblast signature, human WISPER TEP, and SULF2, which were identified in-house, in a left ventricular biopsy of a patientpost-transmural myocardial ischemia before device implantation. “Human WISPER TEP” refers to genes modulated by human WISPER expression. FIG. 34D shows the spatial transcriptomics of human cardiac fibroblast / myofibroblast signature, cross species WISPER TEP, and Sulf2, which were identified in-house, in mouse hearts following myocardial infarction. FIG. 34E shows the expression of human WISPER TEP in patients with heart failure with preserved or reduced ejection fraction. HFpEF, heart failure with preserved ejection fraction; HFrEF, heart failure with reduced ejection fraction.

[0053] FIGs. 35A-35B illustrate snRNA-seq data in a hypertrophic cardiomyopathy pig model (R403Q mutant pigs). FIG. 35A shows porcine WISPER expression in different cell types. FIG. 35B shows quantification of porcine WISPER expression in mutant (1 month or 4 months) versus wild type pigs.

[0054] FIGs. 36A-36B illustrate efficacy testing of additional mouse WISPER targeting ASOs. FIG. 36A shows mouse WISPER expression after treatment of mmG184, mmG185, and mmG182, respectively. FIG. 36B shows a comparison between mmG182 and G36 in terms of regulation of WISPER, and WISPER TEP.DETAILED DESCRIPTION OF THE DISCLOSURE

[0055] The present disclosure includes long noncoding transcripts that are associated with the initiation, development, and prognosis of cardiac fibrosis. Such long noncoding transcripts could be a druggable target to prevent, alleviate, or treat development or prognosis of cardiac dysfunction, or symptoms of cardiac dysfunction. As such, in one aspect, provided herein, are modulators of a long noncoding transcript, pharmaceutical compositions comprising the modulator, and kits comprising the modulator. Also provided herein are methods of modulating expression or activity of a long noncoding transcript in a subject in need thereof using modulators of the long noncoding transcript.

[0056] In some instances, such modulators described herein are oligonucleotides (e g , ASOs) targeting IncRNA or its regulatory sequences. In some instances, the design of oligonucleotides effectively targeting IncRNA or its regulatory sequences is different from the one of oligonucleotides targeting protein coding mRNA. In some instances, considering that IncRNA executes its versatile functions via impacting chromatin structure, recruiting various proteins, etc. (i.e., cis functions or trans functions of IncRNA), the potency of ASOs targeting IncRNA or its regulatory sequences is strongly influenced by the IncRNA locus feature on its DNA sequence. Accordingly, in some instances, to guarantee potency, designing and verifying ASOs targeting IncRNA or its regulatory sequences prefers multiomic approaches.

[0057] In some instances, various heart conditions lead to activated myofibroblasts, which triggers initial tissue repair. However, persistent activation of myofibroblasts leads to cardiac fibrosis, which results in organ stiffness, severe loss of function and heart failure. The modulators disclosed herein reduce such pathological processCardiac Fibrosis Associated Long non-coding RNA (IncRNA)

[0058] Long non-coding transcripts or long non-coding RNAs (IncRNAs) are RNA segments that lack protein-coding capacity, yet, in some instances, can mediate various regulatory mechanisms in cell cycle or cell metabolism by regulating transcription and / or post-transcriptional modification of various genes. LncRNAs can be highly tissue-specific, cell state-specific, and / or disease-specific. As such, dysregulation of certain long non-coding transcripts can be associated with an onset, development, or prognosis of a disease or a symptom of a disease (e.g., heart failure, cardiac fibrosis) Alternatively and / or additionally, dysregulation of certain long non-coding transcripts can be a signature or indication of an onset, development, or prognosis of a disease or a symptom of a disease (e.g., heart failure, cardiac fibrosis).

[0059] In some instances, the IncRNA disclosed herein is highly expressed in a heart compared to other tissues (e.g., liver, lung). In some instances, the IncRNA disclosed herein is enriched in myofibroblast. In some instances, the IncRNA disclosed herein is highly expressed in a cardiac myofibroblast compared to other cells (e.g., hepatocytes, tubular cells, lung fibroblasts, lung myofibroblasts, splenocytes, peripheral blood mononuclear cells). In some instances, the IncRNA disclosed herein is enriched in cardiac myofibroblast. In some instances, the expression and / or activity of the IncRNA disclosed herein is increased in myofibroblast compared to fibroblast. In some instances, the expression and / or activity of the IncRNA disclosed herein is increased in cardiac myofibroblast compared to cardiac fibroblast. In some instances, the transcription of the IncRNA disclosed herein is increased in myofibroblast compared to in fibroblast. In some instances, the transcription of the IncRNA disclosed herein is increased in cardiac myofibroblast compared to in cardiac fibroblast. In some instances, the RNA expression of the IncRNA disclosed herein is at least about 1.5 folds, at least about 2 folds, at least about 3 folds, at least about 4 folds, at least about 5 folds, at least about 6 folds, at least about 7 folds, at least about 8 folds, at least about 9 folds, or at least about 10 folds higher in myofibroblasts (e.g., cardiac myofibroblasts) compared to fibroblasts (e g., cardiac fibroblasts).

[0060] In some instances, a IncRNA disclosed herein is associated with one or more superenhancers. In some instances, the IncRNA disclosed herein is associated with one or more cardiacspecific super-enhancers. In some instances, one or more enhancers (e.g., cardiac-specific super-enhancers) are within a genomic locus encoding the IncRNA. In some instances, one or more variants associated to cardiac fibrosis are within a genomic locus encoding the IncRNA. Variants can be identified through Genome Wide Association Studies (GWAS).

[0061] In some instances, the IncRNA disclosed herein is conserved in two or more different species. In some instances, “conserved” refers to the preservation of sequence, locus, and genomic regulatory regions across two or more species (e g., human, mouse, porcine). In some instances, “conserved” refers to the preservation of function and mechanism of action (e.g., interaction with TIAR) across two or more species (e.g., human, mouse, porcine). In some instances, the IncRNA disclosed herein is transcribed from a positive strand, labeled as “(+)” herein. In some instances, the IncRNA disclosed herein is transcribed from a negative strand, labeled as “(-)” herein. In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44654303 to chr20:44659718 (-) (SEQ ID NO: 171). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44654306 to chr20:44659800 (-) (SEQ ID NO: 172). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44656456 to chr20:44659684 (-) (SEQ ID NO: 173). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44659800 to chr20:44685325 (-) (SEQ ID NO: 174). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44659800 to chr20:44685330 (-) (SEQ ID NO: 175). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44659800 to chr20:44685443 (-) (SEQ ID NO: 176). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44659800 to chr20:44696112 (-) (SEQ ID NO: 177). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44659800 to chr20:44696114 (-) (SEQ ID NO: 178). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44659800 to chr20: 44696122 (-) (SEQ ID NO: 179). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44659800 tochr20: 44696124 (-) (SEQ ID NO: 180). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44659800 to chr20:44696141 (-) (SEQ ID NO: 181). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44659800 to chr20:44696150 (-) (SEQ ID NO: 182). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44659800 to chr20:44696156 (-) (SEQ ID NO: 183). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44660580 to chr20:44670984 (-) (SEQ ID NO: 184). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein or an intermediate form thereof or a premature form thereof is located within human chr20:44660596 to chr20: 44696047 (-) (SEQ ID NO: 185).

[0062] In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl7:47079545 to chrl7:47131839 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl7:47080069 to chrl7:47131844 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl7:47081211 to chrl7:47081447 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl7:47090963 to chr 17:47131844 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl7:47090964 to chrl7:47131656 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl 7:47090965 to chrl7:47103770 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl7:47090965 to chrl7:47131382 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl7:47090965 to chrl7:47131645 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl 7:47090967 to chrl7:47131656 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl7:47090971 to chrl 7:47131444 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl 7:47092506 to chrl7:47104189 (-) In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl7:47093218 to chrl7:47131636 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosedherein is located within porcine chrl7:47093218 to chrl7:47131844 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl7:47093219 to chrl7:47131836 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within porcine chrl7:47100594 to chrl 7:47105229 (-).

[0063] In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163618357 to chr2: 163651729 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637152 to chr2: 163640202 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637152 to chr2: 163651135 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637152 to chr2: 163651174 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637152 to chr2: 163651753 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637153 to chr2: 163639865 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637156 to chr2: 163650929 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637156 to chr2: 163651135 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637156 to chr2: 163651173 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637156 to chr2: 163651807 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637652 to chr2: 163651173 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637652 to chr2: 163651633 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163637732 to chr2: 163653720 (-). In some instances, a genomic region that is transcribed to the IncRNAs disclosed herein is located within mouse chr2: 163637734 to chr2:163651807 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163641078 to chr2: 163644515 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163641090 to chr2: 163646805 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163641108 to chr2: 163646609 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163641108 to chr2: 163651175 (-). In some instances, a genomic region that is transcribed to the IncRNA disclosed herein is located within mouse chr2: 163641110 tochr2: 16364651 1 (-). In some aspects, disclosed herein is a IncRNA associated with cardiac fibrosis. In some aspects, the IncRNA associated with cardiac fibrosis comprises at least a portion of nucleic acid sequences disclosed in PCI7EP2014 / 078868 or PCT / EP2018 / 066206, which is incorporated by reference herein in its entirety.

[0064] In some instances, the IncRNA disclosed herein targets a segment of human WISPER chr20:44, 693, 597-44, 696, 188 (GRCh38). In some instances, the IncRNA disclosed herein targets a segment of human WISPER chr20:44, 681, 367-44, 686, 712 (GRCh38). In some instances, the IncRNA disclosed herein targets a human functional equivalent of chrl7:47, 097, 936-47, 101,620 (Sscrofal 1.1), such as but is not limited to chr20:44, 681, 367-44, 686, 712 (GRCh38). In some instances, the IncRNA disclosed herein targets a human functional equivalent of chrl 7:47,090,872- 47,092,315 (Sscrofal 1.1).

[0065] In some instances, the IncRNA disclosed herein targets chrl 7:47, 097, 936-47, 101 , 620 (Sscrofal 1.1). In some instances, the IncRNA disclosed herein targets chrl7:47, 090, 872-47, 092, 315 (Sscrofal 1.1).

[0066] In some instances, the IncRNA disclosed herein is any one of the sequences selected from Table 1. In some instances, the IncRNA disclosed herein comprises a sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of the sequences set forth in Table 1. In some instances, the IncRNA disclosed herein is any one of the sequences selected from Table 2 In some instances, the IncRNA disclosed herein comprises a sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of the sequences set forth in Table 2. In some instances, the IncRNA disclosed herein is any one of the sequences selected from Table 3. In some instances, the IncRNA disclosed herein comprises a sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of the sequences set forth in Table 3.

[0067] In some instances, the IncRNA disclosed herein is a Wisp2 super-enhancer-associated RNA (WISPER). WISPER is a polyadenylated, multi-exonic long non-coding RNA (IncRNA) that is associated with cardiac-specific super-enhancers (SEs) and can regulate cardiac fibrosis. In someinstances, WISPER is highly expressed in myofibroblasts (e.g., cardiac myofibroblasts) compared to fibroblasts. In some instances, WISPER is conserved across species, for example, but not limited to, human, mouse, and porcine. In some instances, expression and / or activity of WISPER can be influenced by environmental stress stimuli (e g., hypertension, myocardial infarction (MI), hypertrophic cardiomyopathy (HCM)). In some instances, WISPER is involved in disease driving pathways. In some instances, disease driving pathways comprise pathways associated with myocardial fibrosis and / or heart failure.

[0068] In some instances, one or more protein-coding genes are located within the genomic locus encoding the IncRNA disclosed herein (e g., WISPER). In some instances, the one or more proteincoding genes regulate fibrosis and inflammation. In some instances, the one or more protein-coding genes are associated with hypertrophic cardiomyopathy. In some instances, one or more proteincoding genes that are associated with fibrosis, inflammation and / or hypertrophic cardiomyopathy are located at most 10 nucleotides, at most 20 nucleotides, at most 30 nucleotides, at most 40 nucleotides, at most 50 nucleotides, at most 55 nucleotides, at most 60 nucleotides, at most 65 nucleotides, at most 70 nucleotides, at most 75 nucleotides, at most 80 nucleotides, at most 85 nucleotides, at most 90 nucleotides, at most 95 nucleotides, or at most 1000 nucleotides upstream of the IncRNA disclosed herein. In some instances, one or more protein-coding genes that are associated with fibrosis, inflammation and / or hypertrophic cardiomyopathy are located at least 10 nucleotides, at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 55 nucleotides, at least 60 nucleotides, at least 65 nucleotides, at least 70 nucleotides, at least 75 nucleotides, at least 80 nucleotides, at least 85 nucleotides, at least 90 nucleotides, at least 95 nucleotides, at least 1000 nucleotides or more upstream from the genomic locus transcribing IncRNA disclosed herein. In some instances, one or more protein-coding genes that are associated with fibrosis, inflammation and / or hypertrophic cardiomyopathy are located at most 10 nucleotides, at most 20 nucleotides, at most 30 nucleotides, at most 40 nucleotides, at most 50 nucleotides, at most 55 nucleotides, at most 60 nucleotides, at most 65 nucleotides, at most 70 nucleotides, at most 75 nucleotides, at most 80 nucleotides, at most 85 nucleotides, at most 90 nucleotides, at most 95 nucleotides, or at most 1000 nucleotides downstream of the IncRNA disclosed herein. In some instances, one or more protein-coding genes that are associated with fibrosis, inflammation and / or hypertrophic cardiomyopathy are located at least 10 nucleotides, at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 55 nucleotides, at least 60 nucleotides, at least 65 nucleotides, at least 70 nucleotides, at least 75 nucleotides, at least 80 nucleotides, at least 85 nucleotides, at least 90 nucleotides, at least 95nucleotides, at least 1000 nucleotides or more downstream from the genomic locus transcribing IncRNA disclosed herein. In some instances, the protein-coding gene comprises SULF2 or JPH2. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates expression of one or more protein-coding genes disclosed herein. For example, in some instances, the activation of IncRNA disclosed herein (e.g., WISPER) increases expression of SULF2. In some instances, the activation of IncRNA disclosed herein (e.g., WISPER) increases expression of IPH2. In some instances, the genomic locus encoding the IncRNA disclosed herein (e.g., WISPER) interacts with SULF2 loci and / or JPH2 loci.

[0069] In some instances, the IncRNA disclosed herein (e.g., WISPER) acts in a cis-acting mechanism. For example, in some instances, the IncRNA disclosed herein (e.g., WISPER) acts in a cis-acting mechanism by regulating gene expression in a way that is dependent on the location of its own sites of transcription. In some instances, the IncRNA disclosed herein (e.g., WISPER) acts in a trans-acting mechanism For example, in some instances, the IncRNA disclosed herein (e.g., WISPER) interacts or binds to one or more protein. For example, WISPER can interact with TIAR, which is an RNA-binding protein that is a pleiotropic regulator of fibrosis, and can regulate TIAR localization in the nucleus.

[0070] In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates expression of TIAR downstream RNA targets. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates expression of TIAR downstream RNA targets enriched in myofibroblasts. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates expression of TIAR downstream RNA targets enriched in fibroblasts. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates expression of TIAR downstream RNA targets enriched in myofibroblasts and fibroblasts. Non-limiting examples of TIAR downstream RNA targets include COL6A2, COL14A1, COL1A1, COL21A1, CILP, COL6A1, SMAD9, COL3A1, PLOD2, POSTN, FN1, FAP TFGB1, SMAD4, COL13A1. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates one or more genes involved in fibrotic and wound healing processes. For example, WISPER can regulate expression ofPTGS2, AMCF-II, FTL, CTSC, SLC3A1, CCL2, ILIA, CXCL8, IL6, IL11, ADGRL4, FOXP2, THBS 1, TCF4, CCN3, ANKRD1, ALCAM, EDN1, UACA, CLEC3B, ACTA2, COL3A1, COL1A1, ME0X1, FN1, PTN, RUNX1 / 2 or a combination thereof. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates one or more genes associated with cardiac contractility, electrical conductivity, or a combination thereof Non-limiting examples of genes associated with cardiac contractility and / or electrical conductivity includes CITED4, ACTN2, MYH7B, KLF11, HDAC9, HEY2, or a derivative thereof. In some instances, the IncRNA disclosedherein (e.g., WISPER) regulates one or more genes associated with cardiac hypertrophy. Nonlimiting examples of genes associated with cardiac hypertrophy includes MYBPC3, MYP2, MY0M3, HANOI, SCN5A, KLF15, SCN10A, TTN, HANOI, or a derivative thereof. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates one or more genes associated with heart disease and / or cardiomyopathy. Non-limiting examples of genes associated with heart disease and / or cardiomyopathy include MYH1 1, TPM1, TNNT2, TNNC1, NPPB, AP3D1, NDUF1 IB, SLC25A4, KCNJ5, TRIP6, or a derivative thereof. In some instances, the IncRNA disclosed herein (e g., WISPER) regulates one or more genes associated with oxidative phosphorylation. Nonlimiting examples of genes associated with oxidative phosphorylation includes ATP5PO / 5F1C, NDUFA2 / 9, NDUFB8 / B9 / A9, SAMM50, or a derivative thereof. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates one or more genes associated with cardiac muscle contraction. Non-limiting examples of genes associated with oxidative phosphorylation includes UQCRC1, CYC1, C0X5B, ATP2A, TPM1, TNNT2, TNNC1, or a derivative thereof. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates expression of one or more genes from Table 5. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates expression of one or more genes from Table 6.

[0071] In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates functions associated with myofibroblasts (e.g., cardiac myofibroblasts). In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates functions associated with fibroblasts (e.g., myofibroblasts). Functions of myofibroblasts and / or fibroblast can include, but not limited to, extracellular matrix organization, collagen fibril organization, cellular response to TGF-beta stimulus, regulating response to hypoxia / oxygen level, or combination thereof. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates cell proliferation, migration, or apoptosis of cells (e.g., cardiac myofibroblasts, cardiac fibroblasts). For example, WISPER can increase proliferation, increase migration, and decrease apoptosis of myofibroblast (e.g., cardiac myofibroblast), or can increase cardiomyocyte diameter. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates expression of one or more heart failure biomarkers of a heart tissue. In some instances, the heart failure biomarker of a heart tissue comprises NPPB, MMP9 COL1 Al, IL1RL1, or a combination thereof. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates expression of one or more heart failure biomarkers in a serum and / or plasma. In some instances, the heart failure biomarker in a serum and / or plasma comprises NT -proBNP, BNP, MMP9, PICP3, soluble ST2, or a combination thereof. The mRNA and / or protein expression of the one or more heart failure biomarkers can be measured.

[0072] In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates cardiac fibroblast to myofibroblast cell state transition to regulate cardiac fibrosis. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates chromatin accessibility landscape of myofibroblast (e.g., cardiac myofibroblast) or fibroblast (e.g., cardiac fibroblast). In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates chromatin structure of myofibroblast (e.g., cardiac myofibroblast) or fibroblast (e.g., cardiac fibroblast). In some instances, the IncRNA disclosed herein (e g., WISPER) regulates chromosomal interaction of myofibroblast (e.g., cardiac myofibroblast) or fibroblast (e.g., cardiac fibroblast).

[0073] In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates a development of tissue fibrosis of a heart. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates a development of tissue fibrosis of a right ventricle of a heart. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates a development of tissue fibrosis of a left ventricle of a heart. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates a development of tissue fibrosis in a border zone of a heart. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates a development of tissue fibrosis in an infarct zone of a heart. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates a development of tissue fibrosis in a remote zone top of a heart. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates a development of tissue fibrosis in a remote zone middle of a heart. In some instances, the IncRNA disclosed herein (e.g., WISPER) regulates tissue scaring process of a heart.Modulators

[0074] In some aspects, a modulator disclosed herein is a modulator of a IncRNA associated with cardiac fibrosis (e.g., WISPER) disclosed herein. In some aspects, the modulator disclosed herein is a nucleic acid editing or modifying moiety. In some instances, the nucleic acid editing or modifying moiety targets or binds to the genomic region disclosed herein. In some instances, the nucleic acid editing or modifying moiety targets or binds to the long noncoding transcript. In some instances, the nucleic acid editing or modifying moiety targets or binds to a premature form of the long noncoding transcript. In some instances, the nucleic acid editing or modifying moiety targets or binds to an intermediate form of the long noncoding transcript. In some instances, the nucleic acid editing or modifying moiety targets or binds to a proximal WISPER enhancer, a proximal WISPER promoter, a WISPER super-enhancer, a WISPER downstream cis(-acting) sequence, a WISPER upstream cis(- acting) sequence, a WISPER trans(-acting)sequence

[0075] In some aspects, the nucleic acid editing or modifying moiety is an oligonucleotide. In some instances, the oligonucleotide is at least partially complementary to a portion of a sequence of one ofSEQ ID NOs: 171 -188 or a sequence from Tables 1-3. In some instances, the oligonucleotide is at least 70%, at least 80%, at least 90%, at least 95% complementary to a portion of a sequence of one of SEQ ID NOs: 171-188 or a sequence from Tables 1-3. In some instances, the oligonucleotide is at least 70%, at least 80%, at least 90%, at least 95% complementary to at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides of one of SEQ ID NOs: 171-188 or a sequence from Tables 1-3. In some instances, the oligonucleotide is at least 70%, at least 80%, at least 90%, at least 95% complementary to at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides of one of SEQ ID NOs: 171-188 or a sequence from Tables 1-3. In some instances, the oligonucleotide is at least partially complementary to a portion of a sequence of one of SEQ ID NOs: 174-183 and 185-188. In some instances, the oligonucleotide is at least 70%, at least 80%, at least 90%, at least 95% complementary to a portion of a sequence of one of SEQ ID NOs: 174-183 and 185-188. In some instances, the oligonucleotide is at least 70%, at least 80%, at least 90%, at least 95% complementary to at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides of one of SEQ ID NOs: 174-183 and 185-188. In some instances, the oligonucleotide is at least 70%, at least 80%, at least 90%, at least 95% complementary to at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides of one of SEQ ID NOs: 174-183 and 185-188.

[0076] In some instances, the oligonucleotide disclosed herein is at least partially complementary to a portion of more than one sequence from SEQ ID NOs: 171-188. In some instances, the oligonucleotide disclosed herein is at least partially complementary to a portion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10 sequences from SEQ ID NOs: 171-188 simultaneously. In some instances, the oligonucleotide disclosed herein is 100% complementary to a portion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10 sequences from SEQ ID NOs: 171-188 simultaneously. In some instances, the oligonucleotide disclosed herein is at least partially complementary to a portion of more than one sequence from Tables 1. In some instances, the oligonucleotide disclosed herein is at least partially complementary to a portion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10 sequences from Table 1 simultaneously. In some instances, the oligonucleotide disclosed herein is 100% complementary to a portion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10 sequences from Table 1 simultaneously. In some instances, the oligonucleotide disclosed herein is at least partially complementary to a portion of more than one sequence from Tables 2. In some instances, the oligonucleotide disclosed herein is at least partially complementary to a portion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10 sequences from Table 2 simultaneously. In some instances, the oligonucleotide disclosed herein is 100% complementary to a portion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10 sequences from Table 2 simultaneously. In some instances, the oligonucleotide disclosed herein is at least partially complementary to a portion of more than one sequence fromTables 3. In some instances, the oligonucleotide disclosed herein is at least partially complementary to a portion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10 sequences from Table 3 simultaneously. In some instances, the oligonucleotide disclosed herein is 100% complementary to a portion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10 sequences from Table 3 simultaneously.

[0077] In some aspects, the nucleic acid editing or modifying moiety is a programmable nucleic acid sequence specific endonuclease. In some instances, the nucleic acid editing or modifying moiety is a nucleic acid guided endonuclease. In some instances, the nucleic acid editing or modifying moiety is a CRISPR-based moiety. In other instances, the nucleic acid editing or modifying moiety is a meganuclease-based tool. In other instances, the nucleic acid editing or modifying moiety is a zinc finger nuclease (ZFN)-based moiety. In other aspects, the nucleic acid editing or modifying moiety is a transcription activator-like effector-based nuclease (TALEN)-based moiety. In other instances, the nucleic acid editing or modifying moiety is an Argonaute system.

[0078] In some aspects, the CRISPR-based moiety disclosed herein is a Type I, Type II, Type III, Type IV, Type V, or Type VI CRISPR system. CRISPR / Cas systems may be multi-protein systems or single effector protein systems. Multi -protein, or Class 1, CRISPR systems include Type I, Type III, and Type IV systems. In some instances, Class 2 systems include a single effector molecule and include Type II, Type V, and Type VI. In some aspects, the CRISPR-based moiety disclosed herein comprises a single or multiple effector proteins. An effector protein may comprise one or multiple nuclease domains. An effector protein may target DNA or RNA, and the DNA or RNA may be single stranded or double stranded. Effector proteins may generate double strand or single strand breaks. Effector proteins may comprise mutations in a nuclease domain thereby generating a nickase protein. Effector proteins may comprise mutations in one or more nuclease domains, thereby generating a catalytically dead nuclease that is able to bind but not cleave a target sequence.

[0079] In some aspects, the CRISPR-based moiety disclosed comprises a single or multiple guiding RNAs (gRNAs). The gRNA may comprise a crRNA. The gRNA may comprise a chimeric RNA with crRNA and tracrRNA sequences. The gRNA may comprise a separate crRNA and tracrRNA. Target nucleic acid sequences may comprise a protospacer adjacent motif (PAM) or a protospacer flanking site (PFS). The PAM or PFS may be 3’ or 5’ of the target or protospacer site. Cleavage of a target sequence may generate blunt ends, 3’ overhangs, or 5’ overhangs.

[0080] The gRNA disclosed herein may comprise a spacer sequence. Spacer sequences may be complementary to target sequences or protospacer sequences Spacer sequences may be 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36nucleotides in length. In some aspects, the spacer sequence may be less than 10 or more than 36 nucleotides in length.

[0081] The gRNA disclosed herein may comprise a repeat sequence. In some aspects, the repeat sequence is part of a double stranded portion of the gRNA. A repeat sequence may be 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some aspects, the spacer sequence may be less than 10 or more than 50 nucleotides in length.

[0082] The gRNA disclosed herein may comprise one or more synthetic nucleotides, non-naturally occurring nucleotides, nucleotides with a modification, deoxyribonucleotide, or any combination thereof. Additionally and / or alternatively, a gRNA may comprise a hairpin, linker region, single stranded region, double stranded region, or any combination thereof. Additionally or alternatively, a gRNA may comprise a signaling or reporter molecule.

[0083] The gRNA disclosed herein may be encoded by genetic or episomal DNA. The gRNA disclosed herein may be provided or delivered concomitantly with a CRISPR nuclease or sequentially. The gRNA disclosed herein may be chemically synthesized, in vitro transcribed or otherwise generated using standard RNA generation techniques known in the art.

[0084] The CRISPR-based moiety disclosed herein can be a Type II CRISPR system, for example a Cas9 system. The Type II nuclease can comprise a single effector protein, which, In some aspects, comprises a RuvC and HNH nuclease domains. In some aspects, a functional Type II nuclease may comprise two or more polypeptides, each of which comprises a nuclease domain or fragment thereof. The target nucleic acid sequences may comprise a 3’ protospacer adjacent motif (PAM). In some aspects, the PAM may be 5’ of the target nucleic acid. Guide RNAs (gRNA) may comprise a single chimeric gRNA, which contains both crRNA and tracrRNA sequences. In some instances, the gRNA may comprise a set of two RNAs, for example a crRNA and a tracrRNA. The Type II nuclease may generate a double strand break, which in some cases creates two blunt ends. In some aspects, the Type II CRISPR nuclease is engineered to be a nickase such that the nuclease only generates a single strand break. In such cases, two distinct nucleic acid sequences may be targeted by gRNAs such that two single strand breaks are generated by the nickase. In some aspects, the two single strand breaks effectively create a double strand break. In some aspects, where a Type II nickase is used to generate two single strand breaks, the resulting nucleic acid free ends may either be blunt, have a 3’ overhang, or a 5’ overhang In some aspects, a Type II nuclease may be catalytically dead such that it binds to a target sequence, but does not cleave. For example, a Type II nuclease may have mutations in boththe RuvC and HNH domains, thereby rendering both nuclease domains non-functional. A Type II CRISPR system may be one of three sub-types, namely Type II- A, Type II-B, or Type II-C.

[0085] The CRISPR-based moiety disclosed herein can be a Type V CRISPR system, for example a Cpfl, C2cl, or C2c3 system. The Type V nuclease may comprise a single effector protein, which comprises a single RuvC nuclease domain. In other cases, a function Type V nuclease comprises a RuvC domain split between two or more polypeptides. In such cases, the target nucleic acid sequences may comprise a 5’ PAM or 3’ PAM. Guide RNAs (gRNA) may comprise a single gRNA or single crRNA, such as may be the case with Cpfl . In some aspects, a tracrRNA is not needed. In other examples, such as when C2cl is used, a gRNA may comprise a single chimeric gRNA, which contains both crRNA and tracrRNA sequences or the gRNA may comprise a set of two RNAs, for example a crRNA and a tracrRNA. The Type V CRISPR nuclease may generate a double strand break, which generates a 5’ overhang. In some aspects, the Type V CRISPR nuclease is engineered to be a nickase such that the nuclease only generates a single strand break. In such cases, two distinct nucleic acid sequences may be targeted by gRNAs such that two single strand breaks are generated by the nickase. In some aspects, the two single strand breaks effectively create a double strand break. In some aspects where a Type V nickase is used to generate two single strand breaks, the resulting nucleic acid free ends may either be blunt, have a 3’ overhang, or a 5’ overhang. In some aspects, a Type V nuclease may be catalytically dead such that it binds to a target sequence, but does not cleave. For example, a Type V nuclease may have mutations a RuvC domain, thereby rendering the nuclease domain non-functional.

[0086] The CRISPR-based moiety disclosed herein may be a Type VI CRISPR system, for example a C2c2 system. A Type VI nuclease may comprise a HEPN domain. In some aspects, the Type VI nuclease comprises two or more polypeptides, each of which comprises a HEPN nuclease domain or fragment thereof. In such cases, the target nucleic acid sequences may by RNA, such as single stranded RNA. When using Type VI CRISPR system, a target nucleic acid may comprise a protospacer flanking site (PFS). The PFS may be 3’ or 5 ’or the target or protospacer sequence. Guide RNAs (gRNA) may comprise a single gRNA or single crRNA. In some aspects, a tracrRNA is not needed. In other examples, a gRNA may comprise a single chimeric gRNA, which contains both crRNA and tracrRNA sequences or the gRNA may comprise a set of two RNAs, for example a crRNA and a tracrRNA. In some aspects, a Type VI nuclease may be catalytically dead such that it binds to a target sequence, but does not cleave For example, a Type VI nuclease may have mutations in a HEPN domain, thereby rendering the nuclease domains non-functional.

[0087] Non-limiting examples of suitable nucleases, including nucleic acid-guided nucleases, for use in the present disclosure include C2cl, C2c2, C2c3, Cast, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Cpfl, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlOO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, homologues thereof, orthologues thereof, or modified versions thereof.

[0088] In some aspects, The CRISPR-based moiety disclosed herein is an Argonaute (Ago) system. Ago protein may be derived from a prokaryote, eukaryote, or archaea. The target nucleic acid may be RNA or DNA. A DNA target may be single stranded or double stranded. In some aspects, the target nucleic acid does not require a specific target flanking sequence, such as a sequence equivalent to a protospacer adjacent motif or protospacer flanking sequence. The Ago protein may create a double strand break or single strand break. In some aspects, when an Ago protein forms a single strand break, two Ago proteins may be used in combination to generate a double strand break. In some aspects, an Ago protein comprises one, two, or more nuclease domains. In some aspects, an Ago protein comprises one, two, or more catalytic domains. One or more nuclease or catalytic domains may be mutated in the Ago protein, thereby generating a nickase protein capable of generating single strand breaks. In other aspects, mutations in one or more nuclease or catalytic domains of an Ago protein generates a catalytically dead Ago protein that may bind but not cleave a target nucleic acid.

[0089] Ago proteins may be targeted to target nucleic acid sequences by a guiding nucleic acid. In some aspects, the guiding nucleic acid is a guide DNA (gDNA). The gDNA may have a 5’ phosphorylated end. The gDNA may be single stranded or double stranded. Single stranded gDNA may be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some aspects, the gDNA may be less than 10 nucleotides in length. In some aspects, the gDNA may be more than 50 nucleotides in length.

[0090] Argonaute-mediated cleavage may generate blunt end, 5’ overhangs, or 3’ overhangs. In some aspects, one or more nucleotides are removed from the target site during or following cleavage.

[0091] In some aspects, the nucleic acid editing or modifying moiety is a repressive dCas9 with the aid of a (single) guide RNA targeting the portion of the genomic region that is transcribed to the long noncoding transcript. In some instances, the nucleic acid editing or modifying moiety is dCas9- KRAB-MECP2 with the aid of a (single) guide RNA targeting the portion of the genomic region thatis transcribed to the long noncoding transcript. In other specific aspects, the nucleic acid editing or modifying moiety is dCas9-KRAB-DNMTl with the aid of a (single) guide RNA targeting the portion of the genomic region that is transcribed to the long noncoding transcript. In the above- mentioned aspects, the (single) guide RNA targets 5’ side of an enhancer region the genomic region that is transcribed to the long noncoding transcript. In the certain aspects, the (single) guide RNA targets 5’ side of an enhancer region the genomic region that is transcribed to the long noncoding transcript.

[0092] In some aspects, the modulator disclosed herein is a synthetic or an artificial oligonucleotide or a polynucleotide. In specific aspects, the synthetic or artificial oligonucleotide or polynucleotide is a small interfering RNA (siRNA), a microRNA (miRNA), an inhibitory double stranded RNA (dsRNA), a small or short hairpin RNA (shRNA), an antisense oligonucleotide (ASO), a piwi- interacting RNA (piRNA), a heterogeneous nuclear RNA (hnRNA), a small nuclear RNA (snRNA), an enzymatically-prepared siRNA (esiRNA), modified RNA (modRNA), or the precursors thereof. In some instances, the nucleic acid molecule is an ASO. In some instances, design of ASOs targeting IncRNA or its regulatory sequences is different from the one of ASOs targeting protein coding mRNA. In some instances, the potency of ASOs targeting IncRNA or its regulatory sequences is strongly influenced by the IncRNA locus feature on its DNA sequence.

[0093] In some instances, the ASO is a gapmer or a mixmer. In some instances, the ASO is a DNA analogue. In some instances, the ASO is modified with morpholino nucleotides. In some instances, the ASO is a phosphorodiamidate morpholino oligomer (PMO). ASO can maximize efficacy (on- target), minimize toxicity (off-target), and be modality agnostic. In some instances, potency of the ASO and target profile can be based on an mRNA sequence. In some instances, potency of the ASO that can target IncRNA can be influenced by a IncRNA locus features on its DNA sequence. In some instances, the ASO can be used across two or more species (e.g., human, mouse, porcine) to reach similar target knockdown.

[0094] In some instances, the nucleic acid molecule is single-stranded. In some instances, the nucleic acid is double-stranded.

[0095] In some aspects, the modulator disclosed herein is an oligonucleotide. In some instances, the oligonucleotide comprises a modified siRNA, a modified miRNA, a modified dsRNA, a modified shRNA, a modified ASO, a modified piRNA, a modified phRNA, a modified snRNA, a modified siRNA, or a modified precursors thereof In some instances, the oligonucleotide is a modified ASO In some instances, the oligonucleotide is a single-stranded ASO.

[0096] In some instances, the modulator disclosed herein (e.g., oligonucleotide) is about 6-50 nucleotides long. In some instances, the modulator disclosed herein (e.g., oligonucleotide) is about 6-45, 6-40, 6-35, 6-30, 6-20, 6-18, 7-45, 7-40, 7-35, 7-30, 7-20, 7-18, 8-45, 8-40, 8-35, 8-30, 8-20, 8- 18, 9-45, 9-40, 9-35, 9-30, 9-20, 9-18, 10-45, 10-40, 10-35, 10-20, 10-18, 11-30, 11-45, 11-40, 11- 35, 11-30, 11-20, 11-18, 12-45, 12-40, 12-35, 12-30, 12-20, or 12-18 nucleotides long. In some instances, the modulator disclosed herein (e.g., oligonucleotide) is about 12-30 nucleotides long. In some instances, the modulator disclosed herein (e.g., oligonucleotide) is about 13-30 nucleotides long. In some instances, the modulator disclosed herein (e.g., oligonucleotide) is about 14-22 nucleotides long. In some instances, the modulator disclosed herein (e.g., oligonucleotide) is at least 6, 7, 8, 9, or 10 nucleotides long. In some instances, the modulator disclosed herein (e.g., oligonucleotide) is at most 18, 20, 30, 35, 40, 45, 50, 55, or 60 nucleotides long.

[0097] In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises a sequence selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 9 consecutive nucleotides with no more than 1 mismatch from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 9 consecutive nucleotides with no more than 2 mismatches from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 9 consecutive nucleotides with no more than 3 mismatches from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 10 consecutive nucleotides with no more than 1 mismatch from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e g., an oligonucleotide, and more specifically an ASO) comprises at least 10 consecutive nucleotides with no more than 2 mismatches from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 10 consecutive nucleotides with no more than 3 mismatches from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 11 consecutive nucleotides with no more than 1 mismatch from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e g , an oligonucleotide, and more specifically an ASO) comprises at least 1 1 consecutive nucleotides with no more than 2 mismatches from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and morespecifically an ASO) comprises at least 11 consecutive nucleotides with no more than 3 mismatches from any one of the sequences selected from Table 4 In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 12 consecutive nucleotides with no more than 1 mismatch from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 12 consecutive nucleotides with no more than 2 mismatches from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 12 consecutive nucleotides with no more than 3 mismatches from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 13 consecutive nucleotides with no more than 1 mismatch from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 13 consecutive nucleotides with no more than 2 mismatches from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least 13 consecutive nucleotides with no more than 3 mismatches from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises a nucleic acid sequence of at least 80%, at least 85%, at least 90%, at least 95% identical to a sequence from any one of the sequences selected from Table 4 In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises a nucleic acid sequence of at most 80%, at most 85%, at most 90%, at most 95% identical to a sequence from any one of the sequences selected from Table 4. In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises a nucleic acid sequence of about 80%, about 85%, about 90%, about 95% identical to a sequence from any one of the sequences selected from Table 4. Table 4 shows sequences of ASOs targeting IncRNAs or its regulatory sequences disclosed herein.

[0098] In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises one or more sugar-modified nucleotide. In some specific instances, the sugar-modified nucleotide is a 2’ -fluoro modified nucleotide. In some specific instances, the sugar-modified nucleotide is a 2’-alkoxy modified nucleotide (e g , 2’-methoxy modified nucleotide) In some specific instances, the sugar-modified nucleotide is a 2’- amino modified nucleotide. In some specific instances, the sugar-modified nucleotide is a 2’- azido modified nucleotide.

[0099] In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises one or more backbone-modified nucleotide. In some specific instances, the modified backbone is a methylphosphonate. In some specific instances, the modified backbone is phosphorothioate. In some specific instances, the modified backbone is a guanidinopropyl phosphoramidate. In some specific instances, the modified backbone is a mesylphosphorami date (MsPA) linkages.

[0100] In some specific instances, the modified backbone is phosphorothioate, and the phosphorothioate is a stereochemically enriched phosphorothioate. In certain instances, the strand contains at least one stereochemically enriched phosphorothioate. In some instances, the strand comprises at least 1, 2, 3 stereochemically enriched phosphorothioates. In some instances, the strand comprises only 1, 2, 3, or 4 stereochemically enriched phosphorothioates

[0101] In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises one or more purine modification. In some specific instances, the purine modification disclosed herein is 2,6-diaminopurine. In some specific instances, the purine modification disclosed herein is 3 -deaza-adenine. In some specific instances, the purine modification disclosed herein is 7-deaza-guanine. In some specific instances, the purine modification disclosed herein is 8-azido-adenine.

[0102] In some instances, the modulator (e.g., an oligonucleotide, and more specifically an ASO) disclosed herein comprises one or more pyrimidine modification. In some specific instances, the pyrimidine modification disclosed herein is 2-thio-thymidine. In some specific instances, the pyrimidine modification disclosed herein is 5-carboxamide-uracil. In some specific instances, the pyrimidine modification disclosed herein is 5-methyl-cytosine. In some specific instances, the pyrimidine modification disclosed herein is 5-ethynyl uracil.

[0103] In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises an abasic substitution. In those cases where a hybridized polynucleotide construct is contemplated for use as siRNA, a reduction of miRNA-like off-target effects is desirable. The inclusion of one or more (e g., one or two) abasic substitutions in the hybridized polynucleotide constructs may reduce or even eliminate miRNA-like off-target effects, as the abasic substitutions lack nucleobases that are capable of engaging in base-pairing interactions and alleviate steric hindrance. Thus, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) may include one or more (e g , one or two) abasic substitutions In specific instances, abasic substitution is at the 5thnucleotide from the 5’ end of the antisense stranddisclosed herein. The modulator disclosed herein may contain a strand including a seed region including a hypoxanthine nucleobase-containing nucleoside (e.g., inosine).

[0104] In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises one or more type of modifications as disclosed above. Accordingly, in some instances, about 10% of the nucleotides from the modulator disclosed herein (e g., an oligonucleotide, and more specifically an ASO) are modified with one or more type of modifications as disclosed above. In other instances, about 20% of the nucleotides from the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) are modified with one or more type of modifications as disclosed above. In other instances, about 30% of the nucleotides from the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) are modified with one or more type of modifications as disclosed above. In other instances, about 40% of the nucleotides from the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) are modified with one or more type of modifications as disclosed above. In other instances, about 50% of the nucleotides from the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) are modified with one or more type of modifications as disclosed above. In other instances, about 60% of the nucleotides from the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) are modified with one or more type of modifications as disclosed above. In other instances, about 70% of the nucleotides from the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) are modified with one or more type of modifications as disclosed above. In other instances, about 80% of the nucleotides from the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) are modified with one or more type of modifications as disclosed above. In other instances, about 90% of the nucleotides from the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) are modified with one or more type of modifications as disclosed above. In other instances, 100% of the nucleotides from the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) are modified with one or more type of modifications as disclosed above.

[0105] In some instances, the one or more types of modifications disclosed herein occurs at different positions within the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO). In specific instances, the one or more types of modifications disclosed herein occurs in the seed region within the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) In specific instances, the one or more types of modifications disclosed herein occurs at 3’ terminal of the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO). In specific instances, the one or more types of modifications disclosed herein occurs at 5’ terminal ofthe modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO). In specific instances, the one or more types of modifications disclosed herein occurs dispersedly within the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO). In specific instances, the one or more types of modifications disclosed herein occurs in clusters within the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO).

[0106] In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) is a gapmer comprising a central region of consecutive DNA nucleotides flanked by a 5’-wing region and 3’-wing region, wherein at least one of 5’-wing region and 3’-wing region comprises a nucleic acid analogue, wherein the nucleic acid analogue comprises one or more ribose modifications, one or more backbone modifications, one or more nucleobase modifications, or a combination thereof.

[0107] In some instances, the one or more ribose modifications disclosed herein include locked nucleic acid (LNA), tricyclo-DNA, 2’-fluoro, 2’-O-methyl, 2’ -methoxy ethyl (2’-M0E), 2’-cyclic ethyl (cET), unlocked nucleic acid (UNA), conformationally restricted nucleoside (CRN), or any combination thereof. In some instances, the nucleic acid analogue comprises a 2’ -MOE RNA. In some instances, the 5 ’-wing region comprises at least one, at least two, at least three, at least four, at least 5, at least 6, or at least 7 2’MOE RNA. In some instances, the 5’-wing region comprises at least two 2’-MOE RNA. In some instances, the 5’-wing region comprises at least five 2’-M0E RNA. In some instances, the 3 ’-wing region comprises at least two, at least three, at least four, at least 5, at least 6, or at least 7 2’MOE RNA. In some instances, the 3’-wing region comprises at least two 2’- MOE RNA. In some instances, the 3 ’-wing region comprises at least five 2’ -MOE RNA.

[0108] In some instances, the one or more backbone modifications comprise phosphorothioate, methylphosphonate, guanidinopropyl phosphorami date, or any combination thereof. In some instances, the one or more nucleobases comprise purine modifications (e.g., 2,6-diaminopurin, 3- deaza-adenine, 7-deaza-guanine, 8-zaido-adenine, or any combination thereof).

[0109] In some instances, the one or more nucleobases comprise pyrimidine modifications (e g., 2- thio-thymidine, 5-carboxamide-uracil, 5-methyl-cytosine, 5 -ethynyl -uracil, or any combination thereof).

[0110] In some instances, the nucleic acid analogue comprises an LNA. In some instances, the LNA comprises a beta-D-oxy LNA, an alpha-L-oxy-LNA, a beta-D-amino-LNA, an alpha-L-amino-LNA, a beta-D-thio-LNA, an alpha-L-thio-LNA, a 5 ’-methyl -LNA, a beta-D-ENA, or an alpha-L-ENA In some instances, the LNA comprises a beta-D-oxy LNA. In some instances, the 5 ’-wing region comprises at least one, at least two, at least three, at least four, or at least five LNAs. In someinstances, the 5 ’-wing region comprises at least one, at least two, at least three, at least four, or at least five consecutive LNAs. In some instances, the 5’-wing region comprises at least two LNAs. In some instances, the 5 ’-wing region comprises three consecutive LNAs. In some instances, the 3’- wing region comprises at least one LNA. In some instances, the 3 ’-wing region comprises two consecutive LNAs.

[0111] In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises a phosphorodiamidate morpholino oligomer (PMO). In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten or more modified internucleotide linkages. In some instances, the at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten or more modified intemucleotide linkages comprises phosphorothioates, phosphorodithioates, or a combination thereof In some instances, the at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten or more modified internucleotide linkages are located between each nucleotide of the modulator disclosed herein (e g., an oligonucleotide, and more specifically an ASO). In some instances, each internucleotide linkage in the nucleic acid molecule is a phosphorothioate backbone.

[0112] In some instances, the modulator is a gapmer, and one or more assays are utilized to assess the efficiency of the gapmer. Accordingly, in some instances, the efficiency of the modulator is assessed by the expression (e.g., transcript expression) of the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by the features of the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by the binding of an RNA-binding protein to the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by the modification and / or functional features of the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by structural features of the IncRNA disclosed herein.

[0113] In some instances, the modulator is a mixmer, and one or more assays are utilized to assess the efficiency of the mixmer. Accordingly, in some instances, the efficiency of the modulator is assessed by the expression of the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by the features of the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by the binding of an RNA-binding protein to the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by the modificationand / or functional features of the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by structural features of the IncRNA disclosed herein.

[0114] In some instances, the modulator is an siRNA which targets a cytoplasmic target, and one or more assays are utilized to assess the efficiency of the modulator. Accordingly, in some instances, the efficiency of the modulator is assessed by the expression of the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by the features of the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by the binding of an RNA- binding protein to the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by the modification and / or functional features of the IncRNA disclosed herein. In some instances, the efficiency of the modulator is assessed by structural features of the IncRNA disclosed herein.

[0115] In some instances, the modulator disclosed herein (e.g., an oligonucleotide, and more specifically an ASO) is encapsulated in a liposome. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed here) is coupled with a nanoparticle.Pharmaceutical Compositions

[0116] Further provided herein are pharmaceutical compositions comprising the modulator disclosed herein (e.g., an oligonucleotide disclosed herein) and a pharmaceutically acceptable salt, excipient, or derivative thereof.

[0117] The suitable pharmaceutically acceptable salts or derivative thereof include but are not limited to (i) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc ; (ii) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and the like; and (iii) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like.

[0118] A pharmaceutical composition disclosed herein can be prepared to include the modulator disclosed herein (e.g., an oligonucleotide disclosed herein), into a form suitable for administration to a subject using carriers, excipients, and vehicles. In some instances, excipients include magnesium carbonate, titanium dioxide, lactose, mannitol and other sugars, talc, milk protein, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycols and solvents, such as sterile water, alcohols, glycerol, and polyhydric alcohols. Intravenous vehicles include fluidand nutrient replenishers. Preservatives include antimicrobial, anti-oxidants, chelating agents, and inert gases. Other pharmaceutically acceptable vehicles include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like, as disclosed, for instance, in Remington: The Science and Practice of Pharmacy, 21stEd., Gennaro, Ed., Lippencott Williams & Wilkins (2005), and The United States Pharmacopeia: The National Formulary (USP 36 NF31), published in 2013. The pH and exact concentration of the various components of the pharmaceutical composition are adjusted according to routine skills in the art. See Goodman and Gilman’s, The Pharmacological Basis for Therapeutics.

[0119] The pharmaceutical compositions disclosed herein may be administered in combination with one or more therapeutic agents. The pharmaceutical compositions disclosed herein may be administered in combination with one or more therapeutic agents that mediates tumor fibrosis. The pharmaceutical compositions disclosed herein may be administered in combination with one or more anti-cancer drug. The pharmaceutical compositions disclosed herein may be administered in combination with one or more myosin inhibitor. Non-limiting examples of Mavacamten (for patients with obstructive hypertrophic cardiomyopathy), Aficameten (for patients with obstructive hypertrophic cardiomyopathy or non-obstructive hypertrophic cardiomyopathy), or a derivative thereof.

[0120] The pharmaceutical compositions disclosed herein may be administered locally or systemically. The therapeutically effective amounts will vary according to factors, such as the degree of infection in a subject, the age, sex, health conditions, and weight of the individual. Dosage regimes can be adjusted to provide the optimum therapeutic response. For example, several divided doses can be administered daily or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0121] The pharmaceutical composition can be administered in a convenient manner, such as by injection (e.g., subcutaneous, intravenous, intraorbital, and the like), oral administration, ophthalmic application, inhalation, topical application, or rectal administration. In some instances, the pharmaceutical compositions disclosed herein is administered intratracheally, orally, nasally, intravenously, or intramuscularly. Depending on the route of administration, the pharmaceutical composition can be coated with a material to protect the pharmaceutical composition from the action of enzymes, acids, and other natural conditions that may inactivate the pharmaceutical composition. The pharmaceutical composition can also be administered parenterally or intraperitoneally Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, andin oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.

[0122] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The composition can be sterile and fluid to the extent that easy syringability exists. The composition can be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms, such as bacteria and fungi. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of certain particle size, in the case of dispersion, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, isotonic agents, for example, sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride are used in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

[0123] Sterile injectable solutions can be prepared by incorporating the pharmaceutical composition in an appropriate solvent with one or a combination of ingredients enumerated above followed by filtered sterilization. Generally, dispersions are prepared by incorporating the pharmaceutical composition into a sterile vehicle that contains a basic dispersion medium and the other ingredients from those enumerated above.

[0124] It is advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein, refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of pharmaceutical composition is calculated to produce the desired therapeutic effect in association with the pharmaceutical vehicle. The specification for the dosage unit forms are related to the characteristics of the pharmaceutical composition and the particular therapeutic effect to be achieve. The principal pharmaceutical composition is compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable vehicle in an acceptable dosage unit In the case of compositions containing supplementary active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the ingredients.

[0125] The pharmaceutical composition can be orally administered, for example, in a carrier, e g., in an enteric-coated unit dosage form The pharmaceutical composition and other ingredients can also be enclosed in a hard or soft-shell gelatin capsule or compressed into tablets. For oral therapeutic administration, the pharmaceutical composition can be incorporated with excipients and used in the form of ingestible tablets, troches, capsules, pills, wafers, and the like. Such compositions and preparations may contain at least 1% by weight of active compound. The percentage of the compositions and preparations can, of course, be varied and can conveniently be between about 5% to about 80% of the weight of the unit. The tablets, troches, pills, capsules, and the like can also contain the following: a binder, such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid, and the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin, or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage unit form is a capsule, it can contain, in addition to materials of the above type, a liquid carrier. Various other materials can be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules can be coated with shellac, sugar, or both. A syrup or elixir can contain the agent, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye, and flavoring, such as cherry or orange flavor. Any material used in preparing any dosage unit form can be of pharmaceutically acceptable purity and substantially non-toxic in the amounts employed. In addition, the pharmaceutical composition can be incorporated into sustained-release preparations and formulations.

[0126] The pharmaceutical composition disclosed herein may comprise one or more permeation enhancer that facilitates bioavailability of the modulator disclosed herein. WO 2000 / 67798, Muranishi, 1990, Crit. Rev. Ther Drug Carrier Systems, 7, 1, Lee et al., 1991, Crit. Rev. Ther. Drug Carrier Systems, 8, 91 are herein incorporated by reference in its entirety. In some aspects, the permeation enhancer is intestinal In some aspects, the permeation enhancer is transdermal. In some aspects, the permeation enhancer is to facilitate crossing the brain-blood barrier. In some aspects, the permeation enhancer improves the permeability in the oral, nasal, buccal, pulmonary, vaginal, or corneal delivery model. In some aspects, the permeation enhancer is a fatty acid or a derivative thereof. In some aspects, the permeation enhancer is a surfactant or a derivative thereof. In some aspects, the permeation enhancer is a bile salt or a derivative thereof. In some aspects, the permeation enhancer is a chelating agent or a derivative thereof In some aspects, the permeation enhancer is a non-chelating non- surfactant or a derivative thereof. In some aspects, the permeation enhancer is an ester or a derivative thereof. In some aspects, the permeation enhancer is an ether or aderivative thereof. In some specific aspects, the permeation enhancer is arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1 -monocaprate, 1- dodecylazacycloheptan-2-one, an acyl carnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof. In one aspect, the permeation enhancer is sodium caprate (CIO). In some instances, the permeation enhancer is chenodeoxycholic acid (CDCA), ursodeoxychenodeoxy cholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate or sodium glycodihydrofusidate. In some instances, the permeation enhancer is polyoxyethylene-9-lauryl ether, or polyoxyethylene-20-cetyl ether.

[0127] Further provided herein are kits comprising the modulator disclosed herein (e.g., an oligonucleotide disclosed herein). Further provided herein are kits comprising the pharmaceutical composition disclosed herein. In some aspects, the kit comprises suitable instructions in order to perform the methods of the kit. The instructions may provide information of performing any of the methods disclosed herein, whether or not the methods may be performed using the reagents provided in the kit.

[0128] For use in the therapeutic applications disclosed herein, kits and articles of manufacture are also disclosed herein. In some aspects, such kits include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the contained s) including one of the separate elements to be used in a method disclosed herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials such as glass or plastic. The articles of manufacture provided herein contain packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment. The container(s) optionally have a sterile access port (for example the container is an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). Such kits optionally comprise a composition with an identifying description or label or instructions relating to its use in the methods disclosed herein.

[0129] A kit may include one or more additional containers, each with one or more of various materials (such as reagents, optionally in concentrated form, and / or devices) desirable from a commercial and user standpoint for use of the modulator disclosed herein. Non-limiting examples of such materials include, but not limited to, buffers, diluents, filters, needles, syringes, carrier,package, container, vial and / or tube labels listing contents and / or instructions for use, and package inserts with instructions for use. In some instances, a set of instructions is included.

[0130] In some aspects, a label is on or associated with the container. A label can be on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself; a label can be associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert. A label can be used to indicate that the contents are to be used for a specific therapeutic application. The label can also indicate directions for use of the contents, such as in the methods disclosed herein.

[0131] In certain aspects, a pharmaceutical composition comprising the modulators provided herein and optional additional active agent is presented in a pack or dispenser device which can contain one or more unit dosage forms. The pack can for example contain metal or plastic foil, such as a blister pack. The pack or dispenser device can be accompanied by instructions for administration. The pack or dispenser can also be accompanied with a notice associated with the container in form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the drug for human or veterinary administration. Such notice, for example, can be the labeling approved by the U.S. Food and Drug Administration for prescription drugs, or the approved product insert.Compositions containing the modulators disclosed herein formulated in a compatible pharmaceutical carrier can also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.Methods

[0132] In some aspects, provided herein is a method of reducing cardiac fibrosis, the method comprising contacting a myofibroblast with any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or any one of the pharmaceutical compositions disclosed herein. In some instances, the method disclosed herein reduces an expression of any one of the IncRNAs (e.g., WISPER) selected from Tables 1-3. In some instances, the reduced expression is observed in a border zone of a heart. In some instances, the reduced expression is observed in an infarct zone of a heart. In some instances, the reduced expression is observed in a border zone and an infarct zone of a heart. In some instances, the method disclosed herein reduces an RNA expression of any one of the IncRNAs selected from Tables 1-3 by at least about 1.5 folds, at least about 2 folds, at least about 3 folds, at least about 4 folds, at least about 5 folds, at least about 6 folds, at least about 7 folds, at least about 8 folds, at least about 9 folds, or at least about 10 folds inthe myofibroblast compared to myofibroblast without contact with any one of the modulators disclosed herein.

[0133] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein downregulates myofibroblast functions. In some instances, myofibroblast functions comprises extracellular matrix organization, collagen fibril organization, cellular response to TGF-beta stimulus, or a combination thereof. In some instances, the modulator disclosed herein (e g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein reduces an expression of a fibrotic marker. In some instances, the fibrotic marker comprises COL1A1, ACTA2, FN1, COL3A1, ME0X1, RUNX1 / 2, PTN, MMP15, or a combination thereof. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein reduces an expression of one or more genes from Table 5. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein reduces an expression of one or more genes from Table 6.

[0134] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein regulates TIAR expression. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein regulates TIAR downstream RNA target genes. In some instances, the TIAR downstream RNA target genes are enriched in myofibroblast. In some instances, the TIAR downstream RNA target genes that are enriched in myofibroblast comprises COL6A2, COL14A1, COL1A1, CILP, COL21A1, COL6A1, SMAD9, or a combination thereof. In some instances, the TIAR downstream RNA target genes are enriched in fibroblast. In some instances, the TIAR downstream RNA target genes that are enriched in fibroblast comprises TGFB1, SMAD4, COL13A1, or a combination thereof. In some instances, the TIAR downstream RNA target genes are enriched in myofibroblast and fibroblast. In some instances, the TIAR downstream RNA target genes that are enriched in myofibroblast and fibroblast comprises COL3A1, PLOD2, POSTN, FN1, FAP or a combination thereof. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein increases an expression of a down-regulated gene specific to the myofibroblast compared to a control (e g., a myofibroblast without contact with any one of themodulators disclosed herein, a myofibroblast contacted with a scramble / non-wisper targeting ASO control). In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein reduces an expression of an up-regulated gene specific to the myofibroblast compared to a control (e.g., a myofibroblast without contact with any one of the modulators disclosed herein, a myofibroblast contacted with a scramble / non-wisper targeting ASO control). In some instances, the modulator disclosed herein (e g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein increases an expression of a down-regulated gene specific to the myofibroblast and reduces an expression of an up-regulated gene specific to the myofibroblast compared to a control (e.g., a myofibroblast without contact with any one of the modulators disclosed herein, a myofibroblast contacted with a scramble / non-wisper targeting ASO control). In some instances, the up-regulated gene specific to the myofibroblast comprises CILP, C0L14A1, C0L1A1, PL0D2, SMAD9, COL6A2, C0L21A1 or a combination thereof. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein regulates expression of proteincoding genes located within the genomic locus encoding any one of the IncRNAs (e.g., WISPER) disclosed herein. For example, in some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein reduces expression of SULF2 and / or JPH2, which are neighboring protein-coding genes of the IncRNA disclosed here (e.g., WISPER).

[0135] Further provided herein is a method of inducing a cell state transition from a myofibroblast state to a quiescent fibroblast state, the method comprising contacting the cell with any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein is used for cellular reprogramming. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein is involved in cellular reprogramming. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein is involved in partial cellular reprogramming “Reprogram” refer to a process that alters or reverses a differentiation state of a differentiated cell (e.g., myofibroblast). Reprogramming can be a complete or full reversal of the differentiation state to a pluripotent state or a multipotent state. Reprogramming can be a completeor partial reversion of the differentiation state of a differentiated cell (e.g., myofibroblast) to an undifferentiated cell, or a less differentiated state. Reprogramming can result in expression of particular genes by the cells, the expression of which further contributes to reprogramming. Reprogramming can result in chromatin rearrangement and / or change in chromatin accessibility. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein is involved in epigenomic reprogramming.

[0136] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein is used to induce a cell to transition (or reprogram a cell) away from a myofibroblast state In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein is used to induce a cell to transition (or reprogram a cell) towards (i.e., in a trajectory to) a fibroblast cell state. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein is used to induce a cell to transition (or reprogram a cell) as a fibroblast cell state.

[0137] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein is used to reprogram a cell (e.g., differentiated cell, myofibroblast) into a fibroblast. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein) is used to reprogram a myofibroblast into a fibroblast. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein) is used to reprogram a myofibroblast into a quiescent fibroblast. In some instances, a fibrotic marker (e.g., CoLlAl, ACTA2, FN1, COL3A1, ME0X1, RUNX1 / 2, PTN, MMP15) has a lower expression in the quiescent fibroblast described herein than the one in a myofibroblast.

[0138] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein modulates chromatin accessibility. For example, in some instances, a first segment of chromatin is accessible in the myofibroblast after contacting the myofibroblast with any one of the modulators disclosed herein (e g , an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein. In some instances, a transcription factor binds to such first segment of chromatin, and it comprises CTCF, RFZ, TEAL) 1 / 3 / 4, MESP1, TCF3, ZEB1, or a combinationthereof. In some instances, a second segment of chromatin is inaccessible in the myofibroblast after contacting the myofibroblast with any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein) or any one of the pharmaceutical composition disclosed herein. In some instances, a transcription factor binds to such second segment of chromatin, and it comprises RUNX1 / 2 / 3, JUN B / D, FOS, EBF1, API, GATA, NFE2, or a combination thereof. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein modulates chromosomal interactions. In some the modulator disclosed herein (e g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical composition disclosed herein modulates a chromatin structure.

[0139] Further provided herein is a method of preventing, alleviating, or treating a cardiac fibrosis-mediated cardiac pathology (e g., cardiac myopathy, cardiac myofibroblast-associated pathological condition, etc.) in a subject in need thereof, the method comprising administering to the subject an effective amount of any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein. In some instances, the method disclosed herein prevents, alleviates, or treats symptoms comprising hypertension, myocardial infarction (MI), or hypertrophic cardiomyopathy (HCM) (e.g., obstructive HCM, nonobstructive HCM) or the symptoms associated with such disorders.

[0140] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein results in anti-fibrotic effect (e.g., left ventricle compliance and function. In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein improves a cardiac contractility, a cardiac electrical conductivity, or a combination thereof in the subject. In some instances, the cardiac contractility and / or cardiac conductivity is evaluated by measuring a protein and / or mRNA expression of MYBPC3, MY0M3, SCN5A, SCN10A, HANOI, MYP2, HANOI, KLF15, TIN, or a combination thereof.

[0141] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein reduces one or more biomarker for a risk of poor cardiovascular clinical outcomes in the subject. In some instances, the biomarker for a risk of poor cardiovascular clinical outcomes comprises coagulation factor 2 receptor (F2R). In some instances, the one or more biomarkers for a risk of poor cardiovascular clinical outcomes is enriched in a border zone of a heart from the subject. In someinstances, the one or more biomarkers for a risk of poor cardiovascular clinical outcomes is enriched in an infarct zone of a heart from the subject. In some instances, the one or more biomarkers for a risk of poor cardiovascular clinical outcomes is enriched in a border zone and an infarct zone of a heart from the subject.

[0142] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein reduces one or more biomarkers associated with hypertrophic cardiomyopathy in the subject compared to before being administered with any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein. In some instances, the biomarker associated with hypertrophic cardiomyopathy comprises CITED4, MYH7B, HDAC9, ACTN2, KLF11, HEY2, or a combination thereof. In some instances, the biomarker associated with hypertrophic cardiomyopathy is enriched in a border zone of a heart from the subject. In some instances, the biomarker associated with hypertrophic cardiomyopathy is enriched in an infarct zone of a heart from the subject. In some instances, the biomarker associated with hypertrophic cardiomyopathy is enriched in a border zone and an infarct zone of a heart from the subject.

[0143] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein reduces an expression and / or activity of one or more genes associated with a heart disease and / or cardiomyopathy in the subject compared to before being administered with any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein. In some instances, the gene associated with the heart disease and / or cardiomyopathy comprises MYH11, TPM1, TNNT2, TNNC1, NPPB, AP3D1, NDUF1 IB, SLC25A4, KCNJ5, TRIP6, or a combination thereof.

[0144] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein reduces an expression and / or activity of one or more genes associated with oxidative phosphorylation in the subject compared to before being administered with any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein. In some instances, the gene associated with associated with oxidative phosphorylation comprises ATP5PO / 5F1C, NDUFA2 / 9, NDUFB8 / B9 / A9, SAMM50, or a combination thereof.

[0145] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein reduces an expression and / or activity of one or more genes associated with cardiac muscle contraction in the subject compared to before being administered with any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein. In some instances, the gene associated with cardiac muscle contraction comprises UQCRC1, CYC1, COX5B, ATP2A, TPM1, TNNT2, TNNC1, or a combination thereof.

[0146] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein reduces an expression and / or activity of one or more heart failure markers in the subject compared to before being administered with any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein. In some instances, the one or more heart failure markers are detected in a heart tissue. In some instances, the one or more heart failure markers are detected in a serum or a plasma sample from the subject. In some instances, the heart failure marker comprises NPPB, MMP9 COL1A1, IL1RL1, or a combination thereof. In some instances, the heart failure marker comprises NT-proBNP, BNP, MMP9, PICP3, soluble ST2, or a combination thereof.

[0147] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein reduces a collagen and / or a fibrotic scar in the subject compared to before being administered with any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein. In some instances, the reduced collagen and / or the reduced fibrotic scar is observed in a border zone of a heart in the subject. In some instances, the reduced collagen and / or the reduced fibrotic scar is observed in an infarct zone of a heart in the subject. In some instances, the reduced collagen and / or the reduced fibrotic scar is observed in a border zone and an infarct zone of a heart in the subject.

[0148] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein reduces proliferation of a heart myofibroblast of the subject compared to before being administered with any one of the modulators disclosed herein (e g , an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein In some instances, the method disclosed herein reduces migration of a heart myofibroblast of the subject compared to before beingadministered with any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein. In some instances, the method disclosed herein increases apoptosis of a heart myofibroblast of the subject compared to before being administered with any one of the modulators disclosed herein (e.g., an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein. In some instances, the method disclosed herein reduces the diameter of cardiomyocytes of the subject compared to before being administered with any one of the modulators disclosed herein (e g., an oligonucleotide disclosed herein) or any one of the pharmaceutical compositions disclosed herein.

[0149] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein modulates metabolic pathways or metabolism of the subject to a level similar to that of a healthy subject. For example, in some instances, fatty acid oxidation metabolism in the subject is increased to a level that is similar to a healthy subject. In some instances, the glycolytic metabolism is decreased to a level that is similar to a healthy subject.

[0150] In some instances, the modulator disclosed herein (e.g., an oligonucleotide disclosed herein, and specifically such as an ASO) or the pharmaceutical compositions disclosed herein is used to treat a cardiac fibrosis-mediated cardiac pathology, includes but is not limited to hypertrophic cardiomyopathy, myocardial infarction, heart failure with preserved or reduced ejection fraction, dilated cardiomyopathy, aortic stenosis, diabetic cardiomyopathy, restrictive cardiomyopathy, cardiac amyloidosis, genetic diseases causal of attendant cardiomyopathy, or excessive interstitial fibrosis pathology.

[0151] In some instances, the administering in any of the methods disclosed herein is performed intratracheally, orally, nasally, intravenously, intraperitoneally, or intramuscularly. In some embodiments, the method disclosed herein comprises administering a myosin inhibitor to the subject in addition to the modulator disclosed herein (e.g, an oligonucleotide disclosed herein, and specifically such as an ASO) Non-limiting examples of a myosin inhibitor includes Mavacamten (for patients with obstructive hypertrophic cardiomyopathy), Aficameten (for patients with obstructive hypertrophic cardiomyopathy or non-obstructive hypertrophic cardiomyopathy), or a derivative thereof. In some instances, addition of one or more myosin inhibitor results in anti-fibrotic effect (e.g., left ventricle compliance and function).

[0152] Also provided herein are methods for diagnosing cardiac fibrosis or cardiac fibrosis- mediated cardiac pathology in a subject by detecting an amount and / or an activity of a biomarker comprising a sequence that is at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%identical to a sequence from Tables 1, 5 and 6. In some instances, the method comprises: (a) obtaining a biological sample derived from the subject; (b) detecting an amount and / or an activity of a biomarker from the biological sample, wherein the biomarker comprises a sequence that is at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% identical to a sequence from Tables 1, 5, and 6; and (c) diagnosing the subject with cardiac fibrosis or cardiac fibrosis-mediated cardiac pathology, if the amount and / or the activity of the biomarker is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% higher when compared to a healthy individual In some instances, based on the results in (c), the methods further comprise d) administering to the subject the modulator described herein or the pharmaceutical composition described herein. In some instances, the modulator described herein or the pharmaceutical composition described herein is administered intratracheally, oropharyngeally, orally, nasally, intravenously, intraperitoneally, or intramuscularly. Tn some instances, the biomarker further comprises is coagulation factor 2 receptor (F2R), CITED4, MYH7B, HDAC9, ACTN2, KLF11, HEY2, MYH11, TPM1, TNNT2, TNNC1, NPPB, AP3D1, NDUF11B, SLC25A4, KCNJ5, TRIP6, ATP5PO / 5F1C, NDUFA2 / 9, NDUFB8 / B9 / A9, SAMM50, UQCRC1, CYC1, COX5B, ATP2A, TPM1, TNNT2, TNNC1, NPPB, MMP9 COL1A1, IL1RL1, MYBPC3, MY0M3, SCN5A, SCN10A, HAND!, MYP2, HANOI, KLF15, TTN, miR-21, PLK2, NCAM1, TGFB1, or a combination thereof. In some instances, the detecting comprises using SI nuclease protection assay, microarray analysis, polymerase chain reaction (PCR), hybridization technologies, reverse transcriptase polymerase chain reaction (RT-PCR), Northern blot, serial analysis of gene expression (SAGE), immunoassay, and / or mass spectrometry, or any sequencing-based methods known in the art. In some instances, exemplary sequencing-based methods include but are not limited to bulk RNA sequencing, single cell or single nucleus RNA sequencing, DNA sequencing, DNA methylation profiling (e.g., for example, average % methylated CpG along the transposable element locus or the methylation status of specific CpGs within the transposable element ), sc- or snATAC- seq or bulk ATAC-seq, DNase I assay for accessibility, CUT&RUN or ChlP-seq for specific histone marks (e.g, H3K27ac, H4K16ac, H3K9me3, H3K27me3, H3K4mel, H3K4me3, etc.).

[0153] Also provided herein are methods for monitoring or predicting the progression of cardiac fibrosis or cardiac fibrosis-mediated cardiac pathology in a subject by detecting an amount and / or an activity of a biomarker comprising a sequence that is at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% identical to a sequence from Tables 1, 5 and 6 In some instances, the method comprising: (a) obtaining a biological sample derived from the subject at an earlier time point and a later time point; (b) detecting an amount and / or an activity of a biomarker from the biologicalsample, wherein the biomarker comprises a sequence that is at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% identical to a sequence from Tables 1, 5, and 6; and (c) predicting or concluding the cardiac fibrosis or cardiac fibrosis-mediated cardiac pathology persists or progresses, if the amount and / or the activity of the biomarker at the later time point is not lower when compared to the amount and / or the activity of the biomarker at the earlier time point. In some instances, in (c), the amount and / or the activity of the biomarker at the later time point is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% more than the amount and / or the activity of the biomarker at the earlier time point. In some instances, the later time point is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days after the earlier time point. In some instances, based on the results in (c), the methods further comprise d) administering to the subject the modulator described herein or the pharmaceutical composition described herein. In some instances, the modulator described herein or the pharmaceutical composition described herein is administered intratracheally, oropharyngeally, orally, nasally, intravenously, intraperitoneally, or intramuscularly. In some instances, the biomarker further comprises is coagulation factor 2 receptor (F2R), CITED4, MYH7B, HDAC9, ACTN2, KLF11, HEY2, MYH11, TPM1, TNNT2, TNNC1, NPPB, AP3D1, NDUF11B, SLC25A4, KCNJ5, TRIP6, ATP5PO / 5F1C, NDUFA2 / 9, NDUFB8 / B9 / A9, SAMM50, UQCRC1, CYC1, COX5B, ATP2A, TPM1, TNNT2, TNNC1, NPPB, MMP9 COL1A1, IL1RL1, MYBPC3, MY0M3, SCN5A, SCN10A, HANOI, MYP2, HANOI, KLF15, TTN, miR-21, PLK2, NCAM1, TGFB 1, or a combination thereof. In some instances, the detecting comprises using SI nuclease protection assay, microarray analysis, polymerase chain reaction (PCR), hybridization technologies, reverse transcriptase polymerase chain reaction (RT- PCR), Northern blot, serial analysis of gene expression (SAGE), immunoassay, and / or mass spectrometry, or any sequencing-based methods known in the art. In some instances, exemplary sequencing-based methods include but are not limited to bulk RNA sequencing, single cell or single nucleus RNA sequencing, DNA sequencing, DNA methylation profiling (e g., for example, average % methylated CpG along the transposable element locus or the methylation status of specific CpGs within the transposable element ), sc- or snATAC-seq or bulk ATAC-seq, DNase I assay for accessibility, CUT&RUN or ChlP-seq for specific histone marks (e.g., H3K27ac, H4K16ac, H3K9me3, H3K27me3, H3K4mel, H3K4me3, etc.).

[0154] Also provided herein are methods for monitoring cardiac myofibrotic tissue regeneration / reprograming to fibrotic tissue or monitoring the efficacy of a treatment to induce cardiac regeneration / reprogramming in a subject by detecting an amount and / or an activity of a biomarker comprising a sequence that is at least 60%, at least 70%, at least 80%, at least 90%, or atleast 95% identical to a sequence from Tables 1, 5 and 6. In some instances, the method comprising: (a) obtaining a biological sample derived from the subject at an earlier time point and a later time point; (b) detecting an amount and / or an activity of a biomarker from the biological sample, wherein the biomarker comprises a sequence that is at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% identical to a sequence from Tables 1, 5, and 6; and (c) concluding cardiac myofibrotic tissue regenerates or reprograms to fibrotic tissue or the treatment is effective, if the amount and / or the activity of the biomarker at the later time point is not higher when compared to the amount and / or the activity of the biomarker at the earlier time point. In some instances, in (c), the amount and / or the activity of the biomarker at the later time point is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower than the amount and / or the activity of the biomarker at the earlier time point. In some instances, the later time point is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days after the treatment. In some instances, the later time point is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days after the earlier time point. In some instances, the biomarker further comprises is coagulation factor 2 receptor (F2R), CITED4, MYH7B, HDAC9, ACTN2, KLF1 1, HEY2, MYH11, TPM1, TNNT2, TNNC1, NPPB, AP3D1, NDUF11B, SLC25A4, KCNJ5, TRIP6, ATP5PO / 5F1C, NDUFA2 / 9, NDUFB8 / B9 / A9, SAMM50, UQCRC1, CYC1, COX5B, ATP2A, TPM1, TNNT2, TNNC1, NPPB, MMP9 COL1A1, IL1RL1, MYBPC3, MY0M3, SCN5A, SCN10A, HANOI, MYP2, HANOI, KLF15, TTN, miR-21, PLK2, NCAM1, TGFB 1, or a combination thereof. In some instances, the detecting comprises using SI nuclease protection assay, microarray analysis, polymerase chain reaction (PCR), hybridization technologies, reverse transcriptase polymerase chain reaction (RT-PCR), Northern blot, serial analysis of gene expression (SAGE), immunoassay, and / or mass spectrometry, or any sequencingbased methods known in the art. In some instances, exemplary sequencing-based methods include but are not limited to bulk RNA sequencing, single cell or single nucleus RNA sequencing, DNA sequencing, DNA methylation profiling (e.g., for example, average % methylated CpG along the transposable element locus or the methylation status of specific CpGs within the transposable element ), sc- or snATAC-seq or bulk ATAC-seq, DNase I assay for accessibility, CUT&RUN or ChlP-seq for specific histone marks (e.g., H3K27ac, H4K16ac, H3K9me3, H3K27me3, H3K4mel, H3K4me3, etc.). In some instances, if the cardiac myofibrotic tissue regeneration / reprograming is not as expected, the methods further comprise d) administering to the subject the modulator described herein or the pharmaceutical composition described herein

[0155] Also provided herein are methods for diagnosing cardiac fibrosis or cardiac fibrosis- mediated cardiac pathology, monitoring the progression of cardiac fibrosis, or evaluating / monitoringcardiac myofibrotic tissue regeneration / reprograming to fibrotic tissue in a subject by detecting an amount and / or an activity of a biomarker comprising NT-proBNP / BNP, MMP9, PICP, soluble ST2, activin A, FSTL3, MPK9, fibrinogen, PDE5A, SULF2, CILP, THBS1, PTK2B, TGFB1, PCTP, CXCL16, or a combination thereof. In some instances, the method comprising: (a) obtaining a biological sample derived from the subject; (b) detecting an amount and / or an activity of a biomarker from the biological sample, wherein the biomarker comprises NT-proBNP / BNP, MMP9, PICP, soluble ST2, activin A, FSTL3, MPK9, fibrinogen, PDE5A, SULF2, CILP, THBS1, PTK2B, TGFB1, PCTP, CXCL16, or a combination thereof; and (c) concluding that the subject has (continued) cardiac fibrosis cardiac fibrosis-mediated cardiac pathology, or there is less significant cardiac myofibrotic tissue regeneration / reprograming to fibrotic tissue if the amount and / or the activity of the biomarker is at least 50%, at least 60%, at least 70%, at least 80%, at least 90% higher than a healthy individual In some instances, the biological sample comprises a whole blood sample, a blood plasma sample, or a blood serum sample. In some instances, based on the results in (c), the methods further comprise d) administering to the subject the modulator described herein or the pharmaceutical composition described herein. In some instances, the modulator described herein or the pharmaceutical composition described herein is administered intratracheally, oropharyngeally, orally, nasally, intravenously, intraperitoneally, or intramuscularly. In some instances, the detecting comprises enzyme-linked immunosorbent assay (ELISA), western blotting, mass spectrometry, immunoprecipitation, flow cytometry, lateral flow assay, beads / immobilized surface coated with different fluorescent antibodies, electrochemiluminescence (ECL), radioimmunoassay, or a combination thereof.

[0156] Also provided herein are methods for predicting if a subject with heart failure would be responsive to a cardiac related therapy (e.g., left ventricular assist device (LVAD) implantation) or monitoring the efficacy of such cardiac related therapy by detecting an amount and / or an activity of a biomarker comprising a sequence that is at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% identical to a sequence from Tables 1, 5 and 6. In some instances, the method comprising: (a) obtaining a biological sample derived from the subject before and after the cardiac related therapy; (b) detecting an amount and / or an activity of a biomarker from the biological sample, wherein the biomarker comprises a molecule comprising a sequence that is at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% identical to a sequence from Tables 1, 5 and 6; and (c) predicting the subject is responsive or the cardiac related therapy is effective, if the amount and / or the activity of the biomarker after the cardiac related therapy is not higher than the amount and / or the activity of the plurality of biomarkers before the cardiac related therapy. In someinstances, the amount and / or the activity of the biomarker after the cardiac related therapy is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower than the amount and / or the activity of the plurality of biomarkers before the cardiac related therapy. In some instances, in (a), the biological sample is taken at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days before the cardiac related therapy. In some instances, in (a), the biological sample is taken at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 days after the cardiac related therapy. In some instances, if the cardiac related therapy is not as expected (e.g., the subject is not responsive), the methods further comprise d) administering to the subject the modulator described herein or the pharmaceutical composition described herein. In some instances, the modulator described herein or the pharmaceutical composition described herein is administered intratracheally, oropharyngeally, orally, nasally, intravenously, intraperitoneally, or intramuscularly. Tn some instances, the biomarker comprises SULF2 and COL14A1 . In some instances, the detecting comprises using SI nuclease protection assay, microarray analysis, polymerase chain reaction (PCR), hybridization technologies, reverse transcriptase polymerase chain reaction (RT-PCR), Northern blot, serial analysis of gene expression (SAGE), immunoassay, and / or mass spectrometry, or any sequencing-based methods known in the art. In some instances, exemplary any sequencingbased methods include but are not limited to bulk RNA sequencing, single cell or single nucleus RNA sequencing, DNA sequencing, DNA methylation profiling (e.g., for example, average % methylated CpG along the transposable element locus or the methylation status of specific CpGs within the transposable element ), sc- or snATAC-seq or bulk ATAC-seq, DNase I assay for accessibility, CUT&RUN or ChlP-seq for specific histone marks (e.g., H3K27ac, H4K16ac, H3K9me3, H3K27me3, H3K4mel, H3K4me3, etc.).Certain Terminology

[0157] The use of the alternative (e.g., “or”) should be understood to mean either one, both, or any combination thereof of the alternatives. The term “and / or” should be understood to mean either one, or both of the alternatives.

[0158] The term “noncoding RNA” as used herein, refers to RNA species that are not translated into proteins. The term “long noncoding RNA” or “IncRNA” as used herein, refers to a noncoding RNA that is at least 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides long.

[0159] The term “gapmer” is a chimeric nucleic acid that contains a central sequence of (“DNA gap”) flanked by sequences of modified RNA residues at DNA nucleotides either end to protect the DNA gap from nuclease degradation, whereas the central DNA gap region allows RNase-H- mediated cleavage of the target RNA. In some aspects, the DNA nucleotides of the gap region canbe linked by or contain phosphorothioate modified internucleotide linkages. Gapmer has an internal region having a plurality of nucleosides which is capable of recruiting RNase H activity, such as RNaseH, which region is positioned between external wings at either end, having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external wings.

[0160] A “locked nucleic acid” or “LNA” is often referred to as inaccessible RNA, and is a modified RNA nucleobase. The ribose moiety of an LNA nucleobase is modified with an extra bridge connecting the 2’ oxygen and 4’ carbon. An LNA oligonucleotide offers substantially increased affinity for its complementary strand, compared to traditional DNA or RNA oligonucleotides

[0161] The terms “polynucleic acid,” “polynucleotide,” “oligonucleotide,” “nucleic acid” and “nucleic acid molecule” are used herein to include a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded DNA, as well as triple-, double- and single-stranded RNA. In some aspects, it also includes modifications, such as by methylation and / or by capping, and unmodified forms of the polynucleotide. More particularly, the terms “polynucleotide,” “oligonucleotide,” “nucleic acid” and “nucleic acid molecule” include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing nonnucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids (PNAs)) and polymorpholino (commercially available from the Anti-Vials, Inc., Corvallis, Oreg., as Neugene) polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. There is no intended distinction in length between the terms “polynucleotide,” “oligonucleotide,” “nucleic acid” and “nucleic acid molecule,” and these terms will be used interchangeably. Thus, these terms include, for example, RNA, double- and single-stranded DNA, as well as double- and single-stranded RNA, microRNA, DNA:RNA hybrids, and hybrids between PNAs and DNA or RNA, and also include known types of modifications, for example, labels which are known in the art, methylation, “caps,” substitution of one or more of the naturally occurring nucleotides with an analog (e.g., 2 ’-aminoadenosine, 2’-thiothymidine, inosine, pyrrolo-pyrimidine, 3 ’-methyl adenosine, C5-propynylcytidine, C5-propynyluridine, C5- bromouridine, C5-fluorouridine, C5-iodouridine, C5-methylcytidine, 7-deazaadenosine, 7- deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2’ -thiocytidine),internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc ), with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc ), and with positively charged linkages (e g., aminoalklyphosphoramidates, aminoalkylphosphotriesters), those containing pendant moieties, such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L- lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc ), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide or oligonucleotide. The term also includes locked nucleic acids (e.g., comprising a ribonucleotide that has a methylene bridge between the 2’ -oxygen atom and the 4’-carbon atom). See, for example, Kurreck et al. (2002) Nucleic Acids Res. 30: 1911-1918.

[0162] “Administering”, as it applies in the present disclosure, refers to contact of an effective amount of a modulator of a long noncoding RNA of the disclosure or a synthetic polynucleic acid comprising a nucleic acid sequence of a long noncoding RNA or a portion thereof to the subject. Administering a nucleic acid, such as a microRNA, siRNA, piRNA, snRNA, modRNA, or antisense nucleic acid, to a cell comprises transducing, transfecting, electroporating, translocating, fusing, phagocytosing, shooting or ballistic methods, or any methods by which a nucleic acid can be transported across a cell membrane.

[0163] An “effective amount” of modulator of long noncoding RNA of the disclosure (e.g., microRNA, siRNA, piRNA, snRNA, modRNA, antisense nucleic acid, ribozyme, or small molecule inhibitor, CRISPRs etc.) or a synthetic polynucleic acid is an amount sufficient to effect beneficial or desired results, such as an amount that inhibits, activates, or supplement the activity of the long noncoding RNA. In some instances, the effective amount of the modulator is enough to interfere with the transcription of the long noncoding RNA. An effective amount can be administered in one or more administrations, applications, or dosages. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the condition being treated, the particular drug or drugs employed, mode of administration, and the like. An appropriate “effective” amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation, based upon the information provided herein.

[0164] The terms “quantity,” “amount,” and “level” are used interchangeably herein and may refer to an absolute quantification of a molecule or an analyte in a sample, or to a relative quantification of a molecule or analyte in a sample, i.e., relative to another value such as relative to areference value as taught herein, or to a range of values for the biomarker. These values or ranges can be obtained from a single patient or from a group of patients.

[0165] Whenever the term “at least,” “more than,” or “less than” precedes the first numerical value in a series of two or more numerical values, the term “at least,” “greater than” or “greater than or equal to” applies to each of the numerical values in that series of numerical values. For example, greater than or equal to 1, 2, or 3 is equivalent to greater than or equal to 1, greater than or equal to 2, or greater than or equal to 3.

[0166] The term “a,” “an” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a long noncoding RNA” includes a mixture of two or more long noncoding RNAs, and the like.

[0167] The term “cardiac fibrosis” as used herein, refers to a set of cardiac diseases that affect the heart tissues. In some aspects, cardiac fibrosis refers to thickening or scarring of the cardiac tissue or a portion thereof In some aspects, cardiac fibrosis comprises a scarring event in the cardiac muscle characterized by an increased collagen type I deposition, cardiac fibroblast activation and / or differentiation into myofibroblasts.

[0168] The term “about,” as used herein, when referring to a number or a numerical range, generally means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and thus, the number or numerical range, in some instances, may vary from the stated number or numerical range.

[0169] The term “comprising” (and related terms such as “comprise” or “comprises” or “having” or “including”) is not intended to exclude that in other certain instances, for example, an instance of any composition of matter, composition, method, or process, or the like, disclosed herein, “consist of’ or “consist essentially of’ the disclosed features.

[0170] The term “subject” or “patient,” as used herein, generally encompasses organisms such as mammals. Examples of mammals include, but are not limited to, any member of the mammalian class: humans, non-human primates, such as chimpanzees, and other apes and monkey species; farm animals, such as cattle, horses, sheep, goats, swine; domestic animals, such as rabbits, dogs, and cats; laboratory animals, including rodents, such as rats, mice and guinea pigs, and the like. In one aspect, the mammal is a human.

[0171] The term “treatment” or “treating,” as used herein, are used interchangeably. These terms generally refer to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit and / or a prophylactic benefit. In some instances, the term refers to eradication of the underlying disorder being treated. In other instances, the term refers to the eradication of one ormore of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient is still afflicted with the underlying disorder.

[0172] The term “alleviating” or “alleviate,” as used herein, refers to amelioration, improving, or stalling the further progression of the underlying disorder being treated. In other instances, the term refers to the amelioration, improving, or stalling the further progression of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient is still afflicted with the underlying disorder.

[0173] The term “preventing” or “prevent,” as used herein, refers to the situation where the compositions disclosed herein are administered to a patient at risk of developing a particular disease, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease has not been made.

[0174] The term "or" may refer to "and", "or," or "and / or" and may be used both exclusively and inclusively. For example, the term "A or B" may refer to "A or B", "A but not B", "B but not A", and "A and B". In some cases, context may dictate a particular meaning.

[0175] The term “reducing cardiac fibrosis,” as used herein, refers to not just reduction of fibrotic tissues on the macrolevel but also to various related molecular readouts, such as wisper expression, Wisper TEP, TIAR downstream targets that are specific to myofibroblast, SULF2 expression, fibrotic markers, genomic signatures of myoFB, chromatin accessibility of myoFB etc, as exemplified but are not limited by examples illustrated herein.

[0176] The term “gene signature,” as used herein, refers to genes that exhibit specific expression patterns under a specified condition. In some instances, to assess the impact of modulators described herein on Wisper-TIAR mechanism of action, genes modulated by TIAR that are specific to myofibroblast (e.g., as tested in FIG. 11) were identified and measured. In some instances, to assess the impact of modulators described herein on cell-state transition, genes for “sig. myoFB_cellstate” (e.g., as tested in FIG. 6) were identified and measured. In some instances, to assess the impact of modulators described herein in a disease context, genes that are specifically expressed in hypertrophic cardiomyopathy (e.g., “HCM gene signature” in FIG. 24 and “sig. HCM_patients” in FIG. 6) were identified and measured.

[0177] The term “quiescent fibroblast state,” as used herein, refers to a cell state that is different from myofibroblast state identified by single nucleic RNA-seq Quiescent fibroblast state is a non- pathological cell state with low expression of fibrotic markers (e.g., CoLl Al, ACTA2, FN1, COL3A1, ME0X1, RUNX1 / 2, PTN, MMP15).

[0178] The term “WISPER” and “Wisper” are used interchangeably herein, and refer to a IncRNA (either a genomic sequence or a portion thereof or a transcribed IncRNA or a portion thereof) in a certain species that is identified to be associated with cardiac fibrosis.List of Exemplary Embodiments

[0179] Embodiment 1. A modified oligonucleotide comprising a nucleic acid sequence having at least 10, 11, 12, or 13 contiguous nucleotides with no more than 1, 2, or 3 mismatches from one of nucleic acid sequences in Table 4.

[0180] Embodiment 2. The modified oligonucleotide of embodiment 1, wherein the modified oligonucleotide comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to one of nucleic acid sequences in Table 4.

[0181] Embodiment 3. The modified oligonucleotide of embodiment 1 or embodiment 2, wherein the modified oligonucleotide is about 13-30 nucleotides long.

[0182] Embodiment 4. The modified oligonucleotide of embodiment 3, wherein the modified oligonucleotide is about 14-22 nucleotides long.

[0183] Embodiment 5. The modified oligonucleotide of any one of embodiments 1-4, wherein the modified oligonucleotide is a single-stranded antisense oligonucleotide (ASO).

[0184] Embodiment 6. The modified oligonucleotide of any one of embodiments 1-5, wherein the modified oligonucleotide is a gapmer or a mixmer.

[0185] Embodiment 7. The modified oligonucleotide of embodiment 6, wherein the modified oligonucleotide is a gapmer, wherein the modified oligonucleotide comprises a central region of consecutive DNA nucleotides flanked by a 5’-wing region and 3’-wing region, wherein at least one of 5’-wing region and 3’-wing region comprises a nucleic acid analogue, wherein the nucleic acid analogue comprises one or more ribose modifications, one or more internucleotide linkage modifications, one or more nucleobase modifications, or a combination thereof.

[0186] Embodiment 8. The modified oligonucleotide of embodiment 7, wherein the nucleic acid analogue comprises a 2 ’-methoxy ethyl (2’-M0E) RNA.

[0187] Embodiment 9. The modified oligonucleotide of embodiment 8, wherein the 5’ -wing region comprises at least two 2’ -MOE RNAs.

[0188] Embodiment 10. The modified oligonucleotide of embodiment 8, wherein the 5’-wing region comprises five 2’-M0E RNAs.

[0189] Embodiment 11. The modified oligonucleotide of any one of embodiments 8-10, wherein the 3 ’-wing region comprises at least two 2’ -MOE RNAs.

[0190] Embodiment 12. The modified oligonucleotide of embodiment 11, wherein the 3’-wing region comprises five 2’-M0E RNAs.

[0191] Embodiment 13. The modified oligonucleotide of embodiment 7, wherein the nucleic acid analogue comprises a locked nucleic acid (LNA).

[0192] Embodiment 14. The modified oligonucleotide of embodiment 13, wherein the LNA comprises a beta-D-oxy LNA, an alpha-L-oxy-LNA, a beta-D-amino-LNA, an alpha-L-amino-LNA, a beta-D-thio-LNA, an alpha-L-thio-LNA, a 5'-methyl-LNA, a beta-D-ENA, or an alpha-L-ENA.

[0193] Embodiment 15. The modified oligonucleotide of any one of embodiments 13-14, wherein the 5’-wing region comprises at least two LNAs.

[0194] Embodiment 16. The modified oligonucleotide of embodiment 15, wherein the 5’-wing region comprises three consecutive LNAs.

[0195] Embodiment 17. The modified oligonucleotide of any one of embodiments 13-16, wherein the 3 ’-wing region comprises at least one LNA.

[0196] Embodiment 18. The modified oligonucleotide of embodiment 17, wherein the 3’-wing region comprises two consecutive LNAs.

[0197] Embodiment 19. The modified oligonucleotide of any one of embodiments 1-18, wherein the modified oligonucleotide comprises a phosphorodiamidate morpholino oligomer (PMO).

[0198] Embodiment 20. The modified oligonucleotide of any one of embodiments 1-19, wherein the modified oligonucleotide comprises one or more modified intemucleotide linkages.

[0199] Embodiment 21. The modified oligonucleotide of embodiment 20, wherein the one or more modified internucleotide linkages comprise a phosphorothioate intemucleotide linkage, a phosphorodithioate intemucleotide linkage, or a combination thereof.

[0200] Embodiment 22. The modified oligonucleotide of any one of embodiments 21, wherein the one or more modified intemucleotide linkages comprise one or more phosphorothioate intemucleotide linkages, and the one or more phosphorothioate intemucleotide linkages are located between each nucleotide of the modified oligonucleotide.

[0201] Embodiment 23. The modified oligonucleotide of any one of embodiments 1-21, wherein the modified oligonucleotide comprises or consists of a nucleic acid sequence selected from Table 4.

[0202] Embodiment 24. A pharmaceutical composition comprising the modified oligonucleotide of any one of embodiments 1-23 and a pharmaceutically acceptable salt or derivative thereof.

[0203] Embodiment 25 A kit comprising the modified oligonucleotide of any one of embodiments 1-23 or the pharmaceutical composition of embodiment 24.

[0204] Embodiment 26. A method of reducing cardiac fibrosis, comprising contacting a myofibroblast with the modified oligonucleotide of any one of embodiments 1-23 or the pharmaceutical composition of embodiment 24.

[0205] Embodiment 27. The method of embodiment 26, wherein an expression level of a IncRNA selected from Tables 1-3 is reduced.

[0206] Embodiment 28. The method of embodiment 27, wherein the expression level of the IncRNA is reduced in a border zone or an infarct zone of a heart.

[0207] Embodiment 29. The method of embodiment 26, wherein a gene expression of a fibrotic marker gene is reduced.

[0208] Embodiment 30. The method of embodiment 29, wherein the fibrotic marker gene comprises CoLlAl, ACTA2, FN1, COL3A1, ME0X1, RUNX1 / 2, PTN, MMP15, or a combination thereof.

[0209] Embodiment 31. The method of embodiment 26, wherein an expression of a down- regulated gene specific to the myofibroblast is increased or an expression of an up-regulated gene specific to the myofibroblast is reduced.

[0210] Embodiment 32. The method of embodiment 31, wherein the up-regulated gene specific to the myofibroblast comprises CILP, COL14A1, COL1A1, PLOD2, SMAD9, or a combination thereof.

[0211] Embodiment 33. A method of inducing a cell state transition from a myofibroblast state to a quiescent fibroblast state, comprising contacting the cell with the modified oligonucleotide of any one of embodiments 1-23 or the pharmaceutical composition of embodiment 24.

[0212] Embodiment 34. A method of preventing, alleviating, or treating a heart disease in a subject in need thereof, comprising administering to the subject an effective amount of the modified oligonucleotide of any one of embodiments 1-23 or the pharmaceutical composition of embodiment 24.

[0213] Embodiment 35. The method of 34, wherein a cardiac contractility or electrical conductivity is improved in the subject.

[0214] Embodiment 36. The method of embodiment 35, wherein the cardiac contractility or electrical conductivity is evaluated by measuring an expression of MYBPC3, MY0M3, SCN5A, SCN10A, HANOI, MYP2, HANOI, KLF15, TTN, or a combination thereof.

[0215] Embodiment 37 The method of 34, wherein a biomarker for a risk of poor cardiovascular clinical outcomes is improved in the subject.

[0216] Embodiment 38. The method of embodiment 37, wherein the biomarker for a risk of poor cardiovascular clinical outcomes is enriched in a border zone or an infarct zone of a heart from the subject.

[0217] Embodiment 39. The method of embodiment 37 or 38, wherein the biomarker for a risk of poor cardiovascular clinical outcomes is coagulation factor 2 receptor (F2R).

[0218] Embodiment 40. The method of 34 wherein a biomarker associated with hypertrophic cardiomyopathy is reduced.

[0219] Embodiment 41. The method of embodiment 40, wherein the biomarker associated with hypertrophic cardiomyopathy is enriched in a border zone or an infarct zone of a heart from the subject.

[0220] Embodiment 42. The method of embodiment 40 or embodiment 41, wherein the biomarker associated with hypertrophic cardiomyopathy comprises C1TED4, MYH7B, HDAC9, ACTN2, KLF11, HEY2, or a combination thereof.

[0221] Embodiment 43. The method of embodiment 34, wherein an RNA expression of a gene associated with a heart disease or cardiomyopathy is reduced in the subject.

[0222] Embodiment 44. The method of embodiment 43, wherein the gene associated with the heart disease or cardiomyopathy comprises MYH11, TPM1, TNNT2, TNNC1, NPPB, AP3D1, NDUF1 IB, SLC25A4, KCNJ5, TRIP6, or a combination thereof.

[0223] Embodiment 45. The method of embodiment 34, wherein an RNA expression of a gene associated with oxidative phosphorylation is reduced in the subject.

[0224] Embodiment 46. The method of embodiment 45, wherein the gene associated with oxidative phosphorylation comprises ATP5PO / 5F1C, NDUFA2 / 9, NDUFB8 / B9 / A9, SAMM50, or a combination thereof.

[0225] Embodiment 47. The method of embodiment 34, wherein an RNA expression of a gene associated with cardiac muscle contraction is reduced in the subject.

[0226] Embodiment 48. The method of embodiment 47, wherein the gene associated with cardiac muscle contraction comprises UQCRC1, CYC1, COX5B, ATP2A, TPM1, TNNT2, TNNC1, or a combination thereof.

[0227] Embodiment 49. The method of embodiment 34, wherein an RNA expression of a heart failure marker is reduced in the subject.

[0228] Embodiment 50 The method of 49, wherein the heart failure marker is detected in a heart tissue, and the heart failure marker comprises NPPB, MMP9 COL1A1, IL1RL1, or a combination thereof.

[0229] Embodiment 51. The method of 49, wherein the heart failure marker is detected in a serum or plasma sample from the subject, and the heart failure marker comprises NT -proBNP, BNP, MMP9, PICP3, soluble ST2, or a combination thereof.

[0230] Embodiment 52. The method of 34, wherein a collagen or a fibrotic scar in a border zone or an infarct zone of a heart is reduced in the subject.

[0231] Embodiment 53. The method of 34, wherein proliferation of a cardiac myofibroblast of the subject is reduced, or wherein migration of the cardiac myofibroblast of the subject is reduced, or wherein apoptosis of the cardiac myofibroblast of the subject is increased.

[0232] Embodiment 54. The method of 34, wherein fatty acid oxidation metabolism in the subject is increased to a level that is similar to a healthy subject.

[0233] Embodiment 55. The method of 34, wherein glycolytic metabolism is decreased to a level that is similar to a healthy subject.

[0234] Embodiment 56. The method of any one of embodiments 34-55, wherein the administering is performed intratracheally, orally, nasally, intravenously, intraperitoneally, or intramuscularly.

[0235] Embodiment 57. The method of any one of embodiments 26-56, wherein the modified oligonucleotide is encapsulated in a liposome or coupled with a nanoparticle.

[0236] Embodiment 58. The method of any one of embodiments 34-57, wherein a myosin inhibitor is further administered to the subject.

[0237] Embodiment 59. The method of embodiment 58, wherein the subject is diagnosed with or to have a high / higher chance to contract with a hypertrophic cardiomyopathy, a myocardial infarction, a heart failure with preserved ejection fraction, a dilated cardiomyopathy, an aortic stenosis, a diabetic cardiomyopathy, a restrictive cardiomyopathy, a cardiac amyloidosis, a genetic disease causal of attendant cardiomyopathy, or an excessive interstitial fibrosis pathology

[0238] Embodiment 60. The method of embodiment 59, wherein the hypertrophic cardiomyopathy is obstructive hypertrophic cardiomyopathy, and wherein the myosin inhibitor is Mavacamten.

[0239] Embodiment 51. The method of embodiment 60, wherein the modified oligonucleotide or the pharmaceutical composition improves or eliminates diastolic dysfunction or excessive fibrosis.

[0240] Embodiment 62. The method of embodiment 59, wherein the hypertrophic cardiomyopathy is obstructive hypertrophic cardiomyopathy or non-obstructive hypertrophic cardiomyopathy, and wherein the myosin inhibitor is Aficamten.

[0241] Embodiment 63. A method for diagnosing cardiac fibrosis, monitoring the progression of cardiac fibrosis, or evaluating / monitoring cardiac myofibrotic tissue regeneration / reprograming to fibrotic tissue in a subject, the method comprising: (a) obtaining a biological sample derived from the subject; (b) detecting an amount and / or an activity of a biomarker from the biological sample, wherein the biomarker comprises NT-proBNP / BNP, MMP9, PICP, soluble ST2, activin A, FSTL3, MPK9, fibrinogen, PDE5A, SULF2, CILP, THBS1, PTK2B, TGFB1, PCTP, CXCL16, or a combination thereof; and (c) concluding that the subject has (continued) cardiac fibrosis, or there is less significant cardiac myofibrotic tissue regeneration / reprograming to fibrotic tissue if the amount and / or the activity of the biomarker is at least 50%, at least 60%, at least 70%, at least 80%, at least 90% higher than a healthy individual.

[0242] Embodiment 64. The method of embodiment 63, wherein the biological sample is a whole blood, blood plasma, or blood serum sample.

[0243] Embodiment 65. A method of diagnosing cardiac fibrosis-mediated cardiac pathology in a subject, wherein the method comprises (a) obtaining a biological sample derived from the subject; (b) detecting an amount and / or an activity of a biomarker from the biological sample, wherein the biomarker comprises a sequence from Tables 1, 5, and 6; and (c) diagnosing the subject with cardiac fibrosis-mediated cardiac pathology if the amount and / or the activity of the biomarker is at least 50%, at least 60%, at least 70%, at least 80%, at least 90% higher when compared to a healthy individual.

[0244] Embodiment 66. A method of monitoring or predicting the progression of cardiac fibrosis-mediated cardiac pathology in a subject, wherein the method comprises (a) obtaining a biological sample derived from the subject at an earlier time point and a later time point; (b) detecting an amount and / or an activity of a biomarker from the biological sample, wherein the biomarker comprises a sequence from Tables 1, 5, and 6; and (c) concluding or predicting the cardiac fibrosis-mediated cardiac pathology persists or progresses if the amount and / or the activity of the biomarker at the later time point at least 10% higher than the amount and / or the activity of the biomarker at the earlier time point.EXAMPLES

[0245] The following is a description of various non-limiting examples of methods and materials used in the studies, and are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present disclosure, and are not intended to limit the scope of the disclosure nor are they intended to represent that the experimentsbelow were performed and are all of the experiments that may be performed. Efforts have been made to ensure accuracy with respect to numbers used (e g., amounts, percentages, etc ), but some experimental errors and deviations should be accounted for.Example 1: Wisp2 super-enhancer-associated RNA (WISPER) Sequence and Mechanism Conservation

[0246] Wisp2 super-enhancer-associated RNA (WISPER) is a long non-coding RNA (IncRNA) that can regulate cardiac fibrosis. WISPER sequence, locus and genomic regulatory regions are conserved across human, pig, and mouse (with certain sequence mismatches). WISPER sequence is conserved among human, monkey, pig, and mouse. Thus, various WISPER targeting anti-sense oligonucleotides (ASOs) were designed to effectively knockdown expression of WISPER across species.

[0247] Tn this and the following examples provided herein, in vitro myofibroblast models for different species were established as follows. For the human cardiac fibroblasts (HCF): HCFs were transfected with the ASOs in complete normal media for 24h. Following this, the normal media was changed to starvation media and incubated for 48h more. For porcine cardiac fibroblasts (PCF): PCF were differentiated to myofibroblasts cells through passages, then were incubated for 48h with ASOs in complete media or transfected 48h with ASOs in starvation media. For mouse cardiac fibroblasts (MCF): MCF were transfected 48h with ASOs in starvation media or transfected 48h with ASOs in starvation with TGF-beta (lOnM). These changes in protocol result from the use of different batches of cells and providers which requires the use of different mythologies to get the best differentiation into myofibroblast cells.

[0248] WISPER expression is highly tissue specific. snRNA-seq was performed in mouse, and showed exclusive expression in mouse fibroblasts. In human, leveraging public datasets, WISPER was found to be mostly expressed by fibroblasts cells with trace expression in lymphocytes. snRNA- seq of pig hearts showed that WISPER was expressed exclusively in cardiac fibroblasts in the heart, clustering together with other canonical fibroblast markers (e g., FN1, POSTN, and PDGFRA). Specifically, a single nuclei RNAseq (lOx platform) was performed on nuclei isolated from porcine cardiac biopsies from left ventricles. It was found that WISPER expression was predominantly expressed with cells that co-expressed FN1, POSTN, and PDGFRA, the canonical fibroblast cell markers. Therefore, WISPER was highly cell type / tissue specific.

[0249] Previous studies have shown that WISPER physically interacts with TIAR, an RNA binding protein (RBP) that is involved in fibrosis regulation, to facilitate TIAR translocation into the cell nucleus. Various WISPER isoforms that are specific to fibroblast, myofibroblast, or bothfibroblast and myofibroblast were observed. Within the various WISPER isoforms, specific TIAR binding sites were identified using enhanced version of the crosslinking and immunoprecipitation (eCLIP), particularly at the 5’ regions of WISPER isoforms in myofibroblasts, confirming the interaction between WISPER and TIAR.

[0250] Next, whether the mechanism of WISPER to facilitate TIAR into the cell nucleus is conserved across species was further investigated. TIAR is a pleiotropic regulator of fibrosis, which is an RNA-binding protein modulating splicing and stability of fibrogenic mRNAs. Mouse fibroblasts were transfected with WISPER targeting ASO or without ASO as a control. Cells were stained with TIAR, DAPI, and Actin to visualize the amount of TIAR in the nucleus upon WISPER knockdown. As shown in FIG. 1A, mouse fibroblast had statistically significant reduction in the percentage of cell with nuclear TIAR upon transfection with mouse WISPER targeting ASO (SEQ ID NO: 135) compared to no transfection. Similar observations were found in pig fibroblasts treated with pig ASO (SEQ ID NO: 56) and human fibroblasts treated with human ASO (SEQ ID NO: 55) This significant reduction was observed when treating the mouse fibroblasts with 2.5 nM, 5 nM, or 10 nM of WISPER targeting ASO (SEQ ID NO: 135), as shown in FIG. IB. Likewise, porcine myofibroblasts transfected with 2 nM, 10 nM or 50 nM pig WISPER targeting ASO (SEQ ID NO: 56) showed statistically significant reduction in TIAR within the nucleus compared to a negative control (e.g., scramble / non-wisper targeting ASO control) (see FIG.1B). Human cardiac myofibroblasts transfected with 2 nM, 5 nM, 10 nM or 25 nM human WISPER targeting ASO (SEQ ID NO: 83) also showed statistically significant reduction in TIAR within the nucleus compared to a negative control (e g., scramble / non-wisper targeting ASO control) (see FIG.1B). Collectively, these data confirmed that WISPER targeting ASO blocks TIAR shuttling to the nucleus, and that this WISPER mechanism is conserved across species.

[0251] As WISPER and TIAR interaction facilitate TIAR translocation into the cell nucleus, whether there are changes in downstream RNA targets of TIAR upon transfection with WISPER targeting ASO was next investigated. eCLIP data analysis identified the specific RNA-target landscape of TIAR in cardiac fibroblasts and myofibroblasts. For example, 1035 genes, such as Collal, Coll4al, CILP, and Smad9, were identified to be downstream targets of TIAR in myofibroblasts, and 2230 genes, such as TGFB1, SMAD4, and COL13A1, were identified to be downstream targets of TIAR in fibroblasts. 3057 genes were found to be downstream targets of TIAR in both fibroblasts and myofibroblasts eCLIP peaks for CILP and COL14A1 in myofibroblasts were observed (data not shown). To test whether the expression of these TIAR gene targets are affected by WISPER targeting ASOs, human cardiac fibroblasts were transfected withvarious WISPER targeting ASOs or control ASO (e.g., scramble / non-wisper targeting ASO control) and differentiated to cardiac myofibroblasts with 48 hours of starvation. Next, the transfected myofibroblasts were subjected to RNA-sequencing (RNA-seq) and the RNA-seq data were analyzed for differential expression (DE) to see how transfection with WISPER targeting ASOs affect expression of TI R targets compared to transfection with ASO controls. As shown in FIG. 2, using RNA-sequencing data, DE analysis was used to determine the log2 (Fold Change) of expression between FB and MyoFB (y-axis) exposed to different treatments (x-axis). Highlighted dots represent TIAR targets that were either overexpressed in MyoFB (red) or down regulated in MyoFB (blue). Potent ASOs against Wisper (SEQ ID NOs: 57-83) managed to reverse the expression of these TIAR targets. The white box plots in the background of each treatment show the distribution of log2(FC) of all genes in the transcriptome as a guiding reference. Therefore, knockdown of WISPER reversed the TIAR-mRNA target expression landscape, where there were differences in the expression pattern of TIAR targets upon transfection with WISPER targeting ASOs compared to transfection with ASO controls. Further analysis of the transcriptome revealed that transfection with WISPER targeting ASOs, such as G34 (SEQ ID NO: 81) and G36 (SEQ ID NO: 83), downregulated myofibroblast specific TIAR target genes and rescued expression of fibroblast specific TIAR target genes, as shown in FIG. 3 (a subset of FIG. 2). Specifically, as shown in FIG. 3, myofibroblast-specific genes (highlighted in circles) were downregulated after the treatment of G34 or G36, while fibroblastspecific genes were rescued by the treatment of G34 or G36. This suggested that TIAR target genes can be regulated in myofibroblasts by transfection with WISPER targeting ASOs to revert their expression from myofibroblast to fibroblast specific TIAR target genes.

[0252] As the WISPER locus was identified to interact with the SULF2 locus, the expression of SULF2 and its potential therapeutic relevance with WISPER was next analyzed. SULF2 is a key regulator of fibrotic and inflammatory cascade. For example, SULF2 is a key extracellular matrix remodeling enzyme inducing fibrosis in hearts, it mediates the paracrine release of cytokines and chemokines. In addition, SULF2 is a key extracellular matrix remodeling enzyme that inducing fibrosis in the heart, liver, lung and solid tumors. Therefore, it made SULF2 worth further investigating in relation to WISPER. In vivo patient snRNA-seq data from Amrute et al. was used to evaluate SULF2 and WISPER expression in patients with heart failure who have recovered left ventricular systolic function after left ventricular assist device (LVAD) implantation (reverse remodeled), patients who did not recover (no reverse remodeled), and non-diseased donors The combined fibroblast and myofibroblast clusters derived from the snRNA-seq data revealed that WISPER, SULF2 and COL14A1 are expressed predominantly in the myofibroblast region (see FIG.15). Subcluster by sample origin indicated reduced number of myofibroblast cell population in patients who expressed reverse remodeling after LVAD implantation (Rpost) compared to before the LVAD implantation (Rpre), suggesting that Rpost may also reduce expression of WISPER, SULF2 and C0L14A1.

[0253] In vitro experiment was also conducted to investigate the expression of SULF2 and relation to WISPER. Human cardiac fibroblasts were transfected with human WISPER targeting ASOs and starved for 48 hours to differentiated into cardiac myofibroblasts. As shown in FIG. 16A, transfection with WISPER target ASO (SEQ ID NO: 91) led to decreased expression of WISPER in a dose-dependent manner, as measured by qPCR. SULF2 RNA expression measured by RNAseq also decreased upon transfection with human WISPER targeting ASO (SEQ ID NO: 83) in a dosedependent manner compared to treatment with scramble ASO, as shown in FIG. 16B. Similar effect was found when pig cardiac fibroblasts and mouse cardiac fibroblasts were treated with pig WISPER targeting ASO and mouse WISPER targeting ASO, respectively, and then differentiated to myofibroblasts. As shown in FIG. 17A, upon transfection with increasing dosage of human WISPER targeting ASO (SEQ ID NO: 83), pig WISPER targeting ASO (SEQ ID NO: 56), or mouse WISPER targeting ASO (SEQ ID NO: 139), there was decreased expression in SULF2 in human, pig, and mouse myofibroblasts, respectively. FIG. 17B is a different visualization of FIG. 17A for pig WISPER targeting ASO (SEQ ID NO: 56), adding scramble ASO but without the data point for 50nM concentration. Furthermore, snRNA-seq showed that WISPER and SULF2 were co-expressed in human myofibroblasts, and WISPER knockdown by G117 (SEQ ID NO: 55) reduced expression of both WISPER and SULF2 (see FIG. 18), suggesting that WISPER may regulate the expression of SULF2.

[0254] In vivo data of the post-myocardial infarction (MI) pig model further supported the downregulation of SULF2 expression upon knockdown of WISPER using pig WISPER targeting ASO (SEQ ID NO: 56). Two independent post MI models were established: the 13-day model involved one ASO injection, and the 42 -day model involved two ASO injections. As shown in FIG. 19A, in vivo WISPER targeting ASO treatment after cardiac MI in pig led to a decrease in SULF2 expression in the border and infarct zones of the heart. As shown in FIG. 19B, SULF2 expression in the border zone and infarct zone of the pig left ventricle was reduced at both 13 days and 42 days post-MI with treatment with pig WISPER targeting ASO (SEQ ID NO: 56), compared to treatment with vehicle (control)

[0255] Given these results, WISPER may regulate the expression of SULF2, a key extracellular matrix (ECM) remodeling enzyme, to affect fibrosis and inflammation of the heart. SULF2 is alsoknown to mediate the paracrine release of cytokines and chemokines bound to Heparan Sulfate chains of proteoglycans in the ECM, triggering a profibrotic and inflammatory cascade. Thus, WISPER may cis regulate SULF2 and increase expression of SULF2 in myofibroblasts. The increase in SULF2 may lead to increased SULF2 secretion to the extracellular matrix, resulting in release of profibrotic and inflammatory cytokines.Example 2: Pharmacological effect of WISPER targetins ASOs

[0256] The pharmacological effect of WISPER targeting ASO was investigated. To produceASOs with stronger potency and pharmacological effect, different WISPER targeting ASOs were designed. ASOs that target key regulatory regions within the WISPER gene body (i.e., whole transcriptional region including introns and exons), as well as ASOs that target no regulatory regions were designed. Next, pig cardiac fibroblasts were transfected with WISPER targeting ASOs or scramble / non-Wisper targeting ASO (negative control) and differentiated to cardiac myofibroblasts with 48 hours of starvation or by cell passing in complete cell culture media followed by 48h ASO transfection.

[0257] Two regions in porcine WISPER were identified as shown in FIG. 4A. “Region X” in FIGs. 4A-4D refers to chr!7:47, 097, 936-47, 101, 620 (Sscrofal 1.1), a genomic location within the porcine WISPER gene body overlapping an open chromatin peak defined by snATAC-seq in myofibroblasts and enriched for an important epigenetic marker of chromatin interactions, CTCF. “Region Y” in FIGs. 4A-4D refers to chr!7:47, 090, 872-47, 092, 315 (Sscrofal 1.1), a genomic location within the porcine WISPER gene body where the chromatin is not open in myofibroblasts (no peaks detected by snATAC-seq) and is not enriched for any tested epigenetic marks (Cut&Run experiments).

[0258] As shown in FIG. 4B, transfection with an ASO that target Region X (pWis_67, SEQ ID NO: 56) and an ASO that target Region Y (ASO1, SEQ ID NO: 84) within the pig WISPER gene body resulted in similar knockdown of WISPER expression in myofibroblasts compared to transfection with scramble ASO, as measured by qPCR (using a forward primer AATGCAAAGGTCCTGGGGTA (SEQ ID NO: 189) and a reverse primer GTGTCCACTTCTCCAGCTCA (SEQ ID NO: 1 0)). However, as shown in FIG. 4C, the ASO that targets Region X (pWis_67, SEQ ID NO: 56) showed stronger potency than ASO that targets Region Y (ASO1, SEQ ID NO: 84) as measured by the effect of the ASO transfection on the porcine WISPER target engagement panel (TEP), which corresponds to a set of genes that showed a dosedependent downregulation by porcine WISPER ASOs. Furthermore, as shown in FIG. 4D, qPCR analysis revealed that ASO that targets Region X (pWis 67, SEQ ID NO: 56) demonstrated a morepotent knockdown of different heart disease relevant gene signatures, such as heart cardiac fibroblast (HCF) and hypertrophic cardiomyopathy (HCM) gene signatures, as compared to ASO that targets Region Y (ASO1, SEQ ID NO: 84) or scramble / non-wisper targeting ASO control.

[0259] Similar tests were performed with multiple ASOs designed either to target regulatory regions of the human WISPER gene body or to target exclusively the WISPER RNA, but no regulatory regions of the human WISPER gene body. As seen with pig WISPER targeting ASOs, transfection with any one of the ASOs led to decreased expression of human WISPER in human myofibroblasts compared to transfection with scramble / non-wisper targeting ASO control, as measured by qPCR using a forward primer of CCCTGGCAGCCACTATTCTA(SEQ ID NO: 191) and a reverse primer of GCCAGCAACCAAGGACAAAT (SEQ ID NO: 192). (see FIG. 5A) However, human myofibroblasts transfected with ASOs (ASO3, ASO4, ASO5, ASO6) targeting regulatory regions of the human WISPER gene body (around human chr20: 44681953 to 44694636, SEQ ID NO: 188) demonstrated a more potent knockdown across the different heart disease relevant gene signatures, such as HCF and HCM gene signatures, and TEPs in myofibroblasts compared to transfection with ASOs targeting non-regulatory regions (ASO1 and ASO2) or scramble / non-wisper targeting ASO control (MyoFB_Scr) (see FIG. 5B). Corresponding sequence information can be found in Table 4: ASO1 (SEQ ID NO: 61); ASO2 (SEQ ID NO: 57); ASO3 (SEQ ID NO: 55); ASO4 (SEQ ID NO: 85); ASO5 (SEQ ID NO: 86); ASO6 (SEQ ID NO: 87 and SEQ ID NO: 91).

[0260] Given that human WISPER targeting ASOs and pig WISPER targeting ASOs showed promising knock-down efficiency of WISPER, heart disease relevant gene signatures, and TEPs, the effect of these ASOs on other biological processes were explored. RNAs were extracted from human and pig myofibroblasts upon transfection with WISPER targeting ASO, and were subjected to RNA- seq. The RNA-seq results were analyzed for gene ontology (GO) terms for predicting involvement in biological processes, “target phenotype (cluster analysis)” refers to transcriptomic profiling of gene clusters. By grouping genes whose expression showed a similar trend of expression, the most sensitive genes to ASO treatment were identified. Cluster analysis and subsequent GO term analysis showed that knockdown of WISPER in both human and pig resulted in change in expression of genes that were linked to myofibroblast identity and fibrosis. For example, genes that were sensitive to porcine WISPER targeting ASOs involved in pathways related to e.g., positive regulation of fibroblast migration, cardiac muscle hypertrophy, response to mechanical stimulus, cell-matrix adhesion, actin filament bundle organization, and actomyosin structure organization. On the other hand, genes that were sensitive to human WISPER targeting ASOs involved in pathways related toe g., extracellular matrix organization, extracellular structure organization, collagen fibril organization, and external encapsulating structure organization.

[0261] In addition, WISPER knockdown by “human WISPER targeting ASO” (correspond to SEQ ID NO: 83) impacted genes that were linked to myofibroblast identity and fibrosis across species in a dose-dependent manner, as shown in FIG. 6 Specifically, “sig. My oFB Cell State” in FIG. 6 comprises genes that are significantly up-regulated in myofibroblasts (MyoFb) compared to fibroblasts (Fb) in an in vitro model using primary human cardiac fibroblasts. This custom gene signature was developed from three in-house databases, where the fibroblasts were cultured in a starvation medium for 48 hours. The Fb-MyoFb gene signature represents a consensus reflecting the cell state transition from Fb to MyoFb in vitro, “sig. HCM_Patients” in FIG. 6 comprises genes that were significantly up-regulated in heart biopsies of Hypertrophic Cardiomyopathy (HCM) patients compared to non-failing hearts. Publicly available bulk RNA-sequencing data from four different studies (Sweet et al. 2018; Liu et al. 2019; Hemerich et al. 2019; Liu et al. 2021) were used to define this gene signature. This gene signature was later validated using publicly available single-nucleus RNA-sequencing (snRNA-seq) data from the MAGNet consortium study by Chaffin et al (2022). This gene signature reflected the pathological state of cardiac tissue in HCM patients. “TEP hWis Core” in FIG. 6 refers to hsWisper Core TEP (Stringent Filters). The target engagement panel (TEP) refers to the set of genes influenced by the knock down of Wisper. Using bulk RNA-seq data from the dose-response in house experiments with selected ASOs (G36, G103, G115, G117, G126, G149), in other words, “TEP hWis_Core” comprises all the genes that consistently presented a strong dose-dependent down-regulation by all these anti-Wisper ASOs. “TEP hWis Lenient” in FIG. 6 refers to hsWisper Lenient TEP (Relaxed Filters), which comprises genes that were down- regulated following a dose-dependent response in at least one of selected ASOs (G36, G103, G115, G117, G126, G149). This larger set represents, therefore, a more “relaxed” definition of the TEP This larger set of TEP genes provided more context to the potential breadth of how WISPER functions

[0262] Dose-dependent effect was also observed with WISPER TEP. Specifically, cross-species WISPER TEP containing 82 genes that is enriched with key myofibroblast functions (e.g., extracellular matrix organization, collagen fibril organization, and cellular response to TGF-beta stimulus) was identified. Cross-species WISPER TEP was found to be upregulated in myofibroblasts of human, pig and mouse; however, there was a dose-dependent downregulation of the WISPER TEP in myofibroblasts upon transfection with WISPER targeting ASO across multiple species. This indicated that the knockdown of WISPER presented a similar profile in terms of potency and on- target effects across various species.

[0263] Next, human myofibroblasts were transfected with human WISPER targeting ASOs to test how the ASOs impacted cell behaviors, such as proliferation, migration, and apoptosis. The cell behaviors were observed in myofibroblasts treated with human WISPER targeting ASOs via incucyte live-cell imaging over multiple hours. As shown in FIG. 7, transfection with WISPER targeting ASOs (G115 (SEQ ID NO: 89), G103 (SEQ ID NO: 91), G117 (SEQ ID NO: 55), G149 (SEQ ID NO: 66), G145 (SEQ ID NO: 62), G119 (SEQ ID NO: 92), G1000 (SEQ ID NO: 135), G109 (SEQ ID NO: 88), G107 (SEQ ID NO: 90), G110 (SEQ ID NO: 93), and Gi l 3 (SEQ ID NO: 85)) led to decreased proliferation, decreased migration and increased apoptosis of myofibroblasts, suggesting that WISPER may be able to regulate myofibroblast cell state and behaviors.

[0264] Similarly, a dose-dependent downregulation of WISPER expression in myofibroblasts was also observed upon transfection with increasing dosage of human WISPER targeting ASO (2 5nM, 5 nM, 7.5 nM, or 10 nM of SEQ ID NO: 83) (see FIG. 12A). Further analysis of the snRNA- seq data revealed that knockdown of WISPER by an ASO (SEQ ID NO: 83) resulted in a downregulation of WISPER target engagement panel (TEP) and TIAR myofibroblast specific genes (see FIG. 11). Similar to the expression of WISPER, there was a dose-dependent downregulation of myofibroblast signature and WISPER TEP in myofibroblasts upon transfection with increasing dosage of human WISPER target ASO (2.5 nM, 5 nM, 2.7 nM, or 10 nM of SEQ ID NO: 83), as shown in FIG. 12B and FIG. 12C, respectively. Specifically, “MyoFB signature” in FIG. 12B refers to genes that are significantly up-regulated in myofibroblasts (MyoFb) compared to fibroblasts (Fb) in an in vitro model using primary human cardiac fibroblasts. This custom gene signature was developed from three different in-house datasets, where the fibroblasts were cultured in a starvation medium for 48 hours. The Fb-MyoFb gene signature represents a consensus reflecting the cell state transition from Fb to MyoFb in vitro.

[0265] These findings were also confirmed with single nucleus ATAC sequencing (snATAC- seq). Similar to the experiment disclosed above, pig cardiac fibroblasts were transfected with either pig WISPER targeting ASO or scramble ASO and starved for 48 hours to differentiate into cardiac myofibroblasts. Next, DNA was extracted from the cardiac myofibroblasts and subjected to snATAC-seq. Analysis of snATAC-seq results showed that upon transfection with pig WISPER targeting ASO (SEQ ID NO: 56) the cells displayed similar snATAC-seq profile to fibroblast’s snATAC-seq results (see FIG. 13). In addition, snATAC-seq cell-state phenotyping showed that pig WISPER targeting ASO (SEQ ID NO: 56) reverted the dynamic chromatin accessibility landscape of myofibroblast back to fibroblast state. With transfection of pig WISPER targeting ASO, the regions of open chromatin in myofibroblasts, such as in transcription factor motifs of CTCF, RFZ, or TEAD1 / 3 / 4, were closed similar to the state in fibroblasts. Conversely, with treatment with pig WISPER targeting ASO, the regions of closed chromatin in myofibroblasts, such as in transcription factor motifs of RUNX1, JUN B / D, FOS, or EBF1, were opened similar to the state in fibroblasts.

[0266] snATAC-seq was also performed with human cardiac fibroblasts that were transfected with human WISPER target ASO (2.5 nM, 5 nM, 7.7 nM, or 10 nM), and starved for 48 hours to differentiated into cardio myofibroblasts. “MyoFB signature” in FIG. 14 is similarly described above, comprising genes that are significantly up-regulated in myofibroblasts (MyoFb) compared to fibroblasts (Fb) in an in vitro model using primary human cardiac fibroblasts. This custom gene signature was developed from three different in-house datasets, where the fibroblasts were cultured in a starvation medium for 48 hours. The Fb-MyoFb gene signature represents a consensus reflecting the cell state transition from Fb to MyoFb in vitro. snATAC-seq analysis further identified importanttranscription factors associated with human WISPER targeting ASO sensitive peaks known to be master regulators of fibroblast identity. For example, with transfection of increasing dosage of human WISPER targeting ASO (SEQ ID NO: 83), the regions of open chromatin in myofibroblasts, such as in transcription factor motifs of CTCF, RFZ, or TEAD 1 / 3 / 4, were closed similar to the state in fibroblasts. Conversely, with transfection of increasing dosage of human WISPER targeting ASO, the regions of closed chromatin in myofibroblasts, such as in transcription factor motifs of RUNX1, JUN B / D, FOS, or EBF1, were opened similar to the state in fibroblasts. Therefore, WISPER targeting ASO reprogrammed activated myofibroblast back toward a fibroblast cell state in a dosedependent manner.

[0267] Collectively, these results showed that depletion of WISPER expression by ASO leads to cell-state reprogramming back to pre-pathological activation, and that this change can be demonstrated in both pigs and humans.

[0268] Micro-C is a method of studying chromatin interactions at single nucleosome-resolution using Micrococcal nuclease (NMase). Micro-C maps can reveal patterns of chromosome folding features, such as chromatin compartmentalization compartments and topologically associated domains (TADs). Compartments and TAD structures are involved in the maintenance of gene regulatory programs. Micro-C analysis was performed using human cardiac primary fibroblasts and myofibroblasts (duplicate samples for each condition). Micro-C compartments using CALDER2 (see Liu et al. Nat Commun 12, 2439 (2021), which infers chromatin sub-compartment domains from chromosome contact frequencies First, the various compartment levels were confirmed to enrich matching epigenetic signals, where compartment that is the most transcriptionally active compartment (enriched in epigenetic mark of transcriptional activity) contained epigenetic marks associated with active transcription, while compartment that the most inactive compartment (enriched with epigenetic markers of gene expression silencing) contained repressive chromatin marks. In other words, activating and repressing epigenetic marks were enriched in active and inactive micro-C fibroblast compartments, respectively. After confirmation of the reliability of compartment domains, micro-C was performed to show sub-compartment changes during fibroblast to myofibroblast cell-state transition. No drastic compartment changes were observed between FB and MyoFB (i.e., most regions of the genome were steady with regard to compartments during FB to MyoFB transition), but subtle changes in sub-compartments (sub-compartment changes by 1-2 degrees) still produced profound effects The 3D genome (organization in the 3D space of the nucleus, chromatin loops, A / B compartments, chromosome territories) was also found to be stable during the fibroblast to myofibroblast cell-state transition. The proportion of the genome thatremained the same (same TAD or compartment classification in FB and MyoFB), as well as further information about how the regions that were not static were changing, were quantified. For the changes in TADs, about 25.7% of the genome had one border change (i.e., either the start or the end position of the TAD border changed (e.g., TAD increasing or decreasing size by one border)) during the fibroblast to myofibroblast cell-state transition. About 12.8% of the genome experienced two border change (i.e., both start and end position changed between fibroblast and myofibroblast conditions), while about 61.5% of the genome had no changes. For the changes in compartments, a small proportion of the genome was making drastic compartment changes between active and inactive states (2.7% of the genome were active in FB and became inactive in MyoFB, and another 2.7% of the genome were inactive in FB and become active in MyoFB). At the same time, roughly 1 / 3 of the genome was making minor changes in sub-compartments, while roughly 2 / 3 of the genome were stable.

[0269] H3K27ac and H3K9me3 coverage changed drastically at micro-C compartment boundaries, while CTCF signal was enriched at TAD boundaries in fibroblast and myofibroblasts. By showing CTCF coverage enriched at TAD boundaries, TAD boundary results were confirmed. Specifically, CTCF is a protein that is usually found at TAD boundaries and is required for cohesion accumulation. These regions are frequently insulator regions. The CTCF signal was derived experimentally using Cut&Run on in vitro fibroblasts and myofibroblasts.

[0270] Odds Ratio is a statistic that quantifies the strength of the association between two events. It is a ratio of two sets of odds: odds of the event occurring in the exposed group compared to odds of the event occurring without exposure. A higher odds ratio means larger odds that the event with occur with exposure. The odds of different gene expression changes given different categories of ATAC-seq peaks were examined. Though the upregulated genes are correlated with both open and closed peaks, the odds ratio and p values are drastically different between the two (upregulated genes given open peaks = odds ratio of 9. 1 and p value of 3-24, and upregulated genes given closed peaks = odds ratio of 1.9 and p value of 2-4. Additionally, down-regulated genes given closed peaks are much more associated than up-regulated genes given closed peaks. Similar analysis was performed for the odds of ATAC-seq differential peaks given compartment changes observed with Micro-C.

[0271] These micro-C data collectively revealed that chromatin, epigenetic, and transcriptomic changes may be involved in the transition of cardiac fibroblasts into myofibroblasts.

[0272] Micro-C can also be integrated with GWAS loci to understand WISPER’s potential as a therapeutic target and its mechanism of action. First, GWAS variants associated with cardiac fibrosis were collected from Nauffal et al. Nature Genetics, 2023, and filtered for p<0.005, and WISPER wasidentified in the GWAS loci associated with cardiac fibrosis in chromosome 20. Next, micro-C was used to identify genes with significant interactions with GWAS regions, and GWAS region analysis showed that IncRNAs have high interaction frequency with GWAS regions. Specifically, the investigated IncRNA are annotated IncRNAs as well as unannotated IncRNAs from in-house cardiac transcriptome. The GWAS used are GWAS collected from Nauffal et al. Nature Genetics 2023, which are GWAS associated with increased myocardial T1 relaxation time and thus most likely associated with cardiac fibrosis. WISPER is one of the IncRNAs identified to have interactions with the GWAS.

[0273] Micro-C interactions for the WISPER locus revealed strong interactions with the significant GWAS region on chromosome 20. Micro-C interactions for the WISPER locus also revealed a strong interaction with the SULF2 locus in myofibroblast, which indicates there could be cis-regulation of the SULF2 locus by the WISPER locus. However, this doesn’t rule out the possibility that WISPER IncRNA also plays a role in regulating SULF2, by for example acting as scaffolds, bringing together different protein complexes and chromatin regions, facilitating the formation of specific 3D structures in the genome. Additionally, WISPER IncRNA may act on the formation and maintenance of chromatin loops by bringing distant genomic regions, such as enhancers and promoters, into close proximity. Together with relevant data in Example 1, ASO- mediated WISPER downregulation led to a significant modification of the chromatin state at the SULF2 promoter and consequent transcriptional downregulation, suggesting that WISPER IncRNA is an important component for promoting the physical interaction between the WISPER and SULF2 loci.

[0274] Pseudo-bulk snATAC-seq data further revealed that knockdown of WISPER in myofibroblasts led to a loss of accessibility in SULF2 5’ UTR in both human and pig, highlighting a potential cis mechanism of action for the WISPER locus.Example 3: Effect of ASO against WISPER in cell state transition

[0275] As WISPER is associated with cardiac fibrosis, the effect of WISPER targeting ASOs in cell state transition was investigated. First, pig cardiac myofibroblasts were transfected with either WISPER targeting ASO (SEQ ID NO: 56) or scramble ASO, as shown in FIG. 8A. Next, RNA was extracted from the cardiac myofibroblasts and subjected to single nucleus RNA sequencing (snRNA- seq). snRNA-seq confirmed knockdown of WISPER by transfection with WISPER targeting ASO (SEQ ID NO: 56) at the single cell resolution as compared to transfection with a scramble ASO (see e.g., FIG. 8C and FIG. 8D). In addition, the expression of WISPER with transfection of WISPER targeting ASO was comparable to the expression of WISPER in fibroblasts with no treatment.Further analysis of the snRNA-seq data revealed that Cluster 0, representing myofibroblasts, was mostly composed with cells treated with scramble ASO (see FIG. 8C). In contrast, as shown in the uniform manifold approximation and projection for dimension reduction (UMAP) of FIG. 8D, WISPER was highly expressed in the myofibroblast cluster, and by comparing the clustering between “MyoFB + scramble ASO” and “MyoFB + Wisper ASO,” it is clear that the transfection with WISPER targeting ASO induced myofibroblasts to shift toward a pre-pathological state (such as “Wisper ASO Specific state” in FIG. 8D.

[0276] FIG. 10 also shows that pig myofibroblasts, upon transfection with pig WISPER targeting ASO (SEQ ID NO: 56), were reprogrammed back to a quiescent fibroblast cell-state. Specifically, from the bar graph quantifying the proportion of fibroblasts and myofibroblasts, the treatment of WISPER targeting ASO increased the number of fibroblasts and reduced the number of myofibroblasts, which supported the conclusion that WISPER targeting ASO could induce cell state transition away from myofibroblasts. Furthermore, as shown in FIG. 8E, fibrotic markers such as ACTA2 and FN1 were reduced by WISPER targeting ASO (SEQ ID NO: 56) compared to scramble ASO, suggesting the reprogramming of myofibroblast toward a fibroblast state.

[0277] Similar to the experiments performed with pig fibroblasts, human fibroblasts were treated with either WISPER targeting ASO or scramble ASO and starved for 48 hours to differentiate into cardiac myofibroblasts. Next, RNA was extracted from the cardiac myofibroblasts and subjected to snRNA-seq. As seen with transfection with pig WISPER targeting ASO, snRNA-seq confirmed knockdown of WISPER by human WISPER targeting ASOs (SEQ ID NO: 91 or SEQ ID NO: 83) at the single cell resolution as compared to treatment with a control, and ASO treated cells had a cluster distinct from the one for fibroblasts or myofibroblasts with scramble ASO, as shown in FIG. 9A and FIG. 9B. In addition, the expression of WISPER upon transfection with WISPER targeting ASO was comparable to the expression of WISPER in fibroblasts with no treatment.

[0278] Similarly, UMAPs of the snATAC-seq results, as shown in FIG. 13, also showed that treatment with pig WISPER targeting ASO (SEQ ID NO: 56) led to cell state shift back towards a fibroblast state as compared to transfection with scramble ASO. As shown in FIG. 14, snATAC -seq analysis revealed that transfection with human WISPER targeting ASO (SEQ ID NO: 83) induced a dose-dependent cell-state reprogramming of activated myofibroblast back to quiescent fibroblasts.

[0279] It is worth noting that changes in chromatin state and accessibility, measured by single nuclei (sn)ATAC-seq, are “binar”’ in nature On the other hand, transcriptional changes, measured by single nuclei (sn)RNA-seq, are progressive and gradual (for instance due to RNA molecules having a certain half-life and turn over in the cell, hence there is some inertia in the measuredexpression of a gene). This explains why in single nuclei(sn) ATAC-seq data, a clearer switch from myofibroblast (MyoFB) to fibroblast (FB) cell state upon Wisper ASO treatment was observed (e.g., as shown in FIG. 13). When looking at transcriptional changes upon ASO-mediated Wisper knockdown using snRNA-seq, instead, a more continuous gradient of cell state changes were observed (e.g., FIG. 8D), which represents cells moving on a trajectory back to a FB state (e.g., as shown in FIG. 13)

[0280] Collectively, the above data supports the function of WISPER targeting ASOs in cellular reprogramming or cell state transition.Example 4: Anti-fibrotic effect of ASO against WISPER in vivo porcine and mouse model

[0281] As WISPER is associated with cardiac fibrosis, the anti -fibrotic effect of WISPER targeting ASO was investigated. Differential gene expression analysis of snRNA-seq data from pig cardio myofibroblasts upon transfection with WISPER targeting ASO (SEQ ID NO: 56) showed that compared with transfection of scramble ASO, ASO-dependent WISPER downregulation significantly affected the expression of multiple genes involved in fibrotic processes. Gene ontology analysis on the genes differentially expressed in pig myofibroblasts upon transfection with WISPER targeting ASO (SEQ ID NO: 56) further revealed possible WISPER involvement in fibrotic processes such as wound healing, extracellular matrix deposition, response to TGF-beta, and response to hypoxia / oxygen level. Thus, these single nuclei analysis showed that pig WISPER targeting ASO may affect the expression of genes involved in multiple fibrotic and wound healing processes in vitro.

[0282] To further test whether the anti-fibrotic effect of WISPER targeting ASO is prominent in vivo, wild-type Gottingen minipigs underwent balloon occlusion, and 3 days later, the minipigs were either treated with vehicle or pig WISPER targeting ASO (2.5 mg / kg or 5 mg / kg of SEQ ID NO: 56) through subcutaneous administration. After 13 days, remote zone top, remote zone middle, border zone, and infarct zone of the pigs’ hearts were harvested for analysis (e.g , autopsy, tissue biopsies, histology (H&M, MT), hematology, and biochemistry) (see FIG. 20). RNAs were extracted from the remote zone top, remote zone middle, border zone, and infarct zone of the pigs’ hearts and subjected to RNA-seq. Global transcriptomic profiling of the sequencing results revealed that with treatment of pig WISPER targeting ASO, the expression of genes involved in cardiac identity and function, cardiac contractility, electrical conductivity, cardiac hypertrophy programs, myofibroblast programs, and extracellular matrix (ECM) programs changes Specifically, genes associated with cardiac hypertrophy (e.g., CITED4, MYH7B, HDAC9, ACTN2, KLF11, and HEY2) were downregulated in the remote zone top and middle upon treatment with pig WISPER targeting ASO (SEQ ID NO: 56)compared to treatment with vehicle, which implied functional compensation in the preserved healthy cardiac muscle may not be necessary. Genes associated with pro-fibrosis (e.g., ACTA2, C0L3A1, C0L1A1, ME0X1, RUNX1 / 2, PTN, and FNl)were also downregulated in the border zone upon treatment with pig WISPER targeting ASO (SEQ ID NO: 56) compared to treatment with vehicle, which indicated fewer activated myofibroblasts and lower fibrotic burden. In contrast, genes associated with cardiac contractility and electrical conductivity (e.g., MYBPC3, MY0M3, SCN5A, SCN10A, HANOI, MYP2, HANOI, KLF15, and TTN) were upregulated in the border zone and infarct zone with treatment of pig WISPER targeting ASO (SEQ ID NO: 56) compared to with treatment of vehicle, which indicated improved cardiac muscle health resulting from the ASO treatment. Furthermore, the histology of the pigs’ heart tissues was analyzed. As shown in FIG. 21A, there was reduction in the percent fibrosis in pigs that were treated with pig WISPER targeting ASO (SEQ ID NO: 56). Most notably, there was about 50% reduction in fibrosis in the border zone and about 70% reduction in focal scar in the infarct zone in pigs treated with pig WISPER targeting ASO compared to those treated with vehicle, showing that knockdown of WISPER reduces tissue fibrosis and scaring process. Pig WISPER expression in remote zone top, remote zone middle, border zone, and infarct zone of the pigs’ left ventricle was also measured, and as shown in FIG. 21B, there was reduction in WISPER expression by qPCR with a forward primer of AATGCAAAGGTCCTGGGGTA(SEQ ID NO: 189) and a reverse primer of GTGTCCACTTCTCCAGCTCA (SEQ ID NO: 190), in all zones with treatment of pig WISPER targeting ASO compared to with treatment of vehicle, demonstrating on-target pharmacodynamic effect in vivo.

[0283] In another experiment, instead of treating the pigs with vehicle or pig WISPER targeting ASO only once, the pigs were treated with vehicle or pig WISPER targeting ASO (1, 2.5, or 5 mg / kg of SEQ ID NO: 56) through subcutaneous administration at day 3 and day 24. After 42 days, remote zone top, remote zone middle, border zone, and infarct zone of the pigs’ hearts were harvested for analysis. As shown in FIG. 21C, macroscopy and staining of the infarct zone with Masson’s trichrome revealed a reduction in fibrosis in pigs treated with pig WISPER targeting ASO compared to pigs treated with vehicle. Quantification of fibrosis area further showed that there was about 60% reduction in focal scar in the border zone and about 50% reduction in focal scar in the infarct zone in pigs treated with pig WISPER targeting ASO compared to those treated with vehicle, showing that knockdown of WISPER reduces tissue fibrosis and scaring process even after 42 days post induction of myocardial infarction. Cardiac function, measured by the A ejection fraction percentage, also increased by about 8% with treatment of pig WISPER targeting ASO (SEQ ID NO: 56) compared towith treatment of vehicle (see FIG. 21D). Specifically, left ventricular ejection fraction (LVEF) is a crucial measure of left ventricular systolic function, with significant prognostic value for predicting adverse outcomes in patients with congestive heart failure or after myocardial infarction (MI). LVEF is essential for assessing the severity of systolic dysfunction and guiding the management of various cardiovascular diseases, changes in ejection fraction (AEF) were calculated using Simpson’s method and expressed as a percentage, as measured by echocardiography. AEF was determined by subtracting the LVEF value on day 42 from the value on day 1 post-MI. Therefore, as shown in FIG. 21D, cardia function was improved by WISPER targeting ASOs.

[0284] With the heart tissues harvested at 42 days post induction of myocardial infarction, the expression of pig WISPER in the right ventricle and left ventricle of the heart was quantified after performing RNAscope with probes that hybridize to pig WISPER As shown in FIG. 22, there was a dose-dependent downregulation of pig WISPER with treatment of pig WISPER targeting ASO (SEQ ID NO: 56) compared with treatment of vehicle. Furthermore, the RNA of the heart tissues harvested at 42 days post induction of myocardial infarction were extracted and subjected to RNA-sequencing for gene expression analysis. As shown in FIG. 23, analysis of the pooled treatment samples of all dose treatments showed that with treatment of pig WISPER targeting ASO (SEQ ID NO: 56), there was significant downregulation of WISPER target engagement panel (TEP), which corresponds to a network of 726 genes sensitive to WISPER expression in vitro, in both the border zone and infarct zone of the heart compared to treatment with vehicle. When analyzing by treatment dose, there was a dose-dependent response of WISPER TEP genes with treatment of pig WISPER targeting ASO (SEQ ID NO: 56) compared to treatment with vehicle (see FIG. 23). These data showed that pig WISPER targeting ASO demonstrated on-target pharmacology effect at study endpoint (day 42).Whether there were changes to hypertrophic cardiomyopathy (HCM) gene signature, which corresponds to a set of relevant pathology-associated genes upregulated in the hearts of patients affected by HCM, was also explored. As shown in FIG. 24, with treatment of pig WISPER targeting ASO (SEQ ID NO: 56), there was downregulation of HCM gene signature in both the border zone and infarct zone of the pig’s hearts compared to treatment with vehicle, suggesting a potential therapeutic effect that may be achieved by targeting WISPER in HCM patients. Other gene signatures corresponding to a set of genes related to cardiac function, such as heart disease and cardiomyopathy, cardiac muscle contraction, and oxidative phosphorylation were also measured in border zone and infarct zone of the pig’s hearts As shown in FIG. 25A, in both the border zone and infarct zone, there was a decrease in the gene signature upon treatment with increasing dosage of WISPER targeting ASO (SEQ ID NO: 56) compared to treatment with vehicle. F2R (PARI) is aknown biomarker of cardiovascular risk of poor outcome. F2R antagonists are used to prevent thrombosis and have been shown to reduce ischemic events. MMP15 has been shown to involve in extracellular matrix regulation and can be measured in plasma or serum. The expression of F2R and MMP15 was also measured. FIG. 25B shows that the expression of F2R and MMP15 was also decreased with increasing dosage of WISPER targeting ASO (SEQ ID NO: 56) compared to treatment of vehicle. Therefore, the reduction in expression level of F2R and MMP15 by the WISPER targeting ASO treatment further indicate the efficacy of the ASOs in heart related diseases.

[0285] Furthermore, an analysis of functional protein association network of sensitive genes to WISPER knockdown was performed, in in vivo border and infarct zones (data not shown). For examples, MYH11, TPM1, TNNT2, TNNC1, NPPB, AP3D1, NDUF1 IB, SLC25A4, KCNJ5, and TRIP6 were exemplary genes that were sensitive to WISPER knockdown and were related to heart disease and cardiomyopathy. ATP5PO / 5F1 C, NDUFA2 / 9, NDUFB8 / B9 / A9, SAMM50 were exemplary genes that were sensitive to WISPER knockdown and were related to oxidative phosphorylation. UQCRC1, CYC1, COX5B, ATP2A, TPM1, TNNT2, and TNNC1 were exemplary genes that were sensitive to WISPER knockdown and were related to cardiac muscle contraction. Other genes that were sensitive to WISPER knockdown were related to hypertrophic cardiomyopathy, fatty acid metabolism, and actomyosin structure organization.

[0286] The RNA-sequencing results were further analyzed for gene ontology (GO) terms and revealed that knockdown of WISPER may change expression of genes associated with glycolytic process, metabolic process, and ATP metabolic process. Thus, gene signatures associated with hallmarks of glycolysis and fatty acid beta oxidation was obtained from public data sets and whether these gene signatures changed with knockdown of WISPER was observed. As shown in FIG. 26A (top panel), there was significant decrease in gene signature associated with glycolysis in the infarct zone upon treatment with pig WISPER targeting ASO (SEQ ID NO: 56) compared to treatment with vehicle. Significant downregulation of glycolytic metabolism predominant in failing hearts at infarct zone suggested possible improvement in heart metabolism and presence of healthier tissue upon knockdown of WISPER. Furthermore, as shown in FIG. 26A (bottom panel), there was a significant increase in gene signature associated with fatty acid beta oxidation in the remote zone top upon treatment with pig WISPER targeting ASO (SEQ ID NO: 56) compared to treatment with vehicle. Significant increase in fatty acid oxidation metabolism predominant healthy hearts at the remote zone top suggested a possible switch in metabolism back to pre-pathological state upon knockdown of WISPER.

[0287] The RNA expression level of key precursor genes for validated heart failure biomarkers within the heart was also quantified. As shown in FIG. 26B and FIG. 26C, upon treatment with pig WISPER targeting ASO (SEQ ID NO: 56), there was decreased expression of NPPB, MMP9, COL1 Al, and IL1RL1, compared to treatment with vehicle. Further, since NPPB, MMP9, COL1A1, and IL1RL1 can be found as NT-proBNP / BNP, MMP9, PICP, and soluble ST2, respectively in the serum and / or plasma, the results further indicated the possibility of translating these changes into corresponding protein-based biomarkers detectable in the bloodstream, which is clinically practical.

[0288] Similar experiments were performed in a mouse post-myocardial infarction model as described in Micheletti et al. Sei Transl Med . 2017 Jun 21;9(395). Expression of pro-fibrotic gene such as Acta2 was reduced by ASO treatment (SEQ ID NO: 135) (see FIG. 27A). Left ventricular internal dimension was reduced by the ASO treatment (SEQ ID NO: 135) as well (see FIG. 27B).

[0289] Separately, a hypertrophic cardiomyopathy (HCM) pig model (R403Q) was established, and single nuclei RNA sequencing was performed. As shown in FIG. 35 A, porcine WISPER was predominantly expressed in fibroblasts. As shown in FIG. 35B, porcine WISPER was upregulated in HCM pigs, and its expression increased with age.

[0290] Collectively, the in vivo results suggested that treatment with WISPER targeting ASO can result in anti -fibrotic effect.Example 5: GWAS-related analysis on Human WISPER further support its role in cardiac fibrosis

[0291] Genome-wide association studies (GWAS) can help identify genes associated with a particular disease. Thus, GWAS variants associated with cardiac fibrosis were characterized to see whether any GWAS variants may interact with WISPER. Multiple human genetic variants significantly associated with cardiac fibrosis were found to be within the human WISPER gene body and the associated cardiac super-enhancer, suggesting that these GWAS variants may interact with WISPER. Multi-modal activity by contact (ABC) analysis was performed to identify myofibroblast specific interactions between WISPER and genomic locations of interest, such as GWAS or expression quantitative trait loci (eQTL). With ABC, the WISPER locus was found to have myofibroblast specific interactions with GWAS variants associated with cardiac fibrosis. 3D genome conformation signal (micro-C) was also performed to identify distal WISPER target interactions with GWAS single nucleotide polymorphisms (SNPs). As seen previously mentioned, the WISPER locus is in chromosome 20 with top 3 most significant GWAS variants associated with cardiac fibrosis. Micro-C revealed that WISPER may interact with one of the top 3 disclosed GWAS variants associated to fibrosis specifically in activated cardiac myofibroblasts. Further, byperforming snATAC-seq with human cardiac fibrosis transfected with human WISPER targeting ASO (2.5 nM, 5 nM, 7.5 nM, 10 nM) and differentiated to cardiac myofibroblasts, it was found that human WISPER targeting ASO affects chromatin accessibility at the locus of the GWAS variant associated with fibrosis (“peak overlapping GWAS”, rs6120797 G>A, which is associated with T1 mapping time with a P-value of 1.05e-08, see Nauffal et al., Nature Genetics 2023) in a dosedependent manner. Furthermore, the chromatin overlapping the fibrotic GWAS (i.e., rs6120797 variant is within the boundaries of the snATAC-seq peak) also reopened in a dose-dependent manner in myofibroblasts upon transfection of human WISPER targeting ASO. Taken together, a distinct closing of the chromatin around the GWAS variant rs6120797 region reopened in an ASO- concentration dependent manner, which indicates this opening and closing could mediate relevant transcription factor binding that is important for the disease.

[0292] Micro-C analysi s also revealed that WISPER locus interacts with a de novo variant located in JPH2 gene body, which is associated with hypertrophic cardiomyopathy. Specifically, micro-C analysis showed interaction between WISPER and JPH2 variant associated with hypertrophic cardiomyopathy. There was also interaction observed between WISPER and IPH2 promoter. Thus, whether WISPER knockdown impacts JPH2 and JPH2 promoter was investigated. Considering that H3K4me3 is a specific marker of transcriptionally active promoters, the H3K2me3 coverage at JPH2 promoter was measured. It was observed that transfection with pig WISPER targeting ASO (SEQ ID NO: 56) did not impact H3K4me3 coverage globally; however, H3K4me3 coverage at JPH2 promoter was identified to be impacted by transfection with pig WISPER targeting ASO. H3K4me3 coverage at IPH2 promoter was also repressed in myofibroblasts upon transfection with pig WISPER targeting ASO (SEQ ID NO: 56). As shown in FIG. 32, JPH2 expression was also downregulated in myofibroblasts upon transfection with pig WISPER targeting ASO (SEQ ID NO: 56), as measured by bulk RNAseq analysis.

[0293] Collectively, these data suggest that GWAS variants or JPH2 may interact with the WISPER locus to possibly affect WISPER’s role in cardiac fibrosis.Example 6: WISPER targeting ASOs exhibited satisfactory safety profile

[0294] As treatment with WISPER targeting ASO was shown to decrease cardiac fibrosis and reduce anti-fibrotic effects in Examples 1-4, the next step was to assess the safety of using WISPER targeting ASO for human therapeutic uses, and how it may impact other tissue types. For example, toxicity can be evaluated by ATP activity, LDH-cytoxicity, apoptosis induction, extracellular EGF quantification, immunostimulation can be evaluated by examining IRF pathway (IFNa / b), NFkB activation (IL-6 or IL- 10), and INF chemokines (MIP-la / b or MCP-1), and complement activationsuch as APC complex (e.g., C3a, Bb, and C5a) can be measured. The lung fibroblasts were transfected using the same protocol as the human cardiac fibroblasts. For hepatocytes and PTEC cells, gymnosis was used for ASO delivery, and similarly for PBMCs, where ASOs are incubated with the cells for various time points. First, the specificity of human WISPER targeting ASOs was studied. Both human cardiac and lung fibroblasts were treated with different human WISPER targeting ASOs (G36, G103, G115, G117, G126, G149) or scramble ASO and differentiated into myofibroblasts. Specifically, sequence information for G36 (SEQ ID NO: 83), G103 (SEQ ID NO: 91), G115 (SEQ ID NO: 89), G117 (SEQ ID NO: 55), G126 (SEQ ID NO: 94), G149 (SEQ ID NO: 66) can be found in Table 4. RNAs were extracted from the cells and subjected to qPCR to measure WISPER expression with a forward primer of CCCTGGCAGCCACTATTCTA (SEQ ID NO: 191) and a reverse primer of GCCAGCAACCAAGGACAAAT (SEQ ID NO: 192). As shown in FIG. 28A, qPCR results show that upon transfection with WISPER targeting ASOs, there was no WISPER activation in human lung myofibroblasts, compared to the WISPER activation in human cardiac myofibroblasts. RNAs extracted from the cells were also subjected to RNA-sequencing. Specifically, “MyoFB Cell-State specific” gene signature and “MyoFB Cell-state in HCM patients” gene signature in FIG. 28B are as described herein. TIAR-related signatures were obtained as follows. “Wisper-TIAR MoA Down regulated in MyoFB” in FIG. 28B refers to genes, among the validated TIAR targets, that displayed a significant down-regulation in MyoFB compared to FB and thus, represented clear markers of the reference FB cell-state. This set of TIAR target genes constituted the TIAR-FB gene signature. The expression of these TIAR targets was negatively correlated with TIAR nuclear localization and are downregulated following the activation of WISPER. On the other hand, “Wisper-TIAR MoA Up regulated in MyoFB” in FIG. 28B refers to a set of TIAR targets that was significantly up-regulated in MyoFB compared to FB and thus, represented clear markers of the MyoFB cell-state. This set of TIAR target genes constituted the TIAR-MyoFB gene signature. The expression of these TIAR targets was positively correlated with TIAR nuclear localization and are most likely linked to WISPER. As shown in FIG. 28B, compared to cardiac myofibroblasts, which showed downregulation of TIAR targets, gene signature associated with myofibroblast cell state, and myofibroblast cell-state in hypertrophic cardiomyopathy (HCM) patients upon transfection with human WISPER targeting ASOs, there was no on-target effect in human lung fibroblasts or lung myofibroblasts with treatment with human WISPER targeting ASOs.

[0295] Apoptosis assay using incucyte was performed with human cardiac and lung myofibroblasts upon transfection with human WISPER targeting ASO or scramble ASO. In FIGs. 28C and 28D, “Region 1” refers to chr20:44, 693, 597-44, 696, 188 (GRCh38) (SEQ ID NO: 186),and “Region 2” refers to chr20:44, 681, 367-44, 686, 712 (GRCh38) (SEQ ID NO: 187). As shown in FIG. 28C, Region 2 is a functional equivalence of Region X of porcine WISPER in FIG. 4A, in that both were enriched in snATAC and CTCF signals. ASOs targeting Region 1 and Region 2 in human WISPER respectively were tested in an incucyte assay.

[0296] As shown in FIG. 28D, treatment of human WISPER targeting ASOs induced more apoptosis in cardiac myofibroblasts (“HCF”) than in lung myofibroblasts (“HLF”), confirming the specificity of WISPER in the heart. “Region 1” is the 5 prime region of WISPER and “ASO-Region 1” is G103 (SEQ ID NO: 91), “Region 2” is CTCF peak and “ASO-Region 2” is G115 (SEQ ID NO: 89). Collectively, these in vitro studies showed that WISPER did not have high transcription in lung myofibroblasts, and the ASOs tested did not affect lung myofibroblasts.

[0297] Next, hepatocytes were transfected with human WISPER targeting ASO to assess cytotoxicity, measured by lactate dehydrogenase (LDH) release. As shown in FIG. 29, there was no significant changes in cell cytotoxicity upon transfection with human WISPER target ASOs G117 (SEQ ID NO: 55), G103 (SEQ ID NO: 91), G34.2 (SEQ ID NO: 95), G34.3 (SEQ ID NO: 96), G36 (SEQ ID NO: 83), G34 (SEQ ID NO: 81), G122 (SEQ ID NO: 97), and G126 (SEQ ID NO: 94), and was comparable to transfection with scramble ASOs (Scrl MOE, Scrl LNA).

[0298] Human peripheral blood mononuclear cells (PBMCs) were also isolated and transfected with human WISPER targeting ASOs (G117 (SEQ ID NO: 55), G103 (SEQ ID NO: 91), G36 (SEQ ID NO: 83), G122 (SEQ ID NO: 97), G126 (SEQ ID NO: 94)) or left untreated (NT). The cell supernatant was collected and IL- 10 was measured to test whether the human WISPER targeting ASOs are well -tolerated. As shown in FIG. 30, upon transfection with human WISPER targeting ASOs IL-10 levels were comparable to those of well -tolerated ASOs mentioned in Burel et al., 2022.

[0299] In addition, human renal proximal tubular epithelial cells (PTEC) were transfected with human WISPER targeting ASOs (G117 (SEQ ID NO: 55) , G103 (SEQ ID NO: 91), G34 2 (SEQ ID NO: 95), G34.3 (SEQ ID NO: 96), G36 (SEQ ID NO: 83), G34 (SEQ ID NO: 81), G126 (SEQ ID NO: 94)) or Scrl ASOs. As shown in FIG. 31, there were no significant changes in PTEC viability 10 days after ASO exposure, as measured by ATP levels There were also no changes in EGF levels detected in the supernatant of PTEC after chronic ASO exposure. Thus, the human WISPER targeting ASOs were found to be safe with regards to cytotoxicity, cell viability, or apoptosis.Example 7: WISPER tarsetins ASOs showed promisins efficacy in an in vivo post-myocardial infarction pis model

[0300] A myocardial infarction (MI) pig model was established. Briefly, a 90-minute myocardial ischemia was generated by inflating a balloon catheter in the left anterior descending coronary artery(LAD). The balloon catheter was placed right before the first diagonal of the LAD. The 90 minutes’ ischemia time was then followed by a deflation of the balloon and a reperfusion period of 120 minutes under general anesthesia, and the pig model was established. On day 3 and day 24, pWis_67 ASO (SEQ ID NO: 56) was treated with 1 rng / kg, 2.5 mg / kg, or 5 mg / kg. On day 42, heart tissues were harvested and processed (e.g., nuclei isolation from lateral ventricle biopsies). snRNA sequencing was performed with relevant reagents from lOx Genomics.

[0301] Cell cluster identity was carried out and multiple cell types (e g., visceral neurons, endothelial cell, lymphatic endothelial cells, proliferating macrophages, smooth muscle cells, pericytes, macrophages, adipocytes, cardiomyocytes, and fibroblasts) were identified. Among fibroblasts, the expression of porcine WISPER (see FIG. 33A) and the expression of pWis_67 engagement panel genes (TEPs, comprising the most sensitive genes downregulated as a consequence of Wisper downregulation) (see FIG. 33B) were tested. As shown in FIG. 33 A and FIG. 33B, the downregulation of porcine WISPER and pWis_67 TEPs was dose dependent, which confirmed successful on-target pharmacology of pWis 67 ASO (SEQ ID NO: 56).

[0302] Such an on-target pharmacodynamic effect was specific to the cardiac fibroblasts cell population. As shown in FIG. 33C, down regulation of pWis_67 signature and cross-species WISPER TEP were predominantly observed in fibroblasts (upper row), not in cardiomyocytes (lower row). Furthermore, it was discovered that cardiomyocytes took up the same, if not more, pWis_67 ASO (SEQ ID NO: 56) Therefore, the on-target pharmacodynamic effect that was predominantly observed in fibroblasts / myofibroblasts cells was because of the unique / predominant expressions of the target(s) of pWis_67 (SEQ ID NO: 56) in fibroblasts / myofibroblasts.

[0303] Furthermore, miR-21 is a miRNA associated with cardiac fibroblasts and fibrosis. Its in vivo targets were examined to validate the potential anti-fibrotic impact of such a WISPER-targeting approach. Out of the 18 miR-21 in vivo targets identified by T. Thum, et al., Nature (2008) (assessed by considering the porcine ortholog genes), 8 targets were also identified as porcine WISPER TEPs. More importantly, a knockdown in porcine WISPER by pWis_67 ASO (SEQ ID NO: 56) induced a significant downregulation of the miR-21 in vivo targets (see FIG 33D) by bulk RNA-seq.

[0304] In addition, an investigation of human cardiac fibroblasts to myofibroblasts trajectory led to an identification of several signature transcription factors and their downstream gene networks (regulons) that drive such a fibroblasts-to-myofibroblasts transition. Such networks were created by studying differentially expressed genes using snRNA-seq, studying associated proximal open chromatin peaks using snATAC-seq, identifying transcription factors using motif analysis on open peaks closed to modulated genes. Exemplary transcription factor RUNX2, together with its regulons,signal a fibroblast dominant cell state. On the other hand, exemplary transcription factor SMAD5, together with its regulons, signal a myofibroblast dominant cell state. As shown in FIG. 33E, pWis_67 ASO (SEQ ID NO: 56) affected the expression of genes targeted by RUNX2, while in FIG. 33F, pWis_67 ASO (SEQ ID NO: 56) decreased the expression of genes targeted by SMAD5 in a dose-dependent manner Therefore, the ASO treatment induced myofibroblast reprograming towards fibroblast.

[0305] The treatment of pWis_67 ASO (SEQ ID NO: 56) also led to a consistent downregulation of cardiomyocytes hypertrophy response by both histology (see FIG. 33G) and gene expression analysis (see FIG. 33H). Specifically, at study endpoint, pWis_67 ASO (SEQ ID NO: 56) led to a reduction in cardiomyocytes hypertrophy in left ventricle remote and border Zones. Therefore, the above illustrated pWis_67’s anti-fibrotic effects and highlight a therapeutic effect on cardiomyocytes’ response to myocardial infarction, notably by mitigating a hypertrophic response.

[0306] PLK2 was recently proposed as a key regulator of osteopontin-driven fibrosis and diastolic dysfunction, and its downregulation leads to cardiac fibrosis and promotes atrial fibrillation. Based on a pathological model proposed in S. R. Kunzel, et al. 2021, a reduced level of PLK2 leads to an increase of phosphorylated ERK 'A, which increases osteopontin, and eventually results in fibrotic remodeling, atrial dilation and vulnerability to atrial fibrillation. Therefore, rescue of PLK2 expression in heart failure exerts a cardioprotective role and prevents fibrosis development. As shown in FIG. 331, treatment of pWis_67 ASO (SEQ ID NO: 56) significantly rescued PLK2 expression in the whole left ventricle. Therefore, porcine Wisper downregulation reprogrammed key transcriptomic processes well-known to be involved in heart failure by restoring PLK2 level.

[0307] Similarly, NCAM1 is genetically associated with LV wall thickness, and its expression correlates with reduced LV function in human cardiomyopathy. NCAM1 has been proposed as a plasma biomarker for coronary artery disease. As shown in FIG. 33J, treatment of pWis_67 ASO (SEQ ID NO: 56) significantly reduced NCAM1 expression in at least remote zone top and border zone. In a similar vein, TGFB1 affects cell-cell adhesion in the heart in an NCAM 1 -dependent mechanism. As shown in FIG. 33K, treatment of pWis_67 ASO (SEQ ID NO: 56) also significantly reduced TGFB1 expression in at least remote zone top and border zone.

[0308] Treatment with the pig WISPER targeting ASO (SEQ ID NO: 56) in the minipig post-MI model reduced heart failure and cardiac fibrosis biomarker proteins that were measurable in plasma samples Using SomaScan Discovery v4 1, an unbiased analysis was performed on about 7000 proteins, among which more than 700 proteins were related to cardiovascular diseases. As shown in FIG. 33L, several plasma proteins, including cardiac markers and WISPER TEP-derived proteins,were reduced in both day 14 and Day 42, when compared to day 3 after treatment of pWis_67 ASO (SEQ ID NO: 56). Specifically, for plasma canonical cardiac stress biomarkers, it is known that circulating Activin A and FSTL3 increase with aging and heart failure, and increased circulating Activin A alone is sufficient to induce ActRII signaling which inhibits cardiac functions, and FSTL3 expression in the heart impairs cardiac function. Accordingly, the observation that cardiac markers NT-proBNP, Activin A, and FSTL3 were reduced in both day 14 and day 42 (see FIG. 33M) by pWis_67 ASO (SEQ ID NO: 56) suggest the effective improvement in cardiac functions by targeting WISPER. More specifically, a closer look at FSTL3 reduction in different regions of heart tissues on day 42, shown in FIG. 33N, illustrated that FSTL mRNA expression in regions such as remote zone top, border zone, and infarct zone were more sensitive to pWis_67 ASO (SEQ ID NO: 56). It is also worth mentioning that WISPER TEP-derived proteins in circulation were also very sensitive to WISPER knockdown by pWis_67 ASO (SEQ ID NO: 56). Pharmacodynamic effect was observed at 14 and 42 days following single and double S.C. administration of pWis_67 (SEQ ID NO: 56), respectively, in plasma proteins PDE5A, CILP, and SULF2 (see FIG. 330).Example 8: WISPER expression in human patient biopsies or mouse tissues

[0309] In Kuppe et al. Nature. 2022, multi-modal data were generated from patients with myocardial infarction in multiple physiological zones at distinct time points in myocardium. It was found that human heart specimens that exhibited ischemic heart disease due to severe interstitial fibrosis developed fibrotic zone at a later stage. Utilizing the public data from Kuppe et al., human WISPER expression was examined. In FIG. 34A, the distribution of WISPER in fibroblasts across different zones was visualized, and WISPER was highly expressed in myofibroblasts of the Fibrotic Zone post-Myocardial Infarction. Therefore, these independently obtained human patient biopsy data support WISPER’s association with severe interstitial fibrosis.

[0310] Furthermore, in Kuppe et al., spatial transcriptomics showed an extensive area occupied by fibroblasts or myofibroblasts displayed extensive tissue remodeling and fibrosis, which was expected within the interstitial fibrotic zone. Such spatial transcriptomics data, particularly the ones analyzing fibrotic zone of patient 14 (P14) from Kuppe et al. were utilized to examine the expression of human WISPER TEP, CILP, and SULF2. Shown in FIG. 34B, WISPER TEP derived genes colocalized with fibroblasts or myofibroblasts. In other words, WISPER TEP, CILP, SULF2 expression co-localized with fibroblast / myofibroblast cells in the fibrotic zone of myocardial infarction patients with severe interstitial fibrosis

[0311] In parallel, another independent group studied infarcted hearts with single-cell analysis and spatial transcriptomics (see Calcagno, D.M. et al. Nat Cardiovasc Res 1, 1039-1055 (2022)). Asshown in a hematoxylin and eosin (H&E) cross section of a single human patient heart sample, transmural myocardial ischemia resulted in extensive tissue remodeling and fibrosis. Sourcing from the spatial transcriptomics data from Calcagno et al., human cardiac fibroblast / myofibroblast gene signature and human WISPER TEP, which were compiled in-house and disclosed herein, were specifically examined. The expression data of SULF2, which was identified to be a downstream player of WISPER, was also examined. As shown in FIG. 34C, they co-localized with fibrotic areas and fibroblasts / myofibroblasts, and were specific to fibrosis foci. In other words, it has been independently confirmed that WISPER TEP expression co-localized with fibrotic areas and fibroblasts / myofibroblasts in a left ventricular biopsy of a patient post-transmural myocardial ischemia before device implantation. Similarly, higher expression of human cardiac fibroblast / myofibroblast gene signature, cross species WISPER TEP, and SULF2 were observed in MI mouse model (7 days post MI induction) versus a sham control group (see FIG. 34D).

[0312] Furthermore, another independent group performed RNA sequencing on patients with heart failure with preserved or reduced ejection fraction (see Hahn et al., Circulation. 2021 Jan 12; 143(2): 120-134). Extracting from the published data from Hahn et al., human WISPER TEP expression was visualized in the two groups of patients (see FIG. 34E). WISPER TEP had upregulated expression in HFpEF and HFrEF patients, highlighting WISPER’ s relevance as a therapeutic target in these patient populations.

[0313] Taken together, the tight association of WISPER with heart diseases (e.g., myocardial infarction and myocardial ischemia) and the validity of the cardiac fibroblast / myofibroblast gene signature and WISPER TEP have been confirmed by multiple independent sources. Therefore, WISPER is a verified therapeutic target, along with its relevant readouts (e.g., WISPER TEP). Also, ASOs disclosed herein that efficiently downregulate WISPER have a high potential in clinically reversing relevant heart diseases.Example 9: additional human ASOs (G161-G165)

[0314] Additional human WISPER targeting ASOs, G161 (SEQ ID NO: 129), G162 (SEQ ID NO: 130), G163 (SEQ ID NO: 131), G164 (SEQ ID NO: 132), and G165 (SEQ ID NO: 133), are screened to assess their potency in cultures of human cardiac fibroblasts in vitro. Human cardiac fibroblasts are transfected with various human WISPER targeting ASOs, positive control ASOs (e.g. G36, G117) and / or control ASO (e g., scramble / non-wisper targeting ASO control, non-Wisper targeting ASOs), and are differentiated to cardiac myofibroblasts with 48 hours of starvation The potency is assessed through transcriptomic analysis by measuring the downregulation of WISPER expression and key WISPER- related signatures (e.g. WISPER TEP, HCF signatures) as mentionedabove in other examples. Promising ASOs are further transfected at different concentrations to determine IC50 and a dose-dependent effect on WISPER expression and the key WISPER-related signatures.Example 10: additional mouse ASOs (mmGl 71-mmG207

[0315] In vitro screening was performed in immortalized mouse cardiac fibroblasts and primary cells in-house. Myofibroblast differentiation was induced by starvation and / or TGF-beta treatment (10 ng / mL). Approximately 40 ASOs (MOEs and LNAs, as listed in Table 4 as mmG171-mmG207, SEQ ID NOs: 134-170) were tested for on-target efficacy and high potency with several biological replicates.

[0316] For example, mouse primary cardiac myofibroblasts were treated with mmGl 84 (SEQ ID NO: 147), mmG185 (SEQ ID NO: 148), and mmG182(SEQ ID NO: 145), respectively. Dose dependency curves were plotted against mouse WISPER expression (see FIG. 36A). These mouse WISPER targeting ASOs effectively downregulated mouse WISPER in a dose-dependent manner. Particularly, as shown in FIG. 36B, mmGl 82 (SEQ ID NO: 145) exhibited potent knockdown of WISPER and downregulation of mouse WISPER TEP and cross-species TEP, similar to the efficacy of G36 (SEQ ID NO: 83) in human WISPER TEP and cross-species TEP.

[0317] While preferred instances of the present disclosure have been shown and disclosed herein, it will be obvious to those skilled in the art that such instances are provided by way of example only. It is not intended that the disclosure be limited by the specific examples provided within the specification. While the disclosure has been disclosed with reference to the aforementioned specification, the descriptions and illustrations of the instances herein are not meant to be construed in a limiting sense. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. Furthermore, it shall be understood that all aspects of the disclosure are not limited to the specific depictions, configurations or relative proportions set forth herein which depend upon a variety of conditions and variables. It should be understood that various alternatives to the instances of the disclosure disclosed herein may be employed in practicing the disclosure. It is therefore contemplated that the disclosure shall also cover any such alternatives, modifications, variations or equivalents. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.-116-

Claims

CLAIMSWHAT IS CLAIMED IS:

1. An oligonucleotide modulating activity or expression of a long non-coding RNA that is associated with cardiac fibrosis, wherein the oligonucleotide is at least partially complementary to a portion of a sequence of one of SEQ ID NOs: 171-188 or a sequence from Tables 1-3.

2. The oligonucleotide of claim 1, wherein the oligonucleotide is at least 70%, 80%, or 90% complementary to at least 13 consecutive nucleotides from one of SEQ ID NOs: 171-188 or a sequence from Tables 1-3.

3. The oligonucleotide of claim 1, wherein the oligonucleotide is at least partially complementary to a portion of a sequence of one of SEQ ID NOs: 174-183 and 185-188.

4. The oligonucleotide of claim 1, the oligonucleotide is at least 70%, 80%, or 90% complementary to at least 13 consecutive nucleotides from one of SEQ ID NOs: 174-183 and 185-188.

5. The oligonucleotide of any one of claims 1-4, wherein the oligonucleotide comprises a nucleic acid sequence having at least 10, 11, 12, or 13 contiguous nucleotides with no more than 1, 2, or 3 mismatches from any one of nucleic acid sequences in Table 4.

6. The oligonucleotide of any one of claims 1-4, wherein the oligonucleotide comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to one of nucleic acid sequences in Table 4.

7. The oligonucleotide of any one of claims 1-6, wherein the oligonucleotide is about 14-22 nucleotides long.

8. The oligonucleotide of any one of claims 1-7, wherein the oligonucleotide is a single-stranded antisense oligonucleotide (ASO).

9. The oligonucleotide of claim 8, wherein the oligonucleotide is a gapmer, wherein the oligonucleotide comprises a central region of consecutive DNA nucleotides flanked by a 5’- wing region and 3 ’-wing region, wherein at least one of 5 ’-wing region and 3 ’-wing region comprises a nucleic acid analogue, wherein the nucleic acid analogue comprises one or moreribose modifications, one or more intemucleotide linkage modifications, one or more nucleobase modifications, or a combination thereof.

10. The oligonucleotide of claim 9, wherein the nucleic acid analogue comprises a 2’- methoxy ethyl (2 ’-MOE) RNA.

11. The oligonucleotide of claim 10, wherein the 5’-wing region and the 3’-wing region each comprises at least two 2’-M0E RNAs.

12. The oligonucleotide of claim 11, wherein the 5 ’-wing region comprises three or five 2’ -MOE RNAs.

13. The oligonucleotide of claim 11, wherein the 3’-wing region comprises three or five 2’ -MOE RNAs.

14. The oligonucleotide of claim 9, wherein the nucleic acid analogue comprises a locked nucleic acid (LNA).

15. The oligonucleotide of claim 14, wherein the LNA comprises a beta-D-oxy LNA, an alpha-L-oxy-LNA, a beta-D-amino-LNA, an alpha-L-amino-LNA, a beta-D-thio-LNA, an alpha-L-thio-LNA, a 5'-methyl-LNA, a beta-D-ENA, or an alpha-L-ENA.

16. The oligonucleotide of claim 14 or claim 15, wherein the 5’-wing region comprises at least two LNAs, and wherein the 3 ’-wing region comprises at least one LNA.

17. The oligonucleotide of claim 16, wherein the 5’-wing region comprises three consecutive LNAs.

18. The oligonucleotide of claim 16, wherein the 3’-wing region comprises two consecutive LNAs.

19. The oligonucleotide of claim 14 or claim 15, wherein the 5’-wing region comprises three consecutive LNAs, and wherein the third and the second nucleotides counting from the 3’ end in the 3 ’-wing region comprise two consecutive LNAs, and the last nucleotide in the 3’-wing region is a DNA nucleotide.

20. The oligonucleotide of any one of claims 1-19, wherein the oligonucleotide comprises a phosphorodiamidate morpholino oligomer (PMO).

21. The oligonucleotide of any one of claims 1-20, wherein the oligonucleotide comprises one or more modified internucleotide linkages, and wherein the one or more modified internucleotide linkages comprise a phosphorothioate internucleotide linkage, a phosphorodi thioate intemucleotide linkage, or a combination thereof.

22. The oligonucleotide of claim 21, wherein the one or more modified internucleotide linkages is a phosphorothioate internucleotide linkage, and the phosphorothioate internucleotide linkage is located between each nucleotide of the oligonucleotide.

23. The oligonucleotide of any one of claims 1-22, wherein the oligonucleotide comprises or consists of a nucleic acid sequence selected from Table 4.

24. The oligonucleotide of any one of claims 1-23, wherein the oligonucleotide comprises or consists of a nucleic acid sequence selected from SEQ ID NOs: 55, 81, 83, 89, 91, and 129-133.

25. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1-24 and a pharmaceutically acceptable salt or derivative thereof.

26. A method of inducing a cell state transition of a cell from a myofibroblast state to a quiescent fibroblast state, comprising contacting the cell with the oligonucleotide of any one of claims 1-24 or the pharmaceutical composition of claim 25.

27. The method of claim 26, wherein an expression level of a IncRNA selected from Tables 1-3 is reduced in the cell.

28. The method of claim 26, wherein a gene expression of a fibrotic marker gene is reduced in the cell.

29. The method of claim 28, wherein the fibrotic marker gene comprises CoLlAl, ACTA2, FN1, COL3A1, ME0X1, RUNX1 / 2, PTN, MMP15, or a combination thereof.

30. The method of claim 26, wherein an expression of a down-regulated gene specific to the myofibroblast is increased or an expression of an up-regulated gene specific to the myofibroblast is reduced.

31. The method of claim 30, wherein the up-regulated gene specific to the myofibroblast comprises CILP, COL14A1, COL1A1, PLOD2, SMAD9, or a combination thereof.

32. A method of preventing, alleviating, or treating a cardiac fibrosis-mediated cardiac pathology in a subject in need thereof, comprising administering to the subject an effective amount of the oligonucleotide of any one of claims 1-24 or the pharmaceutical composition of claim 25.

33. The method of claim 32, wherein an expression of a biomarker associated with the cardiac fibrosis-mediated cardiac pathology is changed in the subject to be similar to a level that is observed in a healthy individual.

34. The method of claim 33, wherein the biomarker is selected from a group consisting of coagulation factor 2 receptor (F2R), CITED4, MYH7B, HDAC9, ACTN2, KLF11, HEY2, MYH11, TPM1, TNNT2, TNNC1, NPPB, AP3D1, NDUF11B, SLC25A4, KCNJ5, TRIP6, ATP5PO / 5F1C, NDUFA2 / 9, NDUFB8 / B9 / A9, SAMM50, UQCRC1, CYC1, C0X5B, ATP2A, TPM1, TNNT2, TNNC1, NPPB, MMP9, C0L1A1, IL1RL1, NT-proBNP, BNP, MMP9, PICP3, soluble ST2, MYBPC3, MY0M3, SCN5A, SCN10A, HAND!, MYP2, HANOI, KLF15, TTN, miR-21, PLK2, NCAM1, TGFB1, activin A, FSTL3, MPK9, fibrinogen, PDE5A, SULF2, CILP, THBS1, PTK2B, TGFB1, PCTP, CXCL16, a gene identified in Table 5 and 6, and a combination thereof.

35. The method of 32, wherein a collagen or a fibrotic scar in a border zone or an infarct zone of a heart is reduced in the subject.

36. The method of 32, wherein proliferation of a cardiac myofibroblast of the subject is reduced, or wherein migration of the cardiac myofibroblast of the subject is reduced, or wherein apoptosis of the cardiac myofibroblast of the subject is increased, or wherein cardiomyocyte diameter is reduced.

37. The method of claim 32, wherein the cardiac fibrosis-mediated cardiac pathology is a hypertrophic cardiomyopathy, a myocardial infarction, a heart failure with preserved or reduced ejection fraction, a dilated cardiomyopathy, an aortic stenosis, a diabetic cardiomyopathy, a restrictive cardiomyopathy, a cardiac amyloidosis, a genetic disease causal of attendant cardiomyopathy, or an excessive interstitial fibrosis pathology.

38. A method of diagnosing cardiac fibrosis-mediated cardiac pathology in a subject, wherein the method comprises (a) obtaining a biological sample derived from the subject; (b) detecting an amount and / or an activity of a biomarker from the biological sample, wherein the biomarker comprises a sequence from Tables 1, 5, and 6; and (c) diagnosing the subject with cardiac fibrosis-mediated cardiac pathology if the amount and / or the activity of the biomarker isat least 50%, at least 60%, at least 70%, at least 80%, at least 90% higher when compared to a healthy individual.

39. A method of monitoring or predicting the progression of cardiac fibrosis-mediated cardiac pathology in a subject, wherein the method comprises (a) obtaining a biological sample derived from the subject at an earlier time point and a later time point; (b) detecting an amount and / or an activity of a biomarker from the biological sample, wherein the biomarker comprises a sequence from Tables 1, 5, and 6; and (c) concluding or predicting the cardiac fibrosis-mediated cardiac pathology persists or progresses if the amount and / or the activity of the biomarker at the later time point at least 10% higher than the amount and / or the activity of the biomarker at the earlier time point.

Images